Glycolic acid and/or D-lactic acid for the treatment of neurodegenerative diseases

Abstract

A method of treatment of a neurodegenerative disease which is associated with a decline in mitochondrial activity, includes administering to a person in need of such treatment at least one of Glycolic acid or a pharmaceutically acceptable salt or ester thereof, and D-lactic acid or a pharmaceutically acceptable salt or ester thereof.

Claims

1.-15. (canceled)

16. A method of treatment of a neurodegenerative disease which is associated with a decline in mitochondrial activity, said method comprising administering to a person in need of such treatment at least one of Glycolic acid or a pharmaceutically acceptable salt or ester thereof, and D-lactic acid or a pharmaceutically acceptable salt or ester thereof.

17. The method of claim 16, wherein said disease is at least one of Parkinson's disease, Alzheimer's disease, Huntington's disease, Amyotrophic lateral sclerosis, and other neurodegenerative diseases.

18. The method of claim 17, wherein the disease is Parkinson's disease.

19. The method of claim 16, wherein the glycolic acid or a pharmaceutically acceptable salt or ester thereof, and/or the D-lactic acid or a pharmaceutically acceptable salt or ester thereof are comprised in a formulation, said formulation containing (i) glycolic acid or a pharmaceutically acceptable salt or ester thereof, in an amount of at least 0.005% (w/w), preferably at least 0.0075% (w/w), and most preferably at least 0.01%, and/or (ii) D-lactic acid or a pharmaceutically acceptable salt or ester thereof in an amount of at least 1.0% (w/w), preferably at least 1.5% (w/w) and most preferably at least 4.5% (w/w).

20. The method of claim 16, further comprising administering pyruvate to said person.

21. The method of claim 16, further comprising administering one or more antioxidants to said person.

22. The method of claim 21, wherein the antioxidants comprise coenzyme Q10.

23. The method of claim 16, further comprising administering one or more vitamins to said person.

24. The method of claim 23, wherein said one or more vitamins are selected from at least one member of the group consisting of vitamin E, C, B2 and B9.

25. The method of claim 16, further comprising administering at least one of L-arginine, L-carnitine and L-creatine to said person.

26. The method of claim 16, wherein the glycolic acid or the pharmaceutically acceptable salt or ester thereof, or the D-lactic acid or the pharmaceutically acceptable salt or ester thereof is formulated as a medical food or medical food supplement.

27. The method of claim 26, wherein the medical food or medical food supplement is a milk-based medical food or medical food supplement.

28. A pharmaceutical formulation, comprising glycolic acid or a pharmaceutically acceptable salt or ester thereof in an amount of at least 0.005% (w/w), preferably at least 0.0075% (w/w), most preferably at least 0.01% (w/w), and/or D-lactic acid or a pharmaceutically acceptable salt or ester thereof in an amount of at least 1.5% (w/w), preferably at least 3% (w/w), most preferably at least 4.5% (w/w).

29. The pharmaceutical formulation of claim 28, wherein the pharmaceutical formulation is a medical food or medical food supplement.

30. The pharmaceutical formulation of claim 29, wherein the medical food or medical food supplement is a milk-based medical food or medical food supplement.

31. The pharmaceutical formulation of claim 28, further comprising at least one of pyruvate, antioxidants, vitamins, L-arginine, L-carnitine and L-creatine.

32. The pharmaceutical formulation of claim 31, wherein the antioxidants comprise coenzyme Q10.

33. The pharmaceutical formulation of claim 31, wherein the vitamins are selected from at least one of Vitamin E, C, B2 and B9.

Description

[0072] The figures show

[0073] FIG. 1: DJ-1 is required for mitotic cell rounding and mitochondrial structure upon desiccation. (A) Mitotic rounding force of HeLa cells upon knocking down Parkinson's disease-related genes. Points indicate average cellular force of 12-18 cells normalized to Luciferase (Luc) control. Horizontal blue bars and error bars represent the mean of these values and the associated standard error of the mean, respectively. (B) Rounding force of esiRNA-treated HeLa cells during mitosis. n>4. (C) Rounding pressure of wild type (WT) and DJ-1 knock-out (KO) mouse embryonic fibroblasts (MEFs) throughout mitosis. Points represent individual measurements. Horizontal blue bars and error bars represent the mean and the standard deviation, respectively. **p<0.01. (D) Experimental procedure for preconditioning and rehydration of C. elegans dauer larvae. RH, relative humidity. (E) Differential expression of djr-1.1, djr-1.2, and glod-4 genes in the C. elegans dauer larva upon preconditioning. Tsp-21 gene was used as the internal control. (F) Disruption of the mitochondrial network upon desiccation and rehydration in daf-2ΔΔddjr dauer larvae treated with glod-4 RNAi. Scale bar, 10 μm.

[0074] FIG. 2: Glycolate and D-lactate rescue phenotypes induced by loss of DJ-1 function. (A) Rounding pressure of mitotic RNA-treated HeLa cells in the presence of glycolate (GA), D-lactate (DL) and L-lactate (LL). Horizontal blue bars and error bars represent the mean and the standard deviation, respectively. *p<0.05; **p<0.01, **p<0.001. (B) Mitochondria of paraquat (PQ.sup.2+)-treated HeLa cells. Green, MitoTracker; Blue, DNA. inset, 4× magnification of the boxed area. (C) Circularity of mitochondria of HeLa cells. n≧280. (D) Mitochondria in worm glyoxalase mutants. Wild type (N2), DJ-1 mutant (ΔΔdjr) and GLOD-4 mutant (glod-4) were treated with PQ.sup.2+ with or without GA, and stained with MitoTracker (red). Dashed lines show the outlines of larvae. Scale bars, 10 μm.

[0075] FIG. 3: Glyoxalases produce glycolate and D-lactate to rescue the cell rounding defect of DJ-1-depleted cells. (A) Selected energy metabolism pathways. Key enzymes involved in the pathways were knocked down to test their effects on mitotic rounding pressure. Substances were added to the DJ-1 RNAi cells in an attempt to rescue reduced rounding pressure. Examples of the effects are in the box. Glo-6-P, glucose-6-phosphate; Fru1,6-bisP, fructose-1,6-bisphosphate; GAP, glyceraldehyde-3-phosphate; DHAP, dihydroxyacetone phosphate; 2-DG, 2-deoxyglucose, GYS, glycogen synthase, ALDOA/B/C, aldolases, TPI1, triose phosphate isomerase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase, Glo I, glyoxalase I; Glo II, glyoxalase II; LDHA/B/C, lactate dehydrogenases; LDHD, D-lactate dehydrogenase. Dashed lines show putative sources of glyoxal and methylglyoxal. Green line shows the protective effect of GA and DL on mitochondia. (B) Mean ATP levels normalized to total protein in RNAi-downregulated cells. Oligomycin A (OLA) and 2-DG were used to suppress ATP production. Error bars represent SD. n=5. (C) Rounding pressure of the DJ-1 GLO1 double RNAi-treated cells in the presence of glucose, GA, DL, and LL. Points show individual cells, horizontal blue bars and error bars represent the mean and SD, respectively. **p<0.01,**p<0.001.

[0076] FIG. 4: Glycolate, D-lactate and glucose support viability of dopaminergic neurons in vitro. (A) Viability of the dopaminergic neurons in vitro from wild type and DJ-1 mutant mice embryos. Points show the ratio of tyrosine hydroxylase-positive (TH) cells to the control (no supplement). Horizontal blue bars and error bars represent the mean and the standard deviation, respectively. **p<0.01, ***p<0.001. (B) Viability of the dopaminergic neurons in the presence of 12.5 μM PQ′ in the absence or presence of GA, DL, or LL. Primary neurons isolated from wild-type E14.5 embryos were cultured in vitro in the presence of the indicated supplements and PQ.sup.2+. Points show the ratio of TH.sup.+ cells to the control (no supplement). Horizontal blue bars and error bars represent the mean and the standard deviation, respectively.

[0077] FIG. 5: DJ-1 is required for mitotic cell pressure generation. (A) Left, Schematic of a fast force measurement assay. Right, Example of a measurement. (B) Schematic of a rounding pressure assay. A metaphase cell was first compressed with a tipless cantilever at 14 μm, then the cantilever was lowered to 8 um at 0.1 um/sec to measure the peak (F.sub.peak) and the equilibrium (F.sub.8 μm) rounding forces. The maximal cross section area of the compressed cell was measured to calculate cell volume and rounding pressure corresponding to Fam. Right graph, a typical measurement. Red, rounding force, blue, height of the cantilever from the substrate. (C) Rounding pressure and volume of HeLa cells RNAi knocked down of the selected Parkinson's diseases genes. Result is representative of at least three independent tests, showing data of Individual cells with the mean and standard deviation (SD). *p<0.05; *p<0.01; ***p<0.001. (D) Rounding pressure of metaphase HeLa cells in the trans-mitotic measurement experiment (FIG. 1B). The maximal cell pressure during metaphase is plotted, with the mean (blue) and SD. (E) Rounding pressure of HeLa cells expressing mouse DJ-1 transgene. As the esiRNA for human genes does not usually affect mouse ortholog expression (Kittler et al., 2005), the lower rounding pressure phenotype was rescued by the mouse DJ-1 transgene (fourth group). Pressure of individual mitotic cells was shown with mean (blue) and SD. A typical result of independent tests is shown. (F) Volume of mitotic mouse embryonic fibroblast (MEF). Mitotically arrested wild type (WT) and DJ-1 knock-out (KO) MEFs were compressed to measure rounding pressure (FIG. 1c) and volume. Data of the individual cells are plotted with mean and SD. Result is representative of three independent experiments. (G) Expression of DJ-1 protein in MEFs and RNAi-treated HeLa cells. DJ-1 and tubulin proteins in the lysate were detected in Immunoblotting. No DJ-1 protein detected in KO MEFs. By a densitometric analysis, RNAi of DJ-1 downregulated its expression by 75% in HeLa cells.

[0078] FIG. 6: Upregulation of glyoxalase genes upon desiccation of C. elegans dauer, and the effects of paraquat on worm larvae. (A) The differential expression of djr-1.1, djr-1.2 and glod-4 was tested by RT-PCR in four replicates. See FIG. 1d for the procedure. tsp-21 was a control whose expression did not change by desiccation stress. (B) Length of the worms treated with PQ.sup.2+. Bars and error bars show the mean and SD, respectively. Sensitivity to PQ.sup.2+ was comparable between strains (F=2.334, df=2, p=0.1) but overall increased by concentration (F=81,159, df=5, p<0.001). Every strain was compared to its control at different PQ.sup.2+ concentrations by two-way ANOVA followed by Tukey's honestly significant differences (HSD) test. (C) Worm larvae treated with PQ or control. Scale bar, 250 μm. (D) survival of the worm larvae treated with 200 μM paraquat and 1 mM of the Indicated supplements. Bars and error bars show the mean and SD, respectively. Every strain was affected differently upon each treatment (strain level F=10.748, df=2, p<0.001; treatment level F=24.467, df=5, p<0.001). PQ.sup.2+ decreased viability of ΔΔdjr mutant, which was restored by glycolate (GA), but not by D-lactate (DL), L-lactate (LL), or pyruvate (Pyr). Viability of glod-4 was not affected by PQ.sup.2+ significantly, however the lethality was rescued in a similar way as ΔΔdjr. Every strain was compared to its own control by two-way ANOVA followed by Tukey's HSD test. Data were normalized by Freeman-Tukey's double arcsine transformation prior to ANOVA. *p<0.05; *p<0.01; **p<0.001.

[0079] FIG. 7: DJ-1 is required for response to hypotonic shock during mitosis. (A) Volume change upon Osmotic shock. Mitotic HeLa cells arrested with S-trityl-L-cysteine (STC) were treated with the equal volume of the isotonic (CO.sub.2-independent medium, 300 mOsm), hypotonic (distilled water), and hypertonic (2.86% (w/v) xylose, 500 mOsm) media after 4 min (gray vertical line). Then the volumes of mitotic cells were measured over time. Mean relative volumes (normalized to initial volume) with 95% confidence interval (CI) are shown. (B) Volume change of DJ-1-knock-down mitotic cells upon osmotic shock. Mitotically arrested, esiRNA-treated HeLa cells were treated with hypotonic (left panel) and hypertonic (right panel) media after 4 minutes (light blue or gray vertical lines, respectively). Then the volumes of the mitotic Cells were measured. Mean relative Volumes and 95% CIs are shown.

[0080] FIG. 8: Glycolate and D-lactate rescue the cell pressure defect of DJ-1-deficient mammalian cells. (A) Volume of metaphase RNA-treated HeLa cells supplemented with glycolate (GA), D-lactate (DL), and L-lactate (LL). Data of individual cells with the mean (blue) and SD are shown. Result is representative of three independent experiments. (B) Pressure (left) and volume (right) of mitotic MEF cells supplemented with GA, DL, and LL. Data of individual cells with the mean and SD are shown. *p<0.05; *p<0.01;**p<0.001. (C-D) Rounding pressure (left) and volume (right) of RNAi-treated mitotic HeLa (C) and MEF (D) cells, in the presence of 10 mM glycolate (GA), D-lactate (DL), and L-lactate (LL). Cells were measured after 1 hour from addition of the supplement. Data of individual cells with mean and SD are shown. Like 1 mM of the supplements, 10 mM of GA and DL, but not LL, rescued the lower pressure phenotype. At 10 mM, GA and LL may have negative effects on cell mechanics as it decreases pressure of mitotic WT MEFs. *p<0.05; **p<0.01; ***p<0.001.

[0081] FIG. 9: Glucose, glycolate, D-lactate rescue mitochondria structure of DJ-1-depleted human cells. (A-D) Mitochondria (green) and DNA (blue) of cells treated with control RNAI (A), DJ-1 RNA (B), control RNAI and paraquat (PQ′) (C), and DJ-1 RNAi and PQ.sup.2+ (D). RNAi-treated cells were Incubated with the indicated supplements for 24 hours, stained with MitoTracker, and fixed. Note the round mitochondria in PQ.sup.2+-treated DJ-1 RNAi cells without supplements. Scale bar, 10 μm. (E) Quantification of the disruption of mitochondrial network. Circularity of mitochondria in cell periphery was calculated (n>280 for each box). On the right, the relation between the mitochondrial shape and circularity is drawn. Circularity in each condition was compared to its own control by one-way ANOVA followed by Tukey's HSD test. *p<0.05; **p<0.01: ***p<0.001.

[0082] FIG. 10: Glucose rescues the lower pressure phenotype of mitotic DJ-1-depleted cells. (A) Rounding pressure and volume of the RNA-treated HeLa cells were measured before (−) and after (+) addition of 20 mM glucose. Note that glucose did not rescue the lower pressure of MYH9-RNAi cells. Data of individual cells with mean and SD are shown. **p<0.01; **p<0.001. (B) Rounding pressure and volume of mitotic wild-type (WT) and DJ-1 knock-out (KO) MEFs. Glucose rescued the pressure defect of DJ-1 KO MEFs after a long incubation, but not within a few hours. Data of individual cells with mean and SD are shown. (C-D) Rounding pressure (left) and volume (right) of RNAi-treated metaphase cells in a low (C) or no (D) glucose medium, in the presence of glucose, glycolate (GA), and D-lactate (DL). HeLa cells were maintained for 2 or more passages in the low or no glucose medium before RNAi. Cells were measured after 1 hour since addition of the Supplement. Data of individual cells with mean and SD are shown. The rescue of the lower pressure phenotype was observed in both types of media. Results are representative of three independent experiments.

[0083] FIG. 11: Glyoxalases produce glycolate and D-lactate to rescue the cell rounding defect of DJ-1-depleted cells. (A) immunoblot of DJ-1 in control and DJ-1 RNAi cells. Tubulin serves as a loading control. (B) ATP:ADP ratio of the RNAI-treated HeLa cells in the presence of glucose. RNAi-treated cells were lysed in perchloric acid. Neutralized and filtered lysates were separated in reversed-phase HPLC. Relative abundance of ATP to ADP is plotted. (C) Immunoblot of DJ-1 and GLO1 in control, DJ-1- and GLO1-RNAi-treated HeLa cells. Tubulin serves as a loading control. Double RNAi of DJ-1 and GLO-1 efficiently downregulates the expression of both proteins. (D) Volume of the DJ-1 GLO1 double RNAitreated cells in the presence of glucose (Glc), GA, DL, and LL. See FIG. 3c for the corresponding cell pressure result. Result is representative of two independent experiments, showing individual cell data with mean (blue) and SD.

[0084] FIG. 12: Glycolate, D-lactate, and glucose support in vitro survival of the dopaminergic neuron. (A) Survival of the primary dopaminergic neurons in the presence of the different concentrations of D-lactate, glycolate, and glucose (Glc). The primary neurons from wild type mouse embryos were cultured with the indicated substances for 6 days, fixed, and stained for tyrosine hydroxylase (TH), a dopaminergic neuron-specific marker. The relative number of the TH.sup.+ cells to none-treated control was plotted, with mean and SD. Each dot indicates an independent experiment. (B) immunoblot of DJ-1 in wild type and DJ-1 mutant mouse brain. Total brains isolated from wild type and DJ-1 mutant adults and embryos were lysed, and tested for DJ-1 expression. Tubulin is the loading control.

[0085] FIG. 13: Effect of depletion of energy metabolism genes on mitotic rounding pressure. The indicated genes were RNAi-depleted in HeLa cells, and rounding pressure of metaphase cells was measured on the AFM. Mean rounding pressure it SD was shown, as well as the relative pressure value to that of Luciferase control RNAi cells. In the rightmost column, the effect of RNAI was annotated by statistical significance to the control.

[0086] FIG. 14: Effect of the substances on the lower pressure phenotype in mitotic DJ-1 RNAi cells. Control (Luc) and DJ-1 RNAi-treated cells were treated with the indicated substances, many of which were shown in FIG. 3a. After 1 hour, pressure or rounding force of mitotic HeLa cells was measured on the AFM. Meant SD as well as the relative pressure/force value to that of untreated control was shown. In the rightmost column, the effect of the compound was annotated by statistical significance: Rescue, the substance restored pressure of DJ-1 RNAi cells to that of control RNAI cells, No rescue, the substance did not significantly change pressure of DJ-1 RNAi cells, Toxic, the substance affected cell pressure both in control and DJ-1 RNAI cells.sup.1, the glucose-mediated rescue was inhibited by 6-aminonicotinamide, an inhibitor of the pentose-phosphate pathway.sup.2, treatment caused rounding pressure that is higher than that of untreated DJ-1 RNAi cells but lower than that of untreated control RNAi cells..sup.3, rounding force was measured.

[0087] The examples illustrate the invention.

EXAMPLE 1—MATERIALS AND METHODS

[0088] Cell Culture, RNAi, Worm Strains

[0089] HeLa-Kyoto cells stably expressing histone H2B-EGFP and mCherry-CAAX (clone 2B4), their parental cells, and HeLa-Kyoto expressing mouse DJ-1 transgene were used. Also, mouse embryonic fibroblast (MEF) (Pham et al., 2010) cells were used. Cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS), 2 mM GlutaMAX, 100 unit/ml penicillin, 100 μg/ml streptomycin, plus additional antibiotics for the transgene (0.5 mg/ml Geneticin for H2B-EGFP and mouse DJ-1 BAC transgene; 0.5 pug/ml puromycin for mCherry-CAAX), at 37° C. in a 5% CO.sub.2 environment. The DMEM with high glucose (5 g/1) was used unless specifically mentioned (e.g. FIG. 14). For atomic force microscopy (AFM) measurements of mammalian cells, a CO.sub.2-independent medium containing 4 mM sodium bicarbonate and 20 mM HEPES Was used. HeLa Cells Were RNAi-transfected with 160 nM endoribonuclease-digested small interfering RNA (MISSION esiRNA, Sigma) using oligofectamine reagent (Invitrogen). Paraquat (PQ.sup.2+) was added 24 hours after RNAI. Cells were assayed after 48 hours from RNAI.

[0090] Worm Strains

[0091] All C. elegans strains were maintained on NGM agar plates seeded with Escherichia coli NA22 at 15° C. (Brenner, 1974). Mutant strains djr-1.1(tm918), djr-1.2(tm951) and glod4(tm1266) were obtained from National Bioresource Project, Japan. Wild type (N2) and daf-2 mutant strains were obtained from Caenorhabditis Genetics Center, USA. All mutants were outcrossed at least twice. DJ-1 double mutant djr-1.1(tm918), djr-1.2(tm951), abbreviated as ΔΔdjr, was achieved by crossing both single mutants. This strain was then further crossed to daf-2 to generate daf-2; ΔΔdjr triple mutant.

[0092] Generation of DJ-1 Double Mutants

[0093] Outcrossed djr-1.1 and djr-1.2 males and hermaphrodites were crossed reciprocally. L4 hermaphrodites from F, generation were singled out and let lay eggs for 2 days. Subsequently, the adults were lysed and genotyped Individually.

[0094] One adult was put in 100 μl lysis buffer (1×PCR buffer and 200 ng/μl proteinase-K in water), snap-frozen in liquid nitrogen and incubated for 1 hour at 65° C. Then, the enzyme was denatured at 98° C. for 15 min. Genotyping PCR was performed in 1×PCR buffer with MgCl.sub.2, 200 μM dNTP mix, 400 nM of each primer, 0.02 U Taq polymerase and 5 μl of gDNA from the lysis of an adult hermaphrodite using the following primers: tm918_ext_fwd: CGACGAGTTGCGTATGAGAA (SEQ D NO: 1), tm918_ext_rev CACAAGTTTTTTCGGGGAGAA (SEQ ID NO: 2), tm918_int_fwd TATGCCGGATTAGATGGAGC (SEQ ID NO: 3), tm951_ext_fwd GATTTCTTCGGCGTCTTCTG (SEQ ID NO: 4), tm951_ext_rev CACATCTCGGGCCACTATTT (SEQ ID NO: 5), tm951_int_fwd AAAATGCAACGACCGACTTC (SEQ ID NO: 6). PCR conditions were the following: initial denaturation at 94° C. for 10 min, amplification in 30 cycles of 94° C. for 30 sec, 62° C. for 25 sec and 72° C. for 30 Sec, final extension at 72° C. for 10 min.

[0095] Populations arising from an individual heterozygous for both alleles were selected and L4 hermaphrodites were singled out for one more round of genotyping as described above. Finally, 3 lines homozygous for both alleles were found. One of these lines was selected to be used in Subsequent experiments.

[0096] Genotyping of Glod-4(Tm1266) Mutants

[0097] After outcrossing with N2 twice, hermaphrodite L4s were singled out and genotyped as described above. The following primers were used: tm1266_ext_fwd TCCTCCGCTCGCTTTTTCTC (SEQ ID NO: 7), tm1266_ext_rev TTGCAAGTTGCTTCGCATCC (SEQ ID NO: 8), tm1266_int_fwd TCGAAGCTTTGGTCGTTTCG (SEQ ID NO: 9). PCR conditions were the same as above, except that the annealing temperature was Increased to 65° C.

[0098] Preparation, Culture and Treatment of Primary Mesencephalic Dopaminergic Neurons from Mouse Embryos

[0099] Primary mesencephalic neuronal cell cultures were prepared as previously described (Gille et al., 2004). Briefly, brain mesencephalons from E14.5 C57JBL6 or DJ-1 embryos were dissected under the microscope and digested with Trypsin-EDTA (Sigma-Aldrich). The trypsin reaction was stopped by adding the basic medium (BM) containing Neurobasal A medium (Gibco), 1 mg/ml penicillin/streptomycin, 10% (v/v) fetal calf serum (Invitrogen) and 2 mM L-glutamine and cells were mechanically dissociated using a fire-polished Pasteur pipette. Medium was fully replaced by centrifuging for 5 min. at 1200 rpm, aspiring the supernatant and adding 8 ml of the fresh BM to the pellet. Concentration of cells in the medium was estimated and cells were plated in a volume of 250 μl in 4-well plates (176740, Nunc, Thermo Scientific) or 35 pull in μ-clear 96-well plates (Greiner) coated with poly-D-lysine (Sigma-Aldrich) at a concentration of 2×10.sup.6 cells per ml. The same volume of medium containing the different treatment substances was added 4 hours after plating to obtain the following treatment concentrations: control, 3 mM glucose, 10 mM GA, 10 mMDL and 10 mM LL. 24 hours later ⅓ of the medium was replaced with fresh BM. On DIV3 (day-in-vitro-culture 3) half of the medium was replaced with B27 medium containing Neurobasal A medium, 1 mg/ml penicillin/streptomycin, 2 mM L-Glutamine (Sigma-Aldrich) and B-27 supplement (Life Technologies) and on DIV5 all medium was replaced by B27 medium. On DIV7 cell were either fixed using Accustain® (Sigma-Aldrich) for 30 min. or PQ.sup.2+ treated at a concentration of 12.5 μM for 72 hours more and fixed.

[0100] Immunocytology of Mesencephalic Cell Cultures

[0101] Accustain® fixed neuronal cell cultures were washed 3×10 min in phosphate buffered saline (PBS), blocked using a blocking solution (BS) (0.2% Triton X-100 in PBS and 5% donkey serum (DS)) for 1 hour at RT, and incubated with mouse anti-TH (1:500, Millipore), chicken anti-μIII-tubulin (1:500, Millipore) and rabbit anti-TOM20 (1:200, FL-145, Santa Cruz Biotechnology) or rabbit anti-NeuN (1:500, Millipore) primary antibodies in BS overnight at 4 C. On the next day cells were washed 4×10 min with PBS, incubated in donkey Alexa® 488 anti-rabbit, donkey Alexa® 555 anti-mouse (Life Technologies) and donkey Alexa® 647-antichicken (Jackson ImmunoResearch) secondary antibodies for 1 hour at RT, washed 4×10 min. with PBS, incubated with Hoechst33342 for 10 min and washed once more in PBS.

[0102] Mitochondrial Live Staining of Worm Larva

[0103] Mitochondria staining was performed as previously described. Briefly, MitoTracker Deep Red or CMXROS (M22426, M7512, Life Technologies) were dissolved in DMSO at a concentration of 5 mM and kept at −20° C. as a stock solution. On the day of microscopy worms were incubated in a 1:1000 diluted MitoTracker for 45 min at room temperature. Worms were then paralyzed with 1 mM Levamizol (Sigma-Aldrich), placed on slides covered with a thin layer of NGM medium on top of which the coverslip (22×22 mm, Menzel-Glaser #1) was fixed using nail lack.

[0104] Chemicals

[0105] Glucose (Merck), glycolic acid (15451, ACROS Organics) neutralized with NaOH to pH=7.4, and sodium D-lactate (71716, Sigma), glyoxal (128465, Sigma), paraquat (sc-257968, SantaCruz biotechnologies or 36541 Fluka® from Sigma-Aldrich) were used. Other chemicals used in this study (e.g. FIG. 3A) are listed in the Table of FIG. 13.

[0106] Cell rounding pressure analysis with microcantilevers Cells were grown on a glass-base dish (FD35, World Precision Instruments) with a silicon spacer, which was prepared from μ-Chamber 12 well (ibidi), in the center. Medium was replaced with the CO.sub.2-independent medium, then the dish was mounted on the stage of a light microscope (AxioObserver Z1 or Axiovert200, Zeiss) equipped with a 20× objective (Plan Apochromat, NA=0.80). To measure the force of the mitotic cell, a tipless microcantilever (NSC12/CSC37-B with a nominal spring constant of 0.3 N/m, MikroMasch, Estonia) mounted on a glass block of the AFM head (NanoWizard I or II, JPK instruments, Berlin) was used. Setup and calibration were done before every experiment; see Stewart et al (Stewart at al., 2012) for the details of the procedures. In a quick force measurement illustrated in FIG. 5A, the cantilever was set at 14 m above the glass dish and moved over the mitotically arrested cells to measure the equilibrium force. Measuring the cellular force and pressure through mitosis was done as described (Stewart at al., 2012, Stewart at al., 2011). Otherwise the cell pressure and volume were measured in a constant-height assay, as illustrated in FIG. 5B: the cantilever was first set at 14 μm height and placed over a metaphase cell to record rounding force. The cantilever was then brought down to 8 μm height at 0.1 μmu/sec, to measure peak and equilibrium forces. The maximal cross-section area of the cell was measured from the DIC or mCherry-CAAX image to calculate cell pressure and volume. Calculation of cell pressure and volume, and the contact area to the Cantilever was done as described (Stewart et al., 2012; Stewart et al., 2011). In every experiment, RNAi penetrance was confirmed by lower pressure of MYH9 RNAI-treated cells (Toyoda at al., 2011).

[0107] Light Microscopy, and Image Analysis

[0108] To film the osmotically challenged HeLa cells, a DeltaVision system (Applied Precision) was used, equipped with an Olympus IX-71 Inverted microscope and a 40× (UPIanApo, NA=1.00) objective. Time-lapse images were acquired at 1-min intervals except during osmotic shock treatment (equal volume of water for hypotonic shock; equal volume of the AFM medium containing 2.86% (w/v) xylose for hypertonic shock). Deconvolved and maximally projected images were analyzed manually on Image.J to annotate the radius and the volume of the round objects (i.e. mitotic cells), assuming that the cells were spherical (Stewart et al., 2011). To image mitochondria of HeLa cells, MitoTracker Red CMXRos was added at 150 nM and fixed with 3% (v/w) paraformaldehyde in PBS, 1 mM MgCl.sub.2, and 5 mM EGTA. Chromatin was counter-stained by 1 μg/ml Hoechst33342. They were imaged on the DeltaVision system using a 60× objective (PlanApo N, NA=1.42, Olympus), and deconvolved and maximally projected images were used for the analysis. Due to high background of MitoTracker in the center of the cell, mitochondria in a 15×15 um area in the periphery were manually annotated on Image.J software.

[0109] Microscopy images from live paralyzed worm larvae stained with MitoTracker were taken using a confocal microscope (LSM510, Zeiss, Germany). Samples were excited using a 514 (MitoTracker CMXRos) or a 647 (MitoTracker Deep Red) nm lasers and two channels, one BP505-550 or LP650 and the BF channel were used to acquire the images. Gain was maintained between 450 and 515 for all samples to ensure the detection of signal intensity differences.

[0110] Counting of Dopaminergic Neurons

[0111] Dopaminergic TH.sup.+ neurons were observed using an inverted fluorescence microscope (Axiovert 200M, Zeiss) under a 10× objective (PlanApo, NA=0.45). The diameter of every well was scanned in two perpendicular directions (i.e. top to bottom and left to right) and total TH.sup.+ neurons were counted for every well.

[0112] Immunoblotting

[0113] RNA-transfected HeLa, MEFs, and mouse primary neurons were lysed in a lysis buffer (50 mM HEPES pH=7.5, 150 mM KC, 1 mM MgCl.sub.2, 10% glycerol, 0.1% NP-40) with a protease inhibitor cocktail (Complete, Roche), resolved in SDS-PAGE, and transferred onto a nitrocellulose membrane. In immunoblotting, the following primary antibodies were used: human DJ-1 (FL-189, SantaCruz, 1:200 dilution); mouse DJ-1 (HPAO04190, Sigma, 1:250); GLO1 (FL-184, Santa Cruz, 1:200); alpha-tubulin (DM1A, Sigma, 1:2000). Horseradish peroxidase-conjugated anti-IgG antibodies (Bio-rad, 1:2000) were used for the secondary antibody. Chemiluminescence by ECL reagent was developed on a Hyperfilm (GE healthcare).

[0114] Measurement of ATP level, ATP:ADP ratio, and energy metabolism flux To measure ATP level in the cell lysate, a kit (A22066, Invitrogen) was used. Luminescence from the luciferase-luciferin reaction was measured on an automated reader (EnVision 2104, PerkinElmer). The luminescence was normalized using the protein amount in the samples. To measure the ATP:ADP ratio, cell extract was separated in an HPLC column essentially as described (Di Pierro et al., 1995). In short, HeLa cells were lysed in perchloric acid, cleared by centrifugation, neutralized by K.sub.2CO.sub.3, filtered with a 0.45 μm Millipore HV filter, and loaded onto a C-18 column (OOG-4252-E0, Phenomenex) connected to a HPLC system (Knauer). Absorption at 267 nm was used to calculate the relative abundance ratio of ATP and ADP.

[0115] Statistics and Graph Representation

[0116] Statistical differences between the treatments of the AFM measurements were determined by a non-parametric Mann-Whitney's U-test. For the other experiments, ANOVA followed by the Tukey's honestly significant differences post-hoc test. Data expressed in percentages were first transformed by Tukey's double arcsine function (Freeman and Tukey, 1950) to achieve normal distribution prior to ANOVA. Statistical analysis and graphs were done on a Prism software version 5 (GraphPad Inc.) and an R environment.

EXAMPLE 2—GLYCOLATE AND D-LACTATE SUPPORT IN VITRO AND IN VIVO SURVIVAL OF DOPAMINERGIC NEURONS

[0117] One of the genes associated with Parkinson's disease is DJ-1/PARK7, which belongs to a novel glyoxalase family (Lee et al., 2012). Glyoxalases are enzymes that transform 2-oxoaldehydes into corresponding 2-hydroxyacids, i.e. glyoxal and methylglyoxal into glycolate acid and D-lactate, respectively. Presently, two systems of glyoxalases have been described: 1) Glutathione-dependent GLO-1 and GLO-2 system (Thomalley, 2003) and 2) DJ-1/Glo III, that do not need a co-factor (Lee et al., 2012, Misra et al., 1995). Because substrates of glyoxalases are aggressive aldehydes produced by Oxidation of glucose during glycolysis (methylglyoxal) and peroxidation of fatty acids (glyoxal), it has been assumed that the major function of glyoxalases is to detoxify aldehyde by-products of metabolism (Thomalley, 2003). interestingly, this view was not always prevalent. Glyoxalases, and their corresponding products (e.g. D-lactate) were considered major components of glycolysis (Ray and Ray, 1998). With the elucidation of the now classic Embden-Meyerhof-Pamas pathway of glycolysis, production of D-lactate was seen more as an artifact of a biochemical procedure or an undesired side product of glycolysis. Thus, the cellular role of glyoxalases remains obscure.

[0118] One of the difficulties in understanding the precise function of DJ-1, is that DJ-1 knock-out mice have weak phenotypes. (Pham et al., 2010; Andres-Mateos et al., 2007; Kim et al., 2005). This is presumably because DJ-1 has minor effects on cell metabolism, which only appears with age. Generally, one of the problems in studying the role of a gene with minor defects in the metabolism, is that they likely to give rise to long term problems in cell survival, but have no phenotype in standard assays used by cell biologists studying cells in culture, for instance, cell division, or cell survival. Therefore it seems likely that novel assays, studying non-lethal phenotypes, will be necessary to study the function of such genes.

[0119] The opposed activity of osmotic pressure and acto-myosin contraction drive an increase in mechanical forces and cell rounding during mitosis (Stewart et al., 2011). In an ongoing screen for genes required for cell rounding, which takes place when cells prepare for mitosis (Stewart et al., 2011; Kunda and Baum, 2009, Cramer and Mitchison, 1997), it was found that silencing DJ-1 in HeLa cells resulted in reduced rounding force during metaphase, which was rescued by a DJ-1 transgene (FIG. 1A, B, FIG. 5D, E). It was also observed the same phenotype in DJ-1-deficient mouse embryonic fibroblasts (FIG. 1C, Supplementary FIG. 1F, G). These results were confirmed by monitoring the rounding pressure of cells as they proceed through mitosis (FIG. 5B, C). DJ-1-depleted mammalian cells had defects in response to hypotonic shock (FIG. 7), suggesting that they cannot exert rounding force because they cannot maintain their osmotic pressure. Inspired by these findings, a miniscreen was performed to test whether other Parkinson's disease-related genes are involved in the mechanics of cell rounding (FIG. 1A, FIG. 5A). Indeed, silencing of SNCA, PINK1, LRRK2, and FBXO7 genes significantly decreased mitotic cellular force. Therefore, genes involved in Parkinson's disease are in some way involved in cell rounding at mitosis.

[0120] Caenorhabditis elegans dauer larva, an arrested stage specialized for survival in adverse conditions, is resistant to severe desiccation and can lose up to 98% of water (Erkut et al., 2011). However, this requires a preconditioning step at a mild desiccative environment to prepare the organism for harsher desiccation conditions. In a Screen to identify genes that are required for desiccation tolerance (Erkut et al., in press), it was found that expression of two DJ-1 orthologs dr-1.1, djr-1.2 were elevated during preconditioning (FIG. 1D, E, FIG. 6). The up-regulation of djr-1.2 was especially strong.

[0121] DJ-1 was recently reported to be a novel glyoxalase (Lee et al., 2012), a class of enzymes that are implicated in the detoxification of o-oxoaldehydes by converting them into a hydroxyacids (Thomalley, 2003). Glod-4, the only member of another glyoxalase family in C. elegans, was also up-regulated upon preconditioning (FIG. 1E, FIG. 6), suggesting the importance of glyoxalases for desiccation tolerance. Many genes involved in Parkinson's disease, among them DJ-1, have been linked to alterations in mitochondrial structure and function and an enhanced sensitivity to mitochondrial toxins like Complex-I inhibitors (Sal et al., 2012). Furthermore, many of the Parkinson's-linked genes that gave affected cell rounding are also involved in mitochondrial function (see FIG. 1A, FIG. 5C) (Burchell et al, 2013; Wang et al, 2012; Kamp et al, 2010 Irrcher et al, 2010: Clark et al. 2006: Park et al., 2006). The effect of glyoxalases was therefore tested on mitochondrial function/structure in worms. djr-1.1; djr-1.2 double mutant on daf-2(e1370ts) background were produced to produce dauer larvae defective in both DJ-1 homologs (daf-2; DDdjr). These worms were subjected to glod-4 RNAI for 2 generations to knockdown the entire glyoxalase pathway of the organism. Subsequently, dauers were preconditioned, desiccated, and rehydrated. Under these conditions, although desiccation tolerance was not obviously compromised, the elaborated network of mitochondria seen in daf-2 mutants, that were wild type for glyoxalase function, was almost non-existent in the triple mutant (FIG. 1D, F).

[0122] One possibility to explain the data so far presented is that the lack of glyoxalases could lead to the build up of their substrates, toxic aldehydes, leading to phenotypic alteration. However, another hypothesis is proposed herein: the defects may result not only from a build up of toxic aldehydes, but also from the lack of the enzymatic products themselves (a-hydroxyacids). To support this idea, it was looked at the effects of the products of glyoxalases, D-lactic acid (DL) and glycolic acid (GA) (Lee et al., 2012; Thomalley, 2003) on cell rounding. Indeed, it was shown that both DL and GA could rescue the reduced pressure of both mitotic DJ-1-RNAI cells and MEFs, whereas L-lactic acid (LL) had no effect (FIG. 2A, FIG. 8).

[0123] It was next looked whether products of glyoxalases are involved in maintenance of mitochondrial structure. DJ-1 RNAi in HeLa cells did not produce an altered mitochondrial phenotype (FIG. 2B). However, the addition of low doses of paraquat, an environmental poison known to affect mitochondria (Sal et al., 2012), and implicated in the onset of Parkinson's disease, disrupted mitochondrial structure in DJ-1 RNAI cells (FIG. 2B). Mitochondria became more circular, and this circular phenotype was rescued by addition of DL and GA (FIG. 2B, C, FIG. 9). A circular mitochondrial phenotype is common indicator of mitochondrial stress (Kanazawa et al., 2008). Similarly to human cells, paraquat disrupted mitochondria in reproductive larvae of C. elegans. In both a ΔΔdjr double mutant and a glod-4 single mutant background (FIG. 2D), paraquat resulted in circular mitochondria and diminished MitoTracker staining, and these alterations were reversed by addition of GA (FIG. 2D).

[0124] So far, it was shown that addition of products of glyoxalases can rescue some of the altered phenotype of DJ-1 mutations. Whether the endogenous pathways necessary for GA or DL production are essential can be analyzed using the mitotic cell-rounding assay, combined with silencing genes in mammalian metabolic pathways by RNAi (FIG. 3A). Remarkably, all tested genes that are known to be involved in generation of GA or DL were required for cell rounding. For example, silencing of glyoxalases, aldolases, triose phosphate isomerase, and D-lactate dehydrogenase decreased mitotic pressure (FIG. 3A, FIG. 13). However, RNAi of genes involved in glycogen metabolism, or ATP synthesis, had no effect on cell rounding. This suggests that DL and GA are indeed produced by metabolic pathways. Surprisingly, glucose alone could rescue the pressure defect of DJ-1 RNAi cells (FIGS. 9 and 10). This could be explained because glucose Increases ATP generation. However, neither pyruvate, which is produced from glucose, nor glutamine, which can enter the Krebs cycle, rescued the DJ-1 pressure phenotype (FIG. 3A, FIG. 14). Most probably, the role of rescuing the cell rounding phenotype is taken over by another glyoxalase, GLO1 (Thomrnalley, 2003). Indeed glucose failed to rescue the pressure phenotype in the cells in which both glyoxalases, DJ-1 and GLO1 were knocked-down, even under conditions in which GA and DL could rescue (FIG. 3C, FIG. 11). The latter finding shows that most GA and DL are derived from glycolysis.

[0125] Because toxins that affect mitochondrial function can hasten Parkinson's disease (Bove et al., 2005), it was questionable whether GA and DL would protect neurons against mitochondrial damage. Therefore, embryonic mesencephalic primary neuronal Cultures were generated and analyzed the Survival of tyrosine hydroxylase positive (TH.sup.2+) neurons by immunostaining. Strikingly the in vitro survival of dopaminergic neurons was stimulated by glucose, GA, and DL, but not by LL (FIG. 4A). Furthermore, GA and DL significantly rescued the toxic effect of paraquat on neurons (FIG. 4B). It was also looked at the effect of these substances on dopaminergic neurons from DJ-1 knock out mice (FIG. 12). Again, GA and DL could stimulate neuronal survival. However, the positive effect of glucose on neuronal survival was dramatically diminished when using DJ-1 KO neurons. This suggests that, in dopaminergic neurons lacking DJ-1, GA and DL cannot be produced from glucose. These results stress the importance of GA and DL in survival of dopaminergic neurons.

[0126] The importance of the glyoxalases is supported by the fact that cells have two different glyoxalase systems. The overlapping phenotypes of the different glyoxalase systems have not been extensively studied. However, DJ-1 is up-regulated in aged mice (Jain et al., 2012), while the activity of Worm GLOD-4 in C. elegans decreases over aging (Morcos et al., 2008). Therefore DJ-1 may be more critical in protection from aging-derived stress. Indeed, glucose failed to support dopaminergic neuron survival in the DJ-1 mutant background (FIG. 4A), suggesting that DJ-1 is the primary glyoxalase in the mammalian central nervous system. This also may explain why mutations in DJ-1 cause neuron-specific diseases in humans.

[0127] The data herein highlight an understudied aspect of the Embden-Meyerhof glycolytic pathway, which is that a small fraction of triose-phosphate is converted into methyiglyoxal, which is further transformed into D-lactate by glyoxalases (Thornalley, 2003). This D-lactate-producing flux could protect mitochondria of diverse cells from environmental and metabolic stresses. To date it has been thought that glyoxalases protect cells by removing products of glycolysis or lipid oxidation. Thus, the experimental data herein suggests that glyoxalases have two functions: on one hand they detoxify chemically aggressive aldehydes and on the other hand they produce compounds necessary for cell physiology.

[0128] Without wishing to be bound by theory the Working hypothesis is that the glyoxalase systems are required to protect mitochondria from stress. It is concluded that increased rounding force as cells enter mitosis, response to osmotic shock, and in vitro culture of primary dopaminergic neurons, are conditions that induce mitochondrial stress. It is not understood how D-lactate, or glycolate protect mitochondria. It is well accepted that the dye that was used to follow mitochondria, MitoTracker, detects the potential of the mitochondrial membrane, which is required for most mitochondrial functions. It therefore seems likely that GA and DL in some way are involved in maintaining mitochondrial potential, which in turn is related to the network structure of mitochondria. GA and DL may act via a role in signaling, or as cofactors in the activity of enzymes or structural proteins necessary for mitochondrial function.

[0129] In addition to their role in maintaining mitochondrial health under stress, it is noted that DJ-1 and its products are Involved in two different processes that involve changes in osmotic pressure: Cell rounding at mitosis, and response to desiccation stress. Because cell rounding requires the generation of osmotic pressure (Stewart et al., 2011), it seems probable that DJ1 mutant cells cannot generate cell force in mitosis because they cannot maintain their osmotic pressure. It also seems likely that response to desiccation involves regulation of osmotic pressure. It will be Interesting to understand whether altered osmotic pressure is directly linked to mitochondrial stress or the products of glyoxalases have two independent functions. There are indications that these processes could be interconnected: Glyoxalases are up-regulated under osmotic stress in yeast (Inoue at al., 1998), and osmotic stress has been shown to reduce the mitochondrial membrane potential (Desai et al., 2002). Thus it is possible that the symptoms of Parkinson's disease, neuronal cell death in the substantia nigra, arise from an increased sensitivity of dopaminergic neurons to continuous osmotic stress (Federico et al., 2012, Corti et al., 2011), which is in turn linked to a decline in mitochondrial activity.

REFERENCES

[0130] Burchell V S, Nelson D E, Sanchez-Martinez A, Delgado-Camprubi M, Ivatt R M, Pogson J H, et al. 2013. The Parkinson's disease-linked proteins Fbxo7 and Parkin Interact to mediate mitophagy. Nat Neurosci 16: 1257-65. doi:10.1038/nn.3489 [0131] Goedert M., Spillantini M G, Del Tredici K, and Braak H. 2013. 100 years of Lewy pathology. Nat Rev Neurol 9: 13-24. doi: 10. 1038/nmeuro.2012.242 [0132] Braidy N, Gai W P, Xu Y H, Sachdev P, Guillemin G J, Jiang X M, et al. 2013. Alpha-Synuclein Transmission and Mitochondrial Toxicity in Primary Human Foetal Enteric Neurons in Vitro. Neurotox Res.doi: 10. 1007/S 12640-013-9420-5 [0133] Schapira A H. 2012. Mitochondrial diseases. Lancet 379: 1825-34. doi:10.1016/S01406736(11)61305-6 [0134] Federico A, Cardaioli E, Da Pozzo P, Formichi P, Gallus G N, and Radi E. 2012. Mitochondria, oxidative stress and neurodegeneration. J Neurol Sci 322: 254-62. doi:10.1016/1.ijns.2012.05.030 [0135] Sai Y, Zou Z, Peng K, and Dong Z. 2012. The Parkinson's disease-related genes act in mitochondrial homeostasis. Neurosci Biobehav Rev. 36: 2034-43. doi: 10.1016/j.neubiorev.2012.06.007 [0136] Freire C, and Koifman S. 2012. Pesticide exposure and Parkinson's disease: epidemiological evidence of association. Neurotoxicology 33: 947-71. doi:10.1016/j.neuro.2012.05.011 [0137] Lee J Y, Song J, Kwon K, Jang S, Kim C, Baek K, et al. 2012. Human DJ-1 and its homologs are novel glyoxalases. Hum Mol Genet 21: 3215-25. doi:10.1093/hmg/dds 155 [0138] Wang X, Yan M H, Fujioka H, Liu J, Wilson-Delfosse A, Chen S G, et al. 2012. LRRK2 regulates mitochondrial dynamics and function through direct interaction with DLP1. Hum Mol Genet 21: 1931-44. doi:10.1093/hmg/dds003 [0139] Stewart M P, Toyoda Y, Hyman A A, and Muller D J. 2012. Tracking mechanics and volume of globular cells with atomic force microscopy using a constant-height clamp. Nat Protoc 7: 143-54. doi:10.1038/nprot. 2011.434 [0140] Jain D, Jain R, Eberhard D, Eglinger J, Bugliani M, PiemontiL, et al. 2012. Age- and dietdependent requirement of DJ-1 for glucose homeostasis in mice with implications for human type 2 diabetes. J Mol Cell Biol. 4: 221-30. doi:10.1093/mcb/mjs025 [0141] Pan-Montojo F, Schwarz M, Winkler C, Arnhold M, O'Sullivan G A, Pal A, et al. 2012. Environmental toxins trigger PD-like progression via increased alpha-synuclein release from enteric neurons in mice. Sci Rep 2: 898. doi:10.1038/srep00898 [0142] Stewart M P, Helenius J, Toyoda Y, Ramanathan S P, Muller D J, and Hyman A A. 2011. Hydrostatic pressure and the actomyosin cortex drive mitotic cell rounding. Nature 469: 226 30. doi:10.1038/nature09642 [0143] Corti O, Lesage S, and Brice A. 2011. What genetics tells us about the causes and mechanisms of Parkinson's disease. Physiol Rev 91: 1161-218. doi: 10.1152/physrev.00022.2010 [0144] Toyoda Y, Stewart M P, Hyman A A, and Muller D J. 2011. Atomic Force Microscopy to Study Mechanics of Living Mitotic Mammalian Cells. Japanese Journal of Applied Physics 50: 1-6. doi: 10.1143/JJAP. 50.08 LA01 [0145] Erkut C, Penkov S, Khesbak H, Vorkel D, Verbavatz J M, Fahmy K, et al. 2011. Trehalose renders the dauer larva of Caenorhabditis elegans resistant to extreme desiccation. Curr Biol 21: 1331-6. doi:10.1016/j.cub.2011.06.064 [0146] Kamp F, Exner N, Lutz A K, Wender N, Hegermann J, Brunner B, et al. 2010. Inhibition of mitochondrial fusion by alpha-synuclein is rescued by PINK1, Parkin and DJ-1. Embo J 29: 3571-89. doi:10.1038/emboj.2010.223 [0147] Irroher I, Aleyasin H, Sefert E L, Hewitt S J, Chhabra S, Phillips M, et al. 2010. Loss of the Parkinson's disease-linked gene DJ-1 perturbs mitochondrial dynamics. Hum Mol Genet 19: 3734-46. doi:10.1093/hmg/dda288 [0148] Pham T T, Giesert F, Rothig A, Floss T, Kallnik M, Weindl K, et al. 2010. DJ-1-deficient mice show less TH-positive neurons in the ventral tegmental area and exhibit non-motoric behavioural impairments. Genes Brain Behav 9: 305-17. doi:10.1111/j.1601-183X.2009.00559.x [0149] Kunda P, and Baum B. 2009. The actin cytoskeleton in spindle assembly and positioning. Trends Cell Biol 19: 174-9. doi:10.1016/j.tcb.2009.01.006 [0150] Morcos M, Du X, Pfisterer F, Hutter H, Sayed A A, Thomalley P, et al. 2008. Glyoxalase-1 prevents mitochondrial protein modification and enhances lifespan in Caenorhabditis elegans. Aging Cell 7:260-9, doi:10.1111/j. 1474-9726.2008.00371.x [0151] Kanazawa T, Zappaterra M D, Hasegawa A, Wright A P, Newman-Smith E D, Buttle K F, et al. 2008. The C. elegans Opal homologue EAT-3 is essential for resistance to free radicals. PLoS Genet 4: e1000022. doi:10.1371/journal.pgen.1000022 [0152] Andres-Mateos E, Perler C, Zhang L, Blanchard-Fillion B, Greco T M, Thomas B, et al. 2007. DJ-1 gene deletion reveals that DJ-1 is an atypical peroxiredoxin-like peroxidase. Proc Natl Acad Sci USA 104: 14807-12. doi:10.1073/pnas.0703219104 [0153] Clark I E, Dodson M W, Jiang C, Cao J H, Huh J R, Seol J H, et al. 2006. Drosophila pink 1 is required for mitochondrial function and interacts genetically with parkin. Nature 441: 1162-6.doi: 10.1038/nature04779 [0154] Park J, Lee S B, Lee S, Kim Y, Song S, Kim S, et al. 2006. Mitochondrial dysfunction in Drosophila PINK1 mutants is complemented by parkin. Nature 441: 1157-61. doi:10.1038/nature04788 [0155] Kittler R, Pelletler L, Ma C, Poser, Fischer S, Hyman A A, et al. 2005. RNA interference rescue by bacterial artificial chromosome transgenesis in mammalian tissue culture cells. Proc Natl Acad Sci USA 102: 2396-401. doi: 10.1073/pnas.0409861102 [0156] Kim R H, Smith P D, Aleyasin H, Hayley S, Mount M P, Pownall S, et al. 2005. Hypersensitivity of DJ-1-deficient mice to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyrindine (MPTP) and oxidative stress. Proc Natl Acad Sci USA 102:5215-20. doi:10.1073/pnas.0501282102 [0157] Bove J, Prou D, Perier C, and Przedborski S. 2005. Toxin-induced models of Parkinson's disease. NeuroRX 2: 484-94. doi:10.1602/neurorx.2.3.484 [0158] Gille G, Hung S T, Reichmann H, and Rausch W D. 2004. Oxidative stress to dopaminergicneurons as models of Parkinson's disease. Ann N Y Acad Sci 1018: 533-40. doi:10.1196/annals.1296.066 [0159] Song D D, Shults C W, Sisk A, Rockenstein E, and Masliah E. 2004. Enhanced substantia nigra mitochondrial pathology in human alpha-synuclein transgenic mice after treatment with MPTP. Exp Neurol 186: 158-72. doi:10.1016/S0014-4886(03)00342-X [0160] Bonifati V, Rizzu P, van Baren M J, Schaap O, Breedveld G J, Krieger E, et al. 2003. Mutations in the DJ-1 gene associated with autosomal recessive early-Onset parkinsonism. Science 299: 256-9. doi:10.1126/science. 1077209 [0161] Thomalley P J. 2003. Glyoxalase 1-structure, function and a critical role in the enzymatic defence against glycation. Biochem Soc Trans 31: 1343-8. doi:10.1042/ [0162] Desal B N, Myers B R, and Schreiber S L. 2002. FKBP12-rapamycin-associated protein associates with mitochondria and senses osmotic stress via mitochondrial dysfunction. Proc Natl Acad Sci USA 99: 4319-24. doi:10.1073/pnas.261702698 [0163] Inoue Y, Tsujimoto Y, and Kimura A. 1998. Expression of the glyoxalase I gene of Saccharomyces cerevisiae is regulated by high osmolarity glycerol mitogen-activated protein kinase pathway in osmotic stress response. J Biol Chem 273:2977-83. [0164] Ray M, and Ray S. 1998. Methylglyoxal: From a putative intermediate of glucose breakdown to its role in understanding that excessive ATP formation in cells may lead to malignancy. Current Science 75: 103-13. [0165] Nagakubo D, Taira T, Kitaura H, Ikeda M, Tamai K, Iiguchi-Ariga S M, et al. 1997. DJ-1, a novel oncogene which transforms mouse NIH3T3 cells in cooperation with ras. Biochem Biophys Res Commun 231:509-13. doi:10.1006/bbrc. 1997.6132 [0166] Cramer L P, and Mitchison T. J. 1997. Investigation of the mechanism of retraction of the cell margin and rearward flow of nodules during mitotic cell rounding. Mol Biol Cell 8: 109-19. [0167] Misra K, Banerjee A B, Ray S, and Ray M. 1995. Glyoxalase III from Escherichia coli: a single novel enzyme for the conversion of methylglyoxal into D-lactate without reduced glutathione. Biochem J 305 (Pt 3): 999-1003. [0168] Di Pierro D, Tavazzi B, Pemo C F, Bartolini M, Balestra E, Calio R, et al. 1995. An ion-pairing high-performance liquid chromatographic method for the direct simultaneous determination of nucleotides, deoxynucleotides, nicotinic coenzymes, Oxypurines, nucleosides, and bases in perchloric acid cell extracts. Anal Biochem 231: 407-12. doi:10.1006/abio, 1995.0071 [0169] Schapira A H, Cooper J M, Dexter D, Jenner P, Clark J B, and Marsden C D. 1989. Mitochondrial complex deficiency in Parkinson's disease. Lancet 1: 1269. [0170] Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics 77: 71-94. [0171] Freeman M F, and Tukey J W. 1950. Transformations Related to the Angular and the Square Root. Ann Math Statistics 21:607-11 doi:10.1214/aoms/11777297.56