DIFFERENTIAL KNOCKOUT OF AN ALLELE OF A HETEROZYGOUS BESTROPHIN 1 GENE
20230174974 · 2023-06-08
Assignee
Inventors
- Lior Izhar (Tel Aviv, IL)
- David Baram (Nir Zvi, IL)
- Joe Georgeson (Rehevot, IL)
- Michal Golan-Mashiach (Ness-Ziona, IL)
- Asael Herman (Ness-Ziona, IL)
- Rafi Emmanuel (Ramla, IL)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
International classification
C12N15/11
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
Abstract
RNA molecules comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and compositions, methods, and uses thereof.
Claims
1-40. (canceled)
41. A method for inactivating a mutant Bestrophin 1 (BEST1) allele in a cell, the method comprising delivering to the cell a composition comprising a) an RNA molecule which comprises a guide sequence portion having 17-24 nucleotides and targets a rs1800009 single nucleotide polymorphism (SNP) position in the mutant BEST1 allele; and b) a CRISPR nuclease, wherein the RNA molecule and the CRIPSR nuclease form a complex that creates a DNA break in the mutant BEST1 allele.
42. The method of claim 41, wherein the RNA molecule further comprises a portion having a sequence which binds to a CRISPR nuclease.
43. The method of claim 41, wherein the RNA molecule further comprises one or more linker portions.
44. The method of claim 41, wherein the RNA molecule is up to 300 nucleotides in length.
45. The method of claim 41, wherein the composition further comprises a tracrRNA molecule.
46. The method of claim 41, wherein the composition further comprises a second RNA molecule comprising a guide sequence portion.
47. The method of claim 46, wherein the guide sequence portion of the second RNA molecule comprises 17-24 nucleotides and comprises 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010.
48. The method of claim 46, wherein the 17-24 nucleotides of the guide sequence portion of the second RNA molecule are in a different sequence from the sequence of the guide sequence portion of the first RNA molecule.
49. The method of claim 46, wherein the second RNA molecule targets a sequence present in both a mutated allele and a functional allele.
50. The method of claim 46, wherein the second RNA molecule targets an intron.
51. The method of claim 41, further comprising subjecting the mutant allele to insertion or deletion by an error prone non-homologous end joining (NHEJ) mechanism, generating a frameshift in the mutated allele’s sequence.
52. The method of claim 51, wherein the frameshift creates an early stop codon in the mutated allele.
53. The method of claim 51, wherein the frameshift results in nonsense-mediated mRNA decay of a transcript of the mutant allele.
54. The method of claim 41, wherein the inactivating results in a truncated protein encoded by the mutated allele and a functional protein encoded by the functional allele.
55. The method of claim 41, wherein the guide sequence portion of the RNA molecule comprises 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1, 2, 102-109, 715, 716, and 960-991.
56. The method of claim 41, wherein the guide sequence portion of the RNA molecule comprises 17-20 contiguous nucleotides set forth in SEQ ID NO: 108 or SEQ ID NO: 109.
57. The method of claim 41, wherein the cell comprises a mutant BEST1 allele and a functional BEST1 allele.
58. The method of claim 57, wherein the sequence of the rs1800009 SNP position in the mutant BEST1 allele differs from the sequence of the rs1800009 SNP position in the functional BEST1 allele.
59. The method of claim 41, wherein the CRISPR nuclease utilizes a NGG protospacer adjacent motif (PAM).
60. The method of claim 41, wherein the CRISPR nuclease is a Streptococcus pyogenes Cas9 nuclease or a Staphylococcus aureus Cas9 nuclease.
Description
DETAILED DESCRIPTION
Definitions
[0020] Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.
[0021] It should be understood that the terms “a” and “an” as used above and elsewhere herein refer to “one or more” of the enumerated components. It will be clear to one of ordinary skill in the art that the use of the singular includes the plural unless specifically stated otherwise. Therefore, the terms “a,” “an” and “at least one” are used interchangeably in this application.
[0022] For purposes of better understanding the present teachings and in no way limiting the scope of the teachings, unless otherwise indicated, all numbers expressing quantities, percentages or proportions, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term “about.” Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
[0023] Unless otherwise stated, adjectives such as “substantially” and “about” modifying a condition or relationship characteristic of a feature or features of an embodiment of the invention, are understood to mean that the condition or characteristic is defined to within tolerances that are acceptable for operation of the embodiment for an application for which it is intended. Unless otherwise indicated, the word “or” in the specification and claims is considered to be the inclusive “or” rather than the exclusive or, and indicates at least one of, or any combination of items it conjoins.
[0024] In the description and claims of the present application, each of the verbs, “comprise,” “include” and “have” and conjugates thereof, are used to indicate that the object or objects of the verb are not necessarily a complete listing of components, elements or parts of the subject or subjects of the verb. Other terms as used herein are meant to be defined by their well-known meanings in the art.
[0025] The “guide sequence portion” of an RNA molecule refers to a nucleotide sequence that is capable of hybridizing to a specific target DNA sequence, e.g., the guide sequence portion has a nucleotide sequence which is fully complementary to said target DNA sequence. In some embodiments, the guide sequence portion is 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length, or approximately 17-24, 18-22, 19-22, 18-20, or 17-20 nucleotides in length. The guide sequence portion may be part of an RNA molecule that can form a complex with a CRISPR nuclease with the guide sequence portion serving as the DNA targeting portion of the CRISPR complex. When the DNA molecule having the guide sequence portion is present contemporaneously with the CRISPR molecule the RNA molecule is capable of targeting the CRISPR nuclease to the specific target DNA sequence. Each possibility represents a separate embodiment. An RNA molecule can be custom designed to target any desired sequence.
[0026] In embodiments of the present invention, an RNA molecule comprises a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010, 1-714, or 715-3010.
[0027] As used herein, “contiguous nucleotides” set forth in a SEQ ID NO refers to nucleotides in a sequence of nucleotides in the order set forth in the SEQ ID NO without any intervening nucleotides.
[0028] In embodiments of the present invention, the guide sequence portion may be 20 nucleotides in length and consists of 20 nucleotides in the sequence of 20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010. In embodiments of the present invention, the guide sequence portion may be less than 20 nucleotides in length. For example, in embodiments of the present invention the guide sequence portion may be 17, 18, or 19 nucleotides in length. In such embodiments the guide sequence portion may consist of 17, 18, or 19 nucleotides, respectively, in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010. For example, a guide sequence portion having 17 nucleotides in the sequence of 17 contiguous nucleotides set forth in SEQ ID NO: 1 may consist of any one of the following nucleotide sequences (nucleotides excluded from the contiguous sequence are marked in strike-through): AUCCGUCAGGUUAAACUCCA (SEQ ID NO: 1) [0029] 17 nucleotide guide sequence 1: CGUCAGGUUAAACUCCA (SEQ ID NO: 3011) [0030] 17 nucleotide guide sequence 2: CCGUCAGGUUAAACUCC (SEQ ID NO: 3012) [0031] 17 nucleotide guide sequence 3: UCCGUCAGGUUAAACUC (SEQ ID NO: 3013) [0032] 17 nucleotide guide sequence 4: AUCCGUCAGGUUAAACU (SEQ ID NO: 3014)
[0033] In embodiments of the present invention, the guide sequence portion may be greater than 20 nucleotides in length. For example, in embodiments of the present invention the guide sequence portion may be 21, 22, 23, or 24 nucleotides in length. In such embodiments the guide sequence portion comprises 20 nucleotides in the sequence of 20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and additional nucleotides fully complimentary to a nucleotide or sequence of nucleotides adjacent to the 3′ end of the target sequence, 5′ end of the target sequence, or both.
[0034] In embodiments of the present invention a CRISPR nuclease and an RNA molecule comprising a guide sequence portion form a CRISPR complex that binds to a target DNA sequence to effect cleavage of the target DNA sequence. CRISPR nucleases, e.g. Cpfl, may form a CRISPR complex comprising a CRISPR nuclease and RNA molecule without a further tracrRNA molecule. Alternatively, CRISPR nucleases, e.g. Cas9, may form a CRISPR complex between the CRISPR nuclease, an RNA molecule, and a tracrRNA molecule.
[0035] In embodiments of the present invention, the RNA molecule may further comprise the sequence of a tracrRNA molecule. Such embodiments may be designed as a synthetic fusion of the guide portion of the RNA molecule and the trans-activating crRNA (tracrRNA). (See Jinek (2012) Science). Embodiments of the present invention may also form CRISPR complexes utilizing a separate tracrRNA molecule and a separate RNA molecule comprising a guide sequence portion. In such embodiments the tracrRNA molecule may hybridize with the RNA molecule via basepairing and may be advantageous in certain applications of the invention described herein.
[0036] The term “tracr mate sequence” refers to a sequence sufficiently complementary to a tracrRNA molecule so as to hybridize to the tracrRNA via basepairing and promote the formation of a CRISPR complex. (See e.g., US8906616). In embodiments of the present invention, the RNA molecule may further comprise a portion having a tracr mate sequence.
[0037] A “gene,” for the purposes of the present disclosure, includes a DNA region encoding a gene product, as well as all DNA regions which regulate the production of the gene product, whether or not such regulatory sequences are adjacent to coding and/or transcribed sequences. Accordingly, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions.
[0038] “Eukaryotic” cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells and human cells.
[0039] The term “nuclease” as used herein refers to an enzyme capable of cleaving the phosphodiester bonds between the nucleotide subunits of nucleic acid. A nuclease may be isolated or derived from a natural source. The natural source may be any living organism. Alternatively, a nuclease may be a modified or a synthetic protein which retains the phosphodiester bond cleaving activity. Gene modification can be achieved using a nuclease, for example a CRISPR nuclease.
Embodiments
[0040] The present disclosure provides a method for utilizing at least one naturally occurring nucleotide difference or polymorphism (e.g., single nucleotide polymorphism (SNP)) for distinguishing/discriminating between two alleles of a gene, one allele bearing a mutation such that it encodes a mutated protein causing a disease phenotype (“mutated allele”), and the other allele encoding for a functional protein (“functional allele”). The method further comprises the step of knocking out expression of the mutated protein and allowing expression of the functional protein. In some embodiments, the method is for treating, ameliorating, or preventing a dominant negative genetic disorder.
[0041] According to embodiments of the present invention, there is provided a first RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010.
[0042] According to embodiments of the present invention, there is provided a first RNA molecule comprising a guide sequence portion having 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010.
[0043] According embodiments of the present invention, an RNA molecule may further comprise a portion having a sequence which binds to a CRISPR nuclease.
[0044] According to embodiments of the present invention, the sequence which binds to a CRISPR nuclease is a tracrRNA sequence.
[0045] According to embodiments of the present invention, an RNA molecule may further comprise a portion having a tracr mate sequence.
[0046] According to embodiments of the present invention, an RNA molecule may further comprise one or more linker portions.
[0047] According to embodiments of the present invention, an RNA molecule may be up to 300, 290, 280, 270, 260, 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, or 100 nucleotides in length. Each possibility represents a separate embodiment. In embodiments of the present invention, the RNA molecule may be 17 up to 300 nucleotides in length, 100 up to 300 nucleotides in length, 150 up to 300 nucleotides in length, 200 up to 300 nucleotides in length, 100 to 200 nucleotides in length, or 150 up to 250 nucleotides in length. Each possibility represents a separate embodiment.
[0048] According to some embodiments of the present invention, there is provided a composition comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and a CRISPR nuclease.
[0049] According to embodiments of the present invention, the composition may comprise a second RNA molecule comprising a guide sequence portion.
[0050] According to embodiments of the present invention, the guide sequence portion of the second RNA molecule comprises 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010.
[0051] According to embodiments of the present invention, the 17-20 nucleotides of the guide sequence portion of the second RNA molecule are in a different sequence from the sequence of the guide sequence portion of the first RNA molecule
[0052] Embodiments of the present invention may comprise a tracrRNA molecule.
[0053] According to some embodiments of the present invention, there is provided a method for inactivating a mutant BEST1 allele in a cell, the method comprising delivering to the cell a composition comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and a CRISPR nuclease.
[0054] According to some embodiments of the present invention, there is provided a method for treating Best Vitelliform Macular Dystrophy, the method comprising delivering to a subject having Best Vitelliform Macular Dystrophy a composition comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and a CRISPR nuclease.
[0055] According to embodiments of the present invention, the composition comprises a second RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010.
[0056] According to embodiments of the present invention, the 17-20 nucleotides of the guide sequence portion of the second RNA molecule are in a different sequence from the sequence of the guide sequence portion of the first RNA molecule
[0057] According to embodiments of the present invention, the CRISPR nuclease and the RNA molecule or RNA molecules are delivered to the subject and/or cells substantially at the same time or at different times.
[0058] According to embodiments of the present invention, the tracrRNA is delivered to the subject and/or cells substantially at the same time or at different times as the CRISPR nuclease and RNA molecule or RNA molecules.
[0059] According to embodiments of the present invention, the first RNA molecule targets a SNP or disease-causing mutation in an exon or promoter of a mutated allele, and wherein the second RNA molecule targets a SNP in the same or a different exon of the mutated allele, a SNP in an intron, or a sequence in an intron present in both the mutated or functional allele.
[0060] According to embodiments of the present invention, the first RNA molecule or the first and the second RNA molecules target a SNP in the promoter region, the start codon, or the untranslated region (UTR) of a mutated allele.
[0061] According to embodiments of the present invention, the first RNA molecule or the first and the second RNA molecules targets at least a portion of the promoter and/or the start codon and/or a portion of the UTR of a mutated allele.
[0062] According to embodiments of the present invention, the first RNA molecule targets a portion of the promoter, a first SNP in the promoter, or a SNP upstream to the promoter of a mutated allele and the second RNA molecule is targets a second SNP, which is downstream of the first SNP, and is in the promoter, in the UTR, or in an intron or in an exon of a mutated allele.
[0063] According to embodiments of the present invention, the first RNA molecule targets a SNP in the promoter, upstream of the promoter, or the UTR of a mutated allele and the second RNA molecule is designed to target a sequence which is present in an intron of both the mutated allele and the functional allele.
[0064] According to embodiments of the present invention, the first RNA molecule targets a sequence upstream of the promotor which is present in both a mutated and functional allele and the second RNA molecule targets a SNP or disease-causing mutation in any location of the gene.
[0065] According to embodiments of the present invention, there is provided a method comprising removing an exon containing a disease-causing mutation from a mutated allele, wherein the first RNA molecule or the first and the second RNA molecules target regions flanking an entire exon or a portion of the exon.
[0066] According to embodiments of the present invention, there is provided a method comprising removing multiple exons, the entire open reading frame of a gene, or removing the entire gene.
[0067] According to embodiments of the present invention, the first RNA molecule targets a SNP or disease-causing mutation in an exon or promoter of a mutated allele, and wherein the second RNA molecule targets a SNP in the same or a different exon of the mutated allele, a SNP in an intron, or a sequence in an intron present in both the mutated or functional allele.
[0068] According to embodiments of the present invention, the first RNA molecule or the first and the second RNA molecules target an alternative splicing signal sequence between an exon and an intron of a mutant allele.
[0069] According to embodiments of the present invention, the second RNA molecule targets a sequence present in both a mutated allele and a functional allele.
[0070] According to embodiments of the present invention, the second RNA molecule targets an intron.
[0071] According to embodiments of the present invention, there is provided a method comprising subjecting the mutant allele to insertion or deletion by an error prone non-homologous end joining (NHEJ) mechanism, generating a frameshift in the mutated allele’s sequence.
[0072] According to embodiments of the present invention, the frameshift results in inactivation or knockout of the mutated allele.
[0073] According to embodiments of the present invention, the frameshift creates an early stop codon in the mutated allele.
[0074] According to embodiments of the present invention, the frameshift results in nonsense-mediated mRNA decay of the transcript of the mutant allele.
[0075] According to embodiments of the present invention, the inactivating or treating results in a truncated protein encoded by the mutated allele and a functional protein encoded by the functional allele.
[0076] According to some embodiments of the present invention, there is provided use of a composition comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and a CRISPR nuclease inactivating a mutant BEST1 allele in a cell, comprising delivering to the cell the RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and the CRISPR nuclease.
[0077] According to embodiments of the present invention, there is provided a medicament comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and a CRISPR nuclease for use in inactivating a mutant BEST1 allele in a cell, wherein the medicament is administered by delivering to the cell the composition comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and a CRISPR nuclease.
[0078] According to some embodiments of the present invention, there is provided use of a composition comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and a CRISPR nuclease for treating ameliorating or preventing Best Vitelliform Macular Dystrophy, comprising delivering to a subject having or at risk of having Best Vitelliform Macular Dystrophy the composition of comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and a CRISPR nuclease.
[0079] According to some embodiments of the present invention, there is provided a medicament comprising the composition comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and a CRISPR nuclease for use in treating ameliorating or preventing Best Vitelliform Macular Dystrophy, wherein the medicament is administered by delivering to a subject having or at risk of having Best Vitelliform Macular Dystrophy: the composition comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and a CRISPR nuclease.
[0080] According to some embodiments of the present invention, there is provided a kit for inactivating a mutant BEST1 allele in a cell, comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010, a CRISPR nuclease, and/or a tracrRNA molecule; and instructions for delivering the RNA molecule; CRISPR nuclease, and/or the tracrRNA to the cell.
[0081] According to some embodiments of the present invention, there is provided a kit for treating Best Vitelliform Macular Dystrophy in a subject, comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010, a CRISPR nuclease, and/or a tracrRNA molecule; and instructions for delivering the RNA molecule; CRISPR nuclease, and/or the tracrRNA to a subject having or at risk of having Best Vitelliform Macular Dystrophy.
[0082] In embodiments of the present invention, the RNA molecule comprises a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-714, SEQ ID NOs: 715-3010, or SEQ ID NOs 1-3010.
[0083] The compositions and methods of the present disclosure may be utilized for treating, preventing, ameliorating, or slowing progression of Best Vitelliform Macular Dystrophy.
[0084] In some embodiments, a mutated allele is deactivated by delivering to a cell an RNA molecule which targets a SNP in the promoter region, the start codon, or the untranslated region (UTR) of the mutated allele.
[0085] In some embodiments, a mutated allele is inactivated by removing at least a portion of the promoter and/or removing the start codon and/or a portion of the UTR. In some embodiments, the method of deactivating a mutated allele comprises removing at least a portion of the promoter. In such embodiments one RNA molecule may be designed for targeting a first SNP in the promoter or upstream to the promoter and another RNA molecule is designed to target a second SNP, which is downstream of the first SNP, and is in the promoter, in the UTR, or in an intron or in an exon. Alternatively, one RNA molecule may be designed for targeting a SNP in the promoter, or upstream of the promoter, or the UTR and another RNA molecule is designed to target a sequence which is present in an intron of both the mutated allele and the functional allele. Alternatively, one RNA molecule may be designed for targeting a sequence upstream of the promotor which is present in both the mutated and functional allele and the other guide is designed to target a SNP or disease-causing mutation in any location of the gene e.g., in an exon, intron, UTR, or downstream of the promoter.
[0086] In some embodiments, the method of deactivating a mutated allele comprises an exon skipping step comprising removing an exon containing a disease-causing mutation from the mutated allele. Removing an exon containing a disease-causing mutation in the mutated allele requires two RNA molecules which target regions flanking the entire exon or a portion of the exon. Removal of an exon containing the disease-causing mutation may be designed to eliminate the disease-causing action of the protein while allowing for expression of the remaining protein product which retains some or all of the wild-type activity. As an alternative to single exon skipping, multiple exons, the entire open reading frame or the entire gene can be excised using two RNA molecules flanking the region desired to be excised.
[0087] In some embodiments, the method of deactivating a mutated allele comprises delivering two RNA molecules to a cell, wherein one RNA molecule targets a SNP or disease-causing mutation in an exon or promoter of the mutated allele, and wherein the other RNA molecule targets a SNP in the same or a different exon of the mutated allele, a SNP in an intron, or a sequence in an intron present in both the mutated or functional allele.
[0088] In some embodiments, an RNA molecule is used to target a CRISPR nuclease to an alternative splicing signal sequence between an exon and an intron of a mutant allele, thereby destroying the alternative splicing signal sequence in the mutant allele.
[0089] Any one of, or combination of, the above-mentioned strategies for deactivating a mutant allele may be used in the context of the invention.
[0090] Additional strategies may be used to deactivate a mutated allele. For example, in embodiments of the present invention, an RNA molecule is used to direct a CRISPR nuclease to an exon or a splice site of a mutated allele in order to create a double-stranded break (DSB), leading to insertion or deletion of nucleotides by an error-prone non-homologous end-joining (NHEJ) mechanism and formation of a frameshift mutation in the mutated allele. The frameshift mutation may result in: (1) inactivation or knockout of the mutated allele by generation of an early stop codon in the mutated allele, resulting in generation of a truncated protein; or (2) nonsense mediated mRNA decay of the transcript of the mutant allele. In further embodiments, one RNA molecule is used to direct a CRISPR nuclease to a promotor of a mutated allele.
[0091] In some embodiments, the method of deactivating a mutated allele further comprises enhancing activity of the functional protein such as by providing a protein/peptide, a nucleic acid encoding a protein/peptide, or a small molecule such as a chemical compound, capable of activating/enhancing activity of the functional protein.
[0092] According to some embodiments, the present disclosure provides an RNA sequence (‘RNA molecule’) which binds to / associates with and/or directs the RNA guided DNA nuclease e.g., CRISPR nuclease to a sequence comprising at least one nucleotide which differs between a mutated allele and a functional allele (e.g., SNP) of a gene of interest (i.e., a sequence of the mutated allele which is not present in the functional allele).
[0093] In some embodiments, the method comprises the steps of: contacting a mutated allele of a gene of interest with an allele-specific RNA molecule and a CRISPR nuclease e.g., a Cas9 protein, wherein the allele-specific RNA molecule and the CRISPR nuclease e.g., Cas9 associate with a nucleotide sequence of the mutated allele of the gene of interest which differs by at least one nucleotide from a nucleotide sequence of a functional allele of the gene of interest, thereby modifying or knocking-out the mutated allele.
[0094] In some embodiments, the allele-specific RNA molecule and a CRISPR nuclease is introduced to a cell encoding the gene of interest. In some embodiments, the cell encoding the gene of interest is in a mammalian subject. In some embodiments, the cell encoding the gene of interest is in a plant.
[0095] In some embodiments, the cleaved mutated allele is further subjected to insertion or deletion (indel) by an error prone non-homologous end joining (NHEJ) mechanism, generating a frameshift in the mutated allele’s sequence. In some embodiments, the generated frameshift results in inactivation or knockout of the mutated allele. In some embodiments, the generated frameshift creates an early stop codon in the mutated allele and results in generation of a truncated protein. In such embodiments, the method results in the generation of a truncated protein encoded by the mutated allele and a functional protein encoded by the functional allele. In some embodiments, a frameshift generated in a mutated allele using the methods of the invention results in nonsense-mediated mRNA decay of the transcript of the mutant allele.
[0096] In some embodiments, the mutated allele is an allele of the BEST1 gene. In some embodiments, the RNA molecule targets a SNP which co-exists with / is genetically linked to the mutated sequence associated with Best Vitelliform Macular Dystrophy genetic disorder. In some embodiments, the RNA molecule targets a SNP which is highly prevalent in the population and exists in the mutated allele having the mutated sequence associated with Best Vitelliform Macular Dystrophy genetic disorder and not in the functional allele of an individual subject to be treated. In some embodiments, a disease-causing mutation within a mutated BEST1 allele is targeted.
[0097] In some embodiments, the SNP is within an exon of the gene of interest. In such embodiments, a guide sequence portion of an RNA molecule may be designed to associate with a sequence of the exon of the gene of interest.
[0098] In some embodiments, SNP is within an intron or an exon of the gene of interest. In some embodiments, SNP is in close proximity to a splice site between the intron and the exon. In some embodiments, the close proximity to a splice site is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides upstream or downstream to the splice site. Each possibility represents a separate embodiment of the present invention. In such embodiments, a guide sequence portion of an RNA molecule may be designed to associate with a sequence of the gene of interest which comprises the splice site.
[0099] In some embodiments, the method is utilized for treating a subject having a disease phenotype resulting from the heterozygote BEST1 gene. In such embodiments, the method results in improvement, amelioration or prevention of the disease phenotype.
[0100] Embodiments referred to above refer to a CRISPR nuclease, RNA molecule(s), and tracrRNA being effective in a subject or cells at the same time. The CRISPR, RNA molecule(s), and tracrRNA can be delivered substantially at the same time or can be delivered at different times but have effect at the same time. For example, this includes delivering the CRISPR nuclease to the subject or cells before the RNA molecule and/or tracr RNA is substantially extant in the subject or cells.
[0101] In some embodiments, the cell is a retinal cell. In some embodiments, the cell is a Retinal pigment epithelium (RPE) cell.
Dominant Genetic Disorders
[0102] One of skill in the art will appreciate that all subjects with any type of heterozygote genetic disorder (e.g., dominant genetic disorder) may be subjected to the methods described herein. In one embodiment, the present invention may be used to target a gene involved in, associated with, or causative of dominant genetic disorders such as, for example treating Best Vitelliform Macular Dystrophy. In some embodiments, the dominant genetic disorder is treating Best Vitelliform Macular Dystrophy. In some embodiments, the target gene is the BEST1 gene (Entrez Gene, gene ID No: 7439).
CRISPR Nucleases and PAM Recognition
[0103] In some embodiments, the sequence specific nuclease is selected from CRISPR nucleases, or a functional variant thereof. In some embodiments, the sequence specific nuclease is an RNA guided DNA nuclease. In such embodiments, the RNA sequence which guides the RNA guided DNA nuclease (e.g., Cpfl) binds to and/or directs the RNA guided DNA nuclease to the sequence comprising at least one nucleotide which differs between a mutated allele and its counterpart functional allele (e.g., SNP). In some embodiments, the CRISPR complex does not further comprise a tracrRNA. In a non-limiting example, in which the RNA guided DNA nuclease is a CRISPR protein, the at least one nucleotide which differs between the dominant mutated allele and the functional allele may be within the PAM site and/or proximal to the PAM site within the region that the RNA molecule is designed to hybridize to. A skilled artisan will appreciate that RNA molecules can be engineered to bind to a target of choice in a genome by commonly known methods in the art.
[0104] In embodiments of the present invention, a type II CRISPR system utilizes a mature crRNA:tracrRNA complex directs a CRISPR nuclease, e.g. Cas9, to the target DNA via Watson-Crick base-pairing between the crRNA and the protospacer on the target DNA next to the protospacer adjacent motif (PAM), an additional requirement for target recognition. The CRISPR nuclease then mediates cleavage of target DNA to create a double-stranded break within the protospacer. A skilled artisan will appreciate that each of the engineered RNA molecule of the present invention is further designed such as to associate with a target genomic DNA sequence of interest next to a protospacer adjacent motif (PAM), e.g., a PAM matching the sequence relevant for the type of CRISPR nuclease utilized, such as for a non-limiting example, NGG or NAG, wherein “N” is any nucleobase, for Streptococcus pyogenes Cas9 WT (SpCAS9); NNGRRT for Staphylococcus aureus (SaCas9); NNNVRYM for Jejuni Cas9 WT; NGAN or NGNG for SpCas9-VQR variant; NGCG for SpCas9-VRER variant; NGAG for SpCas9-EQR variant; NNNNGATT for Neisseria meningitidis (NmCas9); or TTTV for Cpfl. RNA molecules of the present invention are each designed to form complexes in conjunction with one or more different CRISPR nucleases and designed to target polynucleotide sequences of interest utilizing one or more different PAM sequences respective to the CRISPR nuclease utilized.
[0105] In some embodiments, an RNA-guided DNA nuclease e.g., a CRISPR nuclease, may be used to cause a DNA break at a desired location in the genome of a cell. The most commonly used RNA-guided DNA nucleases are derived from CRISPR systems, however, other RNA-guided DNA nucleases are also contemplated for use in the genome editing compositions and methods described herein. For instance, see U.S. Pat. Publication No. 2015-0211023, incorporated herein by reference.
[0106] CRISPR systems that may be used in the practice of the invention vary greatly. CRISPR systems can be a type I, a type II, or a type III system. Non- limiting examples of suitable CRISPR proteins include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8al, Cas8a2, Cas8b, Cas8c, Cas9, Casl0, Casl Od, CasF, CasG, CasH, Csyl , Csy2, Csy3, Csel (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl , Csb2, Csb3,Csxl7, Csxl4, Csxl0, Csxl6, CsaX, Csx3, Cszl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cul966.
[0107] In some embodiments, the RNA-guided DNA nuclease is a CRISPR nuclease derived from a type II CRISPR system (e.g., Cas9). The CRISPR nuclease may be derived from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Neisseria meningitidis, Treponema denticola, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculumthermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, or any species which encodes a CRISPR nuclease with a known PAM sequence. CRISPR nucleases encoded by uncultured bacteria may also be used in the context of the invention. (See Burstein et al. Nature, 2017). Variants of CRIPSR proteins having known PAM sequences e.g., spCas9 D1135E variant, spCas9 VQR variant, spCas9 EQR variant, or spCas9 VRER variant may also be used in the context of the invention.
[0108] Thus, an RNA guided DNA nuclease of a CRISPR system, such as a Cas9 protein or modified Cas9 or homolog or ortholog of Cas9, or other RNA guided DNA nucleases belonging to other types of CRISPR systems, such as Cpfl and its homologs and orthologs, may be used in the compositions of the present invention.
[0109] In certain embodiments, the CRIPSR nuclease may be a “functional derivative” of a naturally occurring Cas protein. A “functional derivative” of a native sequence polypeptide is a compound having a qualitative biological property in common with a native sequence polypeptide. “Functional derivatives” include, but are not limited to, fragments of a native sequence and derivatives of a native sequence polypeptide and its fragments, provided that they have a biological activity in common with a corresponding native sequence polypeptide. A biological activity contemplated herein is the ability of the functional derivative to hydrolyze a DNA substrate into fragments. The term “derivative” encompasses both amino acid sequence variants of polypeptide, covalent modifications, and fusions thereof. Suitable derivatives of a Cas polypeptide or a fragment thereof include but are not limited to mutants, fusions, covalent modifications of Cas protein or a fragment thereof. Cas protein, which includes Cas protein or a fragment thereof, as well as derivatives of Cas protein or a fragment thereof, may be obtainable from a cell or synthesized chemically or by a combination of these two procedures. The cell may be a cell that naturally produces Cas protein, or a cell that naturally produces Cas protein and is genetically engineered to produce the endogenous Cas protein at a higher expression level or to produce a Cas protein from an exogenously introduced nucleic acid, which nucleic acid encodes a Cas that is same or different from the endogenous Cas. In some cases, the cell does not naturally produce Cas protein and is genetically engineered to produce a Cas protein.
[0110] In some embodiments, the CRISPR nuclease is Cpfl. Cpfl is a single RNA-guided endonuclease which utilizes a T-rich protospacer-adjacent motif. Cpfl cleaves DNA via a staggered DNA double-stranded break. Two Cpfl enzymes from Acidaminococcus and Lachnospiraceae have been shown to carry out efficient genome-editing activity in human cells. (See Zetsche et al. (2015) Cell.).
[0111] Thus, an RNA guided DNA nuclease of a Type II CRISPR System, such as a Cas9 protein or modified Cas9 or homologs, orthologues, or variants of Cas9, or other RNA guided DNA nucleases belonging to other types of CRISPR systems, such as Cpfl and its homologs, orthologues, or variants, may be used in the present invention.
[0112] In some embodiments, the guide molecule comprises one or more chemical modifications which imparts a new or improved property (e.g., improved stability from degradation, improved hybridization energetics, or improved binding properties with an RNA guided DNA nuclease). Suitable chemical modifications include, but are not limited to: modified bases, modified sugar moieties, or modified inter-nucleoside linkages. Non-limiting examples of suitable chemical modifications include: 4-acetylcytidine, 5-(carboxyhydroxymethyl)uridine, 2′-O-methylcytidine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, dihydrouridine, 2′-O-methylpseudouridine, “beta, D-galactosylqueuosine”, 2′-O-methylguanosine, inosine, N6-isopentenyladenosine, 1-methyladenosine, 1-methylpseudouridine, 1-methylguanosine, 1-methylinosine, “2,2-dimethylguanosine”, 2-methyladenosine, 2-methylguanosine, 3-methylcytidine, 5-methylcytidine, N6-methyladenosine, 7-methylguanosine, 5-methylaminomethyluridine, 5-methoxyaminomethyl-2-thiouridine, “beta, D-mannosylqueuosine”, 5-methoxycarbonylmethyl-2-thiouridine, 5-methoxycarbonylmethyluridine, 5-methoxyuridine, 2-methylthio-N6-isopentenyladenosine, N-((9-beta-D-ribofuranosyl-2-methylthiopurine-6-yl)carbamoyl)threonine, N-((9-beta-D-ribofuranosylpurine-6-yl)N-methylcarbamoyl)threonine, uridine-5-oxyacetic acid-methylester, uridine-5-oxyacetic acid, wybutoxosine, queuosine, 2-thiocytidine, 5-methyl-2-thiouridine, 2-thiouridine, 4-thiouridine, 5-methyluridine, N-((9-beta-D-ribofuranosylpurine-6-yl)-carbamoyl)threonine, 2′-O-methyl-5-methyluridine, 2′-O-methyluridine, wybutosine, “3-(3-amino-3-carboxy-propyl)uridine, (acp3)u”, 2′-0-methyl (M), 3′-phosphorothioate (MS), 3′-thioPACE (MSP), pseudouridine, or 1-methyl pseudo-uridine. Each possibility represents a separate embodiment of the present invention.
Guide Sequences Which Specifically Target a Mutant Allele
[0113] A given gene may contain thousands of SNPs. Utilizing a 24 base pair target window for targeting each SNP in a gene would require hundreds of thousands of guide sequences. Any given guide sequence when utilized to target a SNP may result in degradation of the guide sequence, limited activity, no activity, or off-target effects. Accordingly, suitable guide sequences are necessary for targeting a given gene. By the present invention, a novel set of guide sequences have been identified for knocking out expression of a mutated BEST1 protein, inactivating a mutant BEST1 gene allele, and treating Best Vitelliform Macular Dystrophy.
[0114] The present disclosure provides guide sequences capable of specifically targeting a mutated allele for inactivation while leaving the functional allele unmodified. The guide sequences of the present invention are designed to, and are most likely to, specifically differentiate between a mutated allele and a functional allele. Of all possible guide sequences which target a mutated allele desired to be inactivated, the specific guide sequences disclosed herein are specifically effective to function with the disclosed embodiments.
[0115] Briefly, the guide sequences may have properties as follows: (1) target SNP/insertion/deletion/indel with a high prevalence in the general population, in a specific ethnic population or in a patient population is above 1% and the SNP/insertion/deletion/indel heterozygosity rate in the same population is above 1%; (2) target a location of a SNP/insertion/deletion/indel proximal to a portion of the gene e.g., within 5k bases of any portion of the gene, for example, a promoter, a UTR, an exon or an intron; and (3) target a mutant allele using an RNA molecule which targets a founder or common pathogenic mutations for the disease/gene. In some embodiments, the prevalence of the SNP/insertion/deletion/indel in the general population, in a specific ethnic population or in a patient population is above 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15% and the SNP/insertion/deletion/indel heterozygosity rate in the same population is above 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15%. Each possibility represents a separate embodiment and may be combined at will.
[0116] For each gene, according to SNP/insertion/deletion/indel any one of the following strategies may be used to deactivate the mutated allele: (1) Knockout strategy using one RNA molecule - one RNA molecule is utilized to direct a CRISPR nuclease to a mutated allele and create a double-strand break (DSB) leading to formation of a frameshift mutation in an exon or in a splice site region of the mutated allele; (2) Knockout strategy using two RNA molecules - two RNA molecules are utilized. A first RNA molecule targets a region in the promoter or an upstream region of a mutated allele and another RNA molecule targets downstream of the first RNA molecule in a promoter, exon, or intron of the mutated allele; (3) Exon(s) skipping strategy - one RNA molecule may be used to target a CRISPR nuclease to a splice site region, either at the 5′ end of an intron (donor sequence) or the 3′ end of an intron (acceptor sequence), in order to destroy the splice site. Alternatively, two RNA molecules may be utilized such that a first RNA molecule targets an upstream region of an exon and a second RNA molecule targets a region downstream of the first RNA molecule, thereby excising the exon(s). Based on the locations of identified SNPs/insertions/deletions/indels for each mutant allele, any one of, or a combination of, the above-mentioned methods to deactivate the mutant allele may be utilized.
[0117] When only one RNA molecule is used is that the location of the SNP is in an exon or in close proximity (e.g., within 20 basepairs) to a splice site between the intron and the exon. When two RNA molecules are used, guide sequences may target two SNPs such that the first SNP is upstream of exon 1 e.g., within the 5′ untranslated region, or within the promoter or within the first 2 kilobases 5′ of the transcription start site, and the second SNP is downstream of the first SNP e.g., within the first 2 kilobases 5′ of the transcription start site, or within intron 1, 2 or 3, or within exon 1, exon 2, or exon 3.
[0118] Guide sequences of the present invention may target a SNP in the upstream portion of the targeted gene, preferably upstream of the last exon of the targeted gene. Guide sequences may target a SNP upstream to exon 1, for example within the 5′ untranslated region, or within the promoter or within the first 4-5 kilobases 5′ of the transcription start site.
[0119] Guide sequences of the present invention may also target a SNP within close proximity (e.g., within 50 basepairs, more preferably with 20 basepairs) to a known protospacer adjacent motif (PAM) site.
[0120] Guide sequences of the present invention also may target: (1) a heterozygous SNP for the targeted gene; (2) a heterozygous SNPs upstream and downstream of the gene; (3) a SNPs with a prevalence of the SNP/insertion/deletion/indel in the general population, in a specific ethnic population, or in a patient population above 1%; (4) have a guanine-cytosine content of greater than 30% and less than 85%; (5) have no repeat of 4 or more thymine/uracil or 8 or more guanine, cytosine, or adenine; (6) having no off-target identified by off-target analysis; and (7) preferably target Exons over Introns or be upstream of a SNP rather than downstream of a SNP.
[0121] In embodiments of the present invention, the SNP may be upstream or downstream of the gene. In embodiments of the present invention, the SNP is within 4,000 base pairs upstream or downstream of the gene.
[0122] The at least one nucleotide which differs between the mutated allele and the functional allele, may be upstream, downstream or within the sequence of the disease-causing mutation of the gene of interest. The at least one nucleotide which differs between the mutated allele and the functional allele, may be within an exon or within an intron of the gene of interest. In some embodiments, the at least one nucleotide which differs between the mutated allele and the functional allele is within an exon of the gene of interest. In some embodiments, the at least one nucleotide which differs between the mutated allele and the functional allele is within an intron or an exon of the gene of interest, in close proximity to a splice site between the intron and the exon e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides upstream or downstream to the splice site.
[0123] In some embodiments, the at least one nucleotide is a single nucleotide polymorphisms (SNPs). In some embodiments, each of the nucleotide variants of the SNP may be expressed in the mutated allele. In some embodiments, the SNP may be a founder or common pathogenic mutation.
[0124] Guide sequences may target a SNP which has both (1) a high prevalence in the general population e.g., above 1% in the population; and (2) a high heterozygosity rate in the population, e.g., above 1%. Guide sequences may target a SNP that is globally distributed. A SNP may be a founder or common pathogenic mutation. In some embodiments, the prevalence in the general population is above 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15%. Each possibility represents a separate embodiment. In some embodiments, the heterozygosity rate in the population is above 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15%. Each possibility represents a separate embodiment.
[0125] In some embodiments, the at least one nucleotide which differs between the mutated allele and the functional allele is linked to/co-exists with the disease-causing mutation in high prevalence in a population. In such embodiments, “high prevalence” refers to at least 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. Each possibility represents a separate embodiment of the present invention. In one embodiment, the at least one nucleotide which differs between the mutated allele and the functional allele, is a disease-associated mutation. In some embodiments, the SNP is highly prevalent in the population. In such embodiments, “highly prevalent” refers to at least 10%, 11%, 12%, 13%, 14%, 15%, 20%, 30%, 40%, 50%, 60%, or 70% of a population. Each possibility represents a separate embodiment of the present invention.
[0126] Guide sequences of the present invention may satisfy any one of the above criteria and are most likely to differentiate between a mutated allele from its corresponding functional allele.
[0127] In some embodiments the RNA molecule targets a SNP/WT sequence linked to SNPs as shown in Table 1 below. The SNP details are indicated in the 1.sup.st column and include: SNP ID No. (based on NCBI’s 2018 database of Single Nucleotide Polymorphisms (dbSNP)). For variants with no available rs number variants characteristic are indicated based on gnomAD 2018 browser database. The 2.sup.nd column indicates an assigned identifier for each SNP. The 3.sup.rd column indicates the location of each SNP on the BEST1 gene.
TABLE-US-00001 BEST1 gene SNPs RSID SNP No. SNP location in the gene rs1800009 s1 Exon_10 of 11 rs2524294 s2 Intron_2 of 10 rs909268 s3 Intron_4 of 10 rs2668898 s4 Intron_6 of 10 rs972355 s5 upstream -18bp rs972353 s6 Exon_1 of 11 rs2736597 s7 Intron_1 of 10 rs1800007 s8 Exon_2 of 11 rs760306 s9 Intron_4 of 10 rs974121 s10 upstream -1048bp rs168991 s11 Intron_2 of 10 rs195161 s12 Intron_5 of 10 rs149698 s13 Exon_10 of 11 rs1534842 s14 upstream -3765bp rs3758976 s15 upstream -250bp rs1800008 s16 Exon_10 of 11 rs195158 s17 Intron_7 of 10 rs195157 s18 Intron_9 of 10 rs195156 s19 Intron_9 of 10 rs2009875 s20 upstream -3323bp rs2955684 s21 Intron_6 of 10 rs2955683 s22 Intron_6 of 10 rs17185413 s23 Intron_10 of 10 rs972354 s24 Exon_1 of 11 rs195163 s25 Intron_4 of 10 rs2668897 s26 Intron_10 of 10 rs1109748 s27 Exon_3 of 11 rs195160 s28 Intron_7 of 10 rs183176 s29 Intron_2 of 10 rs195167 s30 Intron_2 of 10 rs195165 s31 Intron_3 of 10 rs195164 s32 Intron_4 of 10 rs2736594 s33 Intron_2 of 10 rs195162 s34 Intron_5 of 10 rs113492158 s35 Intron_6 of 10 rs195166 s36 Intron_2 of 10 rs741886 s37 Intron_5 of 10 rs2736596 s38 Intron_1 of 10 rs1801621 s39 Exon_11 of 11 rs17156609 s40 downstream +42bp rs1534843 s41 upstream -3860bp rs73491300 s42 upstream -224bp rs74754540 s43 upstream -998bp rs112769638 s44 Intron_1 of 10 rs74369809 s62 Intron_9 of 10 rs78054615 s63 Intron_2 of 10 rs144630276 s64 Intron_2 of 10 rs141507235 s65 Intron_6 of 10 rs114944671 s66 Intron_3 of 10 rs1801327 s67 Exon_11 of 11 rs78012644 s68 Intron_7 of 10 rs112665957 s69 Intron_2 of 10 rs139745332 s70 Intron_2 of 10 rs77543508 s71 Intron_2 of 10 rs78545127 s72 upstream -2638bp rs116516743 s73 upstream -2116bp rs1805140 s74 Exon_6 of 11 rs73493205 s75 Intron_1 of 10 rs77651946 s76 Intron_1 of 10 rs195159 s77 Intron_7 of 10 rs195155 s78 Intron_10 of 10 rs2727272 s79 Intron_2 of 10 rs2668899 s80 Intron_2 of 10 rs2736595 s81 Intron_2 of 10 rs56215258 s82 Intron_10 of 10 rs174481 s83 upstream -960bp rs168990 s84 Intron_4 of 10 rs111509315 s85 Intron_9 of 10 rs1735379 s86 Intron_7 of 10 rs112720784 s87 Intron_2 of 10
Delivery to Cells
[0128] The RNA molecule compositions described herein may be delivered to a target cell by any suitable means. RNA molecule compositions of the present invention may be targeted to any cell which contains and/or expresses a dominant negative allele, including any mammalian or plant cell. For example, in one embodiment a guide sequence specifically targets a mutated BEST1 allele and the target cell is a retinal cell such as pigment epithelium (RPE), photoreceptors (e.g., rod and cone), glial cells (e.g., Müller), and ganglion cells. In some embodiments, the target cell is RPE. Further, the nucleic acid compositions described herein may be delivered as DNA molecules, RNA molecules, Ribonucleoproteins (RNP), nucleic acid vectors, or any combination thereof.
[0129] In some embodiments, the RNA molecule comprises a chemical modification. Non-limiting examples of suitable chemical modifications include 2′-0-methyl (M), 2′-0-methyl, 3′phosphorothioate (MS) or 2′-0-methyl, 3 ‘thioPACE (MSP), pseudouridine, and 1-methyl pseudo-uridine. Each possibility represents a separate embodiment of the present invention.
[0130] Any suitable viral vector system may be used to deliver nucleic acid compositions e.g., the RNA molecule compositions of the subject invention. Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids and target tissues. In certain embodiments, nucleic acids are administered for in vivo or ex vivo gene therapy uses. Non-viral vector delivery systems include naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome or poloxamer. For a review of gene therapy procedures, see Anderson (1992) Science 256:808-813; Nabel & Felgner (1993) TIBTECH 11:211-217; Mitani & Caskey (1993) TIBTECH 11:162-166; Dillon (1993) TIBTECH 11:167-175; Miller (1992) Nature 357:455-460; Van Brunt (1988) Biotechnology 6(10):1149-1154; Vigne (1995) Restorative Neurology and Neuroscience 8:35-36; Kremer & Perricaudet (1995) British Medical Bulletin 51(1):31-44; Haddada et al. (1995) in Current Topics in Microbiology and Immunology Doerfler and Bohm (eds.); and Yu et al. (1994) Gene Therapy 1:13-26.
[0131] Methods of non-viral delivery of nucleic acids and/or proteins include electroporation, lipofection, microinjection, biolistics, particle gun acceleration, virosomes, liposomes, immunoliposomes, lipid nanoparticles (LNPs), polycation or lipid:nucleic acid conjugates, artificial virions, and agent-enhanced uptake of nucleic acids or can be delivered to plant cells by bacteria or viruses (e.g., Agrobacterium, Rhizobium sp. NGR234, Sinorhizoboiummeliloti, Mesorhizobium loti, tobacco mosaic virus, potato virus X, cauliflower mosaic virus and cassava vein mosaic virus). (See, e.g., Chung et al. (2006) Trends Plant Sci. 11(1): 1-4). Sonoporation using, e.g., the Sonitron 2000 system (Rich-Mar), can also be used for delivery of nucleic acids. Cationic-lipid mediated delivery of proteins and/or nucleic acids is also contemplated as an in vivo or in vitro delivery method. (See Zuris et al. (2015) Nat. Biotechnol. 33(1):73-80; see also Coelho et al. (2013) N. Engl. J. Med. 369, 819-829; Judge et al. (2006) Mol. Ther. 13, 494-505; and Basha et al. (2011) Mol. Ther. 19, 2186-2200).
[0132] Additional exemplary nucleic acid delivery systems include those provided by Amaxa.RTM. Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Md.), BTX Molecular Delivery Systems (Holliston, Mass.) and Copernicus Therapeutics Inc., (see, e.g., U.S. Pat. No. 6,008,336). Lipofection is described in e.g., U.S. Pat. No. 5,049,386, U.S. Pat. No. 4,946,787; and U.S. Pat. No. 4,897,355, and lipofection reagents are sold commercially (e.g., Transfectam.TM., Lipofectin.TM. and Lipofectamine.TM. RNAiMAX). Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Felgner, WO 91/17424, WO 91/16024. Delivery can be to cells (ex vivo administration) or target tissues (in vivo administration).
[0133] The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to one of skill in the art (See, e.g., Crystal (1995) Science 270:404-410; Blaese et al. (1995) Cancer Gene Ther. 2:291-297; Behr et al. (1994) Bioconjugate Chem. 5:382-389; Remy et al. (1994) Bioconjugate Chem. 5:647-654; Gao et al. (1995) Gene Therapy 2:710-722; Ahmad et al. (1992) Cancer Res. 52:4817-4820; U.S. Pat. Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787).
[0134] Additional methods of delivery include the use of packaging the nucleic acids to be delivered into EnGeneIC delivery vehicles (EDVs). These EDVs are specifically delivered to target tissues using bispecific antibodies where one arm of the antibody has specificity for the target tissue and the other has specificity for the EDV. The antibody brings the EDVs to the target cell surface and then the EDV is brought into the cell by endocytosis. Once in the cell, the contents are released (See MacDiarmid et al (2009) Nature Biotechnology 27(7):643).
[0135] The use of RNA or DNA viral based systems for viral mediated delivery of nucleic acids take advantage of highly evolved processes for targeting a virus to specific cells in the body and trafficking the viral payload to the nucleus. Viral vectors can be administered directly to patients (in vivo) or they can be used to treat cells in vitro and the modified cells are administered to patients (ex vivo). Conventional viral based systems for the delivery of nucleic acids include, but are not limited to, retroviral, lentivirus, adenoviral, adeno-associated, vaccinia and herpes simplex virus vectors for gene transfer.
[0136] The tropism of a retrovirus can be altered by incorporating foreign envelope proteins, expanding the potential target population of target cells. Lentiviral vectors are retroviral vectors that are able to transduce or infect non-dividing cells and typically produce high viral titers. Selection of a retroviral gene transfer system depends on the target tissue. Retroviral vectors are comprised of cis-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum cis-acting LTRs are sufficient for replication and packaging of the vectors, which are then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression. Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (See, e.g., Buchschacher et al. (1992) J. Virol. 66:2731-2739; Johann et al. (1992) J. Virol. 66:1635-1640; Sommerfelt et al. (1990) Virol. 176:58-59; Wilson et al. (1989) J. Virol. 63:2374-2378; Miller et al. (1991) J. Virol. 65:2220-2224; PCT/US94/05700).
[0137] At least six viral vector approaches are currently available for gene transfer in clinical trials, which utilize approaches that involve complementation of defective vectors by genes inserted into helper cell lines to generate the transducing agent.
[0138] pLASN and MFG-S are examples of retroviral vectors that have been used in clinical trials (Dunbar et al. (1995) Blood 85:3048-305; Kohn et al.(1995) Nat. Med. 1:1017-102; Malech et al. (1997) PNAS 94:22 12133-12138). PA317/pLASN was the first therapeutic vector used in a gene therapy trial. (Blaese et al. (1995). Transduction efficiencies of 50% or greater have been observed for MFG-S packaged vectors. (Ellem et al. (1997) Immunol Immunother. 44(1):10-20; Dranoff et al. (1997) Hum. Gene Ther. 1:111-2).
[0139] Packaging cells are used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenovirus, AAV, and Psi-2 cells or PA317 cells, which package retrovirus. Viral vectors used in gene therapy are usually generated by a producer cell line that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host (if applicable), other viral sequences being replaced by an expression cassette encoding the protein to be expressed. The missing viral functions are supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy typically only possess inverted terminal repeat (ITR) sequences from the AAV genome which are required for packaging and integration into the host genome. Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences. The cell line is also infected with adenovirus as a helper. The helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid. The helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV. Additionally, AAV can be produced at clinical scale using baculovirus systems (see U.S. Pat. No. 7,479,554).
[0140] In many gene therapy applications, it is desirable that the gene therapy vector be delivered with a high degree of specificity to a particular tissue type. Accordingly, a viral vector can be modified to have specificity for a given cell type by expressing a ligand as a fusion protein with a viral coat protein on the outer surface of the virus. The ligand is chosen to have affinity for a receptor known to be present on the cell type of interest. For example, Han et al. (1995) Proc. Natl. Acad. Sci. USA 92:9747-9751, reported that Moloney murine leukemia virus can be modified to express human heregulin fused to gp70, and the recombinant virus infects certain human breast cancer cells expressing human epidermal growth factor receptor. This principle can be extended to other virus-target cell pairs, in which the target cell expresses a receptor and the virus expresses a fusion protein comprising a ligand for the cell-surface receptor. For example, filamentous phage can be engineered to display antibody fragments (e.g., FAB or Fv) having specific binding affinity for virtually any chosen cellular receptor. Although the above description applies primarily to viral vectors, the same principles can be applied to nonviral vectors. Such vectors can be engineered to contain specific uptake sequences which favor uptake by specific target cells.
[0141] Gene therapy vectors can be delivered in vivo by administration to an individual patient, typically by systemic administration (e.g., intravitreal, intravenous, intraperitoneal, intramuscular, subdermal, or intracranial infusion) or topical application, as described below. Alternatively, vectors can be delivered to cells ex vivo, such as cells explanted from an individual patient (e.g., lymphocytes, bone marrow aspirates, tissue biopsy) or universal donor hematopoietic stem cells, followed by reimplantation of the cells into a patient, usually after selection for cells which have incorporated the vector.
[0142] Ex vivo cell transfection for diagnostics, research, or for gene therapy (e.g., via re-infusion of the transfected cells into the host organism) is well known to those of skill in the art. In a preferred embodiment, cells are isolated from the subject organism, transfected with a nucleic acid composition, and re-infused back into the subject organism (e.g., patient). Various cell types suitable for ex vivo transfection are well known to those of skill in the art (See, e.g., Freshney et al. (1994) Culture of Animal Cells, A Manual of Basic Technique, 3rd ed, and the references cited therein for a discussion of how to isolate and culture cells from patients).
[0143] Suitable cells include, but are not limited to, eukaryotic cells and/or cell lines. Non-limiting examples of such cells or cell lines generated from such cells include COS, CHO (e.g., CHO--S, CHO-K1, CHO-DG44, CHO-DUXB11, CHO-DUKX, CHOK1SV), VERO, MDCK, WI38, V79, B14AF28-G3, BHK, HaK, NSO, SP2/0-Ag14, HeLa, HEK293 (e.g., HEK293-F, HEK293-H, HEK293-T), perC6 cells, any plant cell (differentiated or undifferentiated), as well as insect cells such as Spodopterafugiperda (Sf), or fungal cells such as Saccharomyces, Pichia and Schizosaccharomyces. In certain embodiments, the cell line is a CHO-K1, MDCK or HEK293 cell line. Additionally, primary cells may be isolated and used ex vivo for reintroduction into the subject to be treated following treatment with a guided nuclease system (e.g. CRISPR/Cas). Suitable primary cells include peripheral blood mononuclear cells (PBMC), and other blood cell subsets such as, but not limited to, CD4+ T cells or CD8+ T cells. Suitable cells also include stem cells such as, by way of example, embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells (CD34+), neuronal stem cells and mesenchymal stem cells.
[0144] In one embodiment, stem cells are used in ex vivo procedures for cell transfection and gene therapy. The advantage to using stem cells is that they can be differentiated into other cell types in vitro, or can be introduced into a mammal (such as the donor of the cells) where they will engraft in the bone marrow. Methods for differentiating CD34+ cells in vitro into clinically important immune cell types using cytokines such a GM-CSF, IFN-gamma, and TNF-alpha are known (as a non-limiting example see, Inaba et al., J. Exp. Med. 176:1693-1702 (1992)).
[0145] Stem cells are isolated for transduction and differentiation using known methods. For example, stem cells are isolated from bone marrow cells by panning the bone marrow cells with antibodies which bind unwanted cells, such as CD4+ and CD8+ (T cells), CD45+(panB cells), GR-1 (granulocytes), and Iad (differentiated antigen presenting cells) (as anon-limiting example see Inaba et al. (1992) J. Exp. Med. 176:1693-1702). Stem cells that have been modified may also be used in some embodiments.
[0146] Any one of the RNA molecule compositions described herein is suitable for genome editing in post-mitotic cells or any cell which is not actively dividing, e.g., arrested cells. Examples of post-mitotic cells which may be edited using a composition of the present invention include, but are not limited to, a photoreceptor cell, a rod photoreceptor cell, a cone photoreceptor cell, a retinal pigment epithelium (RPE), a glial cell, Muller cell, and a ganglion.
[0147] Vectors (e.g., retroviruses, liposomes, etc.) containing therapeutic nucleic acid compositions can also be administered directly to an organism for transduction of cells in vivo. Administration is by any of the routes normally used for introducing a molecule into ultimate contact with blood or tissue cells including, but not limited to, injection, infusion, topical application (e.g., eye drops and cream) and electroporation. Suitable methods of administering such nucleic acids are available and well known to those of skill in the art, and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route. According to some embodiments, the composition is delivered via sub-retinal injection. According to some embodiments, the composition is delivered via intravitreal injection.
[0148] Vectors suitable for introduction of transgenes into immune cells (e.g., T-cells) include non-integrating lentivirus vectors. See, e.g., U.S. Pat. Publication No. 2009- 0117617.
[0149] Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions available, as described below (See, e.g., Remington’s Pharmaceutical Sciences, 17th ed., 1989).
[0150] In accordance with some embodiments, there is provided an RNA molecule which binds to/ associates with and/or directs the RNA guided DNA nuclease to a sequence comprising at least one nucleotide which differs between a mutated allele and a functional allele (e.g., SNP) of a gene of interest (i.e., a sequence of the mutated allele which is not present in the functional allele). The sequence may be within the disease associated mutation. The sequence may be upstream or downstream to the disease associated mutation. Any sequence difference between the mutated allele and the functional allele may be targeted by an RNA molecule of the present invention to inactivate the mutant allele, or otherwise disable its dominant disease-causing effects, while preserving the activity of the functional allele.
[0151] The disclosed compositions and methods may also be used in the manufacture of a medicament for treating dominant genetic disorders in a patient.
Examples of RNA Guide Sequences Which Specifically Target Mutated Alleles of BEST1 Gene
[0152] Although a large number of guide sequences can be designed to target a mutated allele, the nucleotide sequences described in Tables 2 identified by SEQ ID NOs: 1-3010 below were specifically selected to effectively implement the methods set forth herein and to effectively discriminate between alleles.
[0153] Referring to columns 1-4, each of SEQ ID NOs. 1-3010 indicated in column 1 corresponds to an engineered guide sequence. The corresponding SNP details are indicated in column 2. The SNP details indicated in the 2nd column include the assigned identifier for each SNP corresponding to a SNP ID indicated in Table 1. Column 3 indicates whether the target of each guide sequence is the BEST1 gene polymorph or wild type (REF) sequence. Column 4 indicates the guanine-cytosine content of each guide sequence.
[0154] Table 2 shows guide sequences designed for use as described in the embodiments above to associate with different SNPs within a sequence of a mutated BEST1 allele. Each engineered guide molecule is further designed such as to associate with a target genomic DNA sequence of interest that lies next to a protospacer adjacent motif (PAM), e.g., a PAM matching the sequence NGG or NAG, where “N” is any nucleobase. The guide sequences were designed to work in conjunction with one or more different CRISPR nucleases, including, but not limited to, e.g. SpCas9WT (PAM SEQ: NGG), SpCas9.VQR.1 (PAM SEQ: NGAN), SpCas9.VQR.2 (PAM SEQ: NGNG), SpCas9.EQR (PAM SEQ: NGAG), SpCas9.VRER (PAM SEQ: NGCG), SaCas9WT (PAM SEQ: NNGRRT), NmCas9WT (PAM SEQ: NNNNGATT), Cpfl (PAM SEQ: TTTV), or JeCas9WT (PAM SEQ: NNNVRYM). RNA molecules of the present invention are each designed to form complexes in conjunction with one or more different CRISPR nucleases and designed to target polynucleotide sequences of interest utilizing one or more different PAM sequences respective to the CRISPR nuclease utilized
TABLE-US-00002 Guide sequences designed to associate with specific SNPs of the BEST1 gene SEQ ID NO: SNP ID (Table 1) Target (SNP/REF) %GC 1 s1 BOTH 45% 2 s1 BOTH 45% 3 s2 BOTH 70% 7 s6 BOTH 50% 8 s6 BOTH 50% 9 s8 BOTH 45% 10 s9 BOTH 50% 11 s9 BOTH 55% 12 s12 BOTH 65% 13 s13 BOTH 60% 14 s14 BOTH 60% 15 s14 BOTH 65% 16 s15 BOTH 75% 17 s16 BOTH 40% 18 s16 BOTH 40% 19 s17 BOTH 55% 20 s20 BOTH 45% 21 s21,s22 BOTH,BOTH 45% 22 s23 BOTH 50% 23 s23 BOTH 50% 24 s24 BOTH 50% 25 s24 BOTH 50% 26 s27 BOTH 50% 27 s29 BOTH 35% 28 s31 BOTH 65% 29 s31 BOTH 65% 30 s32 BOTH 45% 31 s32 BOTH 45% 32 s35 BOTH 55% 33 s35 BOTH 55% 34 s36 BOTH 40% 35 s38 BOTH 60% 36 s40 BOTH 45% 37 s41 BOTH 55% 38 s41 BOTH 70% 39 s41 BOTH 55% 40 s42 BOTH 45% 41 s43 BOTH 40% 42 s43 BOTH 50% 79 s62 BOTH 40% 80 s63 BOTH 45% 81 s63 BOTH 55% 82 s63 BOTH 35% 83 s65 BOTH 50% 84 s65 BOTH 45% 85 s66 BOTH 80% 86 s66 BOTH 80% 87 s67 BOTH 35% 88 s69 BOTH 65% 89 s69 BOTH 60% 90 s69 BOTH 70% 91 s71 BOTH 70% 92 s71 BOTH 70% 93 s72 BOTH 40% 94 s72 BOTH 45% 95 s73 BOTH 60% 96 s74 BOTH 50% 97 s74 BOTH 50% 98 s76 BOTH 45% 99 s76 BOTH 40% 100 s79 REF 35% 101 s80 SNP 45% 102 s1 SNP 45% 103 s1 REF 40% 104 s1 SNP 50% 105 s1 REF 45% 106 s1 SNP 45% 107 s1 REF 40% 108 s1 SNP 50% 109 s1 REF 45% 110 s2 SNP 65% 111 s2 REF 70% 112 s2 SNP 55% 113 s2 REF 60% 114 s3 REF 60% 151 s7 SNP 55% 152 s7 SNP 50% 153 s7 REF 55% 154 s7 REF 65% 155 s7 REF 55% 156 s7 SNP 50% 157 s7 SNP 60% 158 s7 SNP 50% 159 s7 REF 55% 160 s7 SNP 50% 161 s7 REF 55% 162 s7 REF 60% 163 s7 SNP 55% 164 s7 REF 55% 165 s7 SNP 50% 166 s8 SNP 45% 167 s8 REF 45% 168 s8 SNP 50% 169 s8 REF 45% 170 s8 SNP 50% 171 s8 REF 40% 172 s9 SNP 50% 173 s9 REF 55% 174 s9 SNP 65% 175 s9 REF 70% 176 s9 SNP 55% 177 s9 REF 60% 178 s9 SNP 60% 179 s9 REF 65% 180 s10 SNP 35% 181 s10 REF 40% 182 s10 REF 30% 183 s10 REF 30% 184 s11 REF 30% 185 s12 REF 65% 186 s12 SNP 70% 223 s15 SNP 85% 224 s15 REF 85% 225 s15 SNP 80% 226 s15 REF 80% 227 s15 SNP 70% 228 s15 REF 70% 229 s15 SNP 70% 230 s15 REF 70% 231 s15 SNP 75% 232 s15 REF 75% 233 s15 SNP 80% 234 s15 REF 80% 235 s15 SNP 65% 236 s15 REF 65% 237 s16 REF 45% 238 s16 SNP 40% 239 s16 REF 60% 240 s16 SNP 55% 241 s16 REF 60% 242 s16 SNP 55% 243 s16 SNP 55% 244 s16 REF 60% 245 s17 SNP 60% 246 s17 REF 65% 247 s17 REF 65% 248 s17 SNP 60% 249 s17 SNP 65% 250 s17 REF 70% 251 s17 REF 55% 252 s17 SNP 50% 253 s17 REF 65% 254 s17 SNP 60% 255 s17 REF 65% 256 s17 SNP 60% 257 s18 REF 55% 258 s18 SNP 50% 295 s24 REF 55% 296 s24 SNP 50% 297 s24 REF 50% 298 s24 SNP 45% 299 s24 REF 55% 300 s24 SNP 50% 301 s24 SNP 50% 302 s25 SNP 55% 303 s25 REF 60% 304 s25 REF 55% 305 s25 REF 65% 306 s25 SNP 60% 307 s25 SNP 50% 308 s25 REF 50% 309 s25 SNP 45% 310 s26 REF 65% 311 s26 SNP 60% 312 s26 REF 70% 313 s26 SNP 65% 314 s26 SNP 60% 315 s26 REF 65% 316 s26 SNP 35% 317 s26 REF 40% 318 s26 SNP 50% 319 s26 REF 55% 320 s26 SNP 60% 321 s26 REF 65% 322 s26 REF 65% 323 s26 SNP 60% 324 s26 SNP 55% 325 s26 REF 60% 326 s27 REF 50% 327 s27 SNP 45% 328 s27 SNP 45% 329 s28 SNP 60% 330 s28 REF 55% 367 s32 REF 45% 368 s32 SNP 50% 369 s33 SNP 55% 370 s33 REF 60% 371 s33 SNP 60% 372 s33 REF 65% 373 s33 SNP 60% 374 s33 REF 65% 375 s34 SNP 60% 376 s34 REF 65% 377 s34 SNP 60% 378 s34 REF 65% 379 s34 REF 65% 380 s34 SNP 60% 381 s35 REF 60% 382 s35 REF 65% 383 s35 REF 65% 384 s35 SNP 60% 385 s35 REF 60% 386 s36 SNP 55% 387 s36 REF 50% 388 s36 SNP 45% 389 s36 REF 40% 390 s36 REF 50% 391 s36 SNP 55% 392 s36 REF 40% 393 s36 SNP 45% 394 s37 REF 65% 395 s37 SNP 60% 396 s37 SNP 55% 397 s37 REF 60% 398 s37 SNP 55% 399 s37 REF 60% 400 s37 REF 55% 401 s37 SNP 50% 402 s37 SNP 60% 439 s40 REF 40% 440 s41 REF 70% 441 s41 SNP 70% 442 s41 REF 60% 443 s41 REF 60% 444 s41 REF 70% 445 s41 SNP 60% 446 s41 REF 60% 447 s41 REF 60% 448 s41 SNP 60% 449 s41 REF 65% 450 s41 SNP 65% 451 s41 SNP 70% 452 s41 SNP 65% 453 s41 REF 65% 454 s41 REF 65% 455 s41 REF 70% 456 s41 REF 70% 457 s41 REF 65% 458 s42 SNP 65% 459 s42 REF 70% 460 s42 SNP 55% 461 s42 REF 60% 462 s42 REF 55% 463 s42 SNP 50% 464 s43 SNP 45% 465 s43 REF 50% 466 s43 SNP 55% 467 s43 REF 60% 468 s43 SNP 50% 469 s43 REF 55% 470 s43 SNP 70% 471 s43 SNP 65% 472 s43 REF 70% 473 s43 SNP 60% 474 s43 REF 65% 511 s53 SNP 30% 512 s53 REF 30% 513 s53 SNP 30% 514 s54 SNP 45% 515 s54 REF 40% 516 s54 REF 40% 517 s54 SNP 45% 518 s54 REF 40% 519 s54 SNP 45% 520 s54 REF 40% 521 s54 SNP 45% 522 s54 SNP 45% 523 s54 REF 40% 524 s55 SNP 45% 525 s55 REF 50% 526 s55 SNP 50% 527 s55 REF 55% 528 s55 SNP 40% 529 s55 REF 45% 530 s55 SNP 40% 531 s55 REF 45% 532 s56 SNP 35% 533 s56 REF 40% 534 s56 REF 40% 535 s56 SNP 35% 536 s56 SNP 40% 537 s56 REF 45% 538 s56 REF 55% 539 s56 SNP 50% 540 s56 REF 50% 541 s56 SNP 45% 542 s56 REF 40% 543 s56 SNP 35% 544 s57 REF 30% 545 s57 REF 35% 546 s57 SNP 30% 583 s62 SNP 50% 584 s62 REF 55% 585 s62 REF 55% 586 s63 REF 55% 587 s63 SNP 50% 588 s63 SNP 55% 589 s63 REF 60% 590 s63 SNP 50% 591 s63 REF 55% 592 s63 SNP 50% 593 s63 REF 55% 594 s63 SNP 45% 595 s63 REF 50% 596 s63 SNP 45% 597 s63 REF 50% 598 s64 REF 45% 599 s64 SNP 40% 600 s64 REF 55% 601 s64 SNP 50% 602 s65 SNP 50% 603 s65 REF 45% 604 s65 REF 45% 605 s65 SNP 50% 606 s65 REF 45% 607 s65 SNP 50% 608 s66 SNP 75% 609 s66 REF 80% 610 s66 REF 60% 611 s66 SNP 55% 612 s66 REF 60% 613 s66 REF 65% 614 s66 SNP 60% 615 s66 SNP 60% 616 s66 REF 65% 617 s66 REF 65% 618 s66 REF 65% 655 s71 REF 80% 656 s71 REF 80% 657 s71 SNP 80% 658 s71 REF 80% 659 s71 SNP 80% 660 s71 REF 85% 661 s71 SNP 85% 662 s71 SNP 70% 663 s71 SNP 75% 664 s71 REF 75% 665 s71 REF 70% 666 s71 SNP 75% 667 s71 REF 75% 668 s72 REF 45% 669 s72 SNP 40% 670 s72 REF 45% 671 s72 REF 45% 672 s72 REF 50% 673 s72 SNP 45% 674 s72 SNP 40% 675 s72 REF 45% 676 s72 REF 50% 677 s72 SNP 45% 678 s73 REF 55% 679 s73 SNP 50% 680 s73 SNP 50% 681 s73 REF 55% 682 s73 REF 60% 683 s73 SNP 55% 684 s73 SNP 50% 685 s73 REF 55% 686 s73 REF 55% 687 s73 SNP 50% 688 s74 SNP 50% 689 s74 REF 45% 690 s74 SNP 40% 727 s5 BOTH 55% 728 s6 BOTH 45% 729 s7 BOTH 60% 730 s7 BOTH 60% 731 s8 BOTH 50% 732 s8 BOTH 50% 733 s8 BOTH 50% 734 s9 BOTH 65% 735 s9 BOTH 60% 736 s10 BOTH 40% 737 s10 BOTH 35% 738 s11 BOTH 45% 739 s12 BOTH 45% 740 s12 BOTH 50% 741 s12 BOTH 65% 742 s13 BOTH 70% 743 s13 BOTH 60% 744 s13 BOTH 55% 745 s14 BOTH 50% 746 s14 BOTH 60% 747 s14 BOTH 50% 748 s14 BOTH 65% 749 s14 BOTH 50% 750 s15 BOTH 70% 751 s15 BOTH 65% 752 s15 BOTH 75% 753 s16 BOTH 70% 754 s16 BOTH 60% 755 s17 BOTH 60% 756 s17 BOTH 65% 757 s17 BOTH 50% 758 s18 BOTH 50% 759 s18 BOTH 50% 760 s18 BOTH 55% 761 s18 BOTH 50% 762 s19 BOTH 40% 799 s34 BOTH 50% 800 s34 BOTH 55% 801 s34 BOTH 70% 802 s34 BOTH 70% 803 s35 BOTH 55% 804 s35 BOTH 55% 805 s35 BOTH 55% 806 s35 BOTH 50% 807 s35 BOTH 50% 808 s35 BOTH 60% 809 s35 BOTH 55% 810 s35 BOTH 50% 811 s35 BOTH 50% 812 s35 BOTH 60% 813 s35 BOTH 55% 814 s35 BOTH 60% 815 s35 BOTH 65% 816 s35 BOTH 55% 817 s35 BOTH 55% 818 s36 BOTH 45% 819 s36 BOTH 40% 820 s36 BOTH 40% 821 s37 BOTH 65% 822 s37 BOTH 80% 823 s37 BOTH 75% 824 s37 BOTH 65% 825 s38 BOTH 50% 826 s38 BOTH 55% 827 s38 BOTH 55% 828 s39 BOTH 45% 829 s39 BOTH 35% 830 s40 BOTH 45% 831 s40 BOTH 45% 832 s40 BOTH 50% 833 s41 BOTH 70% 834 s41 BOTH 65% 871 s48,s47 REF,REF 70% 872 s48,s47 REF,REF 70% 873 s48,s47 REF,REF 65% 874 s48,s47 REF,REF 65% 875 s48,s47 REF,REF 65% 876 s48,s47 REF,REF 65% 877 s48,s47 REF,REF 60% 878 s48,s47 REF,REF 70% 879 s48,s47 REF,REF 70% 880 s48,s47 REF,REF 75% 881 s48,s47 REF,REF 75% 882 s48,s47 REF,REF 70% 883 s48,s47 REF,REF 65% 884 s49 BOTH 55% 885 s50 BOTH 60% 886 s50 BOTH 60% 887 s52 BOTH 45% 888 s52 BOTH 70% 889 s53 BOTH 55% 890 s53 BOTH 55% 891 s54 BOTH 60% 892 s55 BOTH 45% 893 s55 BOTH 35% 894 s56 BOTH 30% 895 s56 BOTH 55% 896 s56 BOTH 50% 897 s57 BOTH 40% 898 s57 BOTH 35% 899 s58 BOTH 45% 900 s58 BOTH 50% 901 s59 BOTH 50% 902 s60 BOTH 65% 903 s60 BOTH 65% 904 s61 BOTH 80% 905 s61 BOTH 80% 906 s62 BOTH 50% 943 s77 BOTH 70% 944 s77 BOTH 30% 945 s78 BOTH 40% 946 s78 BOTH 30% 947 s78 BOTH 30% 948 s79 REF 30% 949 s79 REF 40% 950 s79 REF 30% 951 s79 REF 35% 952 s80 SNP 45% 953 s80 SNP 35% 954 s80 SNP 45% 955 s80 SNP 45% 956 s80 SNP 45% 957 s80 SNP 45% 958 s80 SNP 40% 959 s80 SNP 40% 960 s1 REF 45% 961 s1 SNP 50% 962 s1 SNP 50% 963 s1 REF 45% 964 s1 REF 50% 965 s1 SNP 55% 966 s1 SNP 40% 967 s1 REF 35% 968 s1 REF 45% 969 s1 SNP 50% 970 s1 REF 40% 971 s1 SNP 45% 972 s1 REF 45% 973 s1 REF 50% 974 s1 SNP 55% 975 s1 SNP 50% 976 s1 SNP 55% 977 s1 SNP 55% 978 s1 REF 50% 1015 s3 SNP 65% 1016 s3 SNP 55% 1017 s3 REF 55% 1018 s3 REF 55% 1019 s3 SNP 55% 1020 s3 REF 55% 1021 s3 REF 60% 1022 s3 SNP 60% 1023 s3 SNP 60% 1024 s3 SNP 55% 1025 s3 REF 55% 1026 s3 SNP 55% 1027 s3 REF 55% 1028 s3 SNP 55% 1029 s3 REF 65% 1030 s3 SNP 65% 1031 s3 REF 60% 1032 s3 SNP 60% 1033 s3 REF 60% 1034 s3 SNP 60% 1035 s3 REF 60% 1036 s3 SNP 55% 1037 s4 SNP 50% 1038 s4 REF 45% 1039 s4 REF 50% 1040 s4 SNP 55% 1041 s4 REF 40% 1042 s4 SNP 45% 1043 s4 SNP 55% 1044 s4 SNP 50% 1045 s4 REF 45% 1046 s4 SNP 45% 1047 s4 REF 40% 1048 s4 REF 45% 1049 s4 SNP 50% 1050 s4 REF 45% 1087 s5 REF 65% 1088 s5 REF 65% 1089 s5 REF 60% 1090 s5 SNP 60% 1091 s5 SNP 60% 1092 s5 REF 60% 1093 s5 REF 60% 1094 s5 SNP 60% 1095 s5 REF 65% 1096 s5 SNP 65% 1097 s5 REF 65% 1098 s5 SNP 65% 1099 s6 REF 40% 1100 s6 SNP 45% 1101 s6 SNP 50% 1102 s6 REF 45% 1103 s6 REF 40% 1104 s6 SNP 45% 1105 s6 SNP 45% 1106 s6 REF 40% 1107 s6 REF 50% 1108 s6 SNP 55% 1109 s6 SNP 55% 1110 s6 REF 50% 1111 s6 REF 45% 1112 s6 SNP 50% 1113 s6 REF 40% 1114 s6 SNP 45% 1115 s6 SNP 55% 1116 s6 REF 50% 1117 s6 REF 50% 1118 s6 SNP 55% 1119 s6 SNP 45% 1120 s6 REF 40% 1121 s6 SNP 55% 1122 s6 REF 50% 1159 s8 REF 45% 1160 s8 SNP 50% 1161 s8 SNP 50% 1162 s8 REF 45% 1163 s8 SNP 45% 1164 s8 REF 40% 1165 s8 REF 35% 1166 s8 SNP 40% 1167 s8 SNP 50% 1168 s8 REF 45% 1169 s8 SNP 45% 1170 s8 REF 40% 1171 s8 SNP 45% 1172 s8 REF 40% 1173 s8 REF 40% 1174 s8 SNP 45% 1175 s8 SNP 40% 1176 s8 REF 35% 1177 s8 SNP 40% 1178 s8 REF 35% 1179 s8 SNP 50% 1180 s8 REF 45% 1181 s8 SNP 50% 1182 s8 REF 45% 1183 s8 REF 40% 1184 s8 SNP 45% 1185 s9 SNP 60% 1186 s9 REF 65% 1187 s9 REF 60% 1188 s9 SNP 55% 1189 s9 REF 55% 1190 s9 SNP 50% 1191 s9 SNP 60% 1192 s9 REF 65% 1193 s9 SNP 50% 1194 s9 REF 55% 1231 s11 SNP 45% 1232 s11 SNP 45% 1233 s11 REF 50% 1234 s11 SNP 50% 1235 s11 REF 55% 1236 s11 SNP 45% 1237 s11 REF 50% 1238 s11 SNP 40% 1239 s11 REF 45% 1240 s11 REF 50% 1241 s11 SNP 45% 1242 s11 REF 35% 1243 s11 SNP 30% 1244 s11 REF 50% 1245 s11 SNP 45% 1246 s11 REF 45% 1247 s11 SNP 40% 1248 s11 REF 55% 1249 s11 SNP 50% 1250 s11 REF 50% 1251 s11 SNP 45% 1252 s11 REF 40% 1253 s11 SNP 35% 1254 s11 SNP 35% 1255 s11 REF 40% 1256 s11 SNP 30% 1257 s11 REF 35% 1258 s12 REF 60% 1259 s12 SNP 65% 1260 s12 SNP 70% 1261 s12 REF 65% 1262 s12 REF 65% 1263 s12 SNP 70% 1264 s12 SNP 65% 1265 s12 REF 60% 1266 s12 SNP 70% 1303 s13 REF 75% 1304 s13 REF 65% 1305 s13 REF 75% 1306 s13 SNP 70% 1307 s13 REF 75% 1308 s13 SNP 70% 1309 s13 REF 75% 1310 s13 SNP 70% 1311 s13 SNP 60% 1312 s13 REF 70% 1313 s13 SNP 65% 1314 s13 SNP 65% 1315 s13 REF 70% 1316 s13 REF 75% 1317 s13 SNP 70% 1318 s14 SNP 60% 1319 s14 REF 55% 1320 s14 SNP 55% 1321 s14 REF 50% 1322 s14 REF 55% 1323 s14 REF 55% 1324 s14 REF 50% 1325 s14 SNP 65% 1326 s14 REF 60% 1327 s14 REF 65% 1328 s14 SNP 70% 1329 s14 SNP 70% 1330 s14 REF 65% 1331 s14 REF 55% 1332 s14 SNP 60% 1333 s14 REF 65% 1334 s14 REF 55% 1335 s14 REF 65% 1336 s14 SNP 70% 1337 s14 REF 60% 1338 s14 REF 60% 1375 s15 REF 70% 1376 s15 SNP 70% 1377 s15 REF 70% 1378 s15 SNP 70% 1379 s15 REF 75% 1380 s15 SNP 75% 1381 s15 REF 85% 1382 s15 SNP 85% 1383 s15 REF 80% 1384 s15 SNP 80% 1385 s15 REF 80% 1386 s15 REF 75% 1387 s15 SNP 75% 1388 s15 REF 70% 1389 s15 SNP 70% 1390 s15 SNP 80% 1391 s15 SNP 75% 1392 s15 REF 75% 1393 s15 SNP 80% 1394 s15 REF 80% 1395 s15 SNP 70% 1396 s15 REF 70% 1397 s16 SNP 55% 1398 s16 REF 60% 1399 s16 REF 60% 1400 s16 SNP 55% 1401 s16 SNP 40% 1402 s16 REF 45% 1403 s16 SNP 45% 1404 s16 SNP 55% 1405 s16 REF 60% 1406 s16 SNP 50% 1407 s16 REF 55% 1408 s16 SNP 60% 1409 s16 REF 65% 1410 s16 REF 65% 1447 s17 REF 65% 1448 s17 SNP 60% 1449 s17 REF 50% 1450 s17 SNP 60% 1451 s17 REF 65% 1452 s17 REF 65% 1453 s17 SNP 60% 1454 s17 SNP 45% 1455 s17 SNP 60% 1456 s17 REF 65% 1457 s18 REF 55% 1458 s18 SNP 50% 1459 s18 REF 55% 1460 s18 SNP 50% 1461 s18 REF 55% 1462 s18 SNP 50% 1463 s18 REF 50% 1464 s18 SNP 45% 1465 s18 SNP 45% 1466 s18 REF 50% 1467 s18 SNP 45% 1468 s18 SNP 50% 1469 s18 REF 55% 1470 s18 SNP 45% 1471 s18 REF 55% 1472 s18 SNP 50% 1473 s18 REF 55% 1474 s18 SNP 50% 1475 s18 REF 50% 1476 s18 SNP 45% 1477 s18 REF 50% 1478 s18 REF 55% 1479 s18 SNP 50% 1480 s18 REF 55% 1481 s18 SNP 50% 1482 s18 REF 50% 1519 s21 SNP 65% 1520 s21 SNP 70% 1521 s21 SNP 70% 1522 s21 SNP 70% 1523 s21 SNP 75% 1524 s21 SNP 75% 1525 s21 SNP 65% 1526 s21 SNP 70% 1527 s23 REF 50% 1528 s23 SNP 55% 1529 s23 SNP 50% 1530 s23 REF 45% 1531 s23 REF 45% 1532 s23 SNP 50% 1533 s23 SNP 60% 1534 s23 REF 55% 1535 s23 REF 50% 1536 s23 SNP 55% 1537 s23 REF 55% 1538 s23 SNP 60% 1539 s23 SNP 55% 1540 s23 SNP 65% 1541 s23 REF 60% 1542 s23 REF 50% 1543 s23 SNP 55% 1544 s23 SNP 60% 1545 s23 REF 55% 1546 s23 SNP 55% 1547 s23 REF 50% 1548 s23 REF 60% 1549 s23 SNP 65% 1550 s23 SNP 55% 1551 s23 REF 50% 1552 s23 REF 55% 1553 s23 SNP 60% 1554 s23 SNP 60% 1591 s25 SNP 45% 1592 s25 REF 50% 1593 s25 REF 60% 1594 s25 SNP 55% 1595 s25 SNP 50% 1596 s25 REF 55% 1597 s25 REF 65% 1598 s25 SNP 60% 1599 s25 SNP 55% 1600 s25 REF 60% 1601 s25 REF 60% 1602 s25 SNP 55% 1603 s25 REF 60% 1604 s25 SNP 55% 1605 s26 SNP 45% 1606 s26 REF 50% 1607 s26 REF 55% 1608 s26 SNP 50% 1609 s26 REF 50% 1610 s26 SNP 45% 1611 s26 SNP 45% 1612 s26 REF 50% 1613 s26 REF 40% 1614 s26 SNP 35% 1615 s26 SNP 60% 1616 s26 REF 60% 1617 s26 SNP 55% 1618 s26 REF 65% 1619 s26 SNP 60% 1620 s26 REF 50% 1621 s26 SNP 45% 1622 s26 REF 65% 1623 s26 SNP 60% 1624 s26 SNP 65% 1625 s26 REF 70% 1626 s26 SNP 60% 1663 s28 SNP 65% 1664 s28 REF 60% 1665 s28 REF 65% 1666 s28 SNP 70% 1667 s28 REF 60% 1668 s28 SNP 65% 1669 s28 REF 55% 1670 s28 SNP 60% 1671 s28 SNP 70% 1672 s28 REF 65% 1673 s28 REF 55% 1674 s28 SNP 60% 1675 s28 SNP 55% 1676 s28 REF 50% 1677 s28 SNP 65% 1678 s28 REF 60% 1679 s28 SNP 60% 1680 s28 REF 65% 1681 s28 SNP 70% 1682 s28 SNP 70% 1683 s28 REF 65% 1684 s28 REF 60% 1685 s28 SNP 65% 1686 s28 REF 55% 1687 s28 SNP 55% 1688 s28 SNP 55% 1689 s28 SNP 60% 1690 s28 REF 55% 1691 s83 SNP 45% 1692 s83 SNP 50% 1693 s83 SNP 40% 1694 s83 SNP 45% 1695 s83 SNP 45% 1696 s83 SNP 50% 1697 s83 SNP 50% 1698 s29 SNP 50% 1735 s30 SNP 75% 1736 s30 SNP 65% 1737 s30 SNP 60% 1738 s30 SNP 65% 1739 s30 SNP 65% 1740 s30 SNP 70% 1741 s30 REF 65% 1742 s30 SNP 65% 1743 s30 SNP 60% 1744 s30 SNP 65% 1745 s30 REF 60% 1746 s30 SNP 65% 1747 s31 REF 35% 1748 s31 SNP 35% 1749 s31 REF 50% 1750 s31 SNP 50% 1751 s31 SNP 40% 1752 s31 REF 40% 1753 s31 REF 70% 1754 s31 REF 55% 1755 s31 SNP 55% 1756 s31 SNP 40% 1757 s31 REF 40% 1758 s31 REF 40% 1759 s31 SNP 40% 1760 s31 SNP 70% 1761 s31 SNP 50% 1762 s31 REF 50% 1763 s31 SNP 55% 1764 s31 REF 55% 1765 s31 SNP 50% 1766 s31 REF 50% 1767 s31 SNP 70% 1768 s31 REF 70% 1769 s31 REF 60% 1770 s31 SNP 60% 1807 s32 REF 65% 1808 s32 SNP 70% 1809 s32 REF 55% 1810 s32 SNP 60% 1811 s32 REF 50% 1812 s32 SNP 55% 1813 s32 SNP 55% 1814 s32 REF 50% 1815 s32 SNP 55% 1816 s32 REF 50% 1817 s32 SNP 55% 1818 s32 SNP 55% 1819 s32 REF 50% 1820 s32 SNP 60% 1821 s32 REF 55% 1822 s33 REF 65% 1823 s33 SNP 60% 1824 s33 REF 65% 1825 s33 SNP 60% 1826 s33 REF 65% 1827 s33 SNP 60% 1828 s33 REF 70% 1829 s33 SNP 65% 1830 s33 REF 70% 1831 s33 SNP 65% 1832 s33 REF 70% 1833 s33 SNP 65% 1834 s33 REF 60% 1835 s33 SNP 65% 1836 s33 REF 70% 1837 s33 SNP 60% 1838 s33 REF 65% 1839 s33 SNP 55% 1840 s34 SNP 65% 1841 s34 SNP 60% 1842 s34 REF 65% 1879 s36 SNP 45% 1880 s36 REF 35% 1881 s36 SNP 40% 1882 s36 SNP 40% 1883 s36 REF 50% 1884 s36 SNP 55% 1885 s36 REF 35% 1886 s36 SNP 40% 1887 s36 REF 35% 1888 s36 SNP 40% 1889 s36 REF 40% 1890 s36 SNP 45% 1891 s36 SNP 55% 1892 s36 REF 50% 1893 s36 SNP 40% 1894 s36 REF 35% 1895 s36 REF 35% 1896 s36 REF 40% 1897 s36 SNP 45% 1898 s36 SNP 45% 1899 s36 REF 40% 1900 s36 SNP 45% 1901 s36 REF 40% 1902 s36 REF 50% 1903 s36 SNP 55% 1904 s36 SNP 55% 1905 s36 REF 50% 1906 s36 SNP 45% 1907 s36 REF 40% 1908 s37 SNP 50% 1909 s37 REF 55% 1910 s37 SNP 55% 1911 s37 REF 60% 1912 s37 REF 60% 1913 s37 SNP 55% 1914 s37 REF 70% 1951 s38 REF 50% 1952 s38 SNP 45% 1953 s38 SNP 50% 1954 s38 REF 55% 1955 s38 SNP 50% 1956 s38 REF 55% 1957 s38 REF 55% 1958 s38 SNP 50% 1959 s38 REF 55% 1960 s38 SNP 50% 1961 s39 REF 40% 1962 s39 SNP 45% 1963 s39 REF 40% 1964 s39 SNP 45% 1965 s39 REF 40% 1966 s39 SNP 45% 1967 s39 SNP 30% 1968 s39 SNP 30% 1969 s39 SNP 30% 1970 s39 SNP 45% 1971 s39 REF 40% 1972 s39 REF 40% 1973 s39 SNP 45% 1974 s39 REF 30% 1975 s39 SNP 35% 1976 s39 SNP 30% 1977 s39 REF 30% 1978 s39 SNP 35% 1979 s39 SNP 35% 1980 s39 REF 30% 1981 s39 SNP 30% 1982 s40 SNP 45% 1983 s40 SNP 35% 1984 s40 REF 40% 1985 s40 SNP 45% 1986 s40 REF 50% 2023 s41 SNP 70% 2024 s41 REF 60% 2025 s41 REF 65% 2026 s41 SNP 65% 2027 s41 REF 65% 2028 s41 SNP 60% 2029 s41 REF 65% 2030 s41 SNP 65% 2031 s41 REF 60% 2032 s41 REF 65% 2033 s41 REF 60% 2034 s41 REF 65% 2035 s41 REF 65% 2036 s41 REF 65% 2037 s41 SNP 65% 2038 s41 SNP 65% 2039 s41 REF 65% 2040 s41 REF 65% 2041 s41 SNP 65% 2042 s41 REF 70% 2043 s41 REF 60% 2044 s41 REF 65% 2045 s41 SNP 65% 2046 s41 REF 65% 2047 s41 SNP 60% 2048 s41 REF 60% 2049 s41 SNP 60% 2050 s41 REF 60% 2051 s41 REF 60% 2052 s41 SNP 60% 2053 s41 REF 60% 2054 s42 REF 70% 2055 s42 SNP 65% 2056 s42 SNP 45% 2057 s42 REF 50% 2058 s42 REF 55% 2095 s43 REF 70% 2096 s43 SNP 65% 2097 s43 REF 75% 2098 s43 SNP 70% 2099 s43 SNP 70% 2100 s43 REF 70% 2101 s43 SNP 65% 2102 s43 SNP 50% 2103 s43 REF 75% 2104 s43 SNP 70% 2105 s43 SNP 70% 2106 s43 REF 75% 2107 s43 REF 75% 2108 s43 SNP 70% 2109 s43 REF 65% 2110 s43 SNP 60% 2111 s46 SNP 45% 2112 s46 REF 45% 2113 s46 REF 40% 2114 s46 SNP 40% 2115 s46 REF 50% 2116 s46 SNP 50% 2117 s46 REF 35% 2118 s46 SNP 35% 2119 s46 REF 45% 2120 s46 SNP 45% 2121 s46 SNP 50% 2122 s46 SNP 45% 2123 s46 SNP 50% 2124 s46 REF 50% 2125 s46 SNP 50% 2126 s46 SNP 45% 2127 s46 REF 45% 2128 s46 SNP 50% 2129 s46 REF 50% 2130 s46 REF 50% 2167 s48 SNP 60% 2168 s48 SNP 65% 2169 s48 SNP 60% 2170 s49 SNP 45% 2171 s49 SNP 55% 2172 s49 SNP 45% 2173 s50 REF 60% 2174 s50 SNP 55% 2175 s50 REF 60% 2176 s50 SNP 55% 2177 s50 SNP 55% 2178 s50 REF 60% 2179 s50 REF 60% 2180 s50 SNP 55% 2181 s50 REF 60% 2182 s50 SNP 55% 2183 s51 REF 65% 2184 s51 REF 50% 2185 s52 REF 60% 2186 s52 SNP 55% 2187 s52 REF 80% 2188 s52 SNP 75% 2189 s52 SNP 45% 2190 s52 REF 75% 2191 s52 SNP 70% 2192 s52 REF 70% 2193 s52 REF 50% 2194 s52 SNP 45% 2195 s52 REF 50% 2196 s52 REF 60% 2197 s52 SNP 55% 2198 s52 SNP 55% 2199 s52 REF 60% 2200 s52 REF 60% 2201 s52 SNP 55% 2202 s52 SNP 50% 2239 s53 REF 50% 2240 s53 SNP 50% 2241 s53 REF 45% 2242 s53 SNP 45% 2243 s53 SNP 30% 2244 s53 REF 30% 2245 s53 REF 55% 2246 s53 SNP 40% 2247 s53 REF 40% 2248 s53 SNP 50% 2249 s53 REF 50% 2250 s53 SNP 55% 2251 s53 SNP 35% 2252 s53 REF 35% 2253 s54 REF 50% 2254 s54 SNP 55% 2255 s54 REF 40% 2256 s54 SNP 45% 2257 s54 REF 55% 2258 s54 SNP 45% 2259 s54 REF 40% 2260 s54 SNP 60% 2261 s54 REF 55% 2262 s54 SNP 60% 2263 s54 REF 55% 2264 s54 SNP 60% 2265 s54 SNP 45% 2266 s54 SNP 45% 2267 s54 REF 40% 2268 s54 SNP 45% 2269 s54 REF 40% 2270 s54 REF 50% 2271 s54 SNP 55% 2272 s54 SNP 55% 2273 s54 REF 50% 2274 s54 REF 40% 2311 s55 SNP 40% 2312 s55 REF 45% 2313 s55 SNP 45% 2314 s55 REF 50% 2315 s56 REF 50% 2316 s56 SNP 45% 2317 s56 SNP 30% 2318 s56 SNP 35% 2319 s56 REF 40% 2320 s56 REF 35% 2321 s56 REF 35% 2322 s56 SNP 30% 2323 s56 SNP 50% 2324 s56 REF 55% 2325 s56 SNP 30% 2326 s56 SNP 45% 2327 s56 REF 50% 2328 s56 REF 55% 2329 s56 REF 35% 2330 s56 SNP 45% 2331 s56 REF 50% 2332 s56 SNP 35% 2333 s56 REF 40% 2334 s56 REF 35% 2335 s56 SNP 30% 2336 s56 SNP 50% 2337 s56 REF 55% 2338 s56 REF 45% 2339 s56 SNP 40% 2340 s56 SNP 50% 2341 s56 REF 40% 2342 s56 SNP 35% 2343 s57 REF 30% 2344 s57 REF 30% 2345 s57 REF 30% 2346 s57 REF 35% 2383 s58 REF 55% 2384 s58 SNP 50% 2385 s58 REF 55% 2386 s58 SNP 50% 2387 s58 SNP 45% 2388 s58 REF 50% 2389 s58 SNP 50% 2390 s58 REF 55% 2391 s58 REF 50% 2392 s58 SNP 45% 2393 s58 REF 45% 2394 s58 SNP 40% 2395 s58 SNP 50% 2396 s58 REF 55% 2397 s58 REF 50% 2398 s58 SNP 45% 2399 s58 REF 50% 2400 s58 SNP 45% 2401 s58 SNP 45% 2402 s58 SNP 45% 2403 s59 REF 50% 2404 s59 SNP 55% 2405 s59 SNP 55% 2406 s59 SNP 55% 2407 s59 REF 50% 2408 s59 REF 50% 2409 s59 SNP 55% 2410 s59 SNP 55% 2411 s59 REF 50% 2412 s59 SNP 55% 2413 s60 SNP 60% 2414 s60 REF 65% 2415 s60 SNP 60% 2416 s60 REF 65% 2417 s60 REF 65% 2418 s60 SNP 60% 2455 s61 SNP 60% 2456 s61 SNP 60% 2457 s61 SNP 60% 2458 s61 SNP 70% 2459 s61 REF 65% 2460 s61 REF 70% 2461 s61 REF 70% 2462 s61 SNP 70% 2463 s61 REF 60% 2464 s61 REF 65% 2465 s61 REF 55% 2466 s61 SNP 55% 2467 s61 SNP 65% 2468 s61 SNP 70% 2469 s62 SNP 50% 2470 s62 REF 50% 2471 s62 REF 45% 2472 s62 SNP 45% 2473 s62 REF 50% 2474 s62 REF 50% 2475 s62 SNP 45% 2476 s62 SNP 45% 2477 s62 REF 55% 2478 s62 REF 45% 2479 s62 REF 55% 2480 s62 REF 50% 2481 s62 SNP 50% 2482 s62 SNP 50% 2483 s62 REF 55% 2484 s62 REF 50% 2485 s62 REF 55% 2486 s62 SNP 55% 2487 s62 REF 55% 2488 s62 SNP 55% 2489 s62 SNP 50% 2490 s62 REF 50% 2527 s63 SNP 50% 2528 s63 REF 55% 2529 s64 REF 60% 2530 s64 SNP 55% 2531 s64 SNP 45% 2532 s64 REF 50% 2533 s64 REF 55% 2534 s64 SNP 50% 2535 s64 SNP 55% 2536 s64 REF 60% 2537 s64 REF 50% 2538 s64 SNP 45% 2539 s64 SNP 40% 2540 s64 REF 45% 2541 s65 REF 45% 2542 s65 SNP 50% 2543 s65 SNP 50% 2544 s65 REF 45% 2545 s65 REF 45% 2546 s65 SNP 50% 2547 s65 SNP 50% 2548 s65 REF 45% 2549 s65 REF 45% 2550 s65 SNP 50% 2551 s65 REF 50% 2552 s65 SNP 55% 2553 s65 SNP 50% 2554 s65 REF 50% 2555 s65 SNP 55% 2556 s65 REF 55% 2557 s65 SNP 60% 2558 s65 SNP 60% 2559 s65 REF 55% 2560 s65 SNP 55% 2561 s65 REF 50% 2562 s65 REF 45% 2599 s86 SNP 30% 2600 s66 SNP 65% 2601 s66 REF 70% 2602 s66 REF 75% 2603 s66 SNP 70% 2604 s66 SNP 60% 2605 s66 REF 65% 2606 s66 SNP 60% 2607 s66 REF 65% 2608 s66 REF 60% 2609 s66 SNP 55% 2610 s66 SNP 60% 2611 s66 REF 65% 2612 s66 REF 80% 2613 s66 SNP 75% 2614 s66 REF 70% 2615 s66 SNP 65% 2616 s66 SNP 55% 2617 s66 REF 60% 2618 s66 REF 60% 2619 s66 SNP 55% 2620 s66 SNP 70% 2621 s66 REF 75% 2622 s66 SNP 55% 2623 s66 REF 60% 2624 s67 REF 35% 2625 s67 SNP 40% 2626 s67 SNP 50% 2627 s67 REF 45% 2628 s67 REF 40% 2629 s67 SNP 35% 2630 s67 REF 30% 2631 s67 SNP 45% 2632 s67 REF 30% 2633 s67 SNP 35% 2634 s67 REF 40% 2671 s68 SNP 50% 2672 s68 REF 55% 2673 s68 REF 55% 2674 s68 SNP 50% 2675 s68 REF 50% 2676 s68 SNP 55% 2677 s68 REF 60% 2678 s68 REF 50% 2679 s68 SNP 45% 2680 s68 REF 60% 2681 s68 SNP 55% 2682 s68 REF 55% 2683 s68 SNP 45% 2684 s68 REF 50% 2685 s68 REF 50% 2686 s68 SNP 45% 2687 s68 REF 50% 2688 s68 SNP 45% 2689 s68 REF 50% 2690 s68 SNP 45% 2691 s68 SNP 50% 2692 s69 SNP 70% 2693 s69 REF 75% 2694 s69 SNP 70% 2695 s69 SNP 70% 2696 s69 REF 75% 2697 s69 REF 75% 2698 s69 SNP 70% 2699 s69 REF 75% 2700 s69 SNP 70% 2701 s69 REF 75% 2702 s69 REF 70% 2703 s69 SNP 65% 2704 s69 REF 70% 2705 s69 REF 75% 2706 s69 SNP 70% 2743 s71 SNP 75% 2744 s71 REF 70% 2745 s71 SNP 70% 2746 s71 REF 75% 2747 s71 SNP 75% 2748 s71 SNP 80% 2749 s71 REF 80% 2750 s71 SNP 75% 2751 s71 REF 75% 2752 s71 SNP 85% 2753 s71 REF 85% 2754 s71 REF 75% 2755 s71 SNP 75% 2756 s71 SNP 70% 2757 s71 REF 70% 2758 s71 REF 75% 2759 s71 SNP 75% 2760 s71 REF 70% 2761 s71 SNP 70% 2762 s72 SNP 35% 2763 s72 REF 40% 2764 s72 SNP 35% 2765 s72 REF 45% 2766 s72 SNP 40% 2767 s72 SNP 40% 2768 s72 REF 45% 2769 s72 SNP 45% 2770 s72 REF 50% 2771 s72 SNP 40% 2772 s72 REF 45% 2773 s72 SNP 45% 2774 s72 REF 50% 2775 s72 SNP 40% 2776 s72 REF 45% 2777 s72 REF 50% 2778 s72 REF 45% 2815 s73 SNP 55% 2816 s73 REF 60% 2817 s73 SNP 55% 2818 s73 REF 60% 2819 s73 SNP 50% 2820 s73 REF 55% 2821 s73 REF 55% 2822 s73 SNP 50% 2823 s73 REF 60% 2824 s73 SNP 55% 2825 s73 REF 55% 2826 s73 SNP 50% 2827 s73 SNP 45% 2828 s73 REF 50% 2829 s73 SNP 50% 2830 s74 SNP 40% 2831 s74 REF 45% 2832 s74 SNP 35% 2833 s74 REF 40% 2834 s74 REF 50% 2835 s74 SNP 45% 2836 s74 REF 55% 2837 s74 SNP 50% 2838 s74 SNP 40% 2839 s74 REF 45% 2840 s74 SNP 45% 2841 s74 REF 50% 2842 s74 REF 45% 2843 s74 SNP 45% 2844 s74 REF 50% 2845 s74 SNP 40% 2846 s74 SNP 40% 2847 s74 REF 45% 2848 s74 REF 40% 2849 s74 SNP 35% 2850 s74 SNP 35% 2887 s75 SNP 45% 2888 s75 SNP 30% 2889 s87 SNP 60% 2890 s87 SNP 65% 2891 s87 SNP 65% 2892 s87 SNP 60% 2893 s87 SNP 65% 2894 s87 SNP 65% 2895 s87 SNP 70% 2896 s87 SNP 60% 2897 s87 REF 55% 2898 s87 SNP 65% 2899 s87 REF 45% 2900 s87 SNP 50% 2901 s87 SNP 65% 2902 s87 SNP 65% 2903 s87 SNP 65% 2904 s87 SNP 50% 2905 s76 SNP 45% 2906 s76 SNP 45% 2907 s76 REF 50% 2908 s76 SNP 50% 2909 s76 REF 55% 2910 s76 SNP 45% 2911 s76 REF 50% 2912 s76 SNP 45% 2913 s76 REF 50% 2914 s76 SNP 45% 2915 s76 REF 50% 2916 s76 REF 50% 2917 s76 SNP 45% 2918 s76 REF 50% 2919 s76 SNP 45% 2920 s76 REF 50% 2921 s76 REF 55% 2922 s76 SNP 50% 2959 s77 SNP 75% 2960 s77 REF 80% 2961 s77 SNP 75% 2962 s77 SNP 50% 2963 s77 REF 55% 2964 s77 REF 55% 2965 s77 SNP 50% 2966 s77 REF 65% 2967 s77 SNP 60% 2968 s77 REF 80% 2969 s77 SNP 35% 2970 s77 REF 40% 2971 s77 SNP 65% 2972 s77 REF 70% 2973 s77 SNP 50% 2974 s77 REF 55% 2975 s78 REF 40% 2976 s78 SNP 30% 2977 s78 SNP 35% 2978 s78 REF 35% 2979 s78 SNP 40% 2980 s78 REF 45% 2981 s78 REF 45% 2982 s78 SNP 40% 2983 s78 SNP 35% 2984 s78 REF 40% 2985 s78 SNP 40% 2986 s78 REF 45% 2987 s78 REF 35% 2988 s78 SNP 30% 2989 s78 SNP 40% 2990 s78 REF 45% 2991 s78 REF 45% 2992 s78 SNP 40% 2993 s78 REF 45% 2994 s78 SNP 45% 2995 s78 REF 50% 2996 s78 SNP 40% 2997 s78 REF 45% 2998 s78 REF 50% 2999 s78 SNP 35% 3000 s78 SNP 45% 3001 s78 REF 40% 3002 s78 SNP 40% 3003 s78 REF 45% 3004 s78 REF 40% 3005 s78 SNP 35% 3006 s78 SNP 30% 3007 s78 SNP 40% 3008 s78 REF 35% 3009 s78 REF 45% 3010 s78 SNP 40%
[0155] Examples are provided below to facilitate a more complete understanding of the invention. The following examples illustrate the exemplary modes of making and practicing the invention. However, the scope of the invention is not limited to specific embodiments disclosed in these Examples, which are for purposes of illustration only.
EXPERIMENTAL DETAILS
Example 1: BEST1 Correction Anaylsis
[0156] Guide sequences comprising 17-20 nucleotides in the sequences of 17-20 contiguous nucleotides set forth in SEQ ID NOs: 1-3010 are screened for high on target activity. On target activity is determined by DNA capillary electrophoresis analysis.
[0157] According to DNA capillary electrophoresis analysis, guide sequences comprising 17-20 nucleotides in the sequences of 17-20 contiguous nucleotides set forth in SEQ ID NOs: 1-3010 are found to be suitable for correction of the BEST1 gene.
Discussion
[0158] The guide sequences of the present invention are determined to be suitable for targeting the BEST1 gene.
[0159] REFERENCES [0160] 1. Ahmad and Allen (1992) “Antibody-mediated Specific Binging and Cytotoxicity of Lipsome-entrapped Doxorubicin to Lung Cancer Cells in Vitro”, Cancer Research 52:4817-20 [0161] 2. Anders (1992) “Human gene therapy”, Science 256:808-13 [0162] 3. Basha et al. (2011) “Influence of Cationic Lipid Composition on Gene Silencing Properties of Lipid Nanoparticle Formulations of siRNA in Antigen-Presenting Cells”, Mol. Ther. 19(12):2186-200 [0163] 4. Behr (1994) Gene transfer with synthetic cationic amphiphiles: Prospects for gene therapy”, Bioconjuage Chem 5:382-89 [0164] 5. Blaese (1995) “Vectors in cancer therapy: how will they deliver”, Cancer Gene Ther. 2:291-97 [0165] 6. Blaese et al. (1995) “T lympocyte-directed gene therapy for ADA-SCID: initial trial results after 4 years”, Science 270(5235):475-80 [0166] 7. Buchschacher and Panganiban (1992) “Human immunodeficiency virus vectors for inducible expression of foreign genes”, J. Virol. 66:2731-39 [0167] 8. Burstein et al. (2017) “New CRISPR-Cas systems from uncultivated microbes”, Nature 542:237-41 [0168] 9. Chung et al. (2006) “Agrobacterium is not alone: gene transfer to plants by viruses and other bacteria”, Trends Plant Sci. 11 (1):1-4 [0169] 10. Coelho et al. (2013) “Safety and Efficacy of RNAi Therapy for Transthyretin Amyloidosis”, N Engl J. Med 369:819-29 [0170] 11. Crystal (1995) “Transfer of genes to humans: early lessons and obstacles to success”, Science 270(5235):404-10 [0171] 12. Dillon (1993) “Regulation gene expression in gene therapy” Trends in Biotechnology 11(5):167-173 [0172] 13. Dranoff et al. (1997) “A phase I study of vaccination with autologous, irradiated melanoma cells engineered to secrete human granulocyte macrophage colony stimulating factor”, Hum. Gene Ther. 8(1): 111-23 [0173] 14. Dunbar et al. (1995) “Retrovirally marked CD34-enriched peripheral blood and bone marrow cells contribute to long-term engraftment after autologous transplantation”, Blood 85:3048-57 [0174] 15. Ellem et al. (1997) “A case report: immune responses and clinical course of the first human use of ganulocyte/macrophage-colony-stimulating-factor-tranduced autologous melanoma cells for immunotherapy”, Cancer Immunol Immunother 44:10-20 [0175] 16. Gao and Huang (1995) “Cationic liposome-mediated gene transfer” Gene Ther. 2(10):710-22 [0176] 17. Haddada et al. (1995) “Gene Therapy Using Adenovirus Vectors”, in: The Molecular Repertoire of Adenoviruses III: Biology and Pathogenesis, ed. Doerfler and Böhm, pp. 297-306 [0177] 18. Han et al. (1995) “Ligand-directed retro-viral targeting of human breast cancer cells”, Proc Natl Acad Sci U.S.A. 92(21):9747-51 [0178] 19. Inaba et al. (1992) “Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor”, J Exp Med. 176(6): 1693-702 [0179] 20. Jinek et al. (2012) “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity,” Science 337(6096):816-21 [0180] 21. Johan et al. (1992) “GLVR1, a receptor for gibbon ape leukemia virus, is homologous to a phosphate permease of Neurospora crassa and is expressed at high levels in the brain and thymus”, J Virol 66(3):1635-40 [0181] 22. Judge et al. (2006) “Design of noninflammatory synthetic siRNA mediating potent gene silencing in vivo”, Mol Ther. 13(3):494-505 [0182] 23. Kohn et al. (1995) “Engraftment of gene-modified umbilical cord blood cells in neonates with adnosine deaminase deficiency”, Nature Medicine 1:1017-23 [0183] 24. Kremer and Perricaudet (1995) “Adenovirus and adeno-associated virus mediated gene transfer”, Br. Med. Bull. 51(1):31-44 [0184] 25. Macdiarmid et al. (2009) “Sequential treatment of drug-resistant tumors with targeted minicells containing siRNA or a cytotoxic drug”, Nat Biotehcnol. 27(7):643-51 [0185] 26. Malech et al. (1997) “Prolonged production of NADPH oxidase-corrected granulocyes after gene therapy of chronic granulomatous disease”, PNAS 94(22):12133-38 [0186] 27. Miller et al. (1991) “Construction and properties of retrovirus packaging cells based on gibbon ape leukemia virus”, J Virol. 65(5):2220-24 [0187] 28. Miller (1992) “Human gene therapy comes of age”, Nature 357:455-60 [0188] 29. Mitani and Caskey (1993) “Delivering therapeutic genes - matching approach and application”, Trends in Biotechnology 11(5):162-66 [0189] 30. Nabel and Felgner (1993) “Direct gene transfer for immunotherapy and immunization”, Trends in Biotechnology 11(5):211-15 [0190] 31. Remy et al. (1994) “Gene Transfer with a Series of Lipphilic DNA-Binding Molecules”, Bioconjugate Chem. 5(6):647-54 [0191] 32. Sentmanat et al. (2018) “A Survey of Validation Strategies for CRISPR-Cas9 Editing”, Scientific Reports 8:888, doi:10.1038/s41598-018-19441-8 [0192] 33. Sommerfelt et al. (1990) “Localization of the receptor gene for type D simian retroviruses on human chromosome 19”, J. Virol. 64(12):6214-20 [0193] 34. Van Brunt (1988) “Molecular framing: transgenic animals as bioactors” Biotechnology 6:1149-54 [0194] 35. Vigne et al. (1995) “Third-generation adenovectors for gene therapy”, Restorative Neurology and Neuroscience 8(1,2): 35-36 [0195] 36. Wilson et al. (1989) “Formation of infectious hybrid virion with gibbon ape leukemia virus and human T-cell leukemia virus retroviral envelope glycoproteins and the gag and pol proteins of Moloney murine leukemia virus”, J. Virol. 63:2374-78 [0196] 37. Yu et al. (1994) “Progress towards gene therapy for HIV infection”, Gene Ther. 1(1):13-26 [0197] 38. Zetsche et al. (2015) “Cpf1 is a single RNA-guided endonuclease of a class 2 CRIPSR-Cas system” Cell 163(3):759-71 [0198] 39. Zuris et al. (2015) “Cationic lipid-mediated delivery of proteins enables efficient protein based genome editing in vitro and in vivo” Nat Biotechnol. 33(1):73-80