Methods for establishing colorectal cancer p73 reporter gene cell line

Abstract

The present invention discloses a method for establishing a colorectal cancer p73 reporter gene cell line, specifically including: first designing a site-specific sgRNA sequence of a p73 gene and cloning same into a plasmid PX459; integrating a homologous recombination sequence of the p73 gene and a green fluorescent protein DNA fragment (EGFP), and transforming the plasmid and the integrated fragment together into a colorectal cancer cell line HCT116 by electroporation; performing signal cell screening through a flow cytometer to obtain EGFP-expressing cells, and amplifying a monoclonal cell line; and identifying a positive p73 reporter gene cell line through PCR identification and Western blot, among screened EGFP-expressing cell lines. The colorectal cancer cell line p73 gene and the EGFP are co-expressed, and the expression level of the EGFP is highly consistent with that of the p73 gene. Therefore, the expression level of the p73 gene can be accurately determined by detecting changes in the expression level of the EGFP. The method for establishing the cell line in the present invention is simple, easy to implement, high in efficiency and precise in gene site positioning.

Claims

1. A method for establishing a colorectal cancer p73 reporter gene cell line, the method comprising the following steps: step 1: obtaining a downstream site-specific p73-sgRNA sequence of a p73 gene, wherein the sequence of the p73-sgRNA is as set forth in SEQ ID NO. 1; step 2: constructing a pX459/p73-sgRNA plasmid; step 3: integrating a homologous recombination sequence of the p73 gene and an EGFP fragment; step 4: transforming the plasmid pX459/p73-sgRNA and the green fluorescent protein integrated fragment together into a colorectal cancer cell line HCT116 by electroporation with a ratio of 1:1; step 5: performing single cell screening through a flow cytometer to obtain EGFP-expressing cells, and amplifying a monoclonal cell line; and step 6: further identifying a positive p73 reporter gene cell line through genome PCR and Western blot, among the screened EGFP-expressing cells; wherein in step 2, the method for constructing a pX459/p73-sgRNA plasmid comprises the following step: directly obtaining the plasmid pX459/p73-sgRNA with a correct ssRNA sequence after synthesizing by a biological company according to the sequence of the p73-sgRNA; in step 3, the method for integrating a homologous recombination sequence of the p73 gene and an EGFP fragment comprises the following step: directly obtaining a correct integrated fragment L-EGFP-R after synthesizing by the biological company according to the homologous recombination sequence of the p73 gene and an EGFP sequence; and the sequence of the fragment L-EGFP-R is as set forth in SEQ ID NO. 2.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a schematic diagram of a green fluorescent protein target gene knock-in mechanism.

(2) FIG. 2 shows screening of single cell clones expressed by green fluorescent proteins through a flow cytometer.

(3) FIG. 3 shows a green fluorescent protein expressed by a screened positive p73 reporter gene cell line.

(4) FIG. 4 shows identification of the p73 reporter gene cell line through PCR.

(5) FIG. 5 shows identification of the p73 reporter gene cell line through Western blot.

(6) FIG. 6 shows knockdown of co-expression of p73 and EGFP by shRNA.

DETAILED DESCRIPTION

(7) The present invention will be further described below in specific embodiments, so that persons skilled in the art can better understand the present invention and implement same. However, the present invention is not limited to the embodiments.

(8) Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods, and the used materials and reagents can be obtained by commercial approaches.

Embodiment 1

Establishment of a Colorectal Cancer p73 Reporter Gene Cell Line

(9) At step 1, an appropriate p73-sgRNA sequence is designed and evaluated;

(10) an sgRNA sequence is obtained through screening and evaluation, and is shown as follows:

(11) p73-sgRNA: CGGAGGCCGAGATCCACTGA (>chr1:3733060-3733079), as set forth in SEQ ID NO. 1.

(12) At step 2, a pX459-sgRNA plasmid is constructed, including the following step:

(13) directly obtaining the plasmid pX459/p73-sgRNA of a correct sgRNA sequence after synthesizing by a biological company according to the sequence of the p73-sgRNA.

(14) At step 3, an L-EGFP-R fragment is obtained by integration, including the followings step:

(15) directly obtaining a correct integrated fragment L-EGFP-R after synthesizing by the biological company according to a homologous arm of the p73 gene and an EGFP sequence. The sequence is as set forth in SEQ ID NO. 2, and the construction process is shown in FIG. 1.

(16) At step 4, a colorectal cancer p73 reporter gene cell line having green fluorescence is screened, including the following step:

(17) transforming the plasmid pX459/p73-sgRNA and the green fluorescent protein integrated fragment together into a colorectal cancer cell line HCT116 by electroporation with a ratio of 1:1.

(18) First, single cell screening is performed using 96-well plates in a flow cytometer (see FIG. 2), and 7-10 cell strains having EGFP expression may be obtained by each 96-well plate. The EGFP knock-in efficiency reaches 7-8%, which is significantly higher than the knock-in efficiency of generally 1% in this field.

(19) A selected monoclonal cell line is amplified and cultured (see FIG. 3). A genome DNA of cells having EGFP expression is extracted and obtained. Genome PCR is performed, and if positive amplification is obtained, it indicates that the insertion is successful, and a p73 reporter gene cell line is obtained. The primer sequences for PCR identification are as follows:

(20) TABLE-US-00001 Forward primer F-GT: GGGGGCCCTGAAGATCCCCGAGCAG, as set forth in SEQ ID NO. 3; and Reverse primer R-GT: CCGAGGAGAGGGTTAGGGATAGGC, as set forth in SEQ ID NO. 4.

(21) Wild type cells are also subjected to genome PCR, and the primer sequences for PCR identification are as follows:

(22) TABLE-US-00002 Forward primer F-WT: GGGGGCCCTGAAGATCCCCGAGCAG, as set forth in SEQ ID NO. 5; and Reverse primer R-WT: GCTGCAGCCAGGCGAGGCCC, as set forth in SEQ ID NO. 6.

(23) The comparison result of PCR identification is shown in FIG. 4, and four p73 reporter gene cell lines are obtained.

(24) Finally, a positive p73 reporter gene cell line is further identified through genome PCR and Western blot, among the screened EGFP-expressing cells. The identification result is shown in FIG. 5, and finally, four p73 reporter gene cell lines are obtained.

(25) After stable passage of 30 generations of the p73 reporter gene cell line, sequencing shows that the gene knock-in sequence still keeps genetic stability.

Embodiment 2

Functional Verification of a Colorectal Cancer p73 Reporter Gene Cell Line

(26) Two different specific targeted p73 gene small-molecule interference RNAs are designed, i.e., shRAN-1 and shRAN-2 as shown in FIG. 6, which are respectively transfected into an p73 reporter cell line. After 72 hours, according to transcriptional level analysis, it shows that compared with non-knock-down control, the two specific small-molecule interference RNAs effectively reduce the expression level of the p73 gene (about 70-80% is knocked down). Moreover, the expression of the EGFP gene is also correspondingly reduced by 70-80% along with the knockdown of the p73 gene. The experimental result proves from a molecular level that the reporter gene EGFP and the p73 gene in the colorectal cancer p73 reporter gene cell line constructed in the present invention can be synchronously co-expressed, are synchronously inhibited by shRNA, and can be used for inhibition or over-expression tracing of the p73 gene.

(27) Finally, it should be noted that the aforementioned embodiments are only used for describing the technical solutions of the present invention rather than limiting the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, persons skilled in the art should understand that the technical solutions of the present invention may be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.