Method for the Colorimetric Detection of Contamination with Nucleases

Abstract

Method for detecting the presence of nucleases in a sample, characterized in that it comprises the steps of: —incubating the sample to be tested for the presence of nucleases with at least one oligonucleotide linker constituting the substrate for the nuclease to be detected, for a sufficient time to cause degradation of said oligonucleotide linker by the nuclease possibly present in the sample, —adding to the sample, upon incubation, colloidal gold nanoparticles comprising gold nanoparticles functionalized with a first probe oligonucleotide and gold nanoparticles functionalized with a respective second probe oligonucleotide, said first and second probe oligonucleotides being complementary to a respective portion of the nucleotide sequence of the oligonucleotide linker, and—examining the possible colour change of the sample as a result of the addition of said nanoparticles, a colour change of the sample to the colour assumed by the colloidal gold particles when aggregated at a distance less than their size being indicative of the absence of the tested nuclease from the sample.

Claims

1. Method for detecting the presence of nucleases in a sample, characterized in that it comprises the steps of: incubating the sample to be tested for the presence of nucleases with at least one oligonucleotide linker constituting the substrate for the nuclease to be detected, for a time sufficient to cause degradation of said oligonucleotide linker by the nuclease possibly present in the sample, adding to the sample, upon incubation, colloidal gold nanoparticles comprising gold nanoparticles functionalized with a first probe oligonucleotide and gold nanoparticles functionalized with a respective second probe oligonucleotide, said first and second probe oligonucleotide being complementary to a respective portion of the nucleotide sequence of the oligonucleotide linker, and examining the possible colour shift of the sample as a result of the addition of said nanoparticles, a color shift of the sample to the color assumed by the colloidal gold particles when aggregated at a distance less than their size being indicative of the absence of the tested nuclease from the sample.

2. Method according to claim 1, for detecting DNase or RNase specific for single-stranded DNA or RNA, respectively, in which the oligonucleotide linker is a single-stranded DNA or RNA sequence devoid of secondary structure and not dimerizing.

3. Method according to claim 2, characterized in that the oligonucleotide linker is selected from the group consisting of: TABLE-US-00003 (A).  (SEQ ID NO: 1) 5′ ATAAAGTGACAGAATAGAGTGA 3′(A1)  or:  (SEQ ID NO: 2) 5′ AGTGACAGAATAGA 3′(A2)  (B).  (SEQ ID NO: 3) 5′ ArUrArArArGrUrGrArCrArGrArArUrArGrArGrUr GrA 3′ (B1)  or:  (SEQ ID NO: 4) 5′ ArGrUrGrArCrArGrArArUrArGrAr 3′ (B2)  or:  (SEQ ID NO: 5) 5′ ArGrUrGrArCrArUrCrCrGrArArUrArGrAr 3′ (B3)  or:  (SEQ ID NO: 6) 5′ rCrArUrUrGrCrUrUrCrArUrCrUrGrUrUrUrCrGrUr  CrU 3′ (B4) or:  (SEQ ID NO: 7) 5′rGrCrUrUrCrArUrCrUrGrUrUrUrC 3′ (B5).

4. Method according to claim 1, for detecting a nuclease specific for dsDNA, dsRNA and/or heteroduplex DNA/RNA, wherein the oligonucleotide linker comprises a DNA or RNA sequence, respectively, hybridized to a shorter complementary sequence to form a hybrid sequence having at least one single-stranded free end, wherein said shorter complementary sequence is capable of strand displacement as a result of the hybridization of the single-stranded end with a complementary portion of the probe oligonucleotide that functionalizes the nanoparticles.

5. Method according to claim 4, characterized in that said oligonucleotide linker is selected from the group consisting of: (C) dsDNA sequence consisting of SEQ ID NO:1 and 5′ATT TCT CTG TCA CT 3′ (SEQ ID NO:8) (D) dsRNA sequence consisting of SEQ ID NO:3 and 5′rUrCrUrArUrUrCrUrGrUrCrArCrU 3′ (SEQ ID NO:9) (E) DNA/RNA heteroduplex consisting of SEQ ID NO:1 and 5′rUrCrUrArUrUrCrUrGrUrCrArCrU 3′ (SEQ ID NO:9) or DNA/RNA heteroduplex consisting of SEQ ID NO:3 and 5′ATT TCT CTG TCA CT 3′ (SEQ ID NO:8).

6. Method according to claim 1 for detecting an exonuclease, wherein the oligonucleotide linker is incorporated into a dsDNA sequence having a blunt end or an overhang of not more than 4 bases.

7. Method according to claim 6, wherein the oligonucleotide linker is a dsDNA sequence having a blunt end consisting of SEQ ID NO:1 and 5′TATTCTGTCACTTTAT 3′ (SEQ ID NO:10) or SEQ ID NO:1 and 5′TCACTCTATTCTGTC 3′ (SEQ ID NO:13) or 5′ATA AAG TGA TGA CAT GAG CAG AAT A 3′(SEQ ID NO:11) and 5′ ATGTCACTCTAT 3′(SEQ ID NO 12), or SEQ ID NO:1 and 5′TCACTCTATTCTGTC 3′ (SEQ ID NO:13), or 5′CGTATAAAGTGACAGAATAGAGTGA 3′ (SEQ ID NO: 14) and 5′GCTTATTTCACT 3′ (SEQ ID NO: 15).

8. Method according to claim 1, characterized in that said first and second probe oligonucleotides have a length of from 5 to 80 nucleotides, preferably of from 15 to 40 nucleotides.

9. Method according to claim 8, characterized in that said first and second probe oligonucleotides are selected from the group consisting of TABLE-US-00004 1.  (SEQ ID NO: 16) 5′ ATGTCACTCTATTC 3′ or: (SEQ ID NO: 17) 5′ ATGAGACGAAACAG 3′ 2.  (SEQ ID NO: 18) 5′ TGTCACTTTATACG 3′ or: (SEQ ID NO: 19) 5′ ATGAAGCAATGACG 3′.

10. Method according to claim 1, wherein said colloidal gold nanoparticles have a size of from 1 to 500 nm, preferably of from 15 to 80 nm.

11. Method according to claim 1, wherein said colloidal gold nanoparticles are functionalized with said probe oligonucleotides at a functionalization density of from 2×10.sup.−4/nm.sup.2 to 2×10.sup.−1/nm.sup.2, preferably of from 1×10.sup.−3/nm.sup.2 to 8×10.sup.−2/nm.sup.2.

12. Kit for detecting nucleases in a sample comprising: colloidal gold nanoparticles functionalized with a first and a second probe oligonucleotide and one or more oligonucleotide linkers constituting the substrate for the nuclease(s) to be detected, wherein said first and second probe oligonucleotides are complementary to a respective portion of the nucleotide sequence of one or more of said oligonucleotide linkers.

Description

EXAMPLE 1: Detection of DNase

[0055] An aliquot of the test solution equal to 50 μl is added to a reaction tube containing a small amount of lyophilized substrate (A1) or (C), or to both. The final concentration of the substrate in the solution is 100 nM. Various reaction tubes are prepared, containing variable amounts of the enzyme DNase I (from 200 units to 2×10.sup.−4 units). The solution is left to incubate for one hour, or less in specific cases, at room temperature. An identical amount (50 μl) of water free from nucleases is added to a second identical reaction tube (negative control) containing the same substrate. A third tube (positive control) is instead empty. An identical aliquot of the test solution is added to this. At the end of incubation, a mix of colloidal gold nanoparticles (AuNPs) is added to all the tubes, for a concentration of 1 nM in the final solution. This mix contains, in equal proportions, AuNPs functionalized with two different probe sequences of DNA, probe oligonucleotide 1, with the sequence 5′ ATGTCACTCTATTC 3′ (SEQ ID NO:12), and probe oligonucleotide 2, with the sequence 5′ TGTCACTTTATACG 3′ (SEQ ID NO:14). After brief incubation, the possible colour change is observed, indicative of the absence of contamination. In the negative control the colour change is observed in every case. In the positive control, colour change is not observed, unless substances that interfere with the colorimetric test are present in the solution. In this case, this control offers the possibility of removing small interferences visually, or of deciding the possible non-testability of the sample, if the interference is excessive. This sample containing interfering components may, however, be suitably diluted and tested again. In the samples containing DNase I, the colour change is not observed for the samples that contain from 200 units to 2×10.sup.−3 units of DNase I. 2×10.sup.−3 units thus represents the limit of detection of the test for DNase I.

EXAMPLE 2: Detection of RNase

[0056] An aliquot of the test solution equal to 50 μl is added to a reaction tube containing a small amount of lyophilized substrate (B1) or (D). The final concentration of the substrate in the solution is 75 nM. Various reaction tubes are prepared, containing variable amounts of the enzyme RNase, A (from 1.75 units to 1.75×10.sup.−7 units). The solution is left to incubate for one hour, or less in specific cases, at room temperature. An identical amount (50 μl) of water free from nucleases is added to a second identical reaction tube (negative control) containing the same substrate. A third tube (positive control) is instead empty. An identical aliquot of the test solution is added to this. At the end of incubation, a mix of colloidal gold nanoparticles (AuNPs) is added to all the tubes, for a concentration of 1 nM in the final solution. This mix contains, in equal proportions, AuNPs functionalized with two different probe sequences of DNA, probe oligonucleotide 1, with the sequence 5′ ATGTCACTCTATTC 3′ (SEQ ID NO:12), and probe oligonucleotide 2, with the sequence 5′ TGTCACTTTATACG 3′ (SEQ ID NO:14). After brief incubation, the possible colour change is observed, indicative of the absence of contamination, as described in example 1. In the samples containing RNase A, the colour change is not observed for the samples that contain from 1.75 units to 1.75×10.sup.−7 units of RNase A. 1.75×10.sup.−7 units thus represents the limit of detection of the test for RNase A.

[0057] The method according to the invention was validated using various nucleases, including DNase I, RNase A, Mung Bean nuclease, micrococcal nuclease, nucleases Bal-31, RNase H and extracellular bacterial DNases. The method proved to be capable of detecting all the enzymes tested that display varied substrate specificity. As already mentioned, the method was optimized for six different substrates, thus allowing six classes of enzymes to be tested, including the enzymes mentioned above. However, the test is intended to be extendable to other nucleases, using the same test principle.

[0058] The test can therefore be applied widely in all situations where accurate and rapid inspection for the presence of any contamination with nucleases is required, for example in quality control tests in laboratory practice and thus also in quality control of reagents for molecular biology and of laboratory plasticware, as well as in scientific research applications.

[0059] Furthermore, the test provides information on the specific type of contamination present in the sample, allow specific strategies for inactivation to be defined, which may be more suitable than generalized procedures for nuclease decontamination.

REFERENCES

[0060] Rui Cao, Baoxin Li, Yuanfu Zhang and Zhining Zhang, Naked-eye sensitive detection of nuclease activity using positively-charged gold nanoparticles as colorimetric probes, Chem. Commun., 2011, 47, 12301-12303 [0061] Xiaoyang Xu, Min Su Han, and Chad A. Mirkin, A Gold-Nanoparticle-Based Real-Time Colorimetric Screening Method for Endonuclease Activity and Inhibition, Angew. Chem. Int. Ed., 2007, 46, 3468-3470 [0062] David A. Giljohann, Dwight S. Seferos, Andrew E. Prigodich, Pinal C. Patel, and Chad A. Mirkin, Gene Regulation with Polyvalent siRNA-Nanoparticle Conjugates, J. Am. Chem. Soc., 2009, 131, 2072-2073 [0063] Dwight S. Seferos, Andrew E. Prigodich, David A. Giljohann, Pinal C. Patel, and Chad A. Mirkin, Polyvalent DNA Nanoparticle Conjugates Stabilize Nucleic Acids, Nano Lett., 2009, 9, 308-311.