Monoclonal antibody specifically binding to human plasmalemma vesicle-associated protein PV-1, preparation and use thereof

Abstract

Disclosed herein is a monoclonal antibody or a derivative thereof that specifically binds to human plasmalemma vesicle-associated protein (PLVAP, PV-1), including antigen complementarity-determining regions CDR1, CDR2 and CDR3 of an antibody light chain variable region, and antigen complementarity-determining regions CDR1, CDR2 and CDR3 of an antibody heavy chain variable region. The invention also provides a preparation process of a human-mouse chimeric antibody and amino acid sequences of the antibody heavy chain variable region and the antibody light chain variable region. The monoclonal antibody or derivative thereof can be used as a component of a pharmaceutical composition or prepared into a suitable medicament, administered alone or combined with other medications such as anti-VEGF monoclonal antibody and the like, for treating choroidal neovascularization fundus diseases and other angiogenesis/osmosis-related diseases.

Claims

1. A monoclonal antibody or a derivative thereof specifically binding to human plasmalemma vesicle-associated protein, comprising a first variable region and a second variable region, wherein the first variable region is an antibody light chain variable region comprising antigen complementarity-determining regions CDR1, CDR2 and CDR3 having amino acid sequences as set forth in SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 19, respectively; and wherein the second variable region is an antibody heavy chain variable region comprising antigen complementarity-determining regions CDR1, CDR2 and CDR3 having amino acid sequences as set forth in SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, respectively, and wherein the derivative is a Fab fragment an Fv fragment a single-chain antibody, a bispecific antibody, an antibody-drug conjugate, or a chimeric antigen receptor T-cell.

2. The monoclonal antibody or the derivative thereof according to claim 1, wherein the first variable region is an antibody light chain variable region having an amino acid sequence as set forth in SEQ ID NO: 16; and the second variable region is an antibody heavy chain variable region having an amino acid sequence as set forth in SEQ ID NO: 21.

3. A DNA molecule or a gene encoding the monoclonal antibody or the derivative thereof according to claim 2, comprising the antibody light chain variable region of SEQ ID NO: 15, and the antibody heavy chain variable region of SEQ ID NO: 20.

4. An expression vector comprising the DNA molecule of claim 3 and an expression regulatory sequence operably linked to the DNA sequence.

5. A recombinant host cell, wherein the recombinant host cell is transfected with the expression vector of claim 4.

6. A method for preparing the monoclonal antibody or the derivative thereof of claim 2, comprising the following steps: a) providing an expression vector, wherein the expression vector comprises a DNA sequence encoding the monoclonal antibody or the derivative thereof comprising SEQ ID NO: 15 and SEQ ID NO: 20, and an expression regulatory sequence operably linked to the DNA sequence; b) transfecting a host cell with the expression vector of step a); c) culturing the host cell from step b) under conditions suitable for an expression of the monoclonal antibody or the derivative thereof; and d) isolating, purifying, and collecting the monoclonal antibody or the derivative thereof from a host cell culture medium by affinity chromatography.

7. The monoclonal antibody or the derivative thereof according to claim 2, comprising the antibody light chain variable region, a human antibody light chain constant region, the antibody heavy chain variable region, and a hinge region of a human antibody heavy chain constant region, a CH1 region, a CH2 region, and a CH3 region.

8. The monoclonal antibody or the derivative thereof according to claim 1, comprising the antibody light chain variable region, a human antibody light chain constant region, the antibody heavy chain variable region, a hinge region of a human antibody heavy chain constant region, a CH1 region, a CH2 region, and a CH3 region.

9. The monoclonal antibody or the derivative thereof according to claim 8, wherein the human antibody light chain constant region is a kappa chain or a lambda chain of a human antibody, the human antibody heavy chain constant region is a human IgG1 isotype, a human IgG2 isotype, a human IgG3 isotype, a human IgG4 isotype, a human IgA, or a human IgM.

10. A pharmaceutical composition, comprising a pharmaceutically effective amount of the monoclonal antibody or the derivative thereof of claim 1, and a pharmaceutically accepted carrier.

11. The pharmaceutical composition according to claim 10, wherein the pharmaceutical composition further comprises a pharmaceutically effective amount of an active component antagonizing and blocking VEGF or VEGF-R.

12. A method of using the pharmaceutical composition according to claim 10, comprising a step of administering the pharmaceutical composition for a treatment of an angiogenesis or osmosis-related disease to a patient in need of such treatment.

13. The method according to claim 12, wherein the angiogenesis or osmosis-related disease is a choroidal neovascularization fundus disease.

14. The method according to claim 13, wherein the choroidal neovascularization fundus disease is diabetic retinopathy or age-related macular degeneration.

15. A method of antagonizing and blocking angiogenesis or osmosis in vivo mediated by plasmalemma vesicle-associated protein, comprising a step of administering an appropriate amount of the monoclonal antibody or the derivative thereof of claim 1.

16. The recombinant host cell according to claim 5, wherein the recombinant host cell expresses the monoclonal antibody or a derivative thereof.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a schematic diagram of the amino acid sequence comparison analysis of human PV-1 protein (SEQ ID NO: 1) and mouse PV-1 protein (SEQ ID NO: 2) in Example 1 of the present invention.

(2) FIG. 2 is the SDS-PAGE electrophoretic analysis of the human PV-1-His recombinant protein; lane 1 is a DTT-reduced sample; the marker represents the protein molecular weight standard substance (kd).

(3) FIG. 3A is a schematic diagram of the representative results of determining the supernatant sample of unfused SP2/0 myeloma cell (negative control) specifically binding to CHO cells (CHO/PV-1) transiently transfected with human PV-1 gene by Immunohistochemistry (IHC) method in Example 1 of the present invention. FIG. 3B is a schematic diagram of the representative results of determining the serum of the human immunized with PV-1 antigen (diluted at 1:200) specifically binding to CHO cells (CHO/PV-1) transiently transfected with human PV-1 gene by Immunohistochemistry (IHC) method in Example 1 of the present invention. FIG. 3C is a schematic diagram of the representative results of determining the cell culture supernatant sample of the mouse hybridoma STW-139-15 specifically binding to CHO cells (CHO/PV-1) transiently transfected with human PV-1 gene by Immunohistochemistry (IHC) method in Example 1 of the present invention.

(4) FIG. 4 is a schematic diagram of the results of the ELISA in Example 2 of the present invention, which shows the binding of the supernatant sample of the mouse hybridoma cell STW-139-15 and the recombinant human PV-1 extracellular membrane protein coated in a 96-well plate. MAb113 is a non-related mouse monoclonal antibody sample (anti-SOST antibody); the negative control is culture supernatant sample of unfused SP2/0 myeloma cell.

(5) FIG. 5 is a schematic diagram of the comparison and analysis results by the ELISA method in Example 3 of the present invention, which shows the binding of the mouse monoclonal antibody sample STW-139-15 and the recombinant human PV-1-Fc fusion protein and recombinant proteins of several other non-related genes.

(6) FIGS. 6A-6D are schematic diagrams of the representative results tested by the flow cytometer in Example 4 of the present invention, which determines the binding of the mouse monoclonal antibody STW-139-15 sample and the CHO cells steadily transfected with human PV-1 gene CHO/PV-1). FIG. 6A is a schematic diagram of the representative results determining the binding of the culture supernatant sample of unfused SP2/0 myeloma cell (as a negative control); FIG. 6B is a schematic diagram of the representative results determining the binding of a non-related mouse monoclonal antibody sample mAb21 (anti-PD-1 Mab) and the CHO cells steadily transfected with human PV-1 gene CHO/PV-1). FIG. 6C is a schematic diagram of the representative results determining the binding of the serum of mouse immunized with human PV-1 protein (diluted at 1:200 as a positive control) and the CHO cells steadily transfected with human PV-1 gene CHO/PV-1). FIG. 6D is a schematic diagram of the representative results determining the binding of the cell culture supernatant sample of the mouse hybridoma STW-139-15 (the mouse monoclonal antibody STW-139-15 sample) and the CHO cells steadily transfected with human PV-1 gene CHO/PV-1).

(7) FIG. 7 is a dose-response curve of antibody's solubility-mean fluorescence value tested by the flow cytometer in Example 4 of the present invention, which determines the binding of a series of gradient dilutions of murine STW-139-15 monoclonal antibody sample and CHO cell steadily transfected with human PV-1 gene (CHO/PV-1).

(8) FIGS. 8A-8C are schematic diagrams of the representative results tested by the flow cytometer in Example 4 of the present invention, which determines and analyzes the binding of the mixture sample containing murine STW-139-15 monoclonal antibody samples, CHO cells and CHO/PV-1 cells (at a ratio of 9:1). FIG. 8A is a schematic diagram of the representative results determining the binding of the culture supernatant sample of unfused SP2/0 myeloma cells (as a negative control) in the mixture sample containing murine STW-139-15 monoclonal antibody samples, CHO cells and CHO/PV-1 cells (at a ratio of 9:1). FIG. 8B is a schematic diagram of the representative results determining the binding of a non-related mouse monoclonal antibody sample mAb21 (anti-PD-1 Mab) in the mixture sample containing murine STW-139-15 monoclonal antibody samples, CHO cells and CHO/PV-1 cells (at a ratio of 9:1). FIG. 8C is a schematic diagram of the representative results determining the binding of the murine monoclonal antibody STW-139-15 sample in the mixture sample containing murine STW-139-15 monoclonal antibody samples, CHO cells and CHO/PV-1 cells (at a ratio of 9:1).

(9) FIG. 9 is a schematic diagram of the representative results tested by the flow cytometer in Example 5 of the present invention, which determines and analyzes the binding of the murine monoclonal antibody STW-139-15 sample and human HUVEC. A01NC is the culture supernatant sample of unfused SP2/0 myeloma cells (as a negative control).

(10) FIGS. 10A-10F are schematic diagrams of the representative results by Immunohistochemistry (IHC) method in Example 6 of the present invention, which determines the binding of the murine monoclonal antibody STW-139-15 sample and tissue sections of the normal tissue. FIG. 10A depicts the lung tissue sections. FIG. 10B depicts the liver tissue sections. FIG. 10C depicts the brain tissue sections. FIG. 10D depicts the pancreatic tissue sections. FIG. 10E depicts the heart tissue sections. FIG. 10F depicts the spleen tissue sections.

(11) FIGS. 11A-11F are schematic diagrams of the representative results by Immunohistochemistry (IHC) method in Example 7 of the present invention, which determines the binding of the murine monoclonal antibody STW-139-15 sample and tissue sections of the human tumor tissue. FIG. 11A depicts the lung cancer tissue sections. FIG. 11B depicts the liver cancer tissue sections; FIG. 11C depicts the brain tumor tissue sections. FIG. 11D depicts the pancreatic cancer tissue sections. FIG. 11E depicts the ovarian cancer tissue sections. FIG. 11F depicts the lymphoma tissue sections.

(12) FIG. 12 is a schematic diagram of amino acid sequences comparison and analysis of human PV-1 protein (SEQ ID NO: 8) and monkey PV-1 protein (SEQ ID NO: 25) in Example 8 of the present invention.

(13) FIGS. 13A-13C are schematic diagrams of the representative results tested by the flow cytometer in Example 8 of the present invention, which determines the binding of the murine monoclonal antibody STW-139-15 sample and the CHO cell steadily transfected with monkey PV-1 gene (CHO/monkey PV-1). FIG. 13A is a schematic diagram of the representative results determining the binding of the culture supernatant sample of unfused SP2/0 myeloma cell (as a negative control) and the CHO cell steadily transfected with monkey PV-1 gene (CHO/monkey PV-1). FIG. 13B is a schematic diagram of the representative results determining the binding of a non-related mouse monoclonal antibody sample mAB7 (anti-PD-1 Mab) and the CHO cell steadily transfected with monkey PV-1 gene (CHO/monkey PV-1). FIG. 13C is a schematic diagram of the representative results determining the binding of the murine monoclonal antibody STW-139-15 sample and the CHO cell steadily transfected with monkey PV-1 gene (CHO/monkey PV-1).

(14) FIG. 14 is a schematic diagram of the results tested by the ELISA method in Example 10 of the present invention, which determines the binding of the human-mouse chimeric antibody STW-139-15-C sample and the recombinant human PV-1 extracellular membrane protein coated in a 96-well plate.

(15) FIGS. 15A to 15D are fundus fluorescein images of Macaca Fascicularis by vitreous injection of on the third week after photocoagulation at the time points during the observation period in Example 11 of the present invention. FIG. 15A shows the images of the negative control group (0.9% NaCl injection). FIG. 15B shows the images of STW-139-15C monoclonal antibody tested sample group. FIG. 15C shows the images of the positive control drug hPV19 Mab(anti-VEGF Mab). FIG. 15D shows the images of combination administration of TW-139-15C as a tested drug and positive control drug hPV19 monoclonal antibody.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(16) The present invention will be further described in combination with the examples. The following examples are offered by way of illustration only and are not intended to limit the invention.

Example 1. Establishment and Screening Identification of Mouse Hybridoma Cell Line Secreting Anti-Human PV-1 Antibody

(17) 1.1 Amino Acid Sequence Comparison Analysis of Human PV-1 Protein and Mouse PD-1 Protein.

(18) The comparison analysis of the amino acid sequence of human PV-1 protein (NCBI Reference Sequence: NP_112600.1) (SEQ ID NO: 1) and the amino acid sequence of mouse PV-1 protein (NCBI Reference Sequence: NP_115774.2) (SEQ ID NO: 2) is shown in FIG. 1. More than 20 amino acids in the N-terminal located in the cell membrane (the sequence is marked in italics), the amino acid sequence of the transmembrane region of PV-1 protein is marked in box and bold. The amino acid sequence of C-terminal (human: AA53-442; mouse: AA53-438) all located outside of cell membrane, wherein including 4 N-Glycisylation sites (marked in box) and 9 Cysteines (marked in underline). There is only 62% homology in amino acid sequences between human PV-1 protein and mouse PV-1 protein; there are more than 100 amino acid difference sites in the extracellular region. Therefore, it is speculated that the mouse antibody targeting the human PV-1 extracellular antigen region can be prepared by immunizing mice with the traditional antigen protein and hybridoma preparation techniques.

(19) 1.2 Expression and Preparation of the Recombinant Human PV-1 Protein (Immunogen)

(20) In the example of the present invention, firstly collect the total RNA from human umbilical vein endothelial cells (HUVEC) and obtain cDNA by reverse transcription-polymerase chain reaction (RT-PCR). After that, the gene fragment coding human PV-1 protein was cloned by PCR technology using cDNA as the template. After DNA sequencing and identification, treated with restriction DNA endonuclease, cloned into DNA plasmid to express exogenous genes in CHO cells effectively, then the recombinant plasmid was obtained.

(21) 1.2.1 Cloning of the Gene Coding Human PV-1 Full-Length Protein and Construction of Expression Plasmid Thereof

(22) The construction process of the expression plasmid is as follows:

(23) Firstly, the gene fragment coding human PV-1 full-length protein (about 1344 bp in length) was successfully amplified by PCR using the above cDNA as a template and the following pair of primers:

(24) TABLE-US-00001 Forward primer hPV-1-His-F-HindIII: (SEQ ID NO: 3) AACTAAGCTTGCCACCATGGGTCTGGCCATGGAGCACGGA; Reverse primers hPV-1-His-R-XhoI: (SEQ ID NO: 4) ACCACTCGAGTCAGTGATGGTGATGGTGATGGCCACTGGATGGGGCTACA GGGAT

(25) The DNA amplified by PCR was recycled and treated with the restriction DNA endonuclease, cloned into the expression plasmid pCDNA3.1 (Invitrogen), then the recombinant plasmid was obtained. After DNA sequencing and identification, treated with restriction DNA endonuclease, the recombinant plasmid effectively expressing exogenous human PV-1 genes in CHO cell membrane (Plasmid name: pQY-PV-1) was obtained.

(26) 1.2.2 Construction of Expression Plasmid of the Human PV-1 Extracellular Membrane Recombinant Protein with His-6 Label in C-Terminal

(27) The gene fragment of the human PV-1 extracellular membrane protein with 6 histidines label in C-terminal (PV-1-His) was successfully amplified by using PCR recycled product in the previous section (1.2.1) as a template and the following pair of primers:

(28) TABLE-US-00002 Forward primer hPV-1-Fc-F-BglII: (SEQ ID NO: 5) GTGGAGATCTCACGTGAGCACAGAGTCCAACCTG; Reverse primer hPV-1-His-R-XhoI: (SEQ ID NO: 4) GGGAT

(29) The DNA amplified by PCR was recycled and treated with the restriction DNA endonuclease, transferred into the expression vector pCDNA3.1-DHFR with a signal peptide, then the recombinant plasmid was obtained. The recombinant plasmid secreting the recombinant gene hPV-1-His in CHO cells (name: pQY-DHFR-PV1-His) was successfully obtained by endonuclease digestion and DNA sequencing identification.

(30) 1.2.3 Construction of the Recombinant Human PV-1-Fc Fusion Protein Expression Plasmid

(31) The construction process of the expression plasmid was as follows:

(32) The gene fragment of hPV-1 extracellular membrane region (about 1176 bp in length) was successfully amplified by PCR using PCR recycled product in the previous section (1.2.1) as a template and the following pair of primers:

(33) TABLE-US-00003 Forward primer hPV-1-Fc-F-BglII: (SEQ ID NO: 5) GTGGAGATCTCACGTGAGCACAGAGTCCAACCTG Reverse primer hPV-1-Fc-R-BamHI: (SEQ ID NO.: 6) GTGGGCATGTGTGAGTGGATCCGCCACTGGATGGGGCTACAG

(34) After that, the recombinant gene (about 1859 bp length) that fused hPV-1 extracellular membrane gene with the gene fragment coding human IgG1-Fc fragment was successfully amplified by PCR using the recycled product as a template and the following pair of primers:

(35) TABLE-US-00004 Forward primer hPV-1-Fc-F-BglII: (SEQ ID NO: 5) GTGGAGATCTCACGTGAGCACAGAGTCCAACCTG Reverse primer PV1-DHFR-XbaI-R: (SEQ ID NO: 7) TAACTCTAGATCATTTACCCGGGGACAGGG

(36) The recombinant gene DNA amplified by PCR was recycled and treated with endonuclease digestion, cloned into the expression vector pCDNA3.1-DHFR to obtain the recombinant plasmid. The recombinant expression plasmid (name: pQY-DHFR-PV1-Fc) secreting the recombinant gene hPV-1-Fc in CHO cells was proved to be achieved successfully by endonuclease digestion and DNA sequencing identification

(37) 1.3 Expression and Preparation of Human PV-1-his Recombinant Protein and PV-1-Fc Fusion Protein (Immunogen)

(38) The above expression plasmids (pQY-DHFR-PV1-His, pQY-DHFR-PV1-Fc) were mixed with Fugen-6 liposome (Roche) respectively, then transfected into DHFR gene deficiency CHO cell (CHO-dhfr-). After transfection and screening by medications (Methotrexate, MTX), the cell lines effectively expressing the human PV-1-His recombinant protein and the human PV-1-Fc fusion protein were obtained. The screened expression cell lines were amplified and cultured in a serum-free culture medium, then separated and purified from the cell supernatant using Ni-Affinity chromatography column and Protein-A affinity chromatography column respectively, the human PV-1-His recombinant protein and the human PV-1-Fc fusion protein with a purity of over 90% were obtained.

(39) FIG. 2 showed the SDS-PAGE electrophoretic analysis of the human PV-1-His recombinant protein (DTT-reduced). The result showed that the main lanes in the DTT-reduced human PV-1-His protein sample were around 55 kd, which was consistent with the theoretical expected molecular weight of the protein.

(40) 1.4 Recombinant Human PV-1 Protein Immunizes Animals

(41) Firstly, the human PV-1-His recombinant protein and Freund's complete adjuvant (Sigma, USA) were mixed, then injected subcutaneously at multiple points to Balb/c mice (100 μl/mouse, 10 μg PV-1-His protein each time). After 2-3 weeks of the first immunization, the mixture of human PV-1-Fc fusion protein and Freund's incomplete adjuvant (Sigma, USA) were injected into the mice again subcutaneously at multiple points. After 3-4 times of boost immunization, a small amount of the mouse serum was collected and tested the titer of anti-PV-1 antibody in the mouse serum by enzyme-linked immunosorbent assay (ELISA) using a 96-well plate coated with the human PV-1-Fc fusion protein. The splenic cells of the mouse with high titer were collected for the cell fusion of the next step.

(42) 1.5 Cell Fusion

(43) After 3 to 4 days of the last immunization, the splenocytes suspension of the mouse were prepared in a sterile condition, fused with the mouse SP2/0 myeloma cells (purchased from Cell Center of Shanghai Institute of Life Sciences, Chinese Academy of Sciences) at a ratio of 5:1 or 10:1 under the function of 50% PEG-1000 (Sigma, USA). The cell fusion process followed a conventional method (Kohler G and Milstein C: Nature 1975; 256:495-497):1 mL PEG was added slowly within 60 seconds, reacted for 90 seconds, terminated the reaction with the serum-free RPMI-1640 culture medium, centrifuged 10 minutes with 1000 rpm, removed the supernatant; the deposited cells under the centrifugal were obtained and adjusted the cells concentration to 1×10.sup.6/ml with RPMI 1640-10% FCS culture medium containing 10% HAT(H for hypoxanthine, A for amino disc poison, T for thymidine nucleoside, Sigma, USA), added into 96-well flat cell culture plate (200 ul/hole), then incubated in an incubator containing 5% CO.sub.2 (Thermo, USA) at 37° C. for 2-3 weeks.

(44) 1.6 Screening of Mouse Hybridoma Cell with Positive PV-1 Antibody Secretion by Immunohistochemistry (IHC) Method

(45) In the example of the present invention, the cell lines with positive PV-1 antibody secretion were screened from the mouse hybridoma cells by Immunohistochemistry (IHC) method.

(46) The Process was as Follows:

(47) 1) CHO cells transfected with the human PV-1 gene (CHO/PV-1) and non-transfected CHO cells were mixed at a ratio of 1:6 and spread in a 96-well cell culture plate, then incubated overnight in an incubator containing 5% C02 at 37° C.;

(48) 2) The cell culture plate was taken out, and the nutrient solution was absorbed, fixed with the phosphate buffered saline (PBS) containing 2% paraformaldehyde, permeabilized with 90% methanol.

(49) 3) After rinsing with PBS solution, the primary antibody (the mouse hybridoma cell supernatant or serum of PV-1 immunized mouse (diluted at 1:200) as a positive control sample) was added, incubated at 37° C. for 1 hour;

(50) 4) After rinsing with PBS solution, the second antibody (HRP-Goat anti-Mouse IgG (1:400)) was added and incubated at 37° C. for 1 hour;

(51) 5) After rinsing with PBS solution again, the substrate (DAB, 0.1% H2O2) was added for staining

(52) FIG. 3 shows the representative results of Immunohistochemistry (IHC) screening.

(53) As shown in FIG. 3, the supernatant of the mouse hybridoma cell culture with a code name of STW-139-15 (FIG. 3C) can significantly specifically combine with the mixture of CHO/PV-1 and CHO. The IHC staining intensity and the ratio of positive cells are the same as that of the positive control sample (the serum sample of the mouse immunized with PV-1 antigen, FIG. 3B); the IHC staining results of the supernatant of SP2/0 myeloma cell was negative (FIG. 3A), it is also consistent with the expected results.

Example 2. Determining the Binding of the Supernatant Sample of the Mouse Hybridoma Cell STW-139-15 and the Recombinant Human PV-1-Fc Fusion Protein by ELISA

(54) The above primarily screened positive hybridoma cell was diluted to 1-10 cells per well with RPMI-1640-10.sup.0/FCS culture medium, spread in a 96-well cell culture plate, incubated in an incubator containing 5% C02 at 37° C. for 2-3 weeks. After clones grew up, the supernatant was collected and determined the presence of an anti-PV-1 antibody by ELISA.

(55) The ELISA method was as follows:

(56) 1) The 96-well cell culture plate was coated with the recombinant human PV-1-Fc fusion protein (2 μg/ml, pH 9.6, 0.1 M NaHCO.sub.3 solution) at 37° C. for 2 hours, 2% Bovine Serum Albumin (BSA) was added and sealed overnight at 4° C.

(57) 2) The next day, the plate was washed with PBS-0.1% Tween20 solution, followed by the addition of the hybridoma cell culture supernatant to be detected (an unfused SP2/0 myeloma cell culture supernatant as a negative control) and incubated at 37° C. for 2 hours;

(58) 3) After washing with PBS-0.1% Tween20 solution, the HRP-Goat anti-Mouse IgG (Sigma, USA) was added and incubated at 37° C. for 1 hour;

(59) 4) After washing with PBS-0.1% Tween20 solution again, the substrate solution (OPD, 0.1% H.sub.2O.sub.2) was added for staining about 10-15 minutes;

(60) 5) 0.1M HCl solution was added to quench the reaction, then the OD value at 492 nm was read in Multiskan-FC Microplate Reader (Thermo Scientific, USA).

(61) FIG. 4 is a schematic diagram of the representative results of the ELISA.

(62) As shown in FIG. 4, the supernatant sample of the mouse hybridoma cell STW-139-15 contained high titer antibodies and can specifically bind human PV-1-Fc fusion protein, but the supernatant sample of non-related antibodies sample mAb113 (anti-SOST antibody, SOST stands for Sclerostin) and SP2/0 myeloma cell were all negative.

Example 3. Determining and Analyzing the Binding of the Mouse STW-139-15 Monoclonal Antibody and the Human PV-1-Fc Fusion Protein and Other Non-Related Proteins

(63) In the present example, the binding of the mouse STW-139-15 monoclonal antibody and the human PV-1-Fc fusion protein and other non-related proteins was determined by ELISA.

(64) The 96-well ELISA plate was coated with the human PV-1-Fc fusion protein and other non-related proteins (CD3, TIGIT-His, SIRPa-His) or Fc-fusion protein (PD1-Fc, PDL1-Fc, PDL2-Fc, mPDL1-Fc, CTLA4-Fc, CD28-Fc, B7-Fcand BTLA-Fc) in the concentration of 1 ug/ml. The mouse STW-139-15 monoclonal antibody was added as the primary antibody, followed by the addition of the HRP-Goat anti-Mouse IgG (Jackson Company) as the second antibody. After that, the substrate solution (OPD, 0.1% H2O2) was added for staining, 1M HCl solution was added to quench the reaction. The OD value at 492 nm was read in Multiskan MC Microplate Reader (Thermo Scientific, USA).

(65) FIG. 5 showed the ELISA result. The result showed that the murine monoclonal antibody sample STW-139-15 only specifically bound to the human PV-1-Fc fusion protein (OD value >1.0), but did not significantly bind to CD3 and other non-related recombinant proteins (His-labelled, or IgG-Fc fusion protein)(OD value<1.0). The result illustrated that STW-139-15 monoclonal antibody has high specificity in antigen recognition and binding, and only binds to PV-1 protein.

Example 4. Determining and Analyzing the Binding of Murine STW-139-15 Monoclonal Antibody and CHO Cell Transfected with Human PV-1 Gene (CHO/PV-1) by Flow Cytometer

(66) In the present example, the murine monoclonal antibody STW-139-15 sample was used as the primary antibody; the FITC fluorescence-labeled rabbit anti-mouse IgG was used as the second antibody. The binding of STW-139-15 monoclonal antibody sample and the CHO cell expressing the human PV-1 gene was determined by the flow cytometer.

(67) CHO/PV-1 cell stably transfecting and expressing human full-length CHO/PV-1 recombinant protein gene, the supernatant sample of the mouse hybridoma STW-139-15, non-related mouse hybridoma mAb21 sample (anti-PD-1 monoclonal antibody), the serum of the mouse immunized with PV-1 antigen (positive control sample, diluted at 1:200) and SP2/0 myeloma cell culture supernatant (negative control) were incubated at 4° C. for 1 hour, rinsed with PBS-0.1% FCS solution, then the FITC fluorescence-labeled rabbit anti-mouse IgG (diluted at 1:200; Southern Biotech Company) was added and incubated at 4° C. for 1 hour; after rinsing with PBS-0.1% FCS solution, the samples were tested with BD Accuri C6Plus Flow Cytometer (BD Biosciences, USA).

(68) FIGS. 6A-6D are schematic diagrams of the representative result tested by the flow cytometer. As shown in FIGS. 6C-6D, the supernatant sample of the mouse hybridoma STW-139-15, as the same with the positive control sample (FIG. 6C, the serum of the mouse immunized with PV-1 protein), significantly binds to CHO/PV-1 cell (FIG. 6D). Instead, the non-related mouse hybridoma sample (FIG. 6B), the mouse SP2/0 myeloma cell culture supernatant as a negative control sample (FIG. 6A) does not specifically bind to CHO/PV-1 cells.

(69) FIG. 7 showed the antibody's solubility-mean fluorescence curve of a series of gradient dilutions of murine STW-139-15 monoclonal antibody sample binding with CHO cell stably transfected with human PV-1 gene (CHO/PV-1). It showed that the binding of STW-139-15 monoclonal antibody sample and CHO/PV-1 cell in the solubility range of 0.1-10 ug/ml presented a dose-response curve.

(70) FIGS. 8A-8C are schematic diagrams of the representative result of the mixture sample containing the murine STW-139-15 monoclonal antibody sample, CHO cell, and CHO/PV-1 cell (at a ratio of 9:1) tested by the flow cytometer. As shown in FIGS. 8A-8C, compared with the mouse SP2/0 cell supernatant negative control sample (FIG. 8A) and non-related hybridoma cell supernatant (FIG. 8B), the murine hybridoma STW-139-15 monoclonal antibody sample significantly specifically bind to part of cells in mixture sample (FIG. 8C). The binding proportion of positive cells was 9.67%; it is consistent with the percentage of CHO/PV-1 cells (10%) in the mixture sample. The result further demonstrated that STW-139-15 only specifically recognized and bound to PV-1 antigen; it did not bind to the other proteins or antigenic substances in CHO cells.

Example 5. Determining and Analyzing the Binding of Murine STW-139-15 Monoclonal Antibody and Human HUVEC

(71) In the present example, the murine monoclonal antibody STW-139-15 sample was used as the primary antibody; the FITC fluorescence-labeled goat anti-mouse IgG was used as the second antibody; the binding of STW-139-15 monoclonal antibody sample and human HUVE was determined by the flow cytometer.

(72) HUVEC were permeabilized with 0.1% Triton X-100, followed by the addition of the mouse hybridoma STW-139-15 supernatant sample or the mouse SP2/0 cell supernatant as negative control. Then incubated at 4° C. for an hour and rinsed by PBS-0.1% FCS solution; after that, the FITC-Goat anti-Mouse IgG (H+L) (Sigma, USA) was added, incubated at 4° C. for an hour and rinsed by PBS-0.1% FCS solution again. The sample was tested with BD Accuri C6Plus Flow Cytometer (BD Biosciences, USA).

(73) FIG. 9 is a schematic diagram of the representative result tested by the flow cytometer. As shown in FIG. 9, compared with the mouse SP2/0 cell supernatant negative control (sample A01 NC), the mouse hybridoma STW-139-15 cell supernatant sample significantly specifically bound to human HUVEC.

Example 6. Determining the Binding of the Murine STW-139-15 Monoclonal Antibody and Tissue Sections of Human Normal Tissues by Immunohistochemistry (IHC) Method

(74) In the present example, the binding of the murine STW-139-15 monoclonal antibody sample and tissue sections of part of normal human tissues was determined and analyzed by Immunohistochemistry (IHC) method; the detection process was as follows:

(75) After rehydration of paraffin sections of normal human tissues and resumption of antigen treatment, the murine monoclonal antibody STW-139-15 sample was added as the primary antibody, incubated at room temperature for 1 hour, and rinsed. Diluted HRP-Goat anti-Mouse IgG (second antibody) was added, incubated at room temperature for 1 hour and rinsed, then the substrate DAB was added for staining, redyed with hematoxylin, the film was sealed and photographed.

(76) FIGS. 10A-10F are schematic diagrams of the representative results of the Immunohistochemistry method. As shown in FIGS. 10A-10F, in the Immunohistochemical staining sections of the normal tissue, including lung, liver, brain, heart, pancreas, and spleen, STW-139-15 monoclonal antibody sample only specifically bound to lung tissue, and the staining results with other tissues were not significant. The positive Immunohistochemistry determination result of STW-139-15 monoclonal antibody in lung tissue was consistent with the expression result in lung tissue reported in the literature. The cDNA coding PV-1 antigen was initially separated and cloned from rat lung tissue (Stan R V et al., 1999 J Cell Biol. 145:1189-98).

Example 7. Determining the Binding of Murine STW-139-15 Monoclonal Antibody and Tissue Sections of Human Tumor Tissues by Immunohistochemistry (IHC) Method

(77) In the present example, the binding of murine STW-139-15 monoclonal antibody and tissue sections of partial human tumor tissues was determined and analyzed by Immunohistochemistry (IHC) method; the detection process was as follows:

(78) After rehydration of paraffin sections of human tumor tissues and resumption of antigen treatment, the murine monoclonal antibody STW-139-15 sample was added as the primary antibody, incubated at room temperature for 1 hour and rinsed, diluted HRP-Goat anti-Mouse IgG (second antibody) was added, incubated at room temperature for 1 hour and rinsed, the substrate DAB was added for staining, redyed with hematoxylin, the film was sealed and photographed.

(79) FIGS. 11A-11F are schematic diagrams of the representative results of the Immunohistochemistry method. As shown in FIGS. 11A-11F, STW-139-15 monoclonal antibody specifically bound to vascular-like structure in various tumor tissues (including lung cancer, liver cancer, brain tumor, pancreatic cancer, ovarian cancer, etc.). However, the staining result with the lymphoma tissue section was not significant

(80) Based on the fact that STW-139-15 monoclonal antibody specifically bound to various tumor tissues and did not bind to most normal tissues (see the result of Example 6), this monoclonal antibody should be the ideal substance or carrier for preparing the medication or formulation targeting blood vessels of tumor region.

Example 8. Determining the Binding of Murine STW-139-15 Monoclonal Antibody and Macaca Fascicularis PV-1 Protein by Flow Cytometer

(81) 4) Amino Acid Sequences Comparison and Analysis of PV-1 Protein Extracellular Membrane Region of the Human and Monkey

(82) The comparison and analysis result of amino acid sequences of human PV-1 protein extracellular membrane region (SEQ ID NO: 8) and amino acid sequences of Macaca Fascicularis PV-1 protein extracellular membrane region of) extracellular membrane region (SEQ ID NO: 25) was shown in FIG. 12. As shown in FIG. 12, there are 95% homology in protein sequences between the extracellular membrane region of Macaca Fascicularis PV-1 protein and the extracellular membrane region of human PV-1 protein; there are 17 amino acid difference sites.

(83) 5) Construction of CHO Cell Line Expressing Monkey PV-1 Gene

(84) According to amino acid sequences of Macaca Fascicularis PV-1 full-length protein published in Genbank (NCBI: GenBank: AKG92647.1), the responding cDNA fragment of Macaca Fascicularis PV-1 was delegated to Suzhou Genewiz Biological Technology Co. LTD to artifitially synthesize, after that treated with the restriction DNA endonuclease, cloned into the expression plasmid pCDNA3.1-DHFR, then the recombinant plasmid was obtained. After treating with restriction endonuclease digestion and DNA sequencing and identification, the recombinant plasmid expressing Macaca Fascicularis PV-1 full-length protein in CHO-dhfr cell membrane (Plasmid name: pCDNA3.1-DHFR-mkPV1) was successfully obtained.

(85) The above-expressed plasmid DNA was mixed with Fugen-6 liposome (Roche), then transfected into DHFR gene deficiency CHO cell (CHO-dhfr-). After transfection, screened by regular IMDM culture medium containing 8% FBS, the cell line expressing Macaca Fascicularis PV-1 protein was obtained.

(86) 6) Analyzing the Binding of the Murine STW-139-15 Monoclonal Antibody and CHO/Monkey PV-1 Cell by Flow Cytometer

(87) The binding of the murine STW-139-15 monoclonal antibody sample and the above CHO cell expressing Macaca Fascicularis PV-1 full-length protein (CHO/Monkey PV-1) was determined and analyzed by the flow cytometer method as described in Example 4. The representative detection result of the flow cytometer was shown in FIGS. 13A-13C, compared with the negative control sample (SP2/0 myeloma cell culture supernatant, FIG. 13A) and non-related mouse monoclonal antibody mAB7 sample (anti-PD-1 monoclonal antibody, FIG. 13B), the murine monoclonal antibody STW-139-15 significantly bound to CHO/Monkey PV-1 cell (FIG. 13C). The result primarily demonstrated that the different sites between amino acid sequences of Macaca Fascicularis PV-1 protein and amino acid sequences of human PV-1 protein did not affect the binding of STW-139-15 monoclonal antibody and CHO/Monkey PV-1 cell. The result of STW-139-15 monoclonal antibody and CHO/Macaca Fascicularis PV-1 cell also suggested that Macaca Fascicularis is the ideal and related animal for studying STW-139-15 monoclonal antibody.

Example 9. Cloning, Amplification, and Analysis of the Genes Coding the Variable Regions of the Murine STW-139-15 Monoclonal Antobody

(88) In the present example, the total RNA was extracted from the mouse hybridoma cell STW-139-15, and used as a template; together with the degenerate primers, to clone and amplify the cDNA gene fragments of STW-139-15 antibody heavy chain variable region and light chain variable region respectively by reverse transcription-polymerase chain reaction (RT-PCR) method (Wang Y et al: Degenerated primer design to amplify the heavy chain variable region from immunoglobulin cDNA. BMC Bioinformatics. 2006; 7 Suppl (4): S9). Wherein the cDNA gene cloning process was as follows:

(89) Step 1: The total RNA was extracted from the mouse hybridoma cell STW-139-15 by RNA extraction reagent (RNAiso Plus, Takara Company)

(90) Step 2: cDNA template was obtained in Eppendorf tube by RT-PCR method

(91) Wherein, the primer's sequence of the reverse transcription-polymerase chain reaction for STW-139-15 antibody light chain variable region (STW-139-15-L) was TGT CGT TCA CTG CCA TCA AT (SEQ ID NO: 9);

(92) The primer's sequence of the reverse transcription-polymerase chain reaction for STW-139-15 antibody heavy chain variable region (STW-139-15-L) was GCA AGG CTT ACA ACC ACA ATC (SEQ ID NO: 10);

(93) RT-PCR reaction system was as followes:

(94) TABLE-US-00005 Primer  2 μl RNA template 30 μl Incubated at 72° C. for 10 minutes, then stayed on ice for 2 minutes

(95) Followed by:

(96) TABLE-US-00006 5 × RT-PCR reaction buffer  10 μl dNTPs   5 μl PrimeScript reverse transcription-polymerase 1.5 μl Distilled water 1.5 μl Total volume  50 μl

(97) Reacted at 42° C. for 1 hour, then increased to 75° C., after 15 minutes, inactivated, the cDNA was obtained and stored at −20° C. for later use.

(98) Step 3: PCR cloning and amplification of STW-139-15 antbody light chain variable region gene and heavy chain variable region gene

(99) The following pair of primers used in cloning and amplification of STW-139-15 antibody light chain variable region gene by degenerate primers PCR method were as follows:

(100) TABLE-US-00007 Forward primer: (SEQ ID NO: 11) GAC ATT GTG ATG WCM CA Reverse primer: (SEQ ID NO: 12) CTG AGG CAC CTC CAG ATG TT wherein W = A or T, M = A or C.

(101) The following pair of primers used in cloning and amplification of STW-139-15 antibody heavy chain variable region gene by degenerate primers PCR method were as follows:

(102) TABLE-US-00008 Forward primer: (SEQ ID NO: 13) CAR CTG CAR CAR YCT G Wherein, R = A or G, Y = C or T. Reverse primer: (SEQ ID NO: 14) GTG CTG GAG GGG ACA GTC ACT

(103) DNA products amplified by PCR were analyzed by electrophoresis in 1% agarose gel. When electrophoresis is over, the separated bands were cut and sequenced to obtain the nucleotide sequences of the antibody's light and heavy chain variable region DNA. The nucleotide sequence of the light chain variable region DNA was set forth in SEQ ID NO: 15. The amino acid sequence of the light chain variable region DNA inferred from the DNA nucleotide sequence was set forth in SEQ ID NO:16. The amino acid sequences of CDR1, CDR2, and CDR3 of the light chain antigen complementarity-determining regions (CDR) were set forth in SEQ ID NO.: 17, SEQ ID NO.: 18, and SEQ ID NO.: 19, respectively.

(104) The nucleotide sequence of the heavy chain variable region DNA was set forth in SEQ ID NO: 20, and the amino acid sequence of the heavy chain variable region DNA inferred from the DNA nucleotide sequence was set forth in SEQ ID NO: 21. The amino acid sequences of CDR1, CDR2, and CDR3 of the heavy chain antigen complementarity-determining regions (CDR) were set forth in SEQ ID NO.: 22, SEQ ID NO.: 23 and SEQ ID NO.: 24, respectively.

Example 10. Construction of Human-Mouse Chimeric Antibody STW-139-15-C

(105) The murine STW-139-15 antibody light and heavy chain variable region genes obtained by cloning and amplification in Example 9 were fused separately with a human kappa light chain constant region (C-domain) and a human IgG1 heavy chain constant region gene fragment toobtain the human-mouse chimeric light chain gene (STW-139-15-L) and the human-mouse chimeric heavy chain gene (STW-139-15-H). After that, the light and heavy chain chimeric genes were separately cloned into the expression plasmid pcDNA3.1 (Invitrogen), followed by transferring into E. Coli to amplify, and separate, then the expression plasmids containing the human-mouse chimeric light chain gene and the human-mouse chimeric heavy chain gene were obtained.

(106) After that, the partial expression plasmid samples containing the human-mouse chimeric light chain gene (recombinant plasmid code: L17, L18, and L19) and the partial expression plasmid samples containing the human-mouse chimeric heavy chain gene (recombinant plasmid code: H12, H13, and H15) were combined in pair respectively, mixed with Fugen-6 liposome (Roche) and transfected into CHO cell. After 2 to 3 days of cells transfection, the culture supernatant was collected. The 96-well coated with human PV-1-Fc fusion protein, HRP-Goat anti-Mouse IgG (Fab Specific) as the second antibody (Purchased from Shanghai Xitang Biology company), the second tested antibody, was used to read the value at 492 nm in Microplate Reader to detect the binding of the chimeric antibody and human PV-1 protein.

(107) The ELISA representative result was shown in the following Table 1 and FIG. 14:

(108) TABLE-US-00009 TABLE 1 Analyzing the binding activity of the transient transfected cell culture supernatant and human PV1-Fc protein by ELISA method Dilution Times 2 4 8 16 32 64 128 256 512 1024 2048 4096 Light chain and H12 + L17 0.057 0.056 0.057 0.053 0.050 0.055 0.051 0.073 0.054 0.054 0.052 0.055 heavy chain H13 + L18 0.055 0.065 0.054 0.060 0.054 0.052 0.052 0.053 0.055 0.051 0.053 0.054 transfection H15 + L19 0.214 0.134 0.096 0.100 0.054 0.059 0.061 0.055 0.054 0.052 0.053 0.055 samples (Note: L17, L19 are light chains with correct sequences; H15 is a heavy chain with correct sequences; H12, H13 and L18 are chains with wrong sequencing results)

(109) As shown in Table 1 and FIG. 14, the CHO cell culture supernatant transfected with correctly expressed human-mouse chimeric antibody STW-139-15 heavy chain gene plasmid and correctly expressed light chain gene plasmid (H15+L19) can specifically bind to human PV-1-Fc protein.

(110) The above-transfected cell culture supernatant was centrifugated and filtered with a 0.45 μm filter membrane. It was loaded to a Protein-A chromatography affinity column (Protein-A Sepharose Fast Flow, GE, USA) and purified to obtain the human-mouse chimeric antibody (STW-139-15-C) with a purity of over 95%.

(111) Purified STW-139-15-C antibody protein was sterilized, then dissolved in sterile PBS solution to prepare the liquid formulation with a final protein solubility of around 10 mg/ml, which can be stored at a low temperature of 2-8° C. away from light for a long time.

Example 11. Detemining the Biological Efficacy or Activity of the Human-Mouse Chimeric Antibody (STW-139-15-C) in Macaca Fascicularis

(112) STW-139-15 does not recognize the mouse PV-1, so its biological efficacy or activity can not be tested in the mouse. Therefore, in the present example, Macaca Fascicularis was chosen as test animals to determine in vivo the effect of human-mouse chimeric antibody STW-139-15-C on the inhibition of choroidal neovasculature in Macaca Fascicularis induced by laser. The study was delegated to Chengdu Westchina-Frontier PharmaTech Co., (WCFP) and the National Chengdu New Drug Safety Evaluation Center to complete.

(113) Objective

(114) Study the effects of human-mouse chimeric antibody (STW-139-15C, sample code: STW007) through vitreous injection on choroidal neovascularization leakage and growth induced by laser in Macaca Fascicularis and provide an animal experimental basis for further study of this drug.

(115) The present aminal experimental study was divided into two stages, wherein the experimental model, administration grouping, and experimental results in the first stage are described as follows:

(116) Experimental Model and Administration Grouping

(117) 11.1 Modeling

(118) 11.1.1 Anesthetizing

(119) Macaca Fascicularis were anesthetized with pentobarbital sodium (25 mg/kg, intravenous injection), and a small amount of Refresh Celluvisc (Carboxymethylcellulose Sodium) was added irregularly during anesthesia to keep the cornea moist.

(120) 11.1.2 Dilating Pupils

(121) Mydrin-P (compound tropicamide eye drops) was applied to both eyes to dilate pupils.

(122) 11.1.3 Laser Photocoagulation

(123) The head of Macaca Fascicularis was fixed in front of the ophthalmic laser photocoagulation, and the macular area was photocoagulated by retinoscope. Photocoagulation around macular fovea but avoid damage to fovea, irradiation 8-9 points per eye. Laser parameters: spot diameter 50 μm, energy 0.6˜0.7 W, exposure time 0.05 s. Determination of successful photocoagulation: bubbles can be seen to indicate that Bruch's membrane was broken.

(124) One Fluorescein angiography was performed during 2 to 3 weeks after laser photocoagulation to judge the success of the modeling.

(125) The Macaca Fascicularis had at least one light spot of grade 4 on each eyeball to judge the success of the modeling.

(126) 11.2 Dosage Design

(127) The animals in each group were administered in the third week after laser photocoagulation. The dosage design was shown in Table 2:

(128) TABLE-US-00010 TABLE 2 Dosage Design Dosage of Drug Drug Number Group Material Administration Administration Concentration volume of Description Tested Route mg/eye mg/mL μL/eye Animals Model 0.9%NaCl Vitreous — — 50 1 control Injection injection group Positive Positive Drug Vitreous 0.5 20 25 1 control hPV19 injection group monoclonal antibody STW007 STW007 Vitreous 0.5 10 50 1 monoclonal injection antibody (STW- 139-15C) STW007 + STW007 Vitreous 0.25 10 25 1 Positive monoclonal injection drug group antibody (STW- 139-15C) Positive Drug 0.25 20 12.5 hPV19 monoclonal antibody

(129) The positive drug hPV19 monoclonal antibody was a humanized antibody specifically recognizing and binding human and monkey VEGF antigen (See Chinese patent document, ZL: 201210540692X, patent name: Monoclonal antibody for antagonizing and inhibiting binding of vascular endothelial growth factor to its receptor, and coding sequence; and the United States patent document: Patent No.: U.S. Pat. No. 9,580,498B2)

(130) 11.3 Administration

(131) Administration route: vitreous injection in both eyes;

(132) The reason for administration route: consistent with the clinical administration route;

(133) Administration frequency: single dose;

(134) Drug delivery method: each group of Macaca Fascicularis was anesthetized with pentobarbital sodium (around 25 mg/kg, intravenous injection, appropriate adjustments can be done according to the monkey anesthesia situation), disinfected the eyes to be injected with povidone-iodine solution. Table 2 showed that the corresponding concentration of STW007, positive drug, STW007 and positive drug were injected by vitreous injection in both eyes; the model control group was administered 0.9% NaCl injection with the same volume. If necessary, 1 to 2 drops of Oxybuprocaine Hydrochloride eye drops should be dropped into the eyes to be injected to conduct the surface anesthesia, then injected.

(135) After vitreous injection, 1 to 2 drops Ofloxacin eye cream was dropped to resist infection and moisten the cornea.

(136) The day of administration is defined as the first day of the trial.

(137) The Second Stage: Animal Experiments Results

(138) The effects of vitreous injection of STW-139-15C monoclonal antibody (STW007) and positive control drug hPV19 (anti-VEGF monoclonal antibody) on the reduction of fluorescein leakage area and the improvement rate of Macaca Fascicularis on the third week after photocoagulation were shown in Table 3 (statistical data up to the 49th day after administration).

(139) FIG. 15A to FIG. 15D showed fundus fluorescein images of each group at 7, 14, and 21 days after vitreous injection. IDC-32 T1 M

(140) TABLE-US-00011 TABLE 3 Effects of vitreous injection of STW007 on the reduction of fluorescein leakage area and the improvement rate of Macaca Fascicularis Sample group 1 + 2 Model control Sample group 1 Sample group 2 STW139-15C group 0.9% NaCl STW-139-15C anti-VEGF Mab and Index/ Injection Mab hPV19 hPV19Mab Time Determined n X ± SD n X ± SD n X ± SD n X ± SD Reduction of fluorescein leakage area (mm.sup.2) 7 days after 2 −22.347 ± 0.347 2 19.749 ± 5.455 2 12.075 ± 14.310 1 25.866 administration 14 days after 2 −21.091 ± 7.675 2  13.133 ± 12.150 2 12.877 ± 14.641 1 25.560 administration 21 days after 2 −15.778 ± 1.908 2 16.129 ± 9.182 2 14.207 ± 16.845 1 25.975 administration 25 days after 2  −3.288 ± 8.222 2  17.536 ± 10.119 2 14.377 ± 16311  1 27.733 administration 36 days after 2  −1.537 ± 25.918 2 21.483 ± 4.933 2 15.541 ± 20.343 1 23.387 administration 42 days after 2  −2.837 ± 19.808 2 23.191 ± 8.579 2 17.663 ± 20.082 2 30.934 ± 6.034 administration 49 days after 2  −10.161 ± 20.181 2 17.011 ± 4.580 2 16.672 ± 18.410 2 26.167 ± 9.461 administration Improvement rate of fluorescein leakage area (%) 7 days after 2  −54.73 ± 17.64 2 55.36 ± 0.53 2 45.75 ± 18.72 1 88.79  administration 14 days after 2 −48.65 ± 2.91 2  33.27 ± 24.52 2 51.84 ± 13.99 1 87.74  administration 21 days after 2  −39.27 ± 16.51 2  43.24 ± 13.36 2 53.78 ± 22.10 1 89.17  administration 25 days after 2  −11.12 ± 22.56 2  46.96 ± 14.93 2 58.06 ± 15.27 1 95.20  administration 36 days after 2  −13.49 ± 64.48 2 60.64 ± 3.50 2 49.37 ± 42.64 1 80.28  administration 42 days after 2  −14.37 ± 50.53 2 64.10 ± 5.72 2 71.12 ± 19.17 2 93.85 ± 3.27 administration 49 days after 2  −32.41 ± 56.94 2 47.73 ± 0.81 2 69.82 ± 12.84 2  78.31 ± 16.19 administration Note: At the time points from day 7 to day 36 after administration, there were no data on the leakage area in sample group 1 + 2 (4M001) on the right eye, so the sample size was 1.

(141) As shown in Table 3 and FIG. 15A-15D, compared with before administration, fundus fluorescein leakage in the model control group (0.9% NaCl injection) after administration showed no improvement but increased (the average improvement rate of fluorescein leakage area during the observation period was −11.12%˜−54.73%; fundus fluorescein series images from day 7 to day 21 were shown in FIG. 15A). On the other hand, the fundus fluorescein leakage of STW-139-15C monoclonal antibody sample (0.5 mg/eye) was significantly improved from day 7 after administration (the improvement rate of fluorescein leakage area during the observation period was 33.27/6-64.10%). Fundus fluorescein series images from day 7 to day 21 were shown in FIG. 15B); the reduction of fluorescence leakage was similar to the results of the positive control drug hPV19 (anti-VEGF Mab) group at the same dose (0.5 mg/eye) (the improvement rate of fluorescein leakage area during the observation period ranged from 45.75% to 71.12%, and fundus fluorescein series images from day 7 to day 21 were shown in FIG. 15C).

(142) After adminitering STW-139-15C monoclonal antibody sample (0.25 mg/eyes) in combination with the positive control drug hPV19 monoclonal antibody (0.25 mg/eyes), fundus fluorescein leakage area during the observation period maintained between 80.28%˜95.20% (fundus fluorescence angiography series images from day 7 to day 21 after administration were shown in FIG. 15D). Under the condition of halving the injection dose of a single drug, its effect is better than two times the dose of positive control drug hPV19 monoclonal antibody (0.5 mg/eyes). The result showed that STW-139-15C monoclonal antibody specifically binding to PLVAP/PV-1 had a significant inhibitory effect on laser-induced choroidal neovascularization in Macaca Fascicularis. When STW-139-15C monoclonal antibody and VEGF monoclonal antibody were combined, the efficacy was better than each single drug treatment.