Method of Producing Lipid Using Acyl-ACP Thioesterase

Abstract

[Problems] To provide a method of producing a lipid, containing enhancing productivity of medium chain fatty acids or the lipid containing these medium chain fatty acids as components.

[Means to solve] A method of producing a lipid, containing the steps of: culturing a transformant in which a gene encoding any one of the following proteins (A) to (C) is introduced into a host, and collecting a lipid from the cultured product: (A) a protein consisting of the amino acid sequence of the 611th to 772nd positions set forth in SEQ ID NO: 1; (B) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the 611th to 772nd positions set forth in SEQ ID NO: 1, and having acyl-ACP thioesterase activity; and (C) a protein containing the amino acid sequence of the protein (A) or (B), and having acyl-ACP thioesterase activity.

[Selected Drawing] None

Claims

1. A method of producing a lipid, comprising the steps of: culturing a transformant in which a gene encoding any one of the following proteins (A) to (C) is introduced into a host, and collecting a lipid from the cultured product: (A) a protein consisting of the amino acid sequence of the 611th to 772nd positions set forth in SEQ ID NO: 1; (B) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the 611th to 772nd positions set forth in SEQ ID NO: 1, and having acyl-ACP thioesterase activity; and (C) a protein containing the amino acid sequence of the protein (A) or (B), and having acyl-ACP thioesterase activity.

2. (canceled)

3. A method of modifying the composition of a lipid, comprising the steps of: introducing a gene encoding any one of the following proteins (A) to (C) into a host, and thereby obtaining a transformant, and enhancing productivity of medium chain fatty acids or a lipid containing the fatty acids as components produced in a cell of the transformant, to modify the composition of fatty acids or a lipid in all fatty acids or all lipids to be produced: (A) a protein consisting of the amino acid sequence of the 611th to 772nd positions set forth in SEQ ID NO: 1; (B) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the 611th to 772nd positions set forth in SEQ ID NO: 1, and having acyl-ACP thioesterase activity; and (C) a protein containing the amino acid sequence of the protein (A) or (B), and having acyl-ACP thioesterase activity.

4. The method according to claim 1, wherein the protein (C) is any one of the following proteins (C1) to (C20): (C1) a protein consisting of the amino acid sequence of the 1st to 772nd positions set forth in SEQ ID NO: 1; (C2) a protein consisting of the amino acid sequence of the 487th to 772nd positions set forth in SEQ ID NO: 1; (C3) a protein consisting of the amino acid sequence of the 488th to 772nd positions set forth in SEQ ID NO: 1; (C4) a protein consisting of the amino acid sequence of the 497th to 772nd positions set forth in SEQ ID NO: 1; (C5) a protein consisting of the amino acid sequence of the 507th to 772nd positions set forth in SEQ ID NO: 1; (C6) a protein consisting of the amino acid sequence of the 517th to 772nd positions set forth in SEQ ID NO: 1; (C7) a protein consisting of the amino acid sequence of the 527th to 772nd positions set forth in SEQ ID NO: 1; (C8) a protein consisting of the amino acid sequence of the 537th to 772nd positions set forth in SEQ ID NO: 1; (C9) a protein consisting of the amino acid sequence of the 547th to 772nd positions set forth in SEQ ID NO: 1; (C10) a protein consisting of the amino acid sequence of the 557th to 772nd positions set forth in SEQ ID NO: 1; (C11) a protein consisting of the amino acid sequence of the 567th to 772nd positions set forth in SEQ ID NO: 1; (C12) a protein consisting of the amino acid sequence of the 577th to 772nd positions set forth in SEQ ID NO: 1; (C13) a protein consisting of the amino acid sequence of the 587th to 772nd positions set forth in SEQ ID NO: 1; (C14) a protein consisting of the amino acid sequence of the 597th to 772nd positions set forth in SEQ ID NO: 1; (C15) a protein consisting of the amino acid sequence of the 607th to 772nd positions set forth in SEQ ID NO: 1; (C16) a protein consisting of the amino acid sequence of the 608th to 772nd positions set forth in SEQ ID NO: 1; (C17) a protein consisting of the amino acid sequence of the 609th to 772nd positions set forth in SEQ ID NO: 1; (C18) a protein consisting of the amino acid sequence of the 610th to 772nd positions set forth in SEQ ID NO: 1; (C19) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of any one of the proteins (C1) to (C18), and having acyl-ACP thioesterase activity; and (C20) a protein consisting of an amino acid sequence in which 1 or several amino acids are deleted, substituted, inserted or added to the amino acid sequence of any one of the proteins (C1) to (C18), and having acyl-ACP thioesterase activity.

5. The method according to claim 3, wherein the protein (C) is any one of the following proteins (C1) to C20): (C1) a protein consisting of the amino acid sequence of the 1st to 772nd positions set forth in SEQ ID NO: 1; (C2) a protein consisting of the amino acid sequence of the 487th to 772nd positions set forth in SEQ ID NO: 1; (C3) a protein consisting of the amino acid sequence of the 488th to 772nd positions set forth in SEQ ID NO: 1; (C4) a protein consisting of the amino acid sequence of the 497th to 772nd positions set forth in SEQ ID NO: 1; (C5) a protein consisting of the amino acid sequence of the 507th to 772nd positions set forth in SEQ ID NO: 1; (C6) a protein consisting of the amino acid sequence of the 517th to 772nd positions set forth in SEQ ID NO: 1; (C7) a protein consisting of the amino acid sequence of the 527th to 772nd positions set forth in SEQ ID NO: 1; (C8) a protein consisting of the amino acid sequence of the 537th to 772nd positions set forth in SEQ ID NO: 1; (C9) a protein consisting of the amino acid sequence of the 547th to 772nd positions set forth in SEQ ID NO: 1; (C10) a protein consisting of the amino acid sequence of the 557th to 772nd positions set forth in SEQ ID NO: 1; (C11) a protein consisting of the amino acid sequence of the 567th to 772nd positions set forth in SEQ ID NO: 1; (C12) a protein consisting of the amino acid sequence of the 577th to 772nd positions set forth in SEQ ID NO: 1; (C13) a protein consisting of the amino acid sequence of the 587th to 772nd positions set forth in SEQ ID NP: 1; (C14) a protein consisting of the amino acid sequence of the 597th to 772nd positions set forth in SEQ ID NO: 1; (C15) a protein consisting of the amino acid sequence of the 607th to 772nd positions set forth in SEQ ID NO: 1; (C16) a protein consisting of the amino acid sequence of the 608th to 772nd positions set forth in SEQ ID NO: 1; (C17) a protein consisting of the amino acid sequence of the 609th to 772nd positions set forth in SEQ ID NO: 1; (C18) a protein consisting of the amino acid sequence of the 610th to 772nd positions set forth in SEQ ID NO: 1; (C19) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of any one of the proteins (C1) to (C18) and having acyl-ACP thioesterase activity; and (C20) a protein consisting of an amino acid sequence in which 1 or several amino acids are deleted, substituted, inserted or added to the amino acid sequence of any one of the proteins (C1) to (C18) and having acyl-ACP thioesterase activity.

6. The method according to claim 1, wherein the host is Escherichia coli.

7. The method according to claim 3, wherein the host is Escherichia coli.

8. The method according to claim 1, wherein the host is a microalga.

9. The method according to claim 8, wherein the microalga is an alga belonging to the genus Nannochloropsis.

10. The method according to claim 1, wherein the lipid contains a fatty acid having 12 carbon atoms or a fatty acid ester compound thereof.

11. The method according to claim 3, wherein the host is a microalga.

12. The method protein according to claim 11, wherein the microalga is an alga belonging to the genus Nannochloropsis.

13. The method according to claim 3, wherein the lipid contains a fatty acid having 12 carbon atoms or a fatty acid ester compound thereof.

14.-15. (canceled)

16. A transformant, which is obtained by introducing a gene encoding any one of the following proteins (A) to (C) into a host: (A) a protein consisting of the amino acid sequence of the 611th to 772nd positions set forth in SEQ ID NO: 1; (B) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the 611th to 772nd positions set forth in SEQ ID NO: 1, and having acyl-ACP thioesterase activity; and (C) a protein containing the amino acid sequence of the protein (A) or (B), and having acyl-ACP thioesterase activity.

17. The transformant according to claim 16, wherein the protein (C) is any one of the following proteins (C1) to (C20): (C1) a protein consisting of the amino acid sequence of the 1st to 772nd positions set forth in SEQ ID NO: 1; (C2) a protein consisting of the amino acid sequence of the 487th to 772nd positions set forth in SEQ ID NO: 1; (C3) a protein consisting of the amino acid sequence of the 488th to 772nd positions set forth in SEQ ID NO: 1; (C4) a protein consisting of the amino acid sequence of the 497th to 772nd positions set forth in SEQ ID NO: 1; (C5) a protein consisting of the amino acid sequence of the 507th to 772nd positions set forth in SEQ ID NO: 1; (C6) a protein consisting of the amino acid sequence of the 517th to 772nd positions set forth in SEQ ID NO: 1; (C7) a protein consisting of the amino acid sequence of the 527th to 772nd positions set forth in SEQ ID NO: 1; (C8) a protein consisting of the amino acid sequence of the 537th to 772nd positions set forth in SEQ ID NO: 1; (C9) a protein consisting of the amino acid sequence of the 547th to 772nd positions set forth in SEQ ID NO: 1; (C10) a protein consisting of the amino acid sequence of the 557th to 772nd positions set forth in SEQ ID NO: 1; (C11) a protein consisting of the amino acid sequence of the 567th to 772nd positions set forth in SEQ ID NO: 1; (C12) a protein consisting of the amino acid sequence of the 577th to 772nd positions set forth in SEQ ID NO: 1; (C13) a protein consisting of the amino acid sequence of the 587th to 772nd positions set forth in SEQ ID NO: 1; (C14) a protein consisting of the amino acid sequence of the 597th to 772nd positions set forth in SEQ ID NO: 1; (C15) a protein consisting of the amino acid sequence of the 607th to 772nd positions set forth in SEQ ID NO: 1; (C16) a protein consisting of the amino acid sequence of the 608th to 772nd positions set forth in SEQ ID NO: 1; (C17) a protein consisting of the amino acid sequence of the 609th to 772nd positions set forth in SEQ ID NO: 1; (C18) protein consisting of the amino acid sequence of the 610th to 772nd positions set forth in SEQ ID NO: 1; (C19) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of any one of the proteins (C1) to (C18), and having acyl-ACP thioesterase activity; and (C20) a protein consisting of an amino acid sequence in which 1 or several amino acids are deleted, substituted, inserted or added to the amino acid sequence of any one of the proteins (C1) to (C18) and having acyl-ACP thioesterase activity.

18. The transformant according to claim 16, wherein the host is Escherichia coli.

19. The transformant according to claim 16, wherein the host is a microalga.

20. The transformant according to claim 19, wherein the microalga is an alga belonging to the genus Nannochloropsis.

Description

EXAMPLES

[0137] Hereinafter, the present invention will be described more in detail with reference to Examples, but the present invention is not limited thereto. Herein, the nucleotide sequences of the primers used in Examples are shown in Tables 1 and 2.

TABLE-US-00001 TABLE 1 Primer SEQ ID No. Nucleotide sequence (5′ .fwdarw. 3′) NO:  4 gcggccgctctagagccgctgtggtacttttgtcc SEQ ID  NO: 4  5 acaaaatattaacgcttattcttttttccgcggaa SEQ ID  NO: 5  6 ctctagagcggccgccaccg SEQ ID  NO: 6  7 gcgttaatattttgttaaaattcg SEQ ID  NO: 7  8 gcggccgctctagagcgtccgcaaggcactgcctc SEQ ID  NO: 8  9 gcggccgctctagagagcccaaccaaaatgcgcgg SEQ ID  NO: 9 10 gcggccgctctgtgtttgtttgccaagcaagcaac SEQ ID  NO: 10 11 gcggccgctctagagattggcggtgcagcattggc SEQ ID  NO: 11 12 gcggccgctctagaggttgcctgggcggaaggcta SEQ ID  NO: 12 13 gcggccgctctagagcactcagtggcaggcgaatg SEQ ID  NO: 13 14 gcggccgctctagagcgtccccactatgaggttct SEQ ID  NO: 14 15 gcggccgctctagagtgtttcacggccatttgcct SEQ ID  NO: 15 16 gcggccgctctagagctgtatctctatgtcccgaa SEQ ID  NO: 16 17 gcggccgctctagagccgaaaatcggcaccatcat SEQ ID  NO: 17 18 gcggccgctctagagttctttccgcccaccctgaa SEQ ID  NO: 18 19 gcggccgctctagagtgggaggaggaaattgcgtc SEQ ID  NO: 19 20 gcggccgctctagaggaggaggaaattgcgtctcg SEQ ID  NO: 20 21 gcggccgctctagaggaggaaattgcgtctcgtcc SEQ ID  NO: 21 22 gcggccgctctagaggaaattgcgtctcgtcctgg SEQ ID  NO: 22 23 gcggccgctctagagattgcgtctcgtcctggactg SEQ ID  NO: 23

TABLE-US-00002 TABLE 2 Pri- mer SEQ ID No. Nucleotide sequence (5′ .fwdarw. 3′) NO: 26 cttttttgtgaagcaatggccaagttgaccagtgccg SEQ ID  NO: 26 27 tttcccccatcccgattagtcctgctcctcggccac SEQ ID  NO: 27 28 cgagctcggtacccgactgcgcatggattgaccga SEQ ID  NO: 28 29 tgcttcacaaaaaagacagcttcttgat SEQ ID  NO: 29 30 tcgggatgggggaaaaaaacctctg SEQ ID  NO: 30 31 actctagaggatcccctttcgtaaataaatcagctc SEQ ID  NO: 31 33 gggatcctatagagtcgacc SEQ ID  NO: 33 34 cgggtaccgagctcgaattc SEQ ID  NO: 34 35 cgcggtgttgcgcgcccgctgtggtacttttgtcc SEQ ID  NO: 35 36 cgcggtgttgcgcgcattggcggtgcagcattggc SEQ ID  NO: 36 37 cgcggtgttgcgcgcccgaaaatcggcaccatcat SEQ ID  NO: 37 38 cgcggtgttgcgcgcttctttccgcccaccctgaa SEQ ID  NO: 38 39 cgcggtgttgcgcgctgggaggaggaaattgcgtc SEQ ID  NO: 39 40 ctcttccacagaagcttattcttttttccgcggaa SEQ ID  NO: 40 41 cgagctcggtacccgttcttccgcttgttgctgcc SEQ ID  NO: 41 42 tgttgatgcgggctgagattggtgg SEQ ID  NO: 42 43 cagcccgcatcaacaatgaagaccgccgctctcctc SEQ ID  NO: 43 44 gcgcgcaacaccgcgggtgcgggagaac SEQ ID  NO: 44 45 gcttctgtggaagagccagtg SEQ ID  NO: 45 46 ggcaagaaaagctgggggaaaagacagg SEQ ID  NO: 46 50 ccagcttttcttgccactgcgcatggattgaccga SEQ ID  NO: 50

Examples 1

Preparation of Acyl-ACP Thioesterase Gene, Transformation of Escherichia coli, and Producing Lipid by Transformant

[0138] (1) Preparation of Acyl-ACP Thioesterase Gene Derived From Guillardia theta

[0139] The amino acid sequence of the protein having unknown functions derived from Guillardia theta, which is registered with the protein database of National Center for Biotechnology information (NCBI) as Accession No. XP_005824882 (SEQ ID NO: 1), and the gene sequence encoding the same (SEQ ID NO: 2) were obtained. Hereinafter, this protein is also referred to as “GtTE”, and a gene encoding the protein is also referred to as “GtTE gene”.

[0140] Subsequently, the nucleotide sequence set forth in SEQ ID NO: 3 was obtained as a nucleotide sequence subjected to codon optimization to the nucleotide sequence of the 1,459th to 2,319th positions set forth in SEQ ID NO: 2 (corresponding to the 487th to 772nd positions set forth in SEQ ID NO: 1) along with the using frequency of the codon of Escherichia coli. A gene consisting of a nucleotide sequence set forth in SEQ ID NO: 3 was obtained utilizing a custom artificial gene synthesis service provided by Operon Biotechnologies Inc.

(2) Construction of Plasmid for GtTE Gene Expression

[0141] Using an artificially synthesized gene consisting of the nucleotide sequence set forth in SEQ ID NO: 3 as a template, and a pair of the primer Nos. 4 and 5 shown in Table 1, a GtTE gene consisting of the nucleotide sequence set forth in SEQ ID NO: 3 was prepared by PCR.

[0142] Moreover, using a plasmid vector pBluescriptII SK(−) (manufactured by Stratagene) as a template, and a pair of the primer Nos. 6 and 7 shown in Table 1, the pBluescriptII SK(−) was amplified by PCR. Then, the resultant template was subjected to digestion by restriction enzyme Dpnl (manufactured by TOYOBO) treatment.

[0143] A plasmid for GtTE gene expression GtTE_487 was constructed by purifying these two fragments using High Pure PCR Product Purification Kit (manufactured by Roche Applied Science Corporation), and then fusing the resultant material by using In-Fusion HD Cloning Kit (manufactured by Clontech, Inc.) to perform transformation into Escherichia coli DH5α strain Competent Cells (manufactured by Takara Bio), plasmid extraction, and confirmation of a nucleotide sequence of a cloning fragment according to an ordinary method.

[0144] In a similar manner, a plurality of plasmids for GtTE gene expression, in which an N-terminal region of the amino acid sequence set forth in SEQ ID NO: 1 was deleted at various lengths, were constructed.

[0145] PCR was carried out by using the plasmid GtTE_487 as a template, and a pair of any one of the primer Nos. 8 to 23 and the primer No. 6 shown in Table 1, and obtained gene fragments were purified and fused in a manner similar to the method described above, to construct plasmids for GtTE gene expression GtTE_497, GtTE_507, GtTE_517, GtTE_527, GtTE_537, GtTE_547, GtTE_557, GtTE_567, GtTE_577, GtTE_587, GtTE_597, GtTE_607, GtTE_608, GtTE_609, GtTE_610 and GtTE_611, respectively.

[0146] Herein, the plasmid GtTE_487 was constructed in the form of removing an amino acid sequence of the 1 st to 486th positions on an N-terminal side of an amino acid sequence set forth in SEQ ID NQ: 1, and had a nucleotide sequence of the 1st to 861st positions set forth in SEQ ID NO: 3 corresponding to a nucleotide sequence encoding the amino acid sequence of the 487th to 772nd positions set forth in SEQ ID NO: 1 and the termination codon as a GtTE gene. In a similar manner, the plasmid GtTE_497, the plasmid GtTE_507, the plasmid GtTE_517, the plasmid GtTE_527, the plasmid GtTE_537, the plasmid GtTE_547, the plasmid GtTE_557, the plasmid GtTE_567, the plasmid GtTE_577, the plasmid GtTE_587, the plasmid GtTE_597, the plasmid GtTE_607, the plasmid GtTE_608, the plasmid GtTE_609, the plasmid GtTE_610, and the plasmid GtTE_611, were constructed in the form of removing an amino acid sequence of the 1st to 498th positions, the 1st to 506th positions, the 1st to 516th positions, the 1st to 526th positions, the 1st to 536th positions, the 1st to 546th positions, the 1st to 556th positions, the 1st to 566th positions, the 1st to 576th positions, the 1st to 586th positions, the 1st to 596th positions, the 1st to 606th positions, the 1st to 607th positions, the 1st to 608th positions, the 1st to 609th positions, or the 1st to 610th positions, on an N-terminal side of an amino acid sequence set forth in SEQ ID NO: 1, respectively. Further, these plasmids were constructed in the form of expressing a protein fusing an amino acid sequence of the 1st to 29th positions on an N-terminal side of a LacZ protein derived from the plasmid vector pBluescriptII SK(−), to the upstream of the removed sites on an N-terminal side of the amino acid sequence set forth in SEQ ID NO: 1.

(3) Introduction of Plasmid for GtTE Gene Expression into Escherichia Coli

[0147] An Escherichia coli mutant strain, strain K27 (fadD88) (Overath et al, Eur. J. Biochem., vol 7, 559-574, 1989), was transformed by a competent cell transformation method, using the various plasmids for GtTE gene expression. The transformed strain K27 was inoculated in LB agar medium containing 50 μg/mL of Ampicillin sodium (Bacto Trypton 1%, Yeast Extract 0.5%, NaCl 1%, and Agar 1.5%), and was stand overnight at 30° C. The colony thus obtained was inoculated to 2 mL of Overnight Express Instant TB medium (Novagen) and was subjected to shaking culture at 30° C. After 24 hours cultivation, lipid components contained in the culture fluid were analyzed by the method described below. In addition, as a negative control, the Escherichia coli strain K27 transformed with the plasmid vector pBluescriptII SK(−) was also subjected to the same experiment.

(4) Extraction of Lipid from Culture Fluid and Analysis of Fatty Acids Contained Therein

[0148] To 1 mL of the culture fluid, 50 μL of 1 mg/mL 7-pentadecanone (methanol solution) as an internal standard was added, and then 0.5 mL of chloroform, 1 mL of methanol and 10 μL of 2N hydrochloric acid were further added to the cultured fluid. The mixture was vigorously stirred and then was left for 10 minutes or more. Further, 0.5 mL of chloroform and 0.5 mL of 1.5% KCl were added thereto. The mixture was stirred and centrifuged for 5 minutes at 3,000 rpm, and then the chloroform layer (lower layer) was collected with pasteur pipette.

[0149] A nitrogen gas was blown onto the resultant chloroform layer to be dried into solid, 0.7 mL of 0.5 N potassium hydroxide/methanol solution was added thereto, and the resultant mixture was kept warm at 80° C. for 30 minutes. Then, 1 mL of 14% methanol solution of boron trifluoride (manufactured by Sigma-Aldrich) was added to the sample, and the mixture was kept warm at 80° C. for 10 minutes. Thereafter, 1 mL of hexane and 1 mL of saturated saline were added thereto, and the mixture was vigorously stirred and then was left for 10 minutes or more at room temperature. Then, the hexane layer (upper layer) was collected to obtain fatty acid methyl esters.

[0150] Under the measuring conditions as follows, the obtained fatty acid methyl esters were provided for gas chromatographic analysis.

<Gas Chromatography Conditions>

[0151] Capillary column: DB-1 MS (30 m×200 μm×0.25 μm, manufactured by J&W Scientific)
Mobile phase: high purity helium
Flow rate inside the column: 1.0 mL/min
Temperature rise program: 100° C. (for 1 min.).fwdarw.10° C./min.fwdarw.300° C. (for 5 min.)
Equilibration time: for 1 min.
Injection port: split infection (split ratio: 100:1)
Pressure: 14.49 psi, 104 mL/min

Amount of Injection: 1 μL

[0152] Cleaning vial: methanol/chloroform
Detector temperature: 300° C.

[0153] Further, the fatty acid methyl esters were identified by providing the identical sample for a gas chromatography-mass spectrometry analysis under identical conditions described above.

[0154] Amounts of the fatty acid methyl esters were quantitatively determined based on the peak areas of waveform data obtained by the above gas chromatographic analysis. The peak area corresponding to each of the fatty acid methyl esters was compared with that of 7-pentadecanone as the internal standard, and carried out corrections between the samples, and then the amount of each of the fatty acids per liter of the culture fluid was calculated. Further, the total amount of the fatty acids was calculated by summing the amounts of each of the fatty acids thus obtained, and ratio of amounts of each of the fatty acids in the total amount of the fatty acids was calculated.

[0155] The results are shown in Table 3. Herein, in Table below, “TFA” presents a total amount of fatty acids, and “Fatty Acid Composition (% TFA)” presents a ratio of a weight of each fatty acid relative to a weight of the total fatty acid (weight percent). Moreover, description of “Cx:y” represents a fatty acid having “x” as the number of carbon atoms, and “y” as the number of double bonds, and the expressions “C17:0Δ” and “C19:0Δ” designate cis-9,10-Methylen-hexadecanoic acid and cis-t11,12-Methylen-octadecanoic acid, respectively.

TABLE-US-00003 TABLE 3 Introduced TFA Fatty acid composition (% TFA) plasmid (mg/L) C10:0 C12:1 C12:0 C14:1 C14:0 C16:1 C16:0 C17:0Δ C18.1 C19:0Δ pBS 171.0 0.0 0.0 0.0 0.0 5.1 1.7 48.6 28.2 3.4 12.9 GtTE_487 310.6 2.0 1.5 6.0 2.3 15.1 3.6 36.0 20.0 3.3 10.1 GtTE_497 308.9 2.0 1.5 6.0 2.4 13.7 4.0 35.4 20.4 4.1 10.5 GtTE_507 298.7 2.3 1.6 6.2 2.5 13.2 4.0 35.0 20.3 3.9 11.1 GtTE_517 321.5 2.7 2.0 6.9 3.0 14.6 4.9 32.9 18.6 4.4 9.9 GtTE_527 274.1 1.9 1.5 5.1 2.4 12.3 5.8 35.6 19.4 6.5 9.5 GtTE_537 253.2 0.0 1.7 4.9 2.6 10.3 8.7 36.3 17.8 10.5 7.2 GtTE_547 307.2 2.2 1.5 6.0 2.4 13.7 4.2 35.1 20.0 4.5 10.3 GtTE_557 249.7 0.0 0.7 3.8 1.5 11.4 2.9 40.6 23.8 3.6 11.6 GtTE_567 287.4 0.0 1.9 6.9 2.8 16.6 4.7 35.0 18.7 4.1 9.2 GtTE_577 301.7 2.3 1.6 6.0 2.5 15.0 4.1 35.4 18.8 4.4 9.9 GtTE_587 460.9 4.0 4.5 8.9 5.7 17.7 11.1 25.0 10.8 8.9 3.3 GtTE_597 694.5 4.7 7.8 10.3 8.9 19.2 17.5 17.4 5.9 7.5 0.8 GtTE_607 672.0 4.5 7.2 10.3 8.4 19.5 16.0 18.5 6.5 7.4 1.7 GtTE_608 305.1 4.1 3.5 8.7 4.2 17.0 6.9 29.0 14.8 5.1 6.7 GtTE_609 419.4 4.4 4.7 10.5 5.5 18.3 9.2 25.0 10.6 7.0 4.7 GtTE_610 262.4 2.6 2.3 5.7 3.1 12.1 9.0 33.6 15.7 10.1 5.8 GtTE_611 212.2 0.0 1.1 4.4 1.9 9.8 3.9 39.4 24.1 5.6 9.8

[0156] As shown in Table 3, in the strain having the introduced any one of the various plasmids for GtTE gene expression, a ratio of each of the C12:1, C12:0, C14:1, C14:0, and C16:1 fatty adds in the total fatty add significantly increased in comparison with the strain having the introduced the negative control plasmid vector pBluescriptII SK(−) (“pBS” in Table). In particular, a ratio of C14 fatty acids (C14:1 and C14:0 fatty acids) extremely increased. Further, in the strain having the introduced these plasmids for GtTE gene expression, the total amount of fatty acids (TFA) also increased. In particular, in the strain having the introduced the plasmid GtTE_587, GtTE_597, GtTE_607, GtTE_608 or GtTE_609, increase of C12:1, C12:0, C14:1, C14:0 and C16:1 fatty acids, and increase of the total amount of fatty acids were significant.

[0157] From these results, it was confirmed that the proteins encoding the gene introduced into the various plasmids for GtTE gene expression had acyl-ACP thioesterase activity. Moreover, these proteins extremely increased a ratio and productivity of the C12 and C14 fatty acids. Therefore, it was considered that these proteins are acyl-ACP thioesterases having high specificity to the C12 and C14 fatty acids, particularly C14 fatty acids.

[0158] From the results described above, it is recognized that the protein having the region of at least 611th to 772nd positions in the amino acid sequence set forth in SEQ ID NO: 1 designates acyl-ACP thioesterase activity.

Examples 2

Transformation of Nannochloropsis oculata by GtTE Gene, and Producing Lipid by Transformant

(1) Construction of Plasmid for Zeocin Resistance Gene Expression

[0159] A zeocin resistance gene (SEQ ID NO: 24), and a tubulin promoter sequence (SEQ ID NO: 25) derived from Nannochloropsis gaditana strain CCMP 526 described in a literature (Randor Radakovits, et al., Nature Communications, DOI: 10.038/ncomms1688, 2012) were artificially synthesized. Using the thus-synthesized DNA fragments as a template, and a pair of the primer Nos. 26 and 27, and a pair of the primer Nos. 28 and 29 shown in Table 2, PCR was carried out, to amplify the zeocin resistance gene and the tubulin promoter sequence, respectively.

[0160] Further, using a genome of Nannochloropsis oculata strain NIES2145 as a template, and a pair of the primer Nos. 30 and 31 shown in Table 2, PCR was carried out to amplify the heat shock protein terminator sequence (SEQ ID NO: 32).

[0161] Furthermore, using a plasmid vector pUC19 (manufactured by Takara Bio) as a template, and a pair of the primer Nos. 33 and 34 shown in Table 2, PCR was carried out to amplify the plasmid vector pUC19.

[0162] These four amplified fragments were treated by restriction enzyme Dpnl (manufactured by TOYOBO) respectively, and were purified using a High Pure PCR Product Purification Kit (manufactured by Roche Applied Science). Then, obtained four fragments were fused using an in-Fusion HD Cloning Kit (manufactured by Clontech) to construct a plasmid for zeocin resistance gene expression.

[0163] Herein, the plasmid consisted of the pUC19 vector sequence and an insert sequence in which the tubulin promoter sequence, the zeocin resistance gene and the heat shock protein terminator sequence were linked in this order.

(2) Construction of Plasmid for GtTE Gene Expression

[0164] Using the GtTE gene artificially synthesized in Example 1 as a template, and a pair of any one of the primer Nos. 35 to 39 and the primer No. 40 shown in Table 2, PCR was carried out to prepare GtTE gene fragments, in which 5′ side of the nucleotide sequence set forth in SEQ ID NO: 3 was deleted at various lengths.

[0165] Further, using a genome of Nannochloropsis oculata strain NIES2145 as a template, and a pair of the primer Nos. 41 and 42, a pair of the primer Nos. 43 and 44, and a pair of the primer Nos. 45 and 46 shown in Table 2, respectively, PCR was carried out to prepare the LDSP promoter sequence (SEQ ID NO: 47), the VCP1 chloroplast transit signal sequence (SEQ ID NO: 48), and the VCP1 terminator sequence (SEQ ID NO: 49).

[0166] Furthermore, using the above-described plasmid for zeocin resistance gene expression as a template, and a pair of the primer Nos. 50 and 34 shown in Table 2, PCR was carried out to amplify a fragment containing the cassette for zeocin resistance gene expression (the tubulin promoter sequence, the zeocin resistance gene, and the heat shock protein terminator sequence) and the pUC19 sequence.

[0167] Respective GtTE gene fragments, in which 5′ side of the nucleotide sequence set forth in SEQ ID NO: 3 was deleted at various lengths, the amplified fragments of the LDSP promoter, the VCP1 chloroplast transit signal and the VCP1 terminator, and the amplified fragments containing the cassette for zeocin resistance gene expression and the pUC19 sequence were fused by a method in a manner similar to described above, to construct plasmids for GtTE gene expression GtTE_488-Nanno, GtTE_527-Nanno, GtTE_587-Nanno, GtTE_597-Nanno and GtTE_607-Nanno, respectively.

[0168] Herein, these plasmids consisted of the pUC19 vector sequence and an insert sequence in which the LDSP promoter sequence, the GtTE gene in which the VCP1 chloroplast transit signal was linked to the 5′-terminal side of the nucleotide sequence encoding an amino acid sequence of the 488th to 772nd positions, the 527th to 772nd positions, the 587th to 772nd positions, the 597th to 772nd positions, or the 607th to 772nd positions set forth in SEQ ID NO: 1, the VCP1 terminator sequence, the tubulin promoter sequence, the zeocin resistance gene and the heat shock protein terminator sequence were linked in this order.

(3) Introduction of Cassette for GtTE Gene Expression into Nannochloropsis Oculata

[0169] Using the above-described plasmids for GtTE gene expression (GtTE_488-Nanno, GtTE_527-Nanno, GtTE_587Nanno, GtTE_597-Nanno and GtTE_607-Nanno) as a template, respectively, and a pair of the primer Nos. 41 and 31 shown in Table 2, PCR was carried out to amplify cassettes for GtTE gene expression (a DNA fragment containing the LDSP promoter sequence, the VCP1 chloroplast transit signal, the GtTE gene in the form of removing the nucleotide sequence encoding an amino acid sequence of the 1st to 487th positions, the 1st to 526th positions, the 1st to 586th positions, the 1st to 596th positions, or the 1st to 606th positions on an N-terminal side of an amino acid sequence set forth in SEQ ID NO: 1, the VCP1 terminator sequence, the tubulin promoter sequence, the zeocin resistance gene, and the heat shock protein terminator sequence), respectively.

[0170] The amplified fragments were purified using High Pure PCR Product Purification Kit (manufactured by Roche Applied Science), respectively. Herein, sterilized water was used for elution upon purification without using an elution buffer included in the kit.

[0171] About 1×10.sup.9 cells of Nannochloropsis oculata strain NIES2145 were washed with 384 mM sorbitol solution to completely remove a salt, and the resultant was used as a host cell of transformation. The cassette for GtTE gene expression as amplified above was mixed by about 500 ng for each with the host cell, and electroporation was carried out under conditions of 50 μF, 500Ω and 2,200 v/2 mm.

[0172] After 24 hours recovery cultivation in f/2 liquid medium (75 mg of NaNO.sub.3, 6 mg of NaH.sub.2PO.sub.4.2H.sub.2O, 0.5 μg of vitamin B12, 0.5 μg of biotin, 100 μg of thiamine, 10 mg of Na.sub.2SiO.sub.3.9H.sub.2O, 4.4 mg of Na.sub.2EDTA.2H.sub.2O, 3.16 mg of FeCl.sub.3.6H.sub.2O, 12 μg of FeCl.sub.3.6H.sub.2O, 21 μg of ZnSO.sub.4.7H.sub.2O, 180 μg of MnCl.sub.2.4H.sub.2O, 7 μg of CuSO.sub.4.5H.sub.2O, 7 μg of Na.sub.2MoO.sub.4.2H.sub.2O/artificial sea water 1 L), the resultant material was inoculated in f/2 agar medium containing 2 μg/mL of zeocin, sod cultured for two to three weeks under 12 h/12 h light-dark conditions at 25° C. under an atmosphere of 0.3% CO.sub.2. A transformant containing the cassette for GtTE gene expression was selected from the resultant colonies by a PCR method.

(4) Extraction of Lipid from Culture Fluid and Analysis of Fatty Aids Contained Therein

[0173] The selected strain was inoculated to 20 mL of medium in which a nitrogen concentration in the f/2 medium was reinforced 15 times, and a phosphorus concentration therein was reinforced 5 times (hereinafter, referred to as “N15P5 medium”), and subjected to shaking culture for four weeks under the 12 h/12 h light-dark conditions at 25° C. under the atmosphere of 0.3% CO.sub.2, to prepare preculture fluid. Then, 2 mL of the preculture fluid was inoculated to 18 mL of the N15P5 medium, and subjected to shaking culture for three weeks under the 12 h/12 h light-dark conditions at 25° C. under the atmosphere of 0.3% CO.sub.2.

[0174] in addition, as a negative control, an experiment was also conducted on the wild type strain, Nannochloropsis oculata strain NIES2145.

[0175] To 1 mL of the culture fluid, 50 μL of 1 mg/mL 7-pentadecanone (methanol solution) as an internal standard was added, and then 0.5 mL of chloroform and 1 mL of methanol were further added. The mixture was vigorously stirred and then was left for 10 minutes. Further, 0.5 mL of chloroform and 0.5 mL of 1.5% KCl were added thereto. The mixture was stirred and centrifuged for 5 minutes at 3,000 rpm, and then the chloroform layer (lower layer) was collected with pasteur pipette.

[0176] A nitrogen gas was blown onto the resultant chloroform layer to be dried into solid, 0.7 mL of 0.5 N potassium hydroxide/methanol solution was added thereto, and the resultant mixture was kept warm at 80° C. for 30 minutes. Then, 1 mL of 14% methanol solution of boron trifluoride (manufactured by Sigma-Aldrich) was added to the sample, and the mixture was kept warm at 80° C. for 10 minutes. Thereafter 0.5 mL of hexane and 1 mL of saturated saline were added thereto, and the mixture was vigorously stirred and then was left for 10 minutes at room temperature. Then, the hexane layer (upper layer) was collected to obtain fatty acid methyl esters.

[0177] Under the measuring conditions as follows, the obtained fatty acid methyl esters were provided for gas chromatographic analysis.

<Gas Chromatography Conditions>

[0178] Analysis apparatus: 7890A (manufactured by Agilent Technologies)
Capillary column: DB-WAX (10 m×100 μm×0.10 μm, manufactured by J&W Scientific)
Mobile phase: high purity helium
Oven temperature: maintained for 0.5 min. at 100° C..fwdarw.100° C. to 250° C. (temperature increase at 20° C./min).fwdarw.maintained for 3 min. at 250° C. (post run: 1 min.)
Injection port, temperature: 300° C.
Injection method: split injection (split ratio: 50:1)
Amount of injection: 5 μL
Cleaning vial: methanol
Detection method: FID
Detector temperature: 350° C.

[0179] The fatty acid methyl esters were identified and quantitatively determined according to a method similar to Example 1. Table 4 shows the results.

TABLE-US-00004 TABLE 4 Contents of C8 to C14 Fatty acid composition (% TFA) fatty Introduced C8: C10: C12: C14: C16: C16: C18: C18: C18: C18: C20: C20: C20: C20: acid DNA 0 0 0 0 0 1 0 1 2 3 0 3 4 5 (mg/L) WT 0.0 58.9 0.2 4.0 34.1 30.4 1.4 16.1 1.5 0.5 0.1 0.2 2.1 9.4 58.9 GtTE_488-Nanno 0.0 79.5 1.6 5.0 25.2 36.2 1.3 11.7 1.6 0.5 0.2 0.3 2.6 13.3 79.6 GtTE_527-Nanno 0.0 85.0 0.8 4.7 30.6 34.3 1.2 12.7 1.6 0.4 0.2 0.2 2.3 10.7 85.0 GtTE_587-Nanno 0.2 199.2 4.2 6.4 20.0 37.2 0.9 10.9 1.5 0.7 0.2 0.3 3.4 11.8 199.2 GtTE_597-Nanno 0.3 165.7 3.9 5.8 16.3 37.0 0.7 10.8 1.6 0.6 0.1 0.4 3.5 15.9 165.7

[0180] As shown in Table 4, in any of the Nannochloropsis transformants having the introduced cassette for GtTE gene expression (“GtTE_488-Nanno”, “GtTE_527-Nanno”, “GtTE_587-Nanno”, “GtTE_597-Nanno” and “GtTE_607-Nanno”, in Table 4), a ratio of each of the C10:0, C12:0 and C14:0 fatty acids increased in comparison with the wild type strain (“WT” in Table 4). Further, in two kinds of transformants among these (GtTE_587-Nanno and GtTE_597-Nanno), C8:0 fatty acid, which was not detected at all in the wild type strain, was detected. Furthermore, in all of the transformants, productivity of medium chain fatty acids (C8 to C14 fatty acids) increased in comparison with the wild type strain.

[0181] As described above, the transformant in which productivity of the medium chain fatty acids and the productivity of the total fatty acids to be produced are improved can be prepared by promoting the expression of the acyl-ACP thioesterase gene as specified in the present invention. Further, productivity of the medium chain fatty acids can be improved by culturing this transformant.

[0182] Having described our invention as related to the present embodiments. It is our intention that the invention not be limited by any of the details of the description, unless otherwise specified, but rather be construed broadly within its spirit and scope as set out in the accompanying claims.

[0183] This application claims priority on Patent Application No. 2014-246573 filed in Japan on Dec. 5, 2014, which is entirely herein incorporated by reference.