Use of cannabidiol in treatment of pulmonary hypertension

Abstract

The present invention belongs to the field of medicine, and relates to use of cannabidiol (CBD) in the treatment of pulmonary arterial hypertension. The CBD can be used as the only active ingredient or combined with other active ingredients to prepare a medicament for treating pulmonary arterial hypertension. Specifically, the present invention relates to use of any one selected from (1) to (3) in the preparation of a medicament for treating and/or preventing pulmonary arterial hypertension: (1) CBD, (2) a plant extract containing the CBD; and preferably, the plant extract is a cannabis extract, and (3) a pharmaceutical composition containing the CBD and one or more pharmaceutically acceptable adjuvants. In the present invention, upon experimental researches, it has found that the CBD has the function of inhibiting pulmonary arterial hypertension, and is especially suitable for treating the pulmonary arterial hypertension caused by hypoxemia.

Claims

1. A method of treating pulmonary arterial hypertension in a human in need thereof consisting essentially of administering 0.1 mg/kg body weight-100 mg/kg body weight of synthetic cannabidiol to effectively treat the pulmonary arterial hypertension in the human in need thereof.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1: CBD reduces the increased right ventricular systolic pressure as caused by hypoxia, N=10/group, the numeral value is the average value±standard error, and when the wild-type normoxia group is taken as a reference, ***P<0.001; and when the wild-type hypoxia group is taken as a reference, ###P<0.001.

(2) FIG. 2: CBD reduces right ventricular hypertrophy caused by hypoxia, N=10/group, the numeral value is the average value±standard error, and when the wild-type normoxia group is taken as a reference, ***P<0.001; and when the wild-type hypoxia group is taken as a reference, ###P<0.001.

(3) FIG. 3: results of pulmonary arteriolar vascular HE staining (FIGS. 3A-3D) and elastic fiber staining (FIGS. 3E-3H), wherein the samples of FIGS. 3A-3D are paraffin sections of lung tissues of mice from groups 1-4 in sequence, and the samples of FIGS. 3E-3H are paraffin sections of lung tissues of mice from groups 1-4 in sequence.

(4) FIG. 4: CBD reduces the vascular remodeling rate caused by hypoxia, N=10/group, the numeral value is the average value±standard error, and when the wild-type normoxia group is taken as a reference, ***P<0.001; and when the wild-type hypoxia group is taken as a reference, ###P<0.01.

(5) FIG. 5: CBD inhibits LPS-induced activation of primary alveolar macrophages in vitro, The numerical value is the average value±standard error, and when the negative control group is taken as a reference, *P<0.05, **P<0.01; and when the LPS treatment group is taken as a reference, #P<0.05, ##P<0.01.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(6) Hereinafter, embodiments of the present invention will be described in detail with reference to examples, but those skilled in the art will understand that the following examples are only for illustrating the present invention and should not be considered as limiting the scope of the present invention. If no specific conditions are specified in the examples, the embodiments will be carried out according to conventional conditions or the conditions recommended by the manufacturer. All of the used agents or instruments which are not specified with the manufacturer are conventional commercially-available products.

Example 1: Test on Effect of Cannabidiol on Pulmonary Arterial Hypertension Caused by Hypoxia

(7) 1. Experimental Animals, Reagents and Instruments

(8) (1) Experimental Animals

(9) Healthy and lively C57BL/6 mice at the age of 4-6 weeks, with glossy hair colors, and body weights of (25.15±2.15) g (Laboratory Animal Center of Academy of Military Medical Sciences, SPF grade). The mice were divided into four groups:

(10) Group 1 (wild-type normoxia, used as a control group): 10 female mice and 10 male mice under normoxia conditions;

(11) Group 2 (wild-type hypoxia, used as a control group): 10 female mice and 10 male mice under hypoxia conditions;

(12) Group 3 (10 mg/kg, used as an experimental group): 10 female mice and 10 male mice were treated with 10 mg/kg by gavage under hypoxia conditions;

(13) Group 4 (50 mg/kg, used as an experimental group): 10 female mice and 10 male mice were treated with 50 mg/kg by gavage under hypoxia conditions.

(14) (2) Administration Method

(15) The mice of groups 2-4 were placed in an animal feeding chamber under normal pressure and hypoxia, the oxygen concentration in the chamber was maintained at 9%-11%, and the temperature in the chamber was maintained at 22-26° C. The mice of group 1 inhaled normal atmosphere air, and the other conditions were the same as those for mice of groups 2-4.

(16) Previous research results showed that a pulmonary arterial hypertension model using the significant increase in right ventricular systolic pressure as a standard could be established after 14 days of continuous hypoxia in mice (Ricard, N., Tu, L., Le Hiress, M., Huertas, A., Phan, C., Thuillet, R., Sattler, C., Fadel, E., Seferian, A., Montani, D., et al. (2014). Increased pericyte coverage mediated by endothelial-derived fibroblast growth factor-2 and interleukin-6 is a source of smooth muscle-like cells in pulmonary hypertension. Circulation 129, 1586-1597.). In order to explore whether CBD has a therapeutic effect on pulmonary arterial hypertension or not, the inventor first treated mice for 14 days in a continuous hypoxia environment to establish a model of pulmonary arterial hypertension (the groups 2-4), and then administration was started from day 15 to day 21 through gavage once a day, the mice were treated every day for 7 days (the group 3-4), and detection was performed on day 21.

(17) The specific detection steps were described in Part 2 “Experimental Method” hereafter.

(18) (3) Experimental Reagents

(19) Sodium pentobarbital (sigma); cannabidiol (Yunnan Hansu Biotechnology Co., Ltd); Crystal Violet, Victoria Blue B (Sinopharm Chemical Reagent Co., Ltd.); New fuchsine (Tokyo Chemical Industry).

(20) (4) Experimental Instruments

(21) A multi-channel physiological recorder (BE-EH4) from B&E TEKSYSTEMS LTD; an OLYMPUS microscope (CX4) from Olympus (China) Co., Ltd. (OCN); a hypoxia box (CJ-DO2) from Changsha Changjin Technology Co., Ltd; a fluorescence quantitative PCR instrument (Light Cycler480II) from Roche Applied Science.

(22) 2. Experimental Method

(23) (1) Determination of Right Ventricular Systolic Pressure (RVSP)

(24) On day 21, the mice were anesthetized by intraperitoneal injection of sodium pentobarbital (35 mg/kg), and the right ventricular systolic pressure was measured by using a catheter matched with a physiological instrument with reference to the right-heart catheterization reported by Song et al. (Song, Y., Jones, J. E., Beppu, H., Keaney, J. F., Jr., Loscalzo, J., and Zhang, Y. Y. (2005). Increased susceptibility to pulmonary hypertension in heterozygous BMPR2-mutant mice. Circulation 112, 553-562.). A tip of the catheter was connected with a signal acquisition and processing system of the multi-channel physiological recorder, and the position of the tip of the catheter was judged according to the blood pressure values and the migration changes of waveforms of the pressure curve displayed by a monitor. After the catheter entered the right ventricle, RVSP was determined and recorded.

(25) (2) Measurement of Right Ventricular Hypertrophy (RVH) Index

(26) According to the method by Ryan et al., after anesthesia of a mouse, the thoracic cavity of the mouse was opened to pick the heart, all blood vessels and ventricles were stripped off from the heart, the right ventricle was cut off, the weight of the right ventricle and the weights of the left ventricle plus diaphragm were weighed respectively, and the weight of the right ventricle was divided by the combined weight of the left ventricle and diaphragm (RV/(LV+S)).

(27) (3) HE Staining

(28) Sample: paraffin sections of mouse lung tissue.

(29) Objective: observing the pathology of lung tissues to detect whether there is a vascular wall thickening phenomenon or not.

(30) The cut paraffin sections were placed into an oven at 55° C. for 10 min.

(31) 1) the paraffin sections were dewaxed and went downward to 70% ethanol;

(32) xylene I: 15 min

(33) xylene II: 7 min

(34) 1:1 toluene-ethanol solution: 5 min

(35) Ethanol of various stages: each for 5 min

(36) 2) staining with a hematoxylin solution for 10-15 min;

(37) 3) rinsing with tap water for 2 min;

(38) 4) differentiation in a 0.5% hydrochloric acid-alcohol solution for 8 s;

(39) 5) turning back to blue with tap water for 10 min;

(40) 6) 70% alcohol.fwdarw.80% alcohol, each for 2 min;

(41) 7) 0.5% eosin-alcohol dye liquor for 50-70 s;

(42) 8) color separation with 90% ethanol and 95% ethanol, each for 3 min;

(43) 9) dehydrating with absolute ethanol I and II, each for 3 min;

(44) 10) absolute ethanol:xylene (1:1) for 3 min;

(45) 11) xylene I for 3 min;

(46) 12) xylene II for 3 min;

(47) Mounting with a neutral gum;

(48) After the completion of staining, the nucleus was presented as blue-purple, and the cytoplasm was presented as pink.

(49) (4) Elastic Fiber Staining (Elastic staining)

(50) Sample: paraffin sections of mouse lung tissue.

(51) Preparation of dye liquor: 1 g of Victorian Blue B.

(52) 1 g of New Fuchsin, and 1 g of Crystal Violet.

(53) The materials were dissolved in 200 ml of hot water, 4 g of resorcinol, 4 g of dextrin and 50 ml of 30% ferric chloride (prepared immediately before use) were sequentially added, the mixture was boiled for 5 min and filtered, the precipitate and the filter paper were dissolved in 200 ml of 95% ethanol, boiled for 15 min-20 min and filtered (in a water bath), and supplemented with 95% ethanol to 200 ml, and finally 2 ml of concentrated hydrochloric acid was added. The dye liquor was sealed and stored in dark place.

(54) Staining Method

(55) xylene I: 10 min; xylene II: 10 min; 100% ethanol: 5 min; 90% ethanol: 5 min; tap water: 5 min; 0.5% potassium permanganate for 5 min; rinsing with tap water for 2-3 min; a 1% oxalic acid solution for 2-3 min (just for bleaching); rinsing with tap water for 2-3 min; 95% ethanol for 2-3 min; staining with an Elastic dye liquor for 2 h; washing the dye liquor away with 95% ethanol; rinsing with tap water for 2-3 min; staining with a Van Gieson dye liquor for 1 min; dehydrating rapidly: 80% ethanol for 1 min, 90% ethanol for 1 min, absolute ethanol I for 5 min, absolute ethanol II for 5 min, xylene I for 5 min, and xylene II for 5 min.

(56) (5) Vascular Remodeling Rate

(57) The method by Keegan et al. (Keegan, A., Morecroft, I., Smillie, D., Hicks, M. N., and MacLean, M. R. (2001). Contribution of the 5-HT(1B) receptor to hypoxia-induced pulmonary hypertension: converging evidence using 5-HT(1B)-receptor knockout mice and the 5-HT(1B/1D)-receptor antagonist GR127935. Circulation research 89, 1231-1239) was employed, wherein counting was conducted with lung paraffin sections that had previously stained for elastic fibers, and 50-100 μm of pulmonary arterioles far away from the central airway were selected for counting, and a blood vessel that had a remodeling part exceeding ½ or more of the circumference of the blood vessel was recorded as a remodeled blood vessel.

(58) (6) Statistical Treatment

(59) The measurement data were expressed as mean±standard error, and statistical processing was conducted by employing SPSS 22.0. The statistical tests were all based on a double-tailed T test.

(60) 3. Experimental Results

(61) (1) Right Ventricular Systolic Pressure in PAH Mice

(62) The results were as shown in FIG. 1.

(63) After 21 days of continuous hypoxia, the mean right ventricular systolic pressure in the hypoxia model control group was (25.55±2.29) mmHg, which was significantly higher than that in the normoxia control group (17.54±1.48) mmHg, with a statistically significant difference (P<0.001).

(64) After the CBD treatment, the mean right ventricular systolic pressure in the 10 mg/kg experimental group was (16.90±2.31) mmHg, which was significantly lower than that in the hypoxia model control group, with a statistically significant difference (P<0.001); the mean right ventricular systolic pressure in the 50 mg/kg experimental group was (17.92±2.37) mmHg, which was also significantly lower than that in the model group, but there was no significant difference in the results of the two dose treatment groups (10 mg/kg and 50 mg/kg).

(65) (2) The CBD Treatment Significantly Inhibited the Right Ventricular Hypertrophy Index of the PAH Mice

(66) The results were as shown in FIG. 2.

(67) The right ventricular hypertrophy index of the mice in the model group was (32.62±1.41)%, which was significantly higher than that of the mice in the normoxia control group (25.99±1.17)%. After the CBD treatment, the right heart index of the mice in the 10 mg/kg and 50 mg/kg experimental groups were (30.18±1.01)% and (29.90±1.19)%, respectively, which were significantly lower than that of the model group, with a statistically significant difference (P<0.001), but there was no significant difference between the different dose treatment groups.

(68) (3) Pathological Changes of Pulmonary Arterioles

(69) The results were as shown in FIGS. 3A-3H and 4.

(70) In the hypoxia model group, the vascular wall of the mice was significantly thickened and remodeled. After the CBD treatment, the pulmonary arteriole remodeling was significantly reduced, and the remodeling rate was significantly reduced.

(71) Both dose groups of cannabidiol could reduce the right ventricular systolic pressure and inhibit the right ventricular (RV) hypertrophy index; and the pathological remodeling had an improvement effect, including the reduction of arterial medial wall thickness ratio, the reduction of vascular wall medial cross-sectional area ratio and the reduction of the right ventricular hypertrophy.

Example 2: In Vitro Experiment of Treating LPS-Induced Macrophages with Cannabidiol

(72) 1. Experimental Animals, Reagents and Instruments

(73) 2-month-old C57BL/6 mice (Laboratory Animal Center of Academy of Military Medical Sciences, SPF grade)

(74) RPMI-1640 (Sigma)

(75) Cannabidiol (CBD, Yunnan Hansu Biotechnology Co., Ltd)

(76) LPS (Sigma)

(77) Fluorescence quantitative PCR instrument (Roche)

(78) 2. Experimental Method

(79) Primary alveolar macrophages were isolated according to the method by Yang et al. (Yang, H. M., Ma, J. Y., Castranova, V., and Ma, J. K. (1997). Effects of diesel exhaust particles on the release of interleukin-1 and tumor necrosis factor-alpha from rat alveolar macrophages. Experimental lung research 23, 269-284.): two-month-old mice were taken and injected intraperitoneally with pentobarbital to be anesthetized. The mice were fixed at a supine position, and disinfected at the neck, and the neck skin was cut open to strip gland muscles and expose the trachea. A small opening was cut in an upper part of the trachea without cutting off. A small white pipette tip was inserted onto a 1 ml pipette to pipette 1 ml PBS at 4° C. (free of Ca.sup.2+, free of Mg.sup.2+, 0.6 mm EDTA) [50 ml PBS+0.00876 g EDTA] into the lung from the opening, and then pipetted out from the opening after blowing in. Then fresh PBS was taken and pipetted into and out from the opening repeatedly for 3-4 times. The collected alveolar irrigation solution was centrifuged at 200× g for 5 minutes, and the supernatant was discarded. The cells were washed once with a serum-free RPMI-1640 culture medium and centrifuged at 200× g for 5 minutes. The cells were resuspended by adding a serum-containing RPMI-1640 and then inoculated. The cells were subjected to adherence for 2 h, and then washed for three times with PBS. A serum-containing RPMI-1640 was added, and the cells were cultured under 5% carbon dioxide at 37° C.

(80) Alveolar macrophages of the mice were taken and randomly divided into six treatment groups (about 5×10.sup.6 cells in each group), wherein the first group was a negative control; the second group was induced by 100 ng/mL LPS (LPS was added into the culture medium) to simulate a inflammatory reaction model in vivo; the third group was a CBD control group (5 μM CBD was added into the culture medium); and the fourth group was pre-treated with 0.5 μM CBD for 0.5 h, and then induced by 100 ng/mL LPS (0.5 μM CBD and 100 ng/mL LPS were added into the culture medium). The fifth group was pre-treated with 1 μM CBD for 0.5 h and then induced by 100 ng/mL LPS (1 μM CBD and 100 ng/mL LPS were added into the culture medium). The sixth group was pre-treated with 5 μM CBD for 0.5 h and then induced by 100 ng/mL LPS (5 μM CBD and 100 ng/mL LPS were added into the culture medium). The cells were collected after treatment for 5 h, and the expression changes of cellular inflammation cytokines TNF-α, IL-6 and Mgl.sub.2 in each group were detected by the fluorescence quantitative PCR instrument.

(81) TABLE-US-00001 Primers for detecting TNF-α (SEQ ID NO: 1) forward primer: CCCTCACACTCAGATCATCTTCT (SEQ ID NO: 2) reverse primer: GCTACGACGTGGGCTACAG Primers for detecting IL-6: (SEQ ID NO: 3) forward primer: GAGGATACCACTCCCAACAGACC (SEQ ID NO: 4) reverse primer: AAGTGCATCGTTGTTCATACA Primers for detecting Mg1.sub.2: (SEQ ID NO: 5) forward primer: AGGCAGCTGCTATTGGTTCTCTGA (SEQ ID NO: 6) reverse primer: AGTTGACCACCACCAGGTGAGAAT

(82) 3. Experimental Results

(83) The results were as shown in FIG. 5.

(84) The results showed that CBD could significantly inhibit the expression of LPS-induced inflammation-related TNF-α and IL-6 in a dose-dependent manner, and promote the expression of Mgl.sub.2, a gene that inhibited inflammation.

(85) Although specific embodiments of the present invention have been described in detail, those skilled in the art will understand the following things. In light of all the teachings that have been disclosed, various modifications and replacements can be made to those details, which are all within the protection scope of the present invention. The full scope of the present invention is given by the appended claims and any equivalents thereof.