COMPOSITION FOR ENHANCING IMMUNE RESPONSE BY USING ACTIVATION FUNCTION OF DENDRITIC CELLS OF STROMAL VASCULAR FRACTIONS ISOLATED FROM ADIPOSE TISSUES

Abstract

The present disclosure relates to a composition for enhancing an immune response using the activating function of dendritic cells of a stromal vascular fraction isolated from adipose tissue, and in particular, a composition for enhancing an immune response for anti-tumor use.

Claims

1. A composition for enhancing an immune response, the composition comprising a stromal vascular fraction isolated from adipose tissue and dendritic cells loaded with an antigen as an active ingredients.

2. The composition of claim 1, wherein the stromal vascular fraction is a spheroid that is a two-dimensional culture or a three-dimensional culture.

3. The composition of claim 1, wherein the immune response is performed by T cells.

4. The composition of claim 1, wherein the antigen is a virus-derived antigen, a pathogenic microorganism-derived antigen, or a tumor-derived antigen.

5. The composition of claim 1, wherein the composition is an anti-viral immuno-enhancing composition for treating or preventing viral infection, an anti-microbial immuno-enhancing composition for treating or preventing an infection caused by a pathogenic microorganism, or an anti-tumor immuno-enhancing composition for tumor treatment or prevention.

6. The composition of claim 1, wherein the dendritic cells are autologous dendritic cells obtained from an individual to which the composition is administered, allogeneic dendritic cells obtained from another individual, or heterogeneous dendritic cells obtained from a heterogeneous individual.

7. The composition of claim 1, wherein the dendritic cells are immature dendritic cells or mature dendritic cells.

8. The composition of claim 1, wherein the adipose tissue is a subcutaneous fat tissue or a visceral fat tissue around an organ.

9. The composition of claim 1, wherein the antigen is a tumor-derived antigen, and the tumor-derived antigen is a surface-expressed protein of a tumor cell, a surface-expressed receptor of a tumor cell, a peptide inside a tumor cell, a protein inside a tumor cell, or a tumor cell lysate.

10. The composition of claim 1, wherein the antigen is a tumor-derived antigen, and the tumor-derived antigen is EGFRvIII, EGFR, metastin receptor, receptor tyrosine kinases, human epidermal growth factor receptor 2 (HER2), tyrosine kinase-18-receptor (c-Kit), HGF receptor c-Met, CXCR4, CCR7, endothelin-A receptor, peroxisome proliferator activated receptor δ (PPAR-δ), platelet-derived growth factor receptor α (PDGFR-α), CD133, carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), disialoganglioside (GD2), glypican 3 (GPC3), prostate specific membrane antigen (PSMA), tumor-associated glycoprotein 72 (TAG-72), disialoganglioside (GD3), human leukocyte antigen-DR (HLA-DR), mucin 1 (MUC1), New York esophageal squamous cell carcinoma 1 (NY-ESO-1), latent membrane protein 1 (LMP1), tumor necrosis factor-related apoptosis-inducing ligand receptor (TRAILR2), vascular endothelial growth factor receptor 2 (VEGFR2), hepatocyte growth factor receptor (HGFR), CD44, or CD166.

11. The composition of claim 1, wherein the composition is used in combination with or mixed with an anti-viral agent, an anti-microbial agent, or an anti-cancer agent.

12. The composition of claim 1 is a pharmaceutical composition.

13. A composition for enhancing an immune response, the composition comprising a stromal vascular fraction isolated from adipose tissue and dendritic cells as active ingredients.

14. The composition of claim 13, wherein the stromal vascular fraction is a spheroid that is a two-dimensional culture or a three-dimensional culture.

15. The composition of claim 13, wherein the immune response is performed by T cells.

16. The composition of claim 13, wherein the composition is an anti-viral immuno-enhancing composition for treating or preventing viral infection, an anti-microbial immuno-enhancing composition for treating or preventing an infection caused by a pathogenic microorganism, or an anti-tumor immuno-enhancing composition for tumor treatment or prevention.

17. A composition for enhancing an immune response, the composition comprising a spheroid of a stromal vascular fraction isolated from adipose tissue as an active ingredient.

18. The composition of claim 17, wherein the stromal vascular fraction is a spheroid in a two-dimensional culture or a three-dimensional culture.

Description

DESCRIPTION OF DRAWINGS

[0052] FIGS. 1, 2, 3, 4 and 5 are results showing that when a stromal vascular fraction isolated from adipose tissue is cultured, the stromal vascular fraction has characteristics and functions similar to those of lymph node stromal cells;

[0053] FIG. 6 is a result showing that the spheroids of the stromal vascular fraction isolated from adipose tissue may form blood vessels that become the migration channels of immune cells;

[0054] FIGS. 7, 8, 9, 10 and 11 show that the spheroids of the stromal vascular fraction isolated from adipose tissue attract dendritic cells and promote the interaction of dendritic cells with T cells, and the T cells are mostly differentiated into CD4+ effector T cells to induce an immune response;

[0055] FIGS. 12 and 13 show that a two-dimensional culture of a stromal vascular fraction isolated from adipose tissue or a spheroid thereof improves the survival rate of dendritic cells and enhances the immune response of antigen-specific T cells together with dendritic cells loaded with antigen;

[0056] FIG. 14 are results showing that a spheroid of a stromal vascular fraction isolated from adipose tissue reduces the size of the tumor and improves the survival rate of mice when spheroids are administered to mice transplanted with B16 melanoma cells (B16-OVA) expressing tumor antigen (OVA) together with dendritic cells loaded with tumor antigen (OVA); and

[0057] FIG. 15 is a conceptual diagram of the present disclosure.

BEST MODE

[0058] Hereinafter, the present disclosure will be described with reference to embodiments. However, the scope of the present disclosure is not limited to the examples.

EXAMPLE

[0059] 1. Samples and Test Methods

[0060] 1.1 Mouse

[0061] C57BL/6 wild-type mice (Koatech, Seoul, Republic of Korea) and C57BL/10NAGCSAni-(KO) Rag2(H-2b) mice (Taconic Biosciences, N.Y., U.S.) were raised in a specific pathogen-free facility located at Seoul National University Medical School. All mice were male and mice aged 6 to 12 weeks were used. All mouse experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of Seoul National University (IACUC Number: SNU-150115-2-7, SNU-160212-2-7, SNU-171123-4-7).

[0062] 1.2 Isolation of Stromal Vascular Fraction (SVF) and Spheroid Culture

[0063] After collecting and chopping adipose tissue from the intestines (Viscera) and skin (Skin), the tissue was cultured in a sterilized Hank's balanced salt solution (Intron, Seoul, Republic of Korea) that includes 3% bovine serum albumin (BSA) (MP biomedicals, Calif., U.S.) containing 0.8 mg/ml collagenase and 100 ug/ml DNase I, 1.0 mM CaCl.sub.2) (Sigma-Aldrich, Mo., U.S.), and 0.8 mM MgCl.sub.2 (Sigma-Aldrich, Mo., U.S.) for 1 hour at 170 rpm in a shaking incubator at 37° C. After centrifugation at 500 g for 3 minutes, the supernatant was removed and the stromal vascular fraction (SVF), which was a pellet, was isolated (FIG. 1A) and then cultured in Dulbecco's Modified Eagle Medium (Welgene, Daegu, Republic of Korea) containing 10% fetal bovine serum (Gibco, Mass., U.S.) and 1% penicillin/streptomycin (Gibco, Mass., U.S.). To make spheroids, SVF cultured for 6 to 10 days was treated with trypsin and counted. The cultured SVF was dispensed on a spheroid film (Incyto, Cheonan, Republic of Korea). It was confirmed that 361 SVF-spheroids (19X19) were formed on the spheroid film, and after culturing for more than two days, SVF-spheroids were used in the experiment.

[0064] 1.3 Production of Recombinant ZnO-Binding Peptide (ZBP)-Ovalbumin (OVA) Protein

[0065] To produce the recombinant ZnO-binding peptide (ZBP)-ovalbumin (OVA) protein (ZBPOVA), the genomic DNA of the B16MO5 cell line was first extracted according to the manufacturer's instructions using DNeasy Blood & Tissue Kits (Qiagen, Hilden, Germany). The extracted DNA is amplified by PCR (Forward primer: 5′-TTT GAA TTC ATG GGC TCC ATC GGT GCA-3′ SEQ ID NO: 1, Reverse primer: 5′-AAA CTC GAG AGG GGA MC ACA TCT GCC-3′, EcoRI, XhoI restriction sites underlined) and cloned from the pET23d-ZBP vector encoded with 3xZBP (BamHI-PHRKGGDARPHRKGGDARPHRKGGDA-EcoRI, SEQ ID NO: 3). The cloned vector pET23d-ZBPOVA was transformed into the E. coli HIT Competent BL21 strain (RBCBioscience, New Taipei City, Taiwan) according to the manufacturer's instructions. ZBPOVA was purified by a protocol appropriately adapted from the previously described methods (Nature methods 3, 55-64, 2006; Biochemistry and Molecular Biology Education 39, 28-37, 2011). Briefly, an E. coli culture in which protein expression was induced by isopropylthiogalactoside (IPTG; 0.1 mM) was treated with ice-cold buffer (300 mM NaCl, 50 mM phosphate, pH=8.0), in which lysozyme (1 mg/ml) and protease inhibitor cocktail is added, for 30 min and further dissolved by sonication. The lysate was centrifuged, the supernatant was collected, filtered, and purified by column using AKTAstart (GEHealthcare, IL, U.S.) and HisTrap™ FF (GEHealthcare, IL, U.S.). Proteins were dialyzed in PBS at 4° C. overnight. Endotoxin was removed from the purified protein using Triton X-114 as previously described (Microbial cell factories 10, 57, 2011). Endotoxin contamination of purified proteins was determined using the Pierce LAL Chromogenic Endotoxin Quantification Kit (Thermo Fisher Scientific, Mass., U.S.) according to the manufacturer's instructions. Purified ZBPOVA protein was quantified by SDS-PAGE and stored at −80° C. until further use.

[0066] 1.4 Bone Marrow-Derived Dendritic Cells Isolation, Antigen Delivery and Maturation

[0067] As previously described (Nat Nanotechnol 6, 675-682, 2011), bone marrow was isolated and differentiated into dendritic cells. Briefly, the bone marrow of Rag2-knock-out mice was isolated and cultured in Iscove's modified Eagle medium (IMDM) (Gibco, Mass., U.S.) supplemented with 10% FBS, 1.5 ng/ml recombinant mouse GMCSF (PeproTech, N.J., U.S.), 1.5 ng/ml mouse IL-4 (PeproTech, N.J., U.S.), 1% penicillin/streptomycin, 50 pg/ml gentamicin (Gibco, Mass., U.S.), 2 mM L-glutamine (Gibco, Mass., U.S.), 50 nM β-mercaptoethanol (Gibco, Mass., U.S.). Immature dendritic cells were cultured for 6 to 8 days. The medium was changed every other day. Fe.sub.3O.sub.4—ZnO core-shell nanoparticles (FZ—NP) were used to transport internal antigens to immature bone marrow-derived dendritic cells (BMDCs). 100 ug FZ—NPs were washed 3 times with PBS, and FZ—NPs were cultured at room temperature for 1 hour to bind with 20 ug ZBP—OVA. Then, ZBP—OVA and FZ—NPs (NP—OVA) were washed 3 times with IMDM. Next, 1×10.sup.6 dendritic cells were cultured with NPOVA at 37° C. for 1 hour. For the maturation process, dendritic cells were treated with 1 ug/ml lipopolysaccharide (LPS) for 16 to 18 hours. Dendritic cells matured by LPS were washed 3 times with IMDM before the experiment.

[0068] 1.5 Flow Cytometry and Antibodies

[0069] Cells were blocked with a super-block solution being configured with 10% goat serum (Thermo Fisher Scientific, Mass., U.S.), 10% rat serum (Thermo Fisher Scientific, Mass., U.S.), 10% mouse serum (Sigma-Aldrich, Mo., U.S.), 10 pg/ml anti-CD16/CD32 (2.4G2) antibody (BD Pharmingen, N.J., U.S.). The surface marker was then stained with APC/Cy7-conjugated anti-CD45, BV405-conjugated anti-CD11c, alexa488-conjugated anti-CD11c, APC-conjugated anti-B220, PE-conjugated anti-CD11b, APC-conjugated anti-PDPN, FITC-conjugated antilCAM-1, PE/Cy7-conjugated anti-CD31, PE-conjugated anti-LTβR, FITC-conjugated anti-VCAM-1, PE-conjugated antiCD140α, PerCP/Cy5.5-conjugated anti-CD44, PE/Cy7-conjugated anti-CD86, APC-conjugated antil-Ab, BV605-conjugated anti-Ki67, PE-conjugated anti-DC-SIGN (Biolegend, Calif., U.S.), PE-conjugated anti-CD3, BV421-conjugated anti-CD3, PerCP-conjugated anti-CD4, FITC-conjugated anti-CD8, APC-conjugated antiGr-1, BV605-conjugated anti-CD62L, FITC-conjugated anti-1-Ab, PE-conjugated anti-CD40 (BD Pharmingen, N.J., U.S.), PE/Cy7-conjugated anti-CD4, eFlour 450-conjugated anti-CD3, PE/Cy7-conjugated anti-F4/80, APC-conjugated anti-CD80 (eBioscience, Calif., U.S.) in ice for 30 minutes. Live cells were separately stained with Zombi Aqua (Biolegend, Calif., U.S.) or 7-aminoactinomycin D (7-AAD) (BD Pharmingen, N.J., U.S.). Cells were measured using a LSRFortessa X-20 flow cytometer, a BD LSRII flow cytometer (BD Pharmingen, N.J., U.S.), and a CytoFLEXS (Beckman Coulter, Calif., U.S.). Data were analyzed with FlowJo software (Tree Star, Ashland, Oreg., U.S.A).

[0070] 1.6 Transplanted with Kidney Capsules

[0071] Transplantation of SVF-spheroids or dendritic cells into the kidney capsule was performed as previously mentioned (Biochem Biophys Res Commun 514, 1081-1086, 2019). Briefly, the mouse was anesthetized, the hair on the side to be operated on was removed, the skin was disinfected, the incision was made, and the kidneys were exposed to the outside. The kidney capsule surface was torn with a 30-gauge needle (BD Pharmingen, N.J., U.S.), and the graft was slowly injected using a threaded plunger (Hamilton, Nev., U.S.). The incision was sutured with a high-temperature cautery (Bovie Medical Corporation, N.Y., U.S.). The kidney was put back into the body, and the skin was sutured.

[0072] 1.7 Quantitative PCR

[0073] RNA extraction was performed using Trizol reagent according to a standard protocol. Complementary DNA (cDNA) was sequentially synthesized using a reverse transcript premix kit (Intron, Seoul, Republic of Korea). To determine whether SVF can secrete major chemokines of lymph node stromal cells, mRNA expression was measured by quantitative PCR (qPCR) using SYBR Green master mix (Life Technologies, Calif., U.S.) and CFX Real Time PCR Detection System (Bio-Rad Laboratories, Calif., U.S.). Each sample was conducted in two repetitive experiments. Relative mRNA expression was calculated based on the value of β-actin (Actb). Primers are summarized in Table 1.

TABLE-US-00001 TABLE 1 Gene Forward Primer: Reverse Primer: CCL19 CCTGGGAACATCGTGAAAGC TAGTGTGGTGAACACAACAGC (SEQ ID NO: 3) (SEQ ID NO: 4) CCL21 GTGATGGAGGGGGTCAGGA GGGATGGGACAGCCTAAACT (SEQ ID NO: 5) (SEQ ID NO: 6) CXC13 GGCCACGGTATTCTGGAAGC GGGCGTAACTTGAATCCGAT (SEQ ID NO: 7) CTA (SEQ ID NO: 8) CXCL12 CATCAGTGACGGTAAACCAG CACAGTTTGGAGTGTTGAGG (SEQ ID NO: 9) (SEQ ID NO: 10) Actb TGTTACCAACTGGGACGACA GGGGTGTTGAAGGTCTCAAAC TG (SEQ ID NO: 11) (SEQ ID NO: 12)

[0074] 1.8 mRNA Sequencing Analysis

[0075] To identify the gene expression characteristics of SVF and SVF-spheroids, CD45-cells were classified from SVF, and total RNA was isolated using anti-CD45 microbeads and magnetic cell separation (MACS). The quality of RNA was measured with the Agilent 2100 bioanalyzer using the RNA 6000 Nano Chip (Agilent Technologies, Amstelveen, Netherlands), and the amount of RNA was quantified using the ND-2000 Spectrophotometer (Thermo Fisher Scientific, Mass., U.S.). Libraries were generated from total RNA using the SMARTer Stranded RNA-Seq Kit (Clontech Laboratories, Calif., U.S.). Polyadenylated mRNA was specifically isolated using Poly(A) RNA Selection Kit (LEXOGEN, Vienna, Austria), and shearing for cDNA synthesis, fragmentation, and PCR amplification were sequentially performed. Average fragment size was measured with an Agilent 2100 bioanalyzer, and quantification was assessed with a StepOne Real-Time PCR System (Life Technologies, Calif., U.S.). Libraries were sequenced with a paired-end 100-bp reading by HiSeq 2500 (IIlumina, Calif., U.S.). The sequencing data were tabulated using TopHat. Data were analyzed with ExDEGA (E-biogen, Seoul, Republic of Korea) and visualized with Prism 8 (Graph Pad, Calif., U.S.).

[0076] 1.9 Enzyme-Linked Immunosorbent Assay (ELISA)

[0077] The expression of CCL21 and osteopontin at the translational level in the cell culture supernatant was measured with an ELISAM kit purchased from Research and Diagnostic Systems (MN, U.S.) and Lifespan Biosciences (WA, U.S.), respectively, according to the manufacturer's instructions.

[0078] 1.10 Chemotaxis Assay

[0079] In order to confirm the chemoattractive ability of SVF-spheroids, a chemotaxis assay was performed using a p-Slide Chemotaxis kit (Cat #80326; Ibidi, Germany) according to the manufacturer's instructions. 1.5 mg/ml Type I Collagen solution (Corning, N.Y., U.S.) was injected into the observation area. SVF-spheroids in the medium or medium were injected into the left space, and splenocytes were inserted into the right space. Live cell imaging was taken with an FV1000 (Olympus Corporation, Tokyo, Japan) during a 24-hour culturing period.

[0080] 1.11 Co-Culture of Stromal Vascular Fraction (SVF) and Dendritic Cells (DC) or Splenocytes

[0081] In a 24-well plate, 1×10.sup.6/well dendritic cells, 1×10.sup.6/well splenocytes, 1×10.sup.6/well mature dendritic cells (mature DC), or 2×10.sup.4/well SVF cultured with 1×10.sup.6/well splenocytes were prepared, and co-cultured. After culturing, cells were analyzed using flow cytometry.

[0082] 1.12 In Vitro and In Vivo Imaging

[0083] SVF cultured in vitro was observed with a microscope (Olympus corporation, Tokyo, Japan) and VisiView software (Visitron systems, Puchheim, Germany). To confirm the structure resulting from the kidney capsule transplantation in vivo, the grafts were collected two weeks after surgery, placed in frozen section media (Leica Biosystems, IL, U.S.), and quickly frozen in liquid nitrogen. Samples were made into frozen sections with a thickness of 5 to 6 um and stored at −80° C. until the experiment. For histological analysis, hematoxylin-eosin (H&E) staining was performed. For confocal imaging, section samples were fixed in 4% paraformaldehyde and stained with FITC-labeled anti-CD3, FITC-labeled anti-CD8 (BD Pharmingen, N.J., U.S.), Alexa 647-labeled anti-CD31, Alexa 594-labeled anti-PDPN, Alexa 647-labeled anti-CD11c, Alexa 647-labeled anti-CD4 (Biolegend, Calif., U.S.), Alexa 594-labeled anti-VEGFR3 (Bioss Antibodies, Mass., U.S.), 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific, Mass., U.S.). Confocal images were taken with FV3000 (Olympus Corporation, Tokyo, Japan) and analyzed with IMARIS version 9.3 (Bitplane, Z rich, Switzerland).

[0084] 1.13 Evaluation of Antigen-Specific Immune Responses

[0085] To evaluate whether injection of SVF-spheroids, dendritic cells, each or a mixture thereof effectively induces an antigen-specific immune response, each combination (1×10.sup.6 dendritic cells/mouse or 361 SVF-spheroids/mouse or both) were transplanted into the kidney capsule of each mouse once per different weeks, for a total of two times. The dendritic cells injected in each group were intracellularly ingested with NP—OVA and then transplanted, and the same number of NP—OVA was injected into the SVF-spheroid-only transplanted group. Five weeks after the first immunization, splenocytes isolated from each mouse were cultured with OVA 257-264 peptides and OVA 339-323 peptides (InvivoGen, Calif., U.S.) presented by H-2K.sup.b major histocompatibility complex (MHC) I and I-A.sup.b MHC II, respectively, to diffuse OVA-specific T cells. After culturing for 24 hours, the cells were stained with anti-MHC tetramer at 4° C. for 30 minutes, and cell surface staining was performed for an additional 30 minutes, followed by performing flow cytometry assay. APC-labeled tetramer SIINFEKL-H-2K.sup.b and PE-labeled tetramer AAHAEINEA-IA.sup.b were provided by the National Institutes of Health Tetramer Core Facility in the United States.

[0086] 1.14 Tumor Inoculation and Anti-Tumor Effect Test

[0087] For tumor inoculation, OVA-expressing malignant melanoma B16MO5 (5×10.sup.4 cells/mouse) were injected into the left side of the mouse. After 7 days, each combination (1×10.sup.6 dendritic cells/mouse, 361 SVF-spheroids/mouse) was inserted under the kidney capsule three times a week. Each group consisted of 5 mice. Tumor size and survival rates were evaluated to investigate the anti-tumor effect. Tumor size was measured every 2 to 3 days. [tumor volume (mm).sup.3=½×[(short diameter)×(long diameter).sup.2] was calculated. If the tumor size grew more than 2000 mm.sup.3, the mouse was considered dead.

[0088] 1.15 Statistical Analysis

[0089] The data were analyzed with Graph Pad Prism software for statistical analysis. RNA sequencing was performed with ExDEGA version 2.5.

[0090] 2. Results of Experiments

[0091] 2.1 Characteristics of SVF Isolated from Adipose Tissue

[0092] SVFs extracted from adipose tissue on the first 0 days (D0) were mostly small cells (FSC<250 K, FSC: forward scatter, SCC: side scatter) in a circular shape, but when cultured (D3: 3rd day of culture, D6: 6th day of culture), SVFs extracted from adipose tissue were replaced by large (FSC>250K) long-shaped cells (FIGS. 1B to 1D). When flow cytometry was performed to confirm these cell changes in detail, it was confirmed that the CD45+ hematopoietic cell population decreased when cultured (23.4%.fwdarw.5.94%) and the non-hematopoietic cell population increased (76.0%.fwdarw.93.7%) (FIGS. 1E and 1F).

[0093] As a result of analyzing the cell types according to these cell changes through marker analysis, CD4+ T cells, CD8+ T cells, and B220+ B cells decreased rapidly, and CD11c+ dendritic cells were maintained up to 10 days of culture (FIGS. 2A to 2D), and CD11b+ F4/80+ macrophages and Gr-1+ neutrophil cells decreased (FIGS. 2E and 2F). In FIGS. 2, P #0, P #1, and P #2 denote passage numbers 0, 1, and 2, respectively.

[0094] A subtype of lymph node stromal cells uses PDPN and CD31 markers to classify PDPN+ CD31− as fibroblastic reticular cells (FRC), and PDPN+ CD31+ as lymphatic endothelial cells (LECs), and PDPN− CD31+ as blood endothelial cells (BECs). When SVF isolated from adipose tissue is cultured and flow cytometric analysis is performed, the CD45− cell group is the phenotype of lymph node stromal cells, it was confirmed that the CD45− cell group showed characteristics that were divided into PDPN+ CD31−, PDPN+ CD31+, and PDPN− CD31+ similar to the phenotype of lymph node stromal cells (FIGS. 3A to 3E). In particular, it was confirmed that SVF showed a phenotype of FRC (PDPN+ CD31−) of 60% or more when cultured for 5 days or more, and 80% or more when cultured for 10 days or more (FIG. 3B).

[0095] As a result of additional identification of SVFs with a PDPN+ CD31− FRC-like phenotype using FRC-specific markers, it was confirmed that these cells express FRC-specific markers such as lymphotoxin β receptor (LTβR), platelet-derived growth factor α (CD140α), vascular cell adhesion molecule-1 (VCAM-1), and intracellular adhesion molecule-1 (ICAM-1) (FIG. 4). In FIGS. 4, P #0, P #1, and P #2 denote passage numbers 0, 1, and 2, respectively.

[0096] In addition to these phenotypes, in order to investigate whether SVF is functionally similar to lymph node stromal cells, various stimulators, such as TLR3-agonist (Polyl:C, plC), TLR7-agonist (Imiquimod), αLTβR (αLT) and LTβR ligands (anti-LTβR, LIGHT, L) were treated for 24 hours, and when mRNA was quantified by quantitative PCR, it was confirmed that Ccl19, Ccl21, Cxcl13, and Cxcl12, which are representative chemokines secreted by lymph node stromal cells, were expressed (FIG. 5A). It was confirmed that when cultured in the form of spheroids, which is a three-dimensional cell culture method (SVF spheroids, SPH), much more chemokines, such as Ccl19, Ccl21, and Cxcl13, may be expressed compared to the two-dimensional cultured SVF (FIG. 5B).

[0097] The above results can be said to show that SVF isolated from adipose tissue is composed of cells similar to lymph node stromal cells in phenotype and function.

[0098] 2.2 Angiogenic Capacity of SVF Spheroids

[0099] When comparing the gene expression of SVF spheroids (SPH) cultured for 8 days in a three-dimensional culture method (D8) and SVF (SVF) cultured in a two-dimensional culture method (monolayer) by mRNA analysis, SVF When cultured with spheroids, it was confirmed that the expression of 11 genes related to angiogenesis increased when cultured with SVF spheroids (FIGS. 6A and 6B), and CD31 cells (PDPN− CD31+ BEC, PDPN+ CD31+ LEC) increased when flow cytometry was performed (FIG. 6C). In FIG. 6, >10 means that the fold change value of gene expression is more than 10 times the average of the control group (SVF(D8)), <0.1 means less than 0.1 times, and P #0 and P #1 denote passage numbers 0 and 1, respectively.

[0100] In order to actually check the blood vessel formation ability in vivo, when SVF spheroids were transplanted into the kidney capsule of a mouse, it was confirmed that blood vessels were formed on the graft surface 2 weeks after transplantation (FIG. 6D), and the generated blood vessels were positive for VEGFR3 and CD31, which are lymphocytes and endothelial cell markers, respectively (FIG. 6E). In addition, CD3+ T cells appeared to migrate through interaction with CD31+ cells through frozen section images (FIG. 6F).

[0101] The above results can be said to show that SVF spheroids can form blood vessels that serve as migration channels for immune cells.

[0102] 2.3 The Ability of SVF Spheroids to Attract Dendritic Cells and Enhance the Interaction Between T Cells and Dendritic Cells

[0103] As a result of confirming the gene expression changes of chemokines, cytokines, and growth factors in three-dimensional cultured SVF spheroids (SPH) through mRNA analysis, it was confirmed that on day 0 (D0), the expression of factors that attract or activate immune cells increased statistically significantly (p value<0.05) compared to the two-dimensional culture SVF (FIG. 7A). In FIG. 7A, >10 means that the fold change value of gene expression is 10 times more than the average of the control (SVF(D0), and <0.1 means that the fold change value of gene expression is 0.1 times less than the average of the control (SVF(D0). Specifically, the expression of vascular endothelial growth factor α (Vegfa) gene and platelet-derived growth factor C (Pdgfc) gene, which are factors inducing angiogenesis, increased, the expression of Mmp 8, 10 and 13 (Matrix metalloproteinase 8, 10, 13) genes, which open the cell migration channel by decomposing the extracellular matrix, also increased, and the expression of Spp1, Ccl8, Cxcl5, Postn, Cxcl16, Ccl17 genes, which are factors that attract and activate immune cells, also increased. In particular, the expression of the gene Spp1 for osteopontin, a factor known to control the maturation and survival of dendritic cells, was increased, and quantification of osteopontin in the culture supernatant confirmed that the concentration of osteopontin in SVF spheroids increased very high (FIG. 7B).

[0104] These results can be said to show that SVF spheroids express various factors that attract and activate immune cells.

[0105] In order to confirm that the chemokines secreted from the SVF spheroids can actually attract immune cells, a migration assay was performed using the collagen layer for 24 hours, and as a result, it was confirmed that the splenocytes on the right side migrated toward the SVF spheroid (SPH) on the left side over time (FIG. 8A). When migration assay was performed on CD3+ T cells and bone marrow-derived dendritic cells (BMDCs) for the immune cell attraction ability of SVF spheroids, it was confirmed that CD3+ T cells did not migrate, but BMDCs, which are dendritic cells, migrated toward the SVF spheroids (FIGS. 8B, 8C, and 8D).

[0106] In order to check whether SVF spheroids have the ability to attract immune cells in vivo when SVF spheroids (SVF) were transplanted into the mouse kidney capsule, CD3+ T cells were not attracted, but when the mature dendritic cell (mDC) BMDCs were transplanted together, it was confirmed that many CD3+ T cells were attracted, and these CD3+ T cells were mixed with PDPN+ SVF cells (FIG. 9A: SVF spheroid alone transplanted group, 9B: mature dendritic cells alone transplanted group, 9C: transplant group injected with SVF spheroids and mature dendritic cells together). Even when only dendritic BMDCs were transplanted, CD3+ T cells were attracted, but it was confirmed that more CD3+ T cells were attracted when dendritic cells were transplanted with SVF spheroids (FIG. 9D).

[0107] T cells attracted by the SVF spheroids contained CD4+, CD8+ T cells, and CD11c+ dendritic cells (FIGS. 10A and 10B), and when quantified by flow cytometry, it was confirmed that CD3+ T cells and CD4+ T cells were the most in the group transplanted with mature dendritic cells (mDC) and SVF spheroids (SPH+mDC), and a large number of CD8+ T cells and CD11c+ dendritic cells were also present (FIGS. 10C to 10J). These results can be said to show that SVF spheroids can increase CD3+ T cell infiltration when coexisting with dendritic cells.

[0108] In the case that SVF spheroids are present together with dendritic cells when analyzed in more detail by flow cytometry to confirm the state of the induced T cells among CD62L-CD44+ effector T cells, CD62L+ CD44+ memory T cells, and CD62L+ CD44− immature T cells, CD4+ effective group T cells account for the largest portion among the T cells collected in the graft (FIGS. 11A and 11B).

[0109] The above results show that SVF spheroids attract dendritic cells and enhance dendritic cell interaction with T cells and that T cells are mostly differentiated into CD4+ effector T cells to perform an immune response.

[0110] 2.4 The Complex of SVF Spheroids and Dendritic Cells Enhances the Response of Antigen-Specific T Cells.

[0111] When SVF (two-dimensional culture of SVF) and mature dendritic cells (mature DC, mDC) were co-cultured to determine the mechanism by which SVF (two-dimensional culture of SVF) regulates the interaction between dendritic cells and T cells, it was confirmed that the expression of CD40, CD80, MHCII, and DC-SIGN, which are activation markers of dendritic cells, actually increased compared to immature dendritic cells (immature DC, iDC) and mature dendritic cells alone (FIG. 12A). In addition, when the two-dimensional culture SVF and mature dendritic cells were co-cultured for 1 day and stained with 7 MD to examine the degree of apoptosis, it was confirmed that the survival rate of mature dendritic cells (SVF+mDC) was improved when co-cultured with SVF compared to the culture of immature dendritic cells (iDC) and mature dendritic cells (mDC) alone (FIG. 12B). Also, when SVF and ss, a two-dimensional culture, were co-cultured for 7 days and stained with 7 MD, the survival rate of splenocytes (SVF+Spl) co-cultured with SVF for 7 days was about 8 times higher than that of splenocytes alone (Spl) (FIG. 12C).

[0112] In order to examine whether the SVF spheroid and mDC complex can enhance the antigen-specific T cell response, the SVF spheroid and mDC complex was divided into (i) untreated (UT), (ii) SVF spheroid and OVA (ovabulbumin) transplanted group (SPH), (iii) a mature dendritic cell (mDC) transplanted group (mDC) loaded with OVA, (iv) a mature dendritic cell (mDC) transplanted group (SPH+mDC) loaded with SVF spheroids and OVA (n=5), and transplanted twice at the start of the experiment and at the second week of the experiment in the mouse kidney capsule (FIG. 13A). After 4 weeks, when the ratio of OVA antigen-specific CD4+, CD8+ T cells was examined by staining the OVA peptide presented in the MHC tetramer, it was confirmed that the ratio of CD4+, CD8+ T cells increased high in the mDC transplant group activated with SVF spheroids and OVA (FIG. 13B). Here, the antigen, OVA, was bound to Fe.sub.3O.sub.4—ZnO nanoparticles and used for loading into dendritic cells.

[0113] These results show that when mature dendritic cells are co-cultured with two-dimensional culture SVF or spheroids thereof or co-transplanted, the activation of dendritic cells is promoted, and the survival rate is improved, resulting in more effective activation of T cells and antigen-specific T cells, thereby enhancing the response of antigen-specific T cells.

[0114] 2.5 Anti-Tumor Activity of SVF Spheroid and Dendritic Cell Complex

[0115] In order to confirm that the increased antigen-specific T cell immune response confirmed as above actually has an anti-cancer effect that inhibits the growth of cancer cells, B16 melanoma cells expressing OVA (B16-OVA) were injected in the flank of the mouse. The SVF spheroid and mDC complex was divided into (i) untreated (UT), (ii) SVF spheroid and OVA (ovalbumin) transplanted group (SPH), (iii) a mature dendritic cell (mDC) transplanted group (mDC) loaded with OVA, (iv) a mature dendritic cell (mDC) transplanted group (SPH+mDC) loaded with SVF spheroids and OVA (n=5) and transplanted to a mouse kidney capsule three times at 1-week intervals (FIG. 14A). Also here, the antigen, OVA, was bound to Fe.sub.3O.sub.4—ZnO nanoparticles and used for loading into dendritic cells. As a result of the experiment for 32 days, tumor growth was inhibited the most in the mDC transplanted group activated by SVF spheroids and OVA, and the survival rate was maintained at 100% during the experiment period (FIGS. 14B, 14C, and 14D). Therefore, it was found that the effect of SVF spheroids and dendritic cells increased compared to the injection of dendritic cells alone.

[0116] As described above, when the stromal vascular fraction (SVF) isolated from adipose tissue is transplanted together with dendritic cells at the dendritic cell transplantation site, SVF activates dendritic cells at the transplanted site and consequently enhances the response of T cells (FIG. 15).