ENGINEERED FUNGI FOR ITACONIC ACID PRODUCTION
20170327850 · 2017-11-16
Inventors
Cpc classification
C12N9/1205
CHEMISTRY; METALLURGY
C12N9/78
CHEMISTRY; METALLURGY
International classification
C12N9/78
CHEMISTRY; METALLURGY
Abstract
Genetically engineered oleaginous fungi (e.g., engineered Yarrowia lipolytica) are provided for use in itaconic acid production. In some aspects, the engineered fungi comprise a transgene for expression of a cis-aconitic acid decarboxylase (CAD) enzyme and, optionally, one or more further genetic modifications. Methods and culture systems for production of itaconic acid using such fungi are also provided.
Claims
1. A transgenic oleaginous fungus, the fungus comprising at least a first transgenic nucleic acid molecule encoding a cis-aconitic acid decarboxylase (CAD) enzyme operably linked to a promoter functional in the fungus and at least a second genetic modification that increases expression or activity of a gene product selected from the group consisting of AMP deaminase (AMPD), iron-regulatory protein, aconitase, citrate synthase, small acid resistance transporter, citrate transport protein and phosphofructokinase.
2. The fungus of claim 1, wherein the oleaginous fungus is Yarrowia lipolytica.
3. The fungus of claim 1, wherein the fungus comprises a genome integrated nucleic acid molecule encoding a CAD enzyme operably linked to a promoter functional in the fungus.
4. The fungus of claim 1, wherein the fungus comprises an episomal nucleic acid molecule encoding a CAD enzyme operably linked to a promoter functional in the fungus.
5. The fungus of claim 3, wherein the fungus comprises a genome integrated and an episomal nucleic acid molecule each encoding a CAD enzyme operably linked to a promoter functional in the fungus.
6. The fungus of claim 1, wherein the second genetic modification comprises introduction of an expressible transgene encoding a gene product selected from the group consisting of AMPD, iron-regulatory protein, aconitase, citrate synthase, small acid resistance transporter, citrate transport protein and phosphofructokinase.
7. The fungus of claim 1, wherein the second genetic modification comprises mutation or replacement of a promoter linked to an AMPD, iron-regulatory protein, aconitase, citrate synthase, small acid resistance transporter, citrate transport protein or phosphofructokinase gene in the fungus.
8. The fungus of claim 1, wherein the second genetic modification comprises mutation of the coding sequence for an AMPD, iron-regulatory protein, aconitase, citrate synthase, small acid resistance transporter, citrate transport protein or phosphofructokinase gene that increased activity of the gene product.
9. The fungus of claim 1, further comprising at least third, fourth, fifth or sixth genetic modification that increases expression or activity of a gene product selected from the group consisting of AMPD, iron-regulatory protein, aconitase, citrate synthase, small acid resistance transporter, citrate transport protein and phosphofructokinase.
10. The fungus of claim 1, further comprising a transgene encoding a selectable or screenable marker.
11. The fungus of claim 10, wherein the selectable marker is a drug selection marker.
12. The fungus of claim 1, wherein the CAD enzyme is an Aspergillus terreus CAD enzyme (Gene ID AB326105).
13. The fungus of claim 1, wherein the fungus has a Y. lipolytica PO1f genetic background.
14. The fungus of claim 1, wherein the second genetic modification comprises a transgenic nucleic acid molecule encoding an iron-regulatory protein operably linked to a promoter functional in the fungus.
15. The fungus of claim 14, wherein the iron-regulatory protein is a O. cuniculus iron-regulatory protein (Gen ID Q01059).
16. The fungus of claim 15, wherein the iron-regulatory protein comprises a S711D mutation relative to the wild type protein.
17. The fungus of claim 1, wherein the second genetic modification comprises a transgenic nucleic acid molecule encoding a small acid resistance transporter protein operably linked to a promoter functional in the fungus.
18. The fungus of claim 17, wherein the small acid resistance transporter is a Y. lipolytica small acid resistance transporter (Gen ID YALI0E10483g).
19. The fungus of claim 1, wherein the second genetic modification comprises a transgenic nucleic acid molecule encoding a citrate transport protein operably linked to a promoter functional in the fungus.
20. The fungus of claim 19, wherein the citrate transport protein is a Y. lipolytica citrate transport protein (Gen ID YALI0F26323g).
21. The fungus of claim 1, wherein the second genetic modification comprises a transgenic nucleic acid molecule encoding an aconitase operably linked to a promoter functional in the fungus.
22. The fungus of claim 19, wherein the aconitase is a Y. lipolytica aconitase (Gen ID YALI0D09361g).
23. The fungus of claim 21, wherein the aconitase does not include a mitochondrial localization signal (MLS).
24. The fungus of claim 21, further comprising a genome integrated and an episomal nucleic acid molecule each encoding a CAD enzyme operably linked to a promoter functional in the fungus.
25. The fungus of claim 1, wherein the second genetic modification comprises a transgenic nucleic acid molecule encoding citrate synthase operably linked to a promoter functional in the fungus.
26. The fungus of claim 19, wherein the citrate synthase is a Y. lipolytica citrate synthase (Gen ID YALI0E02684g).
27. The fungus of claim 25, wherein the citrate synthase does not include a MLS.
28. The fungus of claim 1, wherein the second genetic modification comprises a transgenic nucleic acid molecule encoding a phosphofructokinase enzyme operably linked to a promoter functional in the fungus.
29. The fungus of claim 28, wherein the phosphofructokinase is a Y. lipolytica phosphofructokinase (Gen ID YALI0D16357g).
30. The fungus of claim 29, wherein the phosphofructokinase comprises a K731A or K731R mutation relative to the wild type protein.
31. The fungus of claim 21, wherein the second genetic modification comprises a transgenic nucleic acid molecule encoding an AMPD enzyme operably linked to a promoter functional in the fungus.
32. The fungus of claim 31, wherein the AMPD enzyme is a Y. lipolytica AMPD enzyme (Gene ID YALI0E11495g).
33. The fungus of claim 31, wherein the transgenic nucleic acid molecule encoding a AMPD enzyme is integrated in the Y. lipolytica genome.
34. The fungus of claim 31, wherein the nucleic acid molecule encoding the AMPD enzyme is comprises in an UAS1B16-TEF expression cassette.
35. The fungus of claim 1, wherein the fungus has been adapted to low pH growth conditions.
36. A culture system comprising a population of transgenic oleaginous fungi in accordance with anyone of claims 1-35 and a growth medium.
37. The culture system of claim 36, wherein the culture produces itaconic acid.
38. The culture system of claim 36, wherein the medium comprises carbon and nitrogen sources, said carbon and nitrogen sources present in a molar ratio of at least 30 (C:N).
39. The culture system of claim 38, wherein said carbon and nitrogen sources are present in a ratio of between about 100 to 1,000 (C:N).
40. The culture system of claim 36, wherein the medium is not supplemented with amino acids.
41. The culture system of claim 36, comprised in a bioreactor.
42. A method for producing an organic commodity chemical comprising: (a) culturing transgenic oleaginous fungi in accordance with any one of claims 1-35 in a growth media; and (b) collecting the organic commodity chemical from the fungus and/or the growth media.
43. The method of claim 42, wherein the commodity chemical comprises itaconic acid.
44. The method of claim 42, wherein the culturing is in a bioreactor.
45. The method of claim 44, wherein the transgenic oleaginous fungi is a fungi in accordance with claim 24.
46. The method of claim 42, wherein the culturing is in a batch system.
47. The method of claim 42, wherein the culturing is in a fed-batch system.
48. The method of claim 42, wherein the culturing is in continuous feed system.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
I. The Present Invention
[0038] Y. lipolytica has the capacity to accumulate lipid content and organic acids through interrelated mechanisms (Papanikolaou, S. et al., 2009). While fatty acid accumulation requires an inhibition and reversal of TCA cycle flux to supply acetyl-CoA fatty acid precursor, organic acid accumulation requires only TCA cycle inhibition. In this manner, organic acid intermediates are accumulated, predominantly as citric and isocitric acid. The inventors have attempted to control TCA cycle inhibition in order to utilize these organic acid reserves for the production of itaconic acid, a value-added chemical monomer with diverse applications.
[0039] As detailed in the studies herein, it was surprisingly found that when the CAD enzyme (e.g., from A. terreus) was overexpressed in Y. lipolytica significant levels of itaconic acid could be produced tapping into the pool of citric, cis-aconitic, and isocitric acid reserves. Significant increases in the production of itaconic acid in Y. lipolytica could be achieved through the episomal expression of a CAD (cis-aconitic acid decarboxylase) enzyme. However, the inventors further increased itaconic acid by chromosomally expressing the CAD gene (either alone or in conjunction with episomal expression), thus avoiding the “half on/half off” phenotype observed in centromeric Y. lipolytica plasmids. Furthermore, by introducing additional genetic modifications into the engineered fungi the production of itaconic acid could be further enhanced. For example, overexpression of AMP deaminase resulted in significant increases in production. Likewise, overexpression or elevated activation of the gene products of Table 3 may result in yet further enhancements of itaconic acid.
[0040] The inventors also investigated alterations in the media conditions that favored itaconic acid production. In particular, it was found that by balancing the levels of carbon and nitrogen sources in the media the output of the system could be greatly enhanced. In particular, moderate nitrogen starvation conditions were found to be the most favorable for itaconic acid production. The additional use of a minimal media formulation, lacking amino acid supplementation, was found to yet further enhance production. In view of the resistance of Y. lipolytica to shear stress bioreactor culture of engineered organisms was also tested and found to likewise produce significant levels of itaconic acid. Thus, embodiments of the invention address a significant need in the art by providing genetically engineered oleaginous fungi that are suitable for industrial scale culture and able to produce high levels of itaconic acid.
II. Oleaginous Fungi
[0041] A wide range of oleaginous fungi can be engineered in accordance with the current embodiments to provide biological systems for itaconic acid production. For example, in some aspects, the engineered organism may be Apiotrichum curvatum, Candida apicola, Candida curvata, Candida revkaufi, Candida pulcherrima, Candida tropicalis, Candida utilis, Cryptococcus curvatus, Cryptococcus terricolus, Debaromyces hansenii, Endomycopsis vernalis, Geotrichum carabidarum, Geotrichum cucujoidarum, Geotrichum histeridarum, Geotrichum silvicola, Geotrichum vulgare, Hyphopichia burtonii, Lipomyces lipoferus, Lipomyces lipofer, Lypomyces orentalis, Lipomyces starkeyi, Lipomyces tetrasporous, Pichia mexicana, Rodosporidium sphaerocarpum, Rhodosporidium toruloides, Rhodotorula aurantiaca, Rhodotorula dairenensis, Rhodotorula diffluens, Rhodotorula glutinus, Rhodotorula glutinis var. glutinis, Rhodotorula gracilis, Rhodotorula graminis, Rhodotorula minuta, Rhodotorula mucilaginosa, Rhodotorula mucilaginosa Rhodotorula mucilaginosa, Rhodotorula terpenoidalis, Rhodotorula toruloides, Sporobolomyces alborubescens, Starmerella bombicola, Torulaspora delbruekii, Torulaspora pretoriensis, Trichosporon behrend, Trichosporon brassicae, Trichosporon cutaneum, Trichosporon domesticum, Trichosporon fermentans, Trichosporon laibachii, Trichosporon loubieri, Trichosporon loubieri var. loubieri, Trichosporon montevideense, Trichosporon pullulans, Wickerhamomyces canadensis, Yarrowia lipolytica, or Zygoascus meyerae.
[0042] In some aspects, the engineered fungus is Yarrowia lipolytica. Y. lipolytica is a well-studied oleaginous yeast organism with well-developed tools for rational genetic engineering and has gained recognition for use in metabolic engineering applications (Barth and Gaillardin, 1996; Beopoulos et al., 2008; Blazeck, 2014; Blazeck et al., 2013a; Blazeck et al., 2011; Blazeck et al., 2013c; Fickers et al., 2003; Gon et al., 2014; Juretzek et al., 2001; Madzak et al., 2004, each incorporated herein by reference). In some aspects, a strain of Y. lipolytica for use according to the embodiments is a leucine and uracil auxotroph strain and/or is devoid of secreted protease activity. For example, the strain can be the PO1f strain (available from the ATCC # MYA-2613).
III. Examples
[0043] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
Example 1: Itaconic Acid Production with Genetically Engineered Yarrowia lipolytica
[0044] Materials and Methods
[0045] Strains and Media for Routine Cultivations
[0046] Y. lipolytica expression vectors were propagated in Escherichia coli DH10B. E. coli DH10B was routinely cultivated in LB Media Broth (Teknova) supplemented with 50 μg/ml ampicillin for plasmid propagation at 37° C. with constant shaking. Yarrowia lipolytica strain PO1f (ATCC # MYA-2613), a leucine and uracil auxotroph devoid of any secreted protease activity (Madzak, C. et al., 2000, incorporated herein by reference) was used as the starting point for all strain construction Y. lipolytica studies.
[0047] YSC media consisted of 20 g/L glucose (Fisher Scientific), 0.79 g/L CSM supplement (MP Biomedicals), and 6.7 g/L Yeast Nitrogen Base w/o amino acids (Becton, Dickinson, and Company). YSC-URA, YSC-LEU, and YSC-LEU-URA media contained 0.77 g/L CSM-Uracil, 0.69 g/L CSM-Leucine, or 0.67 g/L CSM-Leucine-Uracil in place of CSM, respectively. YPD media contained 10 g/L yeast extract (Fisher Scientific), 20 g/L peptone (Fisher Scientific) and 20 g/L glucose, and was supplemented with 300 μg/ml Hygromycin B (Invitrogen) when Y. lipolytica necessary. S. cerevisiae BY4741 (MATa; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0) obtained from EUROSCARF, Frankfurt, Germany was utilized for homologous recombination media construction of the CAD gene (described below) and was cultivated in YPD or the appropriate selection media.
[0048] Cloning Procedures
[0049] All restriction enzymes were purchased from New England Biolabs and all digestions were performed according to standard protocols. PCR reactions were set up with recommended conditions using Phusion high fidelity DNA polymerase (Finnzymes). Ligation reactions were performed overnight at room temperature using T4 DNA Ligase (Fermentas). Gel extractions were performed using the Fermentas GeneJET extraction kit purchased from Fisher ThermoScientific. E. coli minipreps were performed using the Zyppy Plasmid Miniprep Kit (Zymo Research Corporation). S. cerevisiae plasmid minipreps were performed using Zymoprep Yeast Plasmid Miniprep II kit (Zymo Research Corporation). E. coli maxipreps were performed using the Qiagen HiSpeed Plasmid Maxi Kit. Transformation of E. coli strains was performed using standard electroporator protocols (Sambrook and Russell, 2001). Large amounts of linearized DNA (>20 μg), necessary for Y. lipolytica PO1f transformation were cleaned and precipitated using a standard phenol:chloroform extraction followed by ethanol precipitation.
[0050] Genomic DNA (gDNA) was extracted from Y. lipolytica using the Wizard Genomic DNA Purification kit (Promega). Transformation of Y. lipolytica with episomal expression plasmids was performed using the Zymogen Frozen EZ Yeast Transformation Kit II (Zymo Research Corporation), with plating on appropriate selection plates. Transformation of Y. lipolytica PO1f with linearized cassettes was performed as described previously (Blazeck, J. et al., 2013). Briefly, PO1f and its derivatives were inoculated from glycerol stock directly into 10 mL YPD media, grown overnight, and harvested at an OD.sub.600 between 9 and 15 by centrifugation at 1000×g for 5 minutes. Cells were washed in 8.0 mL TE buffer (10 mM Tris, 1 mM EDTA, pH=7.5), spun down, and resuspended in 8.0 mL TE buffer. 10.sup.8 cells were dispensed into separate microcentrifuge tubes for each transformation, spun down, and resuspended in 1.0 mL LiOAc buffer (100 mM LiOAc, adjusted to pH=6.0 with 2 M acetic acid). Cells were incubated with shaking at 30° C. for 60 minutes, spun down, resuspended in 90 μL LiOAc buffer, and placed on ice. 1-5 μg of linearized DNA was added to each transformation mixture in a total volume of 10 μL, followed by 25 μL of 50 mg/mL boiled salmon sperm DNA (Sigma-Aldrich). Cells were incubated at 30° C. for 15 minutes with shaking, before adding 720 μL PEG buffer (50% PEG8000, 100 mM LiOAc, pH=6.0) and 45 μL 2 M dithiothreitol. Cells were incubated at 30° C. with shaking at 225 rpm for 60 minutes, heat shocked for 10 minutes in a 39° C. water bath, spun down and resuspended in 1 mL sterile water. 200 μL of cells were plated on appropriate selection plates. All auxotrophic or antibiotic selection markers for genomic integrations were flanked with LoxP sites to allow for retrieval of integrated markers with the pMCS-UAS1B.sub.16-TEF-Cre or pMCS-HYG-UAS1B.sub.16-TEF-Cre replicative vectors (Blazeck et al., 2013a).
[0051] Plasmid Construction
[0052] Primer sequences can be found in Table 1 below. Four gBlocks gene fragments (Integrated DNA Technologies) were designed to encompass the intronless CAD gene sequence from Aspergillus terreus with at least 50 nucleotides overlapping between each gBlock and with the p416-UAS.sub.TEF-UAS.sub.CIT-UAS.sub.CLB-P.sub.GPD vector backbone (Kanamasa, S. et al., 2008; Blazeck, J. et al. 2012). Primers JB931/932 (SEQ ID NOs: 3/4), JB933/934 (SEQ ID NOs: 5/6), JB935/936 (SEQ ID NOs: 7/8), and JB937/938 (SEQ ID NOs: 9/10) were used to PCR amplify the four gBlocks. Amplified gBlock DNA fragments and linearized p416-UAS.sub.TEF-UAS.sub.CIT-UAS.sub.CLB-P.sub.GPD vector backbone were transformed into S. cerevisiae BY4741 following Hegemann's yeast transformation protocol (Guldener, U. et al., 1996) to enable homologous recombination mediated gene assembly (Shao, Z. et al., 2009). Plasmid p416-UAS.sub.TEF-UAS.sub.CLB-UAS.sub.CLB-P.sub.GPD-AtCAD was isolated from transformed BY4741 with a yeast miniprep, transformed into E. coli, miniprepped, and sequence confirmed.
TABLE-US-00001 TABLE 1 Primer sequences used in plasmid construction. SEQ Primers Sequence (5′-->3′) ID NO: JB865 ggaacggtagatctcgagcgtcccaaaaccttctc 1 JB883 gtggacgggccggcgtttggcgcccgttttttcg 2 JB931 gtattgattgtaattctgtaaatctatttc 3 JB932 cttgctgcaaagaccgcaggaaggacaatgcttgcagagtgtagggggg 4 cttcgctgtgg JB933 tttcatacaggctacggagcttgacgactaccacagcgaagccccccta 5 cactctgcaag JB934 gaggctctctgccgttgccc 6 JB935 ttcttgggggactgttggcc 7 JB936 agatgaagtaaccttcctggccagatc 8 JB937 ccgtccagctggtcgaccag 9 JB938 ctccttccttttcggttagagcggatgtggggggagggcgtgaatgtaa 10 JB1140 gagtggcgcgccatgatttctgctattcgtccc 11 JB1141 gcacttaattaattagagcttgaggccaacga 12 JB1142 gagtggcgcgccatgcttaaggagcgattcgcc 13 JB1143 gagtggcgcgccatgctggcttctcgagtttc 14 JB1144 gcacttaattaattatttcttggaggcagcc 15 JB1145 gagtggcgcgccatggccaacaacttcctcaacttc 16 JB1050 gagtggcgcgccatgaccaaacaatctgcgg 17 JB1051 gcacttaattaattataccagtggcgatttca 18 JB1168 gagtggcgcgccatgtctaatccttttgcatacttag 19 JB1169 gcacttaattaactactttgccatttttctaatca 20 LQ71 aactctagatatgtctgataaaag 21 LQ72 ttagcggccgcatactactgtatattc 22 LQ73 aacgcggccgcctgcagactaaattta 23 LQ74 ttcagatctctaacagttaatcttc 24 LQ311 ACTGGGCGCGCCATGATTGAAGGAATCTCCTTTGCG 25 LQ312 ACTGTTAATTAACTAACAAGGATCAATAATACCCTGCTC 26 LQ317 ACGTGCTCGCGACGTCTGCTTCTGCCA 27 LQ318 TGGCAGAAGCAGACGTCGCGAGCACGT 28 LQ319 GACGTGCTCCGGACGTCTGCTTCTGCCA 29 LQ320 TGGCAGAAGCAGACGTCCGGAGCACGTC 30 AH115 GACTGGCGCGCCATGAGAGCCCTTCTGAACAAG 31 AH116 GTCCTTAATTAATCATCTCATCATTCGTCGGAC 32 AH117 GCCGAACCTTGGAAGTCCCT 33 AH118 GTCCTTAATTAACTAAAGAATCTCCATGATCTTCTCATAGATGGT 34 AH119 GACT GGCGCGCCATGGTTTCATCAGATACCAAGAAG 35 GCCGAACCTTGGAAGTCCCT
[0053] Primers JB1050/1051 (SEQ ID NOs: 17/18) were used to amplify the A. terreus CAD gene from plasmid p416-UAS.sub.TEF-UAS.sub.cIT-UAS.sub.CLB-P.sub.GPD-AtCAD and insert it into the pUC-S2-UAS1B.sub.16-TEF (Blazeck, J. et al., 2013a) and pMCS-UAS1B.sub.16-TEF (Blazeck, J. et al., 2011) chromosomal and episomal expression vectors (respectively) with an AscI/PacI digest to form plasmids pUC-52-UAS1B.sub.16-TEF-CAD and pMCS-UAS1B.sub.16-TEF-CAD.
[0054] Primers LQ71/LQ72 (SEQ ID NOs: 21/22) were used to amplify ORI1001 from plasmid pMCS-Cen1 (Blazeck, J. et al., 2011) and insert it into plasmid pMCS-TEF-hrGFP (Blazeck, J. et al., 2011) with an XbaI/NotI-HF digest (replacing an identical ORI1001) to form plasmid pMCS-TEF-hrGFP-mod. Primers LQ73/LQ74 (SEQ ID NOs: 23/24) were used to amplify Ura3d1 from plasmid the pUC-S1-UAS1B.sub.16-TEF (Blazeck, J. et al., 2013a) and insert it into plasmid pMCS-TEF-hrGFP-mod with an NotI-HF/BglII digest (replacing the LEU2 marker) to form plasmid pMCS-URA-TEF-hrGFP. The UAS1B.sub.16-TEF-CAD expression cassette was gel extracted from plasmid pMCS-UAS1B.sub.16-TEF-CAD and inserted into pMCS-URA-TEF-hrGFP with BstBI/AscI (replacing TEF-hrGFP) to form plasmid pMCS-URA-UAS1B.sub.16-TEF-CAD.
[0055] Primers JB1143/1144 (SEQ ID NOs: 14/15) were used to amplify Y. lipolytica's native, mitochondrial-targeted aconitase gene (YALI0D09361g) from PO1f gDNA template. The aconitase open reading frame was inserted it into pMCS-URA-UAS1B.sub.16-TEF-CAD in place of CAD with an AscI/PacI digest to form plasmid pMCS-URA-UAS1B.sub.16-TEF-ACO. Similarly, primers JB1145/1144 (SEQ ID NOs: 16/15) amplified a truncated version of the aconitase gene (ACOnoMLS), removed of its mitochondrial localization signal (MLS) to prevent protein localization in the mitochondria. Insertion into pMCS-URA-UAS1B.sub.16-TEF-CAD yielded pMCS-URA-UAS1B.sub.16-TEF-ACOnoMLS. A rabbit bifunctional cytosolic iron-regulatory and aconitase protein (IRP1) with a S711D mutation that inhibits citrate to isocitrate conversion but not isocitrate to cis-aconitate conversion (Pitula, J. S. et al., 2004) was codon optimized for expression in yeast and synthesized by Life Technologies. Primers JB1168/1169 (SEQ ID NOs: 19/20) amplified IRP1 for AscI/PacI insertion into pMCS-URA-UAS1B.sub.16-TEF-CAD to form pMCS-URA-UAS1B.sub.16-TEF-IRP1.
[0056] Primers JB1140/1141 (SEQ ID NOs: 11/12) amplified Y. lipolytica's citrate synthase gene (YALI0E02684g) from PO1f gDNA template for insertion into pMCS-UAS1B.sub.16-TEF-CAD with an AscI/PacI digest to form plasmid pMCS-UAS1B.sub.16-TEF-CIT. Similarly, primers JB1142/1141 (SEQ ID NOs: 13/12) amplified a citrate synthase gene truncated of its MLS (CITnoMLS) to enable construction of pMCS-UAS1B.sub.16-TEF-CITnoMLS.
[0057] Primers JB883/865 (SEQ ID NOs: 2/1) amplified an EXP1-Hph-Cyclt hygromycin resistance expression cassette from plasmid pKO (Blazeck, J. et al., 2013a) for Nad/BglII mediated insertion into plasmid pMCS-UAS1B.sub.16-TEF-Cre (Blazeck, J. et al., 2013a) in place of the leucine marker to form plasmid pMCS-HYG-UAS1B.sub.16-TEF-Cre.
[0058] Primers LQ311/312 (SEQ ID NOs: 25/26) amplified Y. lipolytica's pfk gene from PO1f gDNA template for insertion into pMCS-UAS1B.sub.16-TEF with an AscI/PacI digest to form plasmid pMCS-UAS1B.sub.16-TEF-PFK. Primers LQ317/318 (SEQ ID NOs: 27/28) and LQ319/320 (SEQ ID NOs: 29/30) were used to mutate K731 to A or R respectively which were inserted into pMCS-UAS1B.sub.16-TEF with an AscI/PacI digest to form plasmids pMCS-UAS1B.sub.16-TEF-PFKA and pMCS-UAS1B.sub.16-TEF-PFKR respectively. Primers AH115/116 (SEQ ID NOs: 31/32) amplified an organic acid resistance transporter (YALI0E10483g) from PO1f gDNA template for insertion into pMCS-UAS1B.sub.16-TEF with an AscI/PacI digest to form plasmid pMCS-UAS1B.sub.16-TEF-MOAT.
[0059] Primers AH117/118 (SEQ ID NOs: 33/34) amplified Y. lipolytica's citrate transporter protein (YALI0F26323g) PO1f gDNA template to exclude intronic DNA. This was used as the template for amplification by primers AH118/119 (SEQ ID NOs: 34/35) for insertion into pMCS-UAS1B.sub.16-TEF with an AscI/PacI digest to form plasmid pMCS-UAS1B.sub.16-TEF-CTP1.
[0060] Strain Construction
[0061] All strains containing genomic modifications were confirmed through gDNA extraction and PCR confirmation. An AMPD chromosomal expression strain utilizing the uracil auxotrophic marker had previously been constructed, referred to as PO1f uracil AMPD (Blazeck, J. et al., 2014). A chromosomal, NotI-HF linearized pUC-52-UAS1B.sub.16-TEF-CAD expression cassette was transformed into Y. lipolytica PO1f and PO1f uracil.sup.+ AMPD to form strains: PO1f leucine.sup.+ CAD and PO1f leucine.sup.+ uracil.sup.+ AMPD CAD.
[0062] The leucine and uracil markers were removed from PO1f leucine.sup.+ CAD and PO1f leucine.sup.+ uracil.sup.+ AMPD CAD by transforming each strain with plasmid pMCS-HYG-UAS1B.sub.16-TEF-Cre and cultivation in YPD hygromycin media. Replica plating on YPD-hyg, YSC-leu, and YSC-ura plates enabled isolation of PO1f CAD and PO1f AMPD CAD strains that were leucine and uracil auxotrophs.
[0063] When relevant, episomal expression is denoted with an “Epi” moniker in the strain name. PO1f-based strains episomally expression the CAD gene were creating by transforming PO1f with pMCS-UAS1B.sub.16-TEF-CAD or pMCS-URA-UAS1B.sub.16-TEF-CAD singly, in tandem, or in combination with the requisite blank plasmid (pMCS-Cen1 or pMCS-URA-Cen1) to fully complement PO1f's auxotrophies. Additionally, PO1f uracil.sup.+ AMPD was transformed with pMCS-UAS1B.sub.16-TEF-CAD to form PO1f leucine.sup.+ uracil.sup.+ AMPD CAD Epi. Similarly, multi-copy overexpressions of the CAD gene were enabled through transformation of the leucine/uracil auxotrophic PO1f CAD or PO1f AMPD CAD strains with episomal CAD expression vectors.
[0064] Plasmids pMCS-Cen1, pMCS-UAS1B.sub.16-TEF-CIT, pMCS-UAS1B.sub.16-TEF-CITnoMLS, pMCS-URA-Cen1, pMCS-URA-UAS1B.sub.16-TEF-ACO, pMCS-URA-UAS1B.sub.16-TEF-ACOnoMLS, and pMCS-URA-UAS1B.sub.16-TEF-IRP1 were transformed singly or in pairs into the leucine/uracil auxotrophic PO1f AMPD CAD strain to analyze the effect of aconitase and citrate synthase cytosolic or mitochondrial expression.
[0065] Additional strains studied in this example are listed in Table 2 below. Table 3 lists overexpressed enzymes.
TABLE-US-00002 TABLE 2 Additional strains studied. Strains itaconic acid CAD epi, CIT epi 103.8980833 CAD epi, IRP1 epi 70.8289 CAD epi CITnoMLS epi 135.8638833
TABLE-US-00003 TABLE 3 Enzymes for overexpression (or modification for increased activity). SEQ Enzyme Name Organism Gene ID ID NO cis-aconitic acid A. terreus AB326105 36 decarboxylase AMP Deaminase Y. lipolytica YALI0E11495g 37 S711D iron-regulatory O. cuniculus Q01059 38 protein mutant aconitase Y. lipolytica YALI0D09361g 39 aconitase no MLS Y. lipolytica YALI0D09361g 40 citrate synthase Y. lipolytica YALI0E02684g 41 citrate synthase no MLS Y. lipolytica YALI0E02684g 42 small acid resistance Y. lipolytica YALI0E10483g 43 transporter citrate transport protein Y. lipolytica YALI0F26323g 44 phosphofructokinase Y. lipolytica YALI0D16357g 45 K->A phosphofructokinase Y. lipolytica YALI0D16357g 46 mutant K->R phosphofructokinase Y. lipolytica YALI0D16357g 47 mutant
[0066] Itaconic Acid Production and Media Optimization
[0067] Cultivation for itaconic acid production always entailed the following: Yarrowia lipolytica strains were cultivated for two days at 30° C. with constant agitation in 2 mL cultures of the appropriate YSC media and then reinoculated to an OD.sub.600=0.005 in 15 mL media in 250 mL flasks and shaken at 30° C. at 225 rpm.
[0068] Itaconic acid production as a function of media formulation was first investigated by cultivation in varying concentrations of glucose and nitrogen in YSC media. These media formulations contained 0.79 g/L CSM, 1.7 g/L Yeast Nitrogen Base w/o amino acid and w/o (NH.sub.4).sub.2SO.sub.4 (Becton, Dickinson, and Company), and the following concentrations of glucose and ammonium—20 g/L and 1.365 g/L ammonium (5 g/L ammonium sulfate), 20 g/L glucose and 0.055 g/L ammonium (0.2 g/L ammonium sulfate), and 80 g/L and 1.365 g/L ammonium (5 g/L ammonium sulfate). The effect of amino acid supplementation was investigated by cultivation in minimal media formulations utilized 20 g/L glucose, 6.7 g/L Yeast Nitrogen Base w/o amino acids (1.7 g/L YNB and 5 g/L ammonium sulfate (1.365 g/L ammonium)), and uracil supplementation at 0.02 g/L if necessary. Minimal media formulation was then further optimized by adjusting nitrogen availability. Strains were cultivated 20 g/L and 1.365 g/L ammonium (5 g/L ammonium sulfate), 20 g/L glucose and 0.273 g/L ammonium (1.00 g/L ammonium sulfate), and 20 g/L and 0.1365 g/L ammonium (0.50 g/L ammonium sulfate) and analyzed for itaconic acid production.
[0069] Time Course of Itaconic Acid Production
[0070] Strains PO1f leucine.sup.+ CAD and PO1f leucine.sup.+ uracil.sup.+ AMPD CAD were cultivated in minimal media formulations utilizing 20 g/L and 1.365 g/L ammonium (5 g/L ammonium sulfate) with uracil supplementation if necessary for seven days and analyzed for itaconic acid production, citric acid production, and OD.sub.600 after two, three, four, six, and seven days.
[0071] Citric Acid and Itaconic Acid Quantification
[0072] A 1-2 mL culture sample was pelleted down for 5 minutes at 3000×g, and the supernatant was filtered using a 0.2 mm syringe filter (Corning Incorporated). Filtered supernatant was analyzed with a HPLC Ultimate 3000 (Dionex) and a Zorbax SB-Aq column (Agilent Technologies). A 2.0 μL injection volume was used in a mobile phase composed of a 99.5:0.5 ratio of 25 mM potassium phosphate buffer (pH=2.0) to acetonitrile with a flow rate of 1.25 mL/min. The column temperature was maintained at 30° C. and UV-Vis absorption was measured at 210 nm. Citric acid and itaconic acid standards (Sigma-Aldrich) were used to detect and quantify organic acid production.
[0073] Prediction of Intracellular Localization
[0074] Probability of mitochondrial protein localization was predicted using the MITOPROP II v1.101 program (Claros, M. G. et al., 1996). In all cases, the entire protein's amino acid sequence was inputted.
[0075] Bioreactor Fermentations
[0076] Typically, bioreactor fermentations were run in minimal media containing 80 g/L glucose and 6.7 g/L Yeast Nitrogen Base w/o amino acids as batch processes. All fermentations were inoculated to an initial OD.sub.600=0.1 in 1.5 L of media. Dissolved oxygen was maintained at 50% of maximum by varying rotor speed between 250 rpm and 800 rpm with a constant air input flow rate of 2.5 v v.sup.−1 min.sup.−1 (3.75 L min.sup.−1). PH was maintained at 3.5 or above with 2.5 M NaOH, and temperature was maintained at 28° C. 10-15 mL samples were taken every twenty-four hours, and fermentations lasted 7 days. The inventors ran several fermentations with suboptimal conditions before settling on the above parameters.
[0077] pH Tolerance Adaptive Evolution
[0078] PO1f, S1, S2 CAD, AMPD CAD, and AMPD CAD CAD.sub.epi ACONOMLS.sub.epi strains were subjected to serial re-culturing in YSC or YSC-LEU,-URA media, depending on the presence of episomal plasmids. With each subsequent transfer, the initial pH of the media was decreased by 0.1 points using HCl, starting with a initial pH of 5.0 and terminating with an initial pH of 2.8. Cells were grown in 20 mL of appropriate media in 250 mL flasks at 30° C. at 225 rpm. Cells were transferred during late exponential phase into fresh media with a 1000-fold dilution. Once the adaption was completed, the native and evolved strains were tested for improved growth in low-pH conditions. For this test, the native strains and isolates from various stages of the adaption were initially inoculated into 3 mL of YSC or YSC-LEU,-URA media and cultured for 3 days at 30° C. in triplicate. The strains were then inoculated at an OD.sub.600 of 0.01 into 2 mL of YSC or YSC-LEU,-URA adjusted to an initial pH of 4.0, 3.5, 3.0, or 2.5 as well as an unadjusted control. After 24 hours, OD.sub.600 measurements were periodically taken until 63 hours of fermentation.
[0079] Results and Discussion
[0080] Episomal expression of the CAD gene in Y. lipolytica
[0081] Recent characterization of the cis-aconitic acid decarboxylase gene (CAD) enables its utilization for itaconic acid production in microbial hosts. The inventors inserted the CAD gene into a high-strength UAS1B.sub.16-TEF expression cassette on an episomal plasmid to allow for expression in Y. lipolytica, and 33 mg/L itaconic acid titer was observed (
[0082] The inventors attempted to increase itaconic acid production by expressing CAD (again episomally) in a Y. lipolytica strain with the AMP Deaminase (AMPD) enzyme constitutively overexpressed in a UAS1B.sub.16-TEF-driven chromosomal expression cassette. Constitutive expression of AMPD inhibits the citric acid cycle at the isocitric acid intermediate, increasing cis-aconitic acid substrate levels (Beopoulos, A. et al., 2009b). A nearly fivefold increase in itaconic acid was observed in this AMPD overexpression background strain, to 159 mg/L (
[0083] Optimizing C:N Ratio for Itaconic Acid Production
[0084] As described above, Y. lipolytica's central carbon metabolism is pliable to manipulation by AMPD overexpression. It have been previously demonstrated that Y. lipolytica's lipid accumulation potential can be manipulated by controlling carbon (glucose) and nitrogen (ammonium) availability in media formulations (C:N ratio) (Blazeck, J. et al., 2013b). High C:N ratios promotes citric acid accumulation (a metabolic precursor for cis-aconitic acid CAD substrate) by stimulating a nitrogen starvation response that inhibits the citric acid cycle through AMPD-mediated activity (Beopoulos, A. et al., 2009a; Beopoulos, A. et al., 2009b).
[0085] Thus, the inventors attempted to increase citric acid and itaconic acid production by cultivating Y. lipolytica PO1f and PO1f AMPD strains, harboring episomal CAD expression cassettes, in media formulations with increased C:N ratio (
[0086] Integration of CAD to increase itaconic acid production
[0087] Increased protein activity using chromosomal expression compared to episomal expression in Y. lipolytica for a hrGFP reporter gene has previously been observed (Blazeck, J. et al., 2011). Therefore, the inventors integrated the CAD gene into the PO1f and PO1f AMPD overexpression backgrounds and assayed for itaconic acid production (
[0088] The inventors assayed the two chromosomal CAD expression strains for itaconic acid when cultivated in minimal media (C.sub.20N.sub.1.365—amino acids). The PO1f chromosomal CAD expression strain required additional supplementation with 20 mg/L due to a uracil auxotrophy that had been alleviated in the PO1f AMPD overexpression background by insertion of the AMPD expression cassette (Blazeck, J. et al., 2014). Another pronounced increase in itaconic acid production was observed, culminating in 272 mg/L produced by the AMPD overexpression background (
[0089] Optimizing Cultivation Duration
[0090] The inventors analyzed itaconic acid and citric acid production of the PO1f CAD and PO1f AMPD CAD chromosomal expression strains in C.sub.20N.sub.1.365 minimal media (no amino acid supplementation) for seven days (
[0091] Fine-Tuning Media Formulation to Increase Itaconic Acid Production
[0092] The inventors attempted to further modify media formulation utilizing drastic adjustments in carbon and nitrogen availability and failed to increase itaconic acid production in the PO1f AMPD background. In some studies media formulation enhanced by reducing nitrogen content less severely. The PO1f AMPD CAD strain was cultivated for seven days in three minimal media formulations, C.sub.20N.sub.1.365, C.sub.20N.sub.0.273, and C.sub.20N.sub.0.1365. Reducing nitrogen availability by 80% (i.e., a C:N molar ratio of ˜44 at 20 g/L of glucose) using the C.sub.20N.sub.0.273 media formulation drastically increased itaconic acid production to 667 mg/L (
[0093] Bioreactor Fermenations
[0094] Various strains containing combinations of AMPD, CAD, and aconitase, mitochrondrial organic acid transporters (MOATs), and phosphofructokinases, and ACOnoMLS overexpressions were tested for itaconic acid production in flask-scale fermentations to determine optimal strains for bioreactor fermenations (
[0095] pH Growth Adaption
[0096] Evaluating the growth curves of both the native strains (
[0097] All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
REFERENCES
[0098] The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. [0099] Barth, G., Gaillardin, C., 1996. Yarrowia lipolytica. In: Wolf, K., (Ed.), Nonconventional Yeasts in Biotechnology: A Handbook. vol. 1. Springer, pp. 313-388. [0100] Beopoulos, A., Cescut, J., Haddouche, R., Uribelarrea, J. L., Molina-Jouve, C., Nicaud, J. M., 2009a. Yarrowia lipolytica as a model for bio-oil production. Prog. Lipid Res. 48, 375-387. [0101] Beopoulos, A., Chardot, T., Nicaud, J. M., 2009b. Yarrowia lipolytica: A model and a tool to understand the mechanisms implicated in lipid accumulation. Biochimie. 91, 692-696. [0102] Beopoulos, A., Mrozova, Z., Thevenieau, F., Le Dall, M. T., Hapala, I., Papanikolaou, S., Chardot, T., Nicaud, J. M., 2008. Control of Lipid Accumulation in the Yeast Yarrowia lipolytica. Applied and Environmental Microbiology. 74, 7779-7789. [0103] Blazeck, J., Garg, R., Reed, B., Alper, H., 2012. Controlling promoter strength and regulation in Saccharomyces cerevisiae using synthetic hybrid promoters. Biotechnology and Bioengineering. 109, 2884-2995. [0104] Blazeck, J., Hill, A., Liu, L., Knight, R., Miller, J., Pan, A., Otoupal, P., Alper, H. S., 2014. Harnessing Yarrowia lipolytica lipogenesis to create a platform for lipid and biofuel production. Nature Communications. 5. [0105] Blazeck, J., Liu, L., Knight, R., Alper, H., 2013a. Heterologous production of pentane in the oleaginous yeast Yarrowia lipolytica. Journal of Biotechnology. 165, 184-194. [0106] Blazeck, J., Liu, L., Knight, R., Alper, H. S., 2013b. Heterologous production of pentane in the oleaginous yeast Yarrowia lipolytica. Journal of Biotechnology. 165, 184-194. [0107] Blazeck, J., Liu, L., Redden, H., Alper, H., 2011 Tuning Gene Expression in Yarrowia lipolytica by a Hybrid Promoter Approach. Applied and Environmental Microbiology. 77, 7905-7914 [0108] Blazeck, J., Reed, B., Garg, R., Gerstner, R., Pan, A., Agarwala, V., Alper, H., 2013c. Generalizing a hybrid synthetic promoter approach in Yarrowia lipolytica. Applied Microbiology and Biotechnology. 97, 3037-3052. [0109] Bonnarme, P., Gillet, B., Sepulchre, A. M., Role, C., Beloeil, J. C., Ducrocq, C., 1995. Itaconate Biosynthesis in Aspergillus terreus. Journal of Bacteriology. 177, 3573-3578. [0110] Claros, M. G., Vincens, P., 1996. Computational method to predict mitochondrially imported proteins and their targeting sequences. European Journal of Biochemistry. 241, 779-786. [0111] Fickers, P., Le Dall, M. T., Gaillardin, C., Thonart, P., Nicaud, J. M., 2003. New disruption cassettes for rapid gene disruption and marker rescue in the yeast Yarrowia lipolytica. J. Microbiol. Methods. 55, 727-737. [0112] Finogenova, T. V., Morgunov, I. G., Kamzolova, S. V., Chernyayskaya, O. G., 2005. Organic acid production by the yeast Yarrowia lipolytica: A review of prospects. Applied Biochemistry and Microbiology. 41, 418-425. [0113] Gon, #xe7, alves, F. A. G., Colen, G., Takahashi, J. A., 2014. Yarrowia lipolytica and Its Multiple Applications in the Biotechnological Industry. The Scientific World Journal. 2014, 14. [0114] Guldener, U., Heck, S., Fiedler, T., Beinhauer, J., Hegemann, J. H., 1996. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Research. 24, 2519-2524. [0115] Hevekerl, A., Kuenz, A., Vorlop, K.-D., 2014. Filamentous fungi in microtiter plates—an easy way to optimize itaconic acid production with Aspergillus terreus. Applied Microbiology and Biotechnology. 1-7. [0116] Itaconix, L., The development of integrated production of polyitaconic acid from Northeast hardwood biomass. NIFA, New Hampshire, 2009. [0117] Juretzek, T., Le Dall, M. T., Mauersberger, S., Gaillardin, C., Barth, G., Nicaud, J. M., 2001. Vectors for gene expression and amplification in the yeast Yarrowia lipolytica. Yeast. 18, 97-113. [0118] Kamzolova, S. V., Shishkanova, N. V., Morgunov, I. G., Finogenova, T. V., 2003. Oxygen requirements for growth and citric acid production of Yarrowia lipolytica. Fems Yeast Research. 3, 217-222.
[0119] Kanamasa, S., Dwiarti, L., Okabe, M., Park, E. Y., 2008. Cloning and functional characterization of the cis-aconitic acid decarboxylase (CAD) gene from Aspergillus terreus. Applied Microbiology and Biotechnology. 80, 223-229. [0120] Kautola, H., Rymowicz, W., Linko, Y. Y., Linko, P., 1991. Itaconic acid production by immobilized Aspergillus terreus with varied metal additions. Applied Microbiology and Biotechnology. 35, 154-158. [0121] Kinoshita, K., 1932. Über die Production von Itaconsäure and Mannit durch einem neuen Schimmelpilz Aspergillus itaconicus. Acta Phytochim. 5, 271-287. [0122] Li, A., Pfelzer, N., Zuijderwijk, R., Punt, P., 2012. Enhanced itaconic acid production in Aspergillus niger using genetic modification and medium optimization. Bmc Biotechnology. 12. [0123] Madzak, C., Gaillardin, C., Beckerich, J. M., 2004. Heterologous protein expression and secretion in the non-conventional yeast Yarrowia lipolytica: a review. Journal of Biotechnology. 109, 63-81. [0124] Madzak, C., Treton, B., Blanchin-Roland, S., 2000. Strong hybrid promoters and integrative expression/secretion vectors for quasi-constitutive expression of heterologous proteins in the yeast Yarrowia lipolytica. J. Mol. Microbiol. Biotechnol. 2, 207-216. [0125] Morgunov, I., Kamzolova, S., Lunina, J., 2013. The citric acid production from raw glycerol by Yarrowia lipolytica yeast and its regulation. Applied Microbiology and Biotechnology. 97, 7387-7397. [0126] Nuss, P., Gardner, K. H., 2013. Attributional life cycle assessment (ALCA) of polyitaconic acid production from northeast US softwood biomass. International Journal of Life Cycle Assessment. 18, 603-612. [0127] Okabe, M., Lies, D., Kanamasa, S., Park, E. Y., 2009. Biotechnological production of itaconic acid and its biosynthesis in Aspergillus terreus. Applied Microbiology and Biotechnology. 84, 597-606. [0128] Papanikolaou, S., Chatzifragkou, A., Fakas, S., Galiotou-Panayotou, M., Komaitis, M., Nicaud, J. M., Aggelis, G., 2009. Biosynthesis of lipids and organic acids by Yarrowia lipolytica strains cultivated on glucose. European Journal of Lipid Science and Technology. 111, 1221-1232. [0129] Papanikolaou, S., Muniglia, L., Chevalot, I., Aggelis, G., Marc, I., 2002. Yarrowia lipolytica as a potential producer of citric acid from raw glycerol. Journal of Applied Microbiology. 92, 737-744. [0130] Park, Y. S., Itida, M., Ohta, N., Okabe, M., 1994. Itaconic acid production using an air-lift bioreactor in repeated batch culture of Aspergillus terreus. Journal of Fermentation and Bioengineering. 77, 329-331. [0131] Pitula, J. S., Deck, K. M., Clarke, S. L., Anderson, S. A., Vasanthakumar, A., Eisenstein, R. S., 2004. Selective inhibition of the citrate-to-isocitrate reaction of cytosolic aconitase by phosphomimetic mutation of serine-711. Proceedings of the National Academy of Sciences of the United States of America. 101, 10907-10912. [0132] Rywinska, A., Musial, I., Rymowicz, W., Zarowska, B., Boruczkowski, T., 2012. Effect of agitation and aeration on the citric acid production by Yarrowia lipolytica grown on glycerol. Preparative Biochemistry & Biotechnology. 42, 279-291. [0133] Rywinska, A., Rymowicz, W., 2010. High-yield production of citric acid by Yarrowia lipolytica on glycerol in repeated-batch bioreactors. Journal of Industrial Microbiology & Biotechnology. 37, 431-435. [0134] Rywinska, A., Rymowicz, W., Zarowska, B., Wojtatowicz, M., 2009. Biosynthesis of Citric Acid from Glycerol by Acetate Mutants of Yarrowia lipolytica in Fed-Batch Fermentation. Food Technology and Biotechnology. 47, 1-6. [0135] Shao, Z., Zhao, H., Zhao, H., 2009. DNA assembler, an in vivo genetic method for rapid construction of biochemical pathways. Nucleic Acids Research. 37, e16. [0136] Tate, B. E., Itaconic acid and derivatives. In: Grayson, M., Eckroth, E., Eds.), Kirk-Othmer Encyclopedia of Chemical Technology, 1981, pp. 865-873. [0137] Tevz, G., Bencina, M., Legisa, M., 2010. Enhancing itaconic acid production by Aspergillus terreus. Applied Microbiology and Biotechnology. 87, 1657-1664. [0138] Tsai, Y. C., Huang, M. C., Lin, S. F., Su, Y. C., Method for the production of itaconic acid using aspergillus terreus solid state fermentation. Vol. U.S. Pat. No. 6,171,831 B1. National Science Council, United States, 2000. [0139] van der Straat, L., Vernooij, M., Lammers, M., van den Berg, W., Schonewille, T., Cordewener, J., van der Meer, I., Koops, A., de Graaff, L., 2014. Expression of the Aspergillus terreus itaconic acid biosynthesis cluster in Aspergillus niger. Microbial Cell Factories. 13, 11. [0140] Werpy, T., Petersen, G., Top Value Added Chemicals from Biomass: Volume I—Results of Screening for Potential Candidates from Sugars and Synthesis Gas. Vol. 1. U.S Department of Energy, 2004. [0141] Yahiro, K., Takahama, T., Park, Y. S., Okabe, M., 1995. Breeding of Aspergillus terreus Mutant TN-484 for Itaconic Acid Production with High Yield. Journal of Fermentation and Bioengineering. 79, 506-508.