MEDICATION AND DIAGNOSTIC KIT FOR INHIBITING METASTASIS AND INVASION OF BREAST CANCER, shRNA MOLECULE FOR SILENCING EXPRESSION OF HUMAN LINC01614 AND APPLICATION THEREOF

Abstract

The invention provides a medication and a diagnostic kit for inhibiting metastasis and invasion of breast cancer, an shRNA molecule for silencing expression of human LINC01614 and applications thereof. The shRNAs obtained by the invention can interfere with the expression of LINC01614, thereby reducing the migration and invasion ability of tumor cells, inhibiting the expression of EMT proteins, and inhibiting tumor formation and lung metastasis in an animal model in vivo. The invention provides a new solution for targeted therapy of breast cancer. Therefore, the kit for diagnosing metastasis and invasion of breast cancer and the medication for treating metastasis and invasion of breast cancer are developed. The invention provides a new way and strategy for diagnosing and treating metastasis and invasion of breast cancer.

Claims

1. A kit for diagnosing metastasis and invasion of breast cancer, comprising an agent for detecting an LINC01614 inhibition effect in human breast cancer cells, wherein the agent comprises primers shown as SEQ ID No. 10-13.

2. A medication for inhibiting metastasis and invasion of breast cancer, comprising shRNAs for inhibiting expression of human LINC01614, wherein the shRNAs for inhibiting expression of human LINC01614 comprises a shRNA-1 and/or a shRNA-2, a sense strand nucleotide sequence of the shRNA-1 is shown as SEQ ID No. 3, an antisense strand nucleotide sequence of the shRNA-1 is shown as SEQ ID No. 4, a sense strand nucleotide sequence of the shRNA-2 is shown as SEQ ID No.5, and an antisense strand nucleotide sequence of the shRNA-2 is shown as SEQ ID No. 6.

3. The medication for inhibiting metastasis and invasion of breast cancer according to claim 2, wherein the medication is a recombinant lentivirus expression vector of the shRNAs for inhibiting the expression of human LINC01614 or a recombinant lentivirus of the shRNAs for inhibiting the expression of human LINC01614.

4. An shRNA molecule for silencing expression of human LINC01614, comprising an shRNA-1 and/or an shRNA-2, wherein a sense strand nucleotide sequence of the shRNA-1 is shown as SEQ ID No. 3, an antisense strand nucleotide sequence of the shRNA-1 is shown as SEQ ID No. 4, a sense strand nucleotide sequence of the shRNA-2 is shown as SEQ ID No. 5, and an antisense strand nucleotide sequence of the shRNA-2 is shown as SEQ ID No. 6.

5. An application of the shRNA molecule for silencing the expression of human LINC01614 according to claim 4 in preparation of a medication for inhibiting expression of LINC01614.

6. An application of the shRNA molecule for silencing the expression of human LINC01614 according to claim 4 in preparation of a medication for inhibiting metastasis and invasion of human breast cancer cells MDA-MB-231 and Hs578T.

7. An application of the shRNA molecule for silencing the expression of human LINC01614 according to claim 4 in preparation of a medication for inhibiting metastasis and invasion of breast cancer cell.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0020] FIG. 1 shows a validation effect of lentivirus-mediated shRNAs on LINC01614 silencing in human breast cancer cells, MDA-MB-231 and Hs578T cells. * represents that compared with sh-Control, *P is less than 0.05, **P is less than 0.01, and ***P is less than 0.001.

[0021] FIG. 2 shows the clone formation of MDA-MB-231 and Hs578T cells that transfected with lentivirus.

[0022] FIG. 3 shows the migration and invasion ability of MDA-MB-231 and Hs578T cells that transfected with lentivirus.

[0023] FIG. 4 shows the protein expression of EMT-related proteins, E-cadherin and N-cadherin, in MDA-MB-231 and Hs578T cells that transfected with lentivirus.

[0024] FIG. 5 shows subcutaneous tumor formation modelling of nude mice with MDA-MB-231 transfected with lentivirus to knockdown LINC01614. Tumor volume and weight were detected.

[0025] FIG. 6 shows the breast cancer lung metastasis model by tail vein injection with MDA-MB-231 transfected with lentivirus. Lung metastasis was detected.

DESCRIPTION OF THE EMBODIMENTS

[0026] The following example illustrates the present invention but are not intended to limit the scope of the present invention. If not specifically indicated, the technical means used in the examples are conventional means well known to those skilled in the art.

[0027] Statistical Analysis

[0028] Data was subjected to statistical analysis by using SPSS 22.0 software. Measurement data was represented by mean±standard deviation. One-way ANOVA and t-test were used to examine the difference from one another among groups, and p-value less than 0.05 indicated a significant difference.

Example 1: Design of LINC01614 Specific shRNAs

[0029] The shRNA sequences were listed below:

TABLE-US-00001 shRNA-1: (shown as SEQ ID No. 1) TTCCTTAAAGTAGCAATCTTAGC; shRNA-2: (shown as SEQ ID No. 2) GACAAGTTCAGTGGAAACTTTCT.

[0030] A sense strand nucleotide sequence of the shRNA-1:

TABLE-US-00002 (shown as SEQ ID No. 3) 5′-CCGGTTCCTTAAAGTAGCAATCTTAGCCTCGAGGCTAAGATTGCTA CTTTAAGGAATTTTTG-3′;

[0031] An antisense strand nucleotide sequence of the shRNA-1:

TABLE-US-00003 (shown as SEQ ID No. 4) 5′-AATTCAAAAATTCCTTAAAGTAGCAATCTTAGCCTCGAGGCTAAGA TTGCTACTTTAAGGAA-3′.

[0032] A sense strand nucleotide sequence of the shRNA-2:

TABLE-US-00004 (shown as SEQ ID No. 5) 5′-CCGGGACAAGTTCAGTGGAAACTTTCTCTCGAGAGAAAGTTTCCAC TGAACTTGTCTTTTTG-3′;

[0033] An antisense strand nucleotide sequence of the shRNA-2:

TABLE-US-00005 (shown as SEQ ID No. 6) 5′-AATTCAAAAAGACAAGTTCAGTGGAAACTTTCTCTCGAGAGAAAGT TTCCACTGAACTTGTC-3′; sh-LINC01614-1: (shown as SEQ ID No. 7) CCGGTTCCTTAAAGTAGCAATCTTAGCCTCGAGGCTAAGATTGCTACTT TAAGGAATTTTTG; sh-LINC01614-2: (shown as SEQ ID No. 8) CCGGGACAAGTTCAGTGGAAACTTTCTCTCGAGAGAAAGTTTCCACTGA ACTTGTCTTTTTG. sh-Control: (shown as SEQ ID No. 9) TTCTCCGAACGTGTCACGT.

Example 2: Construction of shRNA-Lentiviral Expression Vectors

[0034] The ahU6-MCS-CBh-gcGFP-IRES-puromycin vector was digested by using restriction enzymes EcoR and Age I. Digest products were separated by gel electrophoresis. Target segments were purified. Resuspending and annealing both sense and antisense shRNA oligonucleotides with the ratio of 1:1. The annealed shRNA oligonucleotides were inserted between the restriction sites in vector by ligation. Ligation reaction was transformed into competent Escherichia coli DH5a. Candidate colonies were isolated and amplified. the shRNA inserts of the target vectors were identified by sequencing and alignment.

TABLE-US-00006 Table 1 Designed specific primer based on shRNA inserts NO. 5′ STEM Loop STEM 3′ LINC0161 Ccgg TTCCTTAAAGTAGC CTC GCTAAGATTGCT TTTTTg 4-1-sh1-for AATCTTAGC GAG ACTTTAAGGAA LINC0161 aattcaaa TTCCTTAAAGTAGC CTC GCTAAGATTGCT 4-1-sh1-rev aa AATCTTAGC GAG ACTTTAAGGAA LINC0161 Ccgg GACAAGTTCAGTGG CTC AGAAAGTTTCCA TTTTTg 4-1-sh2-for AAACTTTCT GAG CTGAACTTGTC LINC0161 aattcaaa GACAAGTTCAGTGG CTC AGAAAGTTTCCA 4-1-sh2-for aa AAACTTTCT GAG CTGAACTTGTC

[0035] Specific steps are as follows:

[0036] (1) Linearized and purified of the vectors. The enzyme digestion system is shown in Table 2:

TABLE-US-00007 TABLE 2 Enzyme digestion system Agent Volume (μl) ddH.sub.2O 41 10 × CutSmart Buffer.sup.2 5 Purified plasmid DNA (1 μg/μL) 2 Age I (10 U/μl) 1 EcoR I (10 U/μl) 1 Total 50

[0037] After incubating for 1 h at 37° C. (optimum temperature), reactions were separated by electrophoresis in a 1% agarose gel. Target segments were purified and subjected to enzyme digestion.

[0038] (2) For ligation, linearization vector and annealed shRNA oligonucleotides were ligated by T4 DNA ligase at 16° C. for 1-3 h or overnight. The ligating reaction is shown in Table 3:

TABLE-US-00008 TABLE 3 Ligating reaction Agent Volume (μl) Linearized vector (100 ng/μL)  1* Double-stranded DNA (shRNA) (100 ng/μL) 1 10 × T4 DNA ligase buffer 2 T4 DNA ligase 1 dd H.sub.2O Top up to 20 *Corresponding adjustments should be made according to the size of the vector.

[0039] (3) PCR Identification and Sequencing of Positive Transformed Colonies

[0040] Transform 50 μl competent E. coli DH5a cells with 50 of the ligation reaction. Leave the mixture on ice for 30 min. Heat shocks the mixture in the 42° C. bath for 90 sec then immediately incubated the mixture in the ice for 3 min. Add 950 μL of antibiotic-free liquid LB medium to the cells and incubated in 37° C. shaking incubator for 45 min with a speed of 150 rpm. Add and spread 150 μl cells suspension from each transformation on LB agar+ampicillin (100 μg/ml) plates. Incubate plates at 37° C. overnight. Pick 10 candidate isolated colonies from each transformation and inoculate each into LB+ampicillin (50-100 μg/ml). Grow overnight at 37° C. with shaking (150 RPM). The cultures were collected, and plasmid vectors were extracted.

[0041] shRNA inserts were identified by sequencing and alignment. Correct aligned vectors were identified as a successfully constructed shRNA lentiviral expression vectors.

[0042] (4) Lentivirus Packaging and Titer Determination

[0043] The 293T cells were co-transfected with extracted lentivirus expression vectors and packaging plasmids (Shanghai Genechem Co., Ltd., provided a transfection agent). Harvest and filter the lentiviral supernatants through a 0.45 μm low protein binding filter to remove cellular debris within 48 h. The concentrated viruses were stored at −80° C.

[0044] According to the examples, three recombinants lentivirus, sh-LINC01614-1, sh-LINC01614-2 and sh-Control were obtained.

Example 3: Transfected Human Breast Cancer Cells, MDA-MB-231 and Hs578T Cells, with Sh-LINC01614-1, Sh-LINC01614-2 and Sh-Control Lentivirus

[0045] MDA-MB-231 and Hs578T cells were prepared and inoculated to a 6-pore plate with a density of 2.5×10.sup.5 cells/pore. When the cells density reached 70%, add sh-LINC01614-1, sh-LINC01614-2 or sh-Control lentivirus (MOI=10) supernatant to the cell and transduce for 24 hour. Remove and discard the lentivirus-containing transduction medium and replace with fresh growth medium. Continue to incubate the cells for 72 hours. After 72 h, the GFP expression was analysis by a fluorescence microscope. When the expression reached more than 90% indicated a successful transfection.

Example 4: Detect the Knockdown Efficiency of LINC01614 in Transfected Human Breast Cancer Cells, MDA-MB-231 and Hs578T

[0046] MDA-MB-231 and Hs578T cells that transfected with sh-LINC01614-1, sh-LINC01614-2 or sh-Control lentivirus were harvested. The total RNA of each group was extracted with Total RNA extraction kit (15596026, Invitrogen Company) according to the manufacturer's instructions. The cDNAs were synthesized by reverse transcription with a reverse transcription kit (RR037A, Takara Company). The Real-time PCR detection of LINC01614 (amplification primers shown in Table 4) was performed using SYBR® Select Master Mix (Applied Biosystems, cat: 4472908) on ABI 7900 system (Applied Biosystems, Foster City, Calif., USA) with the primers (Table 4) according to the manufacturer's instructions. The procedure was showed as follows: initial denaturation for 2 minutes at 94° C.; 40 cycles of denature 30 s at 94° C., anneal primers for 30 s at 55° C. and extend DNA for 1 min at 72° C. The Real-Time PCR adopted a 2.sup.−ΔΔCt method for relative quantitative analysis.

TABLE-US-00009 TABLE 4 Real-time PCR Primer sequences Gene Primer sequence LINC01614F 5′-AACCAAGAGCGAAGCCAAGA-3′ (shown as SEQ ID No. 10) LINC01614R 5′-GCTTGGACACAGACCCTAGC-3′ (shown as SEQ ID No. 11) GAPDH F 5′-CTGGTAAAGTGGATATTGTTGCCAT-3′ (shown as SEQ ID No. 12) GAPDH R 5′-TGGAATCATATTGGAACATGTAAACC-3′ (shown as SEQ ID No. 13)

[0047] The results showed that the expression of LINC01614 in sh-LINC01614-1 group and sh-LINC01614-2 group were significantly downregulated than that of sh-Control group (P<0.001), and the silencing effect of sh-LINC01614-2 is better (shown in FIG. 1). Thus, the primers in Example 4 could be used as a kit for detecting the expression of LINC01614 in human breast cancer cells.

Example 5: Knocking Down of LINC01614 Inhibited the Clone Formation of MDA-MB-231 and Hs578T Cells

[0048] MDA-MB-231 and Hs578T cells were plated in six-well plates overnight and then transfected with sh-LINC01614-1, sh-LINC01614-2 or sh-Control lentivirus. After the removal of the drug-containing medium, the cells were washed using PBS, trypsinized and plated at a low density (2000 cells/well in six-well plates). The cells were cultivated for 2-3 weeks in a humidified atmosphere containing 5% CO2 at 37° C. and the medium was refreshed every two days. Then, cells were washed with PBS for twice and fixed with 4% of paraformaldehyde for 30 minutes at room temperature and then washed with 1×PBS. Cells were stained with 0.5% crystal violet (Sigma Chemical Co, St. Louis, Mo.) at room temperature. The excess dye was removed by washed 3 times with distilled water. The cell colonies containing more than 50 cells were counted under microscope. Each experiment was independently repeated for 3 times.

[0049] As shown in FIG. 2, the clone formation of cells that transfected by sh-LINC01614-1 and sh-LINC01614-2 were significantly reduced than that of sh-Control (P<0.01).

Example 6: Knocking Down of LINC01614 Inhibited Migration and Invasion of MDA-MB-231 and Hs578T Cells

[0050] MDA-MB-231 and Hs578T cells infected with sh-LINC01614-1, sh-LINC01614-2 or sh-Control lentivirus were serum starved for 12 h and then digested with trypsin, respectively. Cells were centrifuged, diluted and resuspended with serum-free medium. For migration analysis, the transwell insert membrane is coated with Matrigel. A total of 30 μl diluted Matrigel was added to the upper chamber of each Transwell insert, which was then incubated at 37° C. for 120 min. The upper chamber of the Transwell incubated with 100 μl cells (2×10.sup.4 cells/chamber) suspended in serum-free medium. The lower chamber was supplemented with 500 μl medium containing 20% FBS and incubated for 24 h at 37° C. Cells on the upper surface of the membrane were removed using a cotton swab. Cells on the bottom surface of insert membrane were fixed with 4% of paraformaldehyde for 30 minutes at room temperature and subsequently stained with 0.1% crystal violet for 30 min at room temperature. Migration cells were photographed and counted in five random fields of view under a microscope. For invasion analysis, the transwell insert membrane is NOT coated with Matrigel. The procedure is identic with the migration analysis, the only difference is WITHOUT the presence of Matrigel. Each experiment was independently repeated for 3 times.

[0051] As shown in FIG. 3, the migration and invasion ability of sh-LINC01614-1 group and sh-LINC01614-2 group were significantly reduced compared with the sh-Control group (P<0.05).

Example 7: Knocking Down of LINC01614 Inhibited Epithelial-Mesenchymal Transition (EMT) of MDA-MB-231 and Hs578T Cells

[0052] MDA-MB-231 and Hs578T cells infected with sh-LINC01614-1, sh-LINC01614-2 or sh-Control lentivirus. Total protein of 2×10.sup.6 cells of each group were extracted using Total Protein Extraction kits (KeyGen Biotech, Nanjing, China) following the manufacturer's protocol. The protein concentration was determined by a BSA method. Equal amount of loading buffer was added and denatured at 100° C. for 10 min. 20 μg of denatured samples were loaded and separated by 12% SDS-PAGE and transferred onto a polyvinylidene difluoride (PVDF) membrane. After blocking with 5% of skimmed milk at room temperature for 1.5 h, the membrane was incubated with primary anti-rabbit E-cadherin (1: 1000, CST Company) and N-cadherin (1: 1000, CST Company) and rabbit anti-β-actin monoclonal antibody (1: 5000, Abeam Company) at 4° C. overnight, respectively. Wash the membrane in TBST for three times, 5 min each. Then, HRP-labeled goat anti-rabbit IgG (1: 5000, Abeam Company) was added and incubated at room temperature for 1 h. Proteins were visualized with an enhanced chemiluminescence reagent (Wanleibio Co., Ltd.) and a Chemiluminescence Detection System (Image Lab version 5.1; Bio-Rad Laboratories, Inc.). The β-ACTIN was served as control. Each experiment was independently repeated for 3 times.

[0053] The results of western blot indicated that after knocking down of LINC01614, the expression of the EMT-related protein, E-cadherin, was increased, and the expression of the N-cadherin was reduced. These suggested that the knocking down LINC01614 could inhibit the formation of tumor cell EMT (shown as FIG. 4).

Example 8: Knocking Down of LINC01614 Inhibited the Xenograft Tumor Sizes and Lung Metastasis of MDA-MB-231 Cells

[0054] For tumor xenograft mouse model, MDA-MB-231 cells transfected with sh-Control, sh-LINC01614-1, and sh-LINC01614-2 lentivirus. The BALB/c nude female mice were purchased from The Model Animal Research Center of Nanjing University (Nanjing, China). The mice were divided into three groups: sh-LINC01614-1 group, sh-LINC01614-2 group and sh-Control group. Subsequently, each 5-week-old mouse was subcutaneously injected with 1×10.sup.7 transfected MDA-MB-231 cells that suspended in 200 μl of PBS according to the group. The tumor sizes were monitored every 4 day. Body weight of mice also be monitored 20 days post injection. After 20 days, the nude mice were sacrificed by cervical dislocation. The long diameter (L) and the short diameter (W) of the tumor were measured. The tumor volume was calculated following the formula: (V=L×W2/2. Tumor tissue also been imaged.

[0055] For experimental lung metastasis, MDA-MB-231 cells were transinfected with sh-Control, sh-LINC01614-1, and sh-LINC01614-2 lentivirus. Transfected cells were injected into the 4- to 6-week-old BALB/c nude male mice through tail veins (5×10.sup.6 cells/mouse). After 4 weeks, the lung tissues were dissected and fixed in 10% formalin. Metastatic foci were counted and imaged.

[0056] As displayed in FIG. 5, the xenograft tumor sizes of the sh-LINC01614-1, and sh-LINC01614-2 group were significantly smaller than that of sh-Control group. As showed in FIG. 6, lung metastasis of the sh-LINC01614-1, and sh-LINC01614-2 group were reduced compared with that of sh-Control. The results indicated that downregulated of LINC01614 could significantly inhibit the MDA-MB-231 cell growth and lung metastasis in vivo.

[0057] The results of Examples 6-8 showed downregulated the expression of LINC01614 by transfection with sh-LINC01614-1, and sh-LINC01614-2 lentivirus in the present invention could be used as the medication for inhibiting metastasis and invasion of breast cancer.

[0058] The preferred examples of the present invention have been specifically described above. However, the present invention is not limited to these examples, and those skilled in the art can make various equivalents without departing from the spirit of the present invention.

[0059] Modifications or substitutions of these equivalent modifications or substitutions are all included within the scope defined by the claims of the present application.