OLIGONUCLEOTIDES FOR GENOMIC DNA EDITING

Abstract

A method for making a change in an endogenous chromosomal DNA sequence of a mammalian cell, comprising steps of: (i) introducing into said cell an oligonucleotide having a sequence that is complementary to the chromosomal DNA sequence and that includes the change; (ii) allowing sufficient time for the cell to incorporate the change into the endogenous chromosomal DNA sequence through endogenous nucleic acid modifying pathways; and (iii) identifying the presence of the change in the chromosomal DNA sequence. The invention is particularly useful for correcting mutations in the CFTR gene.

Claims

1. A method for making a change in an endogenous chromosomal DNA sequence of a mammalian cell, comprising steps of: (i) introducing into said cell an oligonucleotide having a sequence that is complementary to the chromosomal DNA sequence except for the change; (ii) allowing sufficient time for the cell to incorporate the change into the endogenous chromosomal DNA sequence through endogenous nucleic acid modifying pathways; and (iii) identifying the presence of the change in the chromosomal DNA sequence.

2. A method according to claim 1, wherein the target sequence in the chromosome is a sequence comprising a mutation in the CFTR gene.

3. A method for making a change in an endogenous mutant CFTR chromosomal DNA sequence of a human cell, comprising steps of: (i) introducing into said cell an oligonucleotide having a sequence that is complementary to the chromosomal DNA sequence except for the change; and (ii) allowing sufficient time for the cell to incorporate the change into the endogenous chromosomal DNA sequence through endogenous nucleic acid modifying pathways.

4. A method according to any preceding claim, wherein the cell is a human cell.

5. A method according to claim 4, wherein the cell is a pluripotent stem cell, a cell residing in an organoid, or a cell residing in an entire organism.

6. A method according to any preceding claim, wherein the change is an insertion of one or more nucleotides (e.g. up to 6 nucleotides) into the endogenous chromosomal DNA sequence.

7. A method according to any one of claims 2 to 6, wherein the endogenous chromosomal DNA sequence is CFTR gene which encodes a polypeptide with deletion of phenylalanine in position 508 (ΔF508) and the change comprises an insertion of three nucleotides to insert an amino acid at position 508 and thereby restore a functional CFTR polypeptide.

8. A method according to any preceding claim, wherein the oligonucleotide is between 20 and 80 nucleotides in length, preferably between 20 and 50 or 25 and 75 nucleotides.

9. A method according to any preceding claim, wherein the oligonucleotide comprises 2′-deoxynucleotide residues, optionally comprising chemical modifications of its sugar moieties, purines, pyrimidines or backbone.

10. A method according to claim 9, wherein the oligonucleotide comprises 2′-deoxynucleotides with one or more phosphorothioate (PS-) linkages and/or one or more locked nucleosides.

11. A method according to any preceding claim, wherein the oligonucleotide is complementary to the sense strand of the endogenous chromosomal DNA sequence.

12. A method according to any preceding claim, utilising an oligonucleotide as defined in any one of claims 16 to 25.

13. A method according to any preceding claim, wherein said cell is a lung cell residing in a human subject and said oligonucleotide is administered to the lung of the subject through inhalation.

14. A method according to claim 13, wherein the oligonucleotide is formulated in iso- or hypotonic saline.

15. The method of any preceding claim, utilising an oligonucleotide as defined in any one of claims 16-33.

16. An oligonucleotide for making a desired insertion or substitution at a specific position in a chosen strand of a target chromosomal DNA sequence, having sequence 5′-X-Y-Z-3′, wherein: X is complementary to the chromosomal sequence downstream in the non-chosen strand of the specific position; Z is complementary to the chromosomal sequence upstream in the non-chosen strand of the specific position; and Y is the desired insertion or substitution; and wherein (i) X and/or Z is/are linked to Y by a phosphorothioate linkage, and/or (ii) the 3′ nucleotide of X and/or the 5′ nucleotide of Z is a locked nucleotide.

17. An oligonucleotide for making a desired insertion or substitution at a specific position in a chosen strand of a target chromosomal DNA sequence, having sequence 5′-X-Y-Z-3′, wherein: X is complementary to the chromosomal sequence downstream in the non-chosen strand of the specific position; Z is complementary to the chromosomal sequence upstream in the non-chosen strand of the specific position; and Y is the desired insertion or substitution.

18. The oligonucleotide of claim 16 or claim 17, wherein the chosen strand is the antisense strand and the non-chosen strand is the sense strand.

19. An oligonucleotide having a sequence that is complementary to a target sequence in an endogenous mammalian chromosomal DNA sequence, except that it includes at an internal position a desired modification of the target sequence, wherein the nucleotide immediately upstream of the internal position is a locked nucleotide.

20. An oligonucleotide having a sequence that is complementary to a target sequence in an endogenous mammalian chromosomal DNA sequence, except that it includes a desired modification of the target sequence, wherein (i) at least the 5′ and/or 3′ terminal nucleotides of the oligonucleotide is/are locked; and/or (ii) at least the 5′ and/or 3′ terminal dinucleotides of the oligonucleotide are linked via a phosphorothioate linkage.

21. An oligonucleotide for restoring function to CFTR having a ΔF508 mutation, having sequence 5′-X-Y-Z-3′, wherein: X is complementary to the sense strand of the human CFTR gene, starting at nucleotide 1524; Z is complementary to the sense strand of the human CFTR gene, up to nucleotide 1520; and Y is a trinucleotide AAG, AAA, AAT, CCG, CAG, CCA, CAA, CCT or CAT; or X is complementary to the antisense strand of the human CFTR gene, up to nucleotide 1520; Z is complementary to the antisense strand of the human CFTR gene, starting at nucleotide 1524; and Y is a trinucleotide CTT, TTT, ATT, CGG, CTG, TGG, TTG, AGG or ATG; or X is complementary to the sense strand of the human CFTR gene, starting at nucleotide 1525; Z is complementary to the sense strand of the human CFTR gene, up to nucleotide 1521; and Y is a trinucleotide AAA, GAA, CCC, TCC, GCC, ACC, ACA, GCA, or CAT; or X is complementary to the antisense strand of the human CFTR gene, up to nucleotide 1521; Z is complementary to the antisense strand of the human CFTR gene, starting at nucleotide 1525; and Y is a trinucleotide TTT, TTC, GGT, GGC, GGA, GGG, TGT, TGC, or ATG.

22. The oligonucleotide of any one of claims 17-21, including at least one non-naturally occurring nucleotide.

23. The oligonucleotide of claim 22, including one or more locked nucleoside(s) and/or one or more phosphorothioate internucleotide linkage(s).

24. The oligonucleotide of claim 23, wherein at least two neighbouring nucleotides are both locked.

25. The oligonucleotide of claim 23, wherein the at least two neighbouring nucleotides are (a) at the 5′ end of the oligonucleotide, (b) at the 3′ end of the oligonucleotide, (c) immediately to the 5′ of the portion of the oligonucleotide which specifies the desired modification of the target sequence, or (d) immediately to the 3′ of the portion of the oligonucleotide which specifies the desired modification of the target sequence.

26. An oligonucleotide comprising the nucleotide sequence of any one of SEQ ID NOs: 1-6 or of any one of SEQ ID NOs: 7-10.

27. An oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 4.

28. The oligonucleotide of claim 27, comprising one or more phosphorothioate (PS-) linkages and/or one or more locked nucleotides.

29. The oligonucleotide of claim 28, comprising one or more (e.g. two or three) consecutive PS-linkages directly upstream or downstream of the AAG trinucleotide at positions 23-25 of SEQ ID NO: 4.

30. The oligonucleotide of any one of claims 26-28, which is an oligodeoxynucleotide.

31. The oligonucleotide of any one of claims 26-29, which is 27-80 nucleotides long.

32. The oligonucleotide of any one of claims 26-30, modified as follows: TABLE-US-00007 SEQ ID NO: Modifications 3 6 PS linkages, between the 4 terminal nucleotides at both ends 4 6 PS linkages, between the 4 terminal nucleotides at both ends 4 6 locked nucleotides: 3 at each end 4 2 locked nucleotides (nucleotides 21 & 22) 4 2 locked nucleotides (nucleotides 26 & 27) 4 3 PS linkages, between nucleotides 20-21, 21-22, and 22-23 9 3 PS linkages, between nucleotides 22-23, 23-24, and 24-25 10 3 PS linkages, between nucleotides 24-25, 25-26, and 26-27

33. The oligonucleotide of any one of claims 26-31, as shown in FIG. 1.

34. An oligonucleotide according to any one of claims 16-32, formulated in isotonic or hypotonic saline.

35. The oligonucleotide according to any one of claims 16-32, for use in the method of any one of claims 1 to 14.

36. An oligonucleotide sequence for correcting a mutation in a target sequence of a chromosome in a target cell of a mammalian, preferably human, subject, wherein the oligonucleotide is complementary to the target sequence except for the corrected sequence, said oligonucleotide being in a form ready for uptake by said the target cells.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0091] FIG. 1: oligonucleotides used with the invention.

[0092] FIGS. 2 & 3: results from experiments 1 & 2, showing the proportion of genomic sequence reads in which the CTT triplet was detected. In FIG. 2 the dark bars are for the “normal” transfection and the light bars are for the “reverse” transfection. In FIG. 3 the dark bars show levels 72 hours after transfection and the light bars are 240 hours after transfection.

[0093] FIGS. 4 & 5 show ddPCR results from experiments 3 & 4, respectively, showing the rate of gene modification as represented by the % of copy numbers of wild-type CFTR sequences divided by the copy number of ΔF508 CFTR sequences. Labels on the x-axis match the names in FIG. 1 after omitting the ‘CFTR’ prefix and the internal ‘nt’, except that ‘CFTR 47 nt 3xPS as’ is ‘47 PS as’. The final ‘NT’ column represents a non-transfected negative control.

MODES FOR CARRYING OUT THE INVENTION

[0094] Cystic fibrosis is an autosomal recessive disease among Caucasians, affecting 1 in every 30,000 people and caused by mutations in the CFTR gene (cystic fibrosis transmembrane conductance regulator. The CFTR gene (SEQ ID NO: 11) encodes a 1480-amino-acid protein that functions as a cAMP-mediated Cl.sup.− channel which plays a crucial role in hydrating airway secretions and regulating other cellular functions, including Na.sup.+ transport, in respiratory epithelia.

[0095] The most prevalent cftr mutation (ΔF508) involves a loss of a trinucleotide at positions 1421-3 of the gene (CTT in the sense strand), leading to a loss of residue Phe-508 in the encoded polypeptide. In order to correct this mutation the inventors have designed oligonucleotides which can re-introduce the CTT triplet. These oligonucleotides have different lengths and include chemical modifications like phosphorothioate (PS) and locked-nucleic acid (LNA) residues, targeted to the sequences flanking the ΔF508 mutation.

[0096] Materials & Methods

[0097] Oligonucleotides were produced and purified according manufacturer's standards (BioSpring GmbH) and reconstituted in water for injection to a final concentration of 100 μM. 15 different oligonucleotides were tested in total, as shown in FIG. 1. In some cases the oligonucleotides include a Cy5 label at the 3′ end, which was used only to facilitate detection after transfection.

[0098] CFPAC-1 cells (ATCC, CRL-1918) with the ΔF508 mutation were cultured in Dulbecco's modified Eagle's medium (Life Technologies) supplemented with 10% heat-inactivated fetal bovine serum. Cells were kept in an atmosphere of humidified air with 5% CO.sub.2.

[0099] CFPAC-1 cells were transfected with the aid of the K2 transfection reagent (Biontex). In brief, 2 hours pre-transfection, cells were exposed to the K2 amplifier reagent. The oligonucleotides were diluted in 150 mM NaCl to a final volume of 50 μl. In a separate tube, 4 μl K2 transfection reagent was diluted in 46 μl 150 mM NaCl and added to the oligonucleotide mixture. After 10 second vortexing, the mix was kept at room temperature for 30 minutes before adding 50 μl to a CFPAC-1 cell suspension containing 1.0×10.sup.5 cells and subsequently seeded in a well of a 24-well plate. After an overnight incubation, the inoculates were replaced by fresh culture medium and incubated for 48, 72 or 240 hours at 37° C., 5% CO.sub.2.

[0100] For sequencing genomic DNA, total cellular DNA from CFPAC-1 cells which had been incubated with the oligonucleotides was isolated using the NucleoSpin® Tissue XS kit (Macherey Nagel) as specified in the manufacturer's protocol, reaching a final volume of 20 μl. The recovered DNA was subjected to two different PCR protocols. In order to generate a human CFTR specific amplicon, a PCR targeting the CFTR gene was performed containing 1 μl of the isolated total cellular DNA. To this end, reactions containing 0.4 μM of forward and reverse primers, 25 μM of each dNTP, 1× AmpliTaq Gold® 360 Buffer, 3.125 mM MgCl.sub.2 and 1.0 units of AmpliTaq Gold® 360 polymerase (all Life Technologies) were assembled. The PCR cycles were performed using the following cycling conditions. An initial denaturing step at 95° C. for 7 min was followed by 30 cycles of 30 s at 95° C., 30 s at 55° C. and 45 s at 72° C. The PCR amplifications were terminated by a final elongation period of 7 min at 72° C. 1 μl of the previous PCR was used in a nested-PCR program containing 0.4 μM of forward primers and a unique MiSeq index primer per sample, 25 μM of each dNTP, 1× AmpliTaq Gold® 360 Buffer, 3.125 mM MgCl.sub.2 and 1.0 units AmpliTaq Gold® 360 polymerase. The PCR cycles were performed using the following cycling conditions. An initial denaturating step at 95° C. for 7 min was followed by 25 cycles of 30 s at 95° C., 30 s at 60° C. and 45 s at 72° C. Reactions were terminated using a final elongation period of 7 minutes at 72° C. In all cases the forward and reverse primers flanked the position of the triplet deletion which leads to the ΔF508 mutation.

[0101] Before loading the PCR products containing the MiSeq sequence primer sequences in the sequencer, the concentration of the purified PCR products was measured using a Qubit® 2.0 Fluorometer (Life Technologies) according the manufacturer's protocol. In summary, two Assay Tubes for the standards were made by making 20-fold dilutions of the 2 stock standards in working solution. For each sample, 200 μl of working solution was prepared in separate tubes, 1 μl of the PCR product was brought into this solution and mixed by vortexing for a couple of seconds. Samples were measured against the 2 standards and the concentration in ng/μl was calculated accordingly. Sequencing of the PCR products was performed on the MiSeq™ system from Illumina, which uses sequencing-by-synthesis to provide rapid high quality sequence data.

[0102] Experiment 1

[0103] CFPAC-1 cells were transfected using two different transfection methods, the reverse transfection whereby the transfection mixture is mixed by the cells while seeding the cells in wells of a 24-well plate and a regular transfection scheme inoculating pre-seeded CFPAC-1 cells. The transfection mixtures shown in Table 2 were used.

[0104] Pre-seeded CFPAC-1 cells (1.5×10.sup.5 cells/well in a 24-well) and the freshly seeded cells (reverse transfection, 1.5×10.sup.5 cells/well in a 24-well) were exposed to these mixture for 24 hours, after which the medium was replaced by fresh culture medium.

[0105] The cells were harvested 72 hours post-transfection and genomic DNA was isolated using the Tissue XS kit as discussed above. This material is amplified using PCR (see above) and then sequenced to determine the proportion of cells which have achieved repair of the of ΔF508 mutation.

[0106] The concentrations of genomic DNA prior to PCR, and the concentrations of PCR product after amplification, are shown in Table 1. The table also shows the results of sequencing the PCR products (see also FIG. 2).

[0107] Experiment 2

[0108] As Experiment 1 had displayed an efficient transfection of CFPAC-1 cells using K2 and the reverse transfection protocol, this method was used to validate different oligonucleotides containing LNA modifications at various positions (see FIG. 1). The transfection mixtures shown in Table 4 were used.

[0109] Cells (1.5×10.sup.5 cells/well in a 24-well) were freshly seeded cells (reverse transfection) together with the mixtures and exposed 24 hours to the reaction mixture after which the medium was replaced by fresh culture medium. 72 or 240 hours post-transfection, the cells were harvested and genomic DNA was isolated using the Tissue XS kit, and subjected to PCR and sequencing as before. Results are in Table 3 (see also FIG. 3). Although signal had declined 10 days after transfection, this effect can be explained by dilution caused by the ongoing process of DNA integration and cell division, and even in preliminary experiments the level of repair which was seen is above background.

[0110] Experiment 3

[0111] Based on these results, we reverse-transfected CFPAC-1 cells with oligonucleotides to bring about DNA editing of the ΔF508 mutation site in CFTR. Genomic DNA of transduced cells was isolated and subjected to a droplet digital PCR (ddPCR) methodology designed to distinguish mutant and wild-type CFTR fragments. The sequence difference causes different Taqman-based probes to bind and be hydrolyzed in a 40-cycle PCR program.

[0112] The results of this ddPCR assay are depicted in FIG. 4, and they demonstrate the ability of the different oligonucleotides to induce gene editing, introducing the missing CTT nucleotides into CFTR. As seen before, the 47 nt single-stranded antisense oligonucleotide containing phosphorothioate modification of the terminal 3 nucleotides (‘47 PS as’), as well as the sequence-identical 47 nt antisense oligonucleotide with two LNA-modified nucleotides 5′ upstream of the AAG (‘47 i2x5′LNA as’), gave the highest rate of gene conversion. Next to this, the oligonucleotide containing two LNA-modified nucleotides 3′ downstream of the AAG (‘47 i2x3′LNA as’) also gave a useful effect on gene conversion.

[0113] Experiment 4

[0114] To further investigate the gene-editing ability of 5′ internally modified oligonucleotides, we designed five further oligonucleotides with different lengths containing three PS-modified nucleotide linkages upstream of the AAG (the final 5 oligos in FIG. 1). CFPAC-1 cells were transduced (reverse transfection) and genomic DNA was isolated and subjected to the ddPCR assay. The results are shown in FIG. 5, and there is a clear length-dependent increase in modified cells as the longer oligonucleotides result in a strong increase in the percentage of wild-type CFTR (i.e. the ‘i3x5′PS as’ series, from 47-57 nt long). For comparison, ‘47 PS as’ (which showed good activity in earlier experiments) was also tested.

[0115] Clearly, the 57 nt anti-sense oligonucleotide containing three PS-modified nucleotides 5′ of the AAG outperformed the shorter versions. The enhanced rate of gene editing compared to the previously-tested ‘47 PS as’ was about 38-fold.

CONCLUSIONS

[0116] These experiments show that the designed oligonucleotides are able to correct the ΔF508 mutation by incorporating the missing CTT sequence at the intended position in the genome of human cells.

[0117] It will be understood that the invention is described above by way of example only and modifications may be made whilst remaining within the scope and spirit of the invention.

TABLE-US-00002 TABLE 1 Genomic PCR DNA product Total # Sample (ng/μl) (ng/μl) reads ΔF508 +CTT 1 27 PS s 167.6 37.2 475787 475772 15 2 27 PS as 225.1 66.8 384348 384346 2 3 47 PS s 208.7 56 453309 453008 301 4 47 PS as 250.7 53.8 520887 503643 17244 5 27 LNA as 381.8 28.2 524339 524330 9 6 47 LNA as 641.8 46.8 473211 468479 4732 9 K2 only 390.0 41.8 519112 519084 28 10 CF-PAC NT 492.3 64.6 423495 423408 87 21 27 PS s 54.4 57.6 466074 466021 53 22 27 PS as 60.9 61.4 482263 482255 8 23 47 PS s 29.2 57.8 501184 501055 129 24 47 PS as 67.2 55.4 455909 454661 1248 25 27 LNA as 115.1 47.8 136465 136464 1 26 47 LNA as 93.8 58.4 433589 432368 1221 29 K2 only 105.1 46 501389 501379 10 30 CF-PAC NT 152.6 40.2 475595 475588 7 #21-#30 show results for the reverse transfection protocol.

TABLE-US-00003 TABLE 2 μl μl μl μl Total μl per Name oligo NaCl K2 NaCl μl well 27 PS s 5.54 49.46 4.4 50.6 110.00 50 27 PS as 5.54 49.46 4.4 50.6 110.00 50 47 PS s 2.64 52.36 4.4 50.6 110.00 50 47 PS as 2.64 52.36 4.4 50.6 110.00 50 27 LNA as 5.54 49.46 4.4 50.6 110.00 50 47 LNA as 2.64 52.36 4.4 50.6 110.00 50 K2 only — 55.00 4.4 50.6 110.00 50

TABLE-US-00004 TABLE 3 Genomic PCR DNA product Total # Sample (ng/μl) (ng/μl) reads ΔF508 +CTT 1 27 LNA as 167.6 290 434123 434122 1 2 47 LNA as 225.1 260 412543 412203 340 3 47 2xi5′LNA 208.7 293 402770 401909 861 4 47 2xi3′LNA 250.7 243 525211 523547 1664 5 27 2x2LNA Cy5 381.8 213 448169 448163 6 6 50 hp5′2x2LNA 641.8 255 404853 404788 65 7 50 hp3′2x2LNA 458.1 266 495851 495851 8 27 2xi5′LNA 352.9 285 467278 467277 1 9 27 2xi3′LNA 390.0 259 543384 543380 4 10 K2 only 492.3 283 403416 403416 21 27 LNA as 54.4 248 428907 428907 22 47 LNA as 60.9 283 492964 492755 209 23 47 2xi5′LNA 29.2 253 403734 403625 109 24 47 2xi3′LNA 67.2 263 206 205 1 25 27 2x2LNA Cy5 115.1 243 463985 463982 3 26 50 hp5′2x2LNA 93.8 270 348200 348198 2 27 50 hp3′2x2LNA 29.0 283 285860 285858 2 28 27 2xi5′LNA 26.7 281 413794 413793 1 29 27 2xi3′LNA 105.1 299 465890 465881 9 30 K2 only 152.6 230 489875 489870 5 #21-#30 show results 240 hours after transfection.

TABLE-US-00005 TABLE 4 μl μl μl μl Total μl per Name oligo NaCl K2 NaCl μl well 27 LNA as 5.54 49.46 4.4 50.6 110.00 50 47 LNA as 2.64 52.36 4.4 50.6 110.00 50 47 i2x5′LNA as 2.64 52.36 4.4 50.6 110.00 50 47 i2x3′LNA as 2.64 52.36 4.4 50.6 110.00 50 27 2x2LNACy5 as 5.54 49.46 4.4 50.6 110.00 50 3′hp2xLNA50 as 2.64 52.36 4.4 50.6 110.00 50 5′hp2xLNA50 as 2.64 52.36 4.4 50.6 110.00 50 27nti2x5′LNA as 5.54 49.46 4.4 50.6 110.00 50 27nti2x3′LNA as 5.54 49.46 4.4 50.6 110.00 50 K2 only — 55.00 4.4 50.6 110.00 50

TABLE-US-00006 SEQUENCE LISTING (F508 codon position underlined) SEQ ID NO: 1 5′-AGAAAATATCATCTTTGGTGTTTCCTA-3′ SEQ ID NO: 2 5′-TAGGAAACACCAAAGATGATATTTTCT-3′ SEQ ID NO: 3 5′-GCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAAT AT-3′ SEQ ID NO: 4 5′-ATATTCATCATAGGAAACACCAAAGATGATATTTTCTTTAATGGT GC-3′ SEQ ID NO: 5 5′-TAGGAAACACCAAAGATGATATTTTCTTTAATGGTGCAAAGCACC ATTAA-3′ SEQ ID NO: 6 5′-ACTACTTATAAAATATAAGTAGTTAGGAAACACCAAAGATGATAT TTTCT-3′ SEQ ID NO: 7 5′-TCATCATAGGAAACACCAAAGATGATATTTTCTTTAA-3′ SEQ ID NO: 8 5′-ATTCATCATAGGAAACACCAAAGATGATATTTTCTTTAATGG-3′ SEQ ID NO: 9 5′-CTATATTCATCATAGGAAACACCAAAGATGATATTTTCTTTAATG GTGCCAG-3′ SEQ ID NO: 10 5′-ATCTATATTCATCATAGGAAACACCAAAGATGATATTTTCTTTAA TGGTGCCAGGCA-3′ SEQ ID NO: 11 ATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTCTCCAAACTTTTT TTCAGCTGGACCAGACCAATTTTGAGGAAAGGATACAGACAGCGCCTG GAATTGTCAGACATATACCAAATCCCTTCTGTTGATTCTGCTGACAAT CTATCTGAAAAATTGGAAAGAGAATGGGATAGAGAGCTGGCTTCAAAG AAAAATCCTAAACTCATTAATGCCCTTCGGCGATGTTTTTTCTGGAGA TTTATGTTCTATGGAATCTUTTATATTTAGGGGAAGTCACCAAAGCAG TACAGCCTCTCTTACTGGGAAGAATCATAGCTTCCTATGACCCGGATA ACAAGGAGGAACGCTCTATCGCGATTTATCTAGGCATAGGCTTATGCC TTCTCTTTATTGTGAGGACACTGCTCCTACACCCAGCCATTTTTGGCC TTCATCACATTGGAATGCAGATGAGAATAGCTATGTTTAGTTTGATTT ATAAGAAGACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAATAAGTA TTGGACAACTTGTTAGTCTCCTTTCCAACAACCTGAACAAATTTGATG AAGGACTTGCATTGGCACATTTCGTGTGGATCGCTCCTTTGCAAGTGG CACTCCTCATGGGGCTAATCTGGGAGTTGTTACAGGCGTCTGCCTTCT GTGGACTTGGTTTCCTGATAGTCCTTGCCCTTTTTCAGGCTGGGCTAG GGAGAATGATGATGAAGTACAGAGATCAGAGAGCTGGGAAGATCAGTG AAAGACTTGTGATTACCTCAGAAATGATTGAAAATATCCAATCTGTTA AGGCATACTGCTGGGAAGAAGCAATGGAAAAAATGATTGAAAACTTAA GACAAACAGAACTGAAACTGACTCGGAAGGCAGCCTATGTGAGATACT TCAATAGCTCAGCCTTCTTCTTCTCAGGGTTCTTTGTGGTGTTTTTAT CTGTGCTTCCCTATGCACTAATCAAAGGAATCATCCTCCGGAAAATAT TCACCACCATCTCATTCTGCATTGTTCTGCGCATGGCGGTCACTCGGC AATTTCCCTGGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAA ACAAAATACAGGATTTCTTACAAAAGCAAGAATATAAGACATTGGAAT ATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAACAGCCTTCT GGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATA ACAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATT TCTCACTTCTTGGTACTCCTGTCCTGAAAGATATTAATTTCAAGATAG AAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCAGGCAAGA CTTCACTTCTAATGATGATTATGGGAGAACTGGAGCCTTCAGAGGGTA AAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGA TTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATG ATGAATATAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGG ACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGAGAAGGTG GAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTTTAGCAAGAG CAGTATACAAAGATGCTGATTTGTATTTATTAGACTCTCCTTTTGGAT ACCTAGATGTTTTAACAGAAAAAGAAATATTTGAAAGCTGTGTCTGTA AACTGATGGCTAACAAAACTAGGATTTTGGTCACTTCTAAAATGGAAC ATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCT ATTTTTATGGGACATTTTCAGAACTCCAAAATCTACAGCCAGACTTTA GCTCAAAACTCATGGGATGTGATTCTTTCGACCAATTTAGTGCAGAAA GAAGAAATTCAATCCTAACTGAGACCTTACACCGTTTCTCATTAGAAG GAGATGCTCCTGTCTCCTGGACAGAAACAAAAAAACAATCTTTTAAAC AGACTGGAGAGTTTGGGGAAAAAAGGAAGAATTCTATTCTCAATCCAA TCAACTCTATACGAAAATTTTCCATTGTGCAAAAGACTCCCTTACAAA TGAATGGCATCGAAGAGGATTCTGATGAGCCTTTAGAGAGAAGGCTGT CCTTAGTACCAGATTCTGAGCAGGGAGAGGCGATACTGCCTCGCATCA GCGTGATCAGCACTGGCCCCACGCTTCAGGCACGAAGGAGGCAGTCTG TCCTGAACCTGATGACACACTCAGTTAACCAAGGTCAGAACATTCACC GAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAGGCAA ACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTG GCTTGGAAATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCT TTTTTGATGATATGGAGAGCATACCAGCAGTGACTACATGGAACACAT ACCTTCGATATATTACTGTCCACAAGAGCTTAATTTTTGTGCTAATTT GGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTGC TGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTC ATAGTAGAAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGT ATTATGTGUTTACATTTACGTGGGAGTAGCCGACACTTTGCTTGCTAT GGGATTCTTCAGAGGTCTACCACTGGTGCATACTCTAATCACAGTGTC GAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCACCTAT GTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTC CAAAGATATAGCAATTTTGGATGACCTTCTGCCTCTTACCATATTTGA CTTCATCCAGTTGTTATTAATTGTGATTGGAGCTATAGCAGTTGTCGC AGTTTTACAACCCTACATCTTTGTTGCAACAGTGCCAGTGATAGTGGC TTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAACTCAA ACAACTGGAATCTGAAGGCAGGAGTCCAATTTTCACTCATCTTGTTAC AAGCTTAAAAGGACTATGGACACTTCGTGCCTTCGGACGGCAGCCTTA CTTTGAAACTCTGTTCCACAAAGCTCTGAATTTACATACTGCCAACTG GTTCTTGTACCTGTCAACACTGCGCTGGTTCCAAATGAGAATAGAAAT GATTTTTGTCATCTTCTTCATTGCTGTTACCTTCATTTCCATTTTAAC AACAGGAGAAGGAGAAGGAAGAGTTGGTATTATCCTGACTTTAGCCAT GAATATCATGAGTACATTGCAGTGGGCTGTAAACTCCAGCATAGATGT GGATAGCTTGATGCGATCTGTGAGCCGAGTCTTTAAGTTCATTGACAT GCCAACAGAAGGTAAACCTACCAAGTCAACCAAACCATACAAGAATGG CCAACTCTCGAAAGTTATGATTATTGAGAATTCACACGTGAAGAAAGA TGACATCTGGCCCTCAGGGGGCCAAATGACTGTCAAAGATCTCACAGC AAAATACACAGAAGGTGGAAATGCCATATTAGAGAACATTTCCTTCTC AATAAGTCCTGGCCAGAGGGTGGGCCTCTTGGGAAGAACTGGATCAGG GAAGAGTACTTTGTTATCAGCTTTTTTGAGACTACTGAACACTGAAGG AGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAACTTTGCAACA GTGGAGGAAAGCCTTTGGAGTGATACCACAGAAAGTATTTATTTTTTC TGGAACATTTAGAAAAAACTTGGATCCCTATGAACAGTGGAGTGATCA AGAAATATGGAAAGTTGCAGATGAGGTTGGGCTCAGATCTGTGATAGA ACAGTTTCCTGGGAAGCTTGACTTTGTCCTTGTGGATGGGGGCTGTGT CCTAAGCCATGGCCACAAGCAGTTGATGTGCTTGGCTAGATCTGTTCT CAGTAAGGCGAAGATCTTGCTGCTTGATGAACCCAGTGCTCATTTGGA TCCAGTAACATACCAAATAATTAGAAGAACTCTAAAACAAGCATTTGC TGATTGCACAGTAATTCTCTGTGAACACAGGATAGAAGCAATGCTGGA ATGCCAACAATTTTTGGTCATAGAAGAGAACAAAGTGCGGCAGTACGA TTCCATCCAGAAACTGCTGAACGAGAGGAGCCTCTTCCGGCAAGCCAT CAGCCCCTCCGACAGGGTGAAGCTCTTTCCCCACCGGAACTCAAGCAA GTGCAAGTCTAAGCCCCAGATTGCTGCTCTGAAAGAGGAGACAGAAGA AGAGGTGCAAGATACAAGGCTT