Method for introducing a polynucleotide into non-adhesively growing plant cells

11261454 · 2022-03-01

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a method for introducing a polynucleotide into non-adhesively growing plant cells, comprising the following steps: providing a solid support having immobilized thereto the polynucleotide in dry state; contacting the plant cells with the polynucleotide on the solid support so as to obtain transformed plant cells; and optionally washing the plant cells.

Claims

1. A method for analyzing non-adhesively growing plant cells, comprising the following steps: i. providing a culture of non-adhesively growing plant cells in one or more wells of a multi-well plate, wherein each of said wells is characterized by a solid bottom surface; ii. adding a gelling substance to said non-adhesively growing plant cells; iii. centrifuging said multi-well plate, thereby arranging the non-adhesively growing plant cells in a monolayer in each of said one or more wells, at each of said solid bottom surfaces; iv. solidifying the gelling substance to form a gel in which said monolayer of non-adhesively growing plant cells is embedded so as to thereby immobilize each monolayer of non-adhesively growing plant cells at the solid bottom surface of each respective one or more wells; and v. detecting at least one parameter in said immobilized monolayer of non-adhesively growing plant cells in an automated manner by means of high-throughput, high-content, and high resolution microscopic analysis that includes the steps of automated image acquisition and automated image analysis using predetermined coordinates.

2. The method of claim 1, wherein said plant is selected from the group consisting of monocotyledonous plants, dicotyledonous plants, algae and mosses.

3. The method of claim 1, wherein said plant is a monocotyledonous plant.

4. The method of claim 3, wherein said monocotyledonous plant is maize.

5. The method of claim 1, wherein said non-adhesively growing plant cells are plant microspores.

6. The method of claim 1, wherein the gelling substance is selected from the group consisting of agar, κ-carrageenan, .Math.-carrageenan, alginic acid, alginate, agarose, furcellaran, jellan gum, glucono-δ-lactone, azotobactor vinelandii gum, xanthan gum, pectin, guar gum, locust bean gum, tara gum, cassia gum, glucomannan, tragacanth gum, karaya gum, pullulan, gum arabic, arabinogalactan, dextran, sodium carboxymethyl cellulose, methyl cellulose, cyalume seed gum, starch, chitin, chitosan, and curdlan.

7. The method of claim 1, wherein the gelling substance is low-melting temperature agarose.

8. The method of claim 1, wherein the gelling substance is alginic acid.

9. The method of claim 1, wherein said at least one parameter is selected from the group consisting of fluorescence, luminescence, transmitted white light, and combinations thereof.

10. The method of claim 1, wherein said at least one parameter is fluorescence.

11. The method of claim 1, wherein said at least one parameter is a combination of fluorescence and transmitted white light.

12. The method of claim 1, wherein said microscopic analysis comprises utilizing an automated microscope.

13. The method of claim 1, wherein said automated image analysis comprises cell identification.

14. The method of claim 13, wherein said automated image analysis further comprises cell classification.

15. The method of claim 13, wherein said microscopic analysis comprises analyzing cell segmentation.

16. The method of claim 13, wherein said microscopic analysis comprises analyzing cell morphology.

17. The method of claim 1, comprising automated sample manipulations by a pipetting or dispersing robot.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1. Illustration of main steps for transient transformation of cells in microwells using dried nucleic acids (Column A) and for cell immobilisation based on cell sedimentation and subsequent trapping at the bottom of microwells either in alginic acid medium (Column B) or low melting temperature gelling substances (Column C).

(2) FIG. 2. Alginate matrix formation after adding microdroplets of W5.

(3) FIG. 3. Development of tobacco leaf protoplasts using PME. Bright field (Panels A, C, E, G, I, K) and chlorophyll autofluorescence channel (Panels B, D, F, H, J, L) images were acquired with 24 h interval after embedding (Panels A, B). Scale bar=60 μm.

(4) FIG. 4. Effect of compound R113 do we need to disclose this compound as this will be subject of another patent application to be filed soon, Alternative: kinase inhibitor? on tobacco leaf protoplast development after 6 days of culture. Normal development of protoplasts cultured in F-PCN medium (Panel A) or in F-PCN with 1 μm of R113 (Panel B). Inhibition of cell divisions and colony formation in F-PCN medium supplemented with 10 μM of R113 (Panel C), complete inhibition of cell division and cell death in F-PCN supplemented with 25 μM of R113 (Panel D). Scale bar=60 μm.

(5) FIG. 5. Tracking of developing protoplasts from Arabidopsis seedlings. Images were acquired after 24 h (Panel A), 48 h (Panel B) and 96 h (Panel C) of culture using the PME-technique. Scale bar=40 μm.

(6) FIG. 6. Immobilization of protoplasts from DR5-GFP Arabidopsis marker line. Bright field (Panels A and C) and GFP channel (Panels B and D) images were acquired right after immobilization (Panels A and B) and after 72 h of culture (Panels C and D) demonstrating an increase in promoter activity in cells at later time point. Scale bar=40 μm.

(7) FIG. 7. Efficiency of transient transformation of Arabidopsis leaf protoplasts using dried DNA (FIG. 14, Table 3). Expression of mCherry protein driven under control of the rolD promoter was estimated after 24 h. Data represents mean values of three independent experiments, error bars indicate standard deviation.

(8) FIG. 8. Co-transformation of Arabidopsis protoplasts using dried and dissolved DNA.

(9) FIG. 9. Transient transformation of tobacco leaf protoplasts using dried DNA. Effect of transient expression of 35S:PIN8-Venus (FIG. 15) construct on protoplast development (Panels A-E). Arrow heads in bright field images (Panels A, C, E) mark positions of transiently transformed cells identified in YFP channel (Panels B, D) after 24 h (Panels A,B), 96n (Panels C,D) and 144 h (Panel E) of culture. Scale bar=60 μm. Panel F plots the efficiency of transient transformation of tobacco protoplasts using dried plasmid DNA: Column 1—1 μg of 35S:Venus, Column 2—2 μg of 35S:Venus (FIG. 16), Column 3—1 μg of 35S:ER-YFP, Column 4—2 μg of 35S:ER-YFP, Column 5—2 μg of 35S:Golgi-YFP, Column 6—2 μg of 35S:PIN1-Venus, Column 7—1 μg of 35S:PIN8-Venus, Column 8—2 μg of 35S:PIN8-Venus. All constructs except of PIN1 and PIN8 tagged with yellow fluorescent protein Venus were taken from Nelson et al. A multicoloured set of in vivo organelle markers for co-localization studies in Arabidopsis and other plants. Plant J 51, 1126-1136 (2006). Data represents mean values of three independent experiments, error bars indicate standard deviation.

(10) FIG. 10. Tracking and 3D reconstructions of developing tobacco protoplasts after the PME immobilization. Image were acquired with 24 h interval starting 24 h after PEG mediated DNA uptake. Different subcellular compartments where visualised using subcellular markers translationally fused to fluorescent proteins: cytoplasmic YFP (Panel A), mitochondrial YFP (Panel B), endoplasmatic reticulum mCherry (Panel C) and tonoplast mCherry (Panel D). All constructs were taken from Nelson et al. A multicoloured set of in vivo organelle markers for co-localization studies in Arabidopsis and other plants. Plant J 51, 1126-1136 (2006). Scale bar=40 μm.

(11) FIG. 11. Knock-down of a stable reporter gene (GFP) by artificial microRNAs (FIG. 14, Table 3). Mean absolute GFP pixel intensity of transformed cells over time (57±20 cells per sample per day).

(12) FIG. 12. Validation of artificial microRNAs efficiency by knock-down of the transiently expressed target gene, PIN1, translationally fused with the GFP (FIG. 14, Table 3). Transformed cells express the marker mCherry, PIN1:mGFP5 and an amiRNA; wt represents cells expressing only mCherry. Images were taken 2 days after transformation, asterisks indicate significant (*, p<0.05) or highly significant (**, p<0.0005) difference to miR.sup.319a sample; bars represent median pixel intensity values of the respective cell population; error bars correspond to standard error.

(13) FIG. 13. Expression of amiR.sup.PIN1 in stable transgenic lines (Col-0 wild-type background). A: Northern Blot analysis shows expression and processing of amiRNAs in several independent lines (upper panel). 5S rRNA serves as loading control (lower panel). DNA oligonucleotides antisense to the respective amiRNA and end-labelled with γ-ATP were used as probes. B-C: Representative phenotypes observed among independent lines transformed with the same construct. B: Altered phyllotaxis pattern of rosette leaves (arrows) in plants expressing amiR.sup.P1, amiR.sup.P2, amiR.sup.P3 and amiR.sup.P33 2 weeks after germination; scale bar=10 mm. C: Altered shoot phyllotaxis and pin1-like shoot phenotypes (arrows) in lines expressing amiR.sup.P1, amiR.sup.P2 and amiR.sup.P33 (scale bar=10 mm).

(14) FIG. 14. Map of amiRNA screening vector pMIR-AT1G73590-mGFP5-4 consisting of three screening elements under corresponding regulatory elements: the amiRNA gene (amiRNA and passenger amiRNA* sequences could be substituted according to Table 3), the target gene PIN1 fused to the reporter marker GFP (this expression element was present for the example 8, but not for the example 7) and the transformation marker mCherry. The nucleotide sequence of pMIR-AT1G73590-mGFP5-4 is shown in SEQ ID NO:1.

(15) FIG. 15. Map and sequence of the vector p2GW7,0-PIN8-Venus for expression of the PIN8-Venus construct. The nucleotide sequence of p2GW7,0-PIN8-Venus is shown in SEQ ID NO:2.

(16) FIG. 16. Map of the vector pAM-PAT-AtPIN1-Venus for expression of the PIN1-Venus construct. The nucleotide sequence of pAM-PAT-AtPIN1-Venus is shown in SEQ ID NO:3.

(17) FIG. 17. A scheme representing primer design for the PPTT experiment shown in Example 9.

(18) FIG. 18. Fluorescence microscopy analysis of transformation efficiencies using plasmid and PCR-expression cassettes in aqueous solution, 24 h after transformation (Example 9).

(19) FIG. 19. Concentration-dependent effect of auxin NAA on firefly/renilla ratio (Example 9)

(20) FIGS. 20A and 20B. Co-transformation (FIG. 20A) and single-product (FIG. 20B) PCR-based amiRNA screening strategies. All steps are applicable for automation.

(21) FIG. 21. Effect of PIN5 and PIN8 expression on tobacco leaf protoplast development. Transient PIN5 expression does not affect developmental program of tobacco leaf protoplasts, while expression of PIN8 arrests cell division and enhances elongation. Arrowheads indicate transformed cells. Scale bars are 20 μm.

(22) FIG. 22. Intracellular localization of AtPIN8-Venus in tobacco leaf protoplasts. Spinning-disk imaging at the cell periphery (Panel A) and inside the cell (Panel B) as well TIRF imaging near the plasma membrane (Panel C) proves ER localization of AtPIN8-Venus (Andromeda microscope, TILL Photonics GmbH, Germany). Scale bars are 5 μm.

(23) FIG. 23. Quantitative analysis of cell expansion between 2nd and 4th day of culture using tracking of cells expressing ER-mCherry marker, AtPIN5 and AtPIN8. Error bars represent 95% confidence intervals.

(24) FIGS. 24A and 24B. Quantitative analysis of PIN8 effect on auxin mediated cell expansion. Concentration-depended cell expansion takes place for developing protoplasts from wild type tobacco (FIG. 24A) and significant loss of auxin-mediated response in protoplasts isolated from AtPIN8-Venus overexpressing line (FIG. 24B). At least 200 cells per group were analyzed. Error bars represent standard errors.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

Definitions

(25) In the context of this disclosure, a number of terms and abbreviations are used. The following definitions are provided.

(26) “microRNA or miRNA” refers to oligoribonucleic acid, which regulates expression of a polynucleotide comprising the target sequence. microRNAs (miRNAs) are noncoding RNAs of about 19 to about 24 nucleotides (nt) in length that have been identified in both animals and plants which regulate expression of a polynucleotide comprising the target sequence. They are processed from longer precursor transcripts that range in size from approximately 70 to 2000 nt or longer, and these precursor transcripts have the ability to form stable hairpin structures. In plants, miRNAs usually have single, highly complementary target sites that mostly locate to coding regions. A miRNA is an “artificial miRNA” when it is genetically engineered. The artificial miRNA is thus predetermined to specifically target a single gene or multiple genes.

(27) “pri-miRNAs” or “primary miRNAs” are long, polyadenylated RNAs transcribed by RNA polymerase II that encode miRNAs. “pre-miRNAs” are primary miRNAs that have been processed to form a shorter sequence that has the capacity to form a stable hairpin and is further processed to release a miRNA.

(28) A “target gene” refers to a gene that encodes a target RNA, i.e., a gene from which a target RNA is transcribed. The gene may encode mRNA, tRNA, small RNA, etc. A “target sequence” refers to an RNA whose expression is to be modulated, e.g., down-regulated. The target sequence may be a portion of an open reading frame, 5′ or 3′ untranslated region, exon(s), intron(s), flanking region, etc.

(29) A “star sequence” or “miRNA* strand” is the complementary sequence within a miRNA precursor that forms a duplex with the miRNA. The complementarity of the star sequence does not need to be perfect.

(30) A new strategy developed using the knowledge on miRNA biology offered by combination of the advantages of RNAi and T-DNA insertion techniques. As plant miRNAs tend to show a high degree of sequence complementarity to their target RNA, several research groups assumed that miRNAs could be used for gene silencing studies. Based on different endogenous miRNA precursor sequences, they designed strategies to replace the 21-nucleotide stretch of the mature miRNA against a 21-nucleotide sequence complementary to a given target gene. By simultaneously exchanging the 21 nucleotides of the miRNA* strand, the stem-loop structure of the precursor was preserved and the processing resulted in a novel miRNA/miRNA* duplex against a chosen target gene. Their advantage lies in the specificity of sequence homology, based on the short length of only 21 nucleotides. They could therefore be applied for the knock-down of single as well as multiple genes with a single construct.

(31) A recombinant construct comprises an artificial combination of nucleic acid fragments, e.g., regulatory and coding sequences that are not found together in nature. The construct may be transcribed to form an RNA, wherein the RNA may be capable of forming a double-stranded RNA and/or hairpin structure. This construct may be expressed in the cell, or isolated or synthetically produced. The construct may further comprise a promoter, or other sequences which facilitate manipulation or expression of the construct.

(32) As used here “suppression” or “silencing” or “inhibition” are used interchangeably to denote the down-regulation of the expression of a product of a target sequence. If the suppression by an artificial miRNA is concerned, the degree of suppression by this artificial miRNA is determined relative to the same organism lacking the nucleic acid encoding the artificial miRNA (e.g. relative to a cell comprising the same target sequence which, however, lacks the nucleic acid sequence encoding the artificial miRNA). This “same organism” (e.g. a cell) should be identical to the test organism (cell) comprising the nucleic acid encoding the artificial miRNA, except that the nucleic acid sequence encoding the artificial miRNA to be tested is absent. Suppression includes expression that is decreased by at least about 10%, preferably by at least about 25%, more preferably by at least about 50%, more preferably by at least about 75%, most preferably by at least about 90%, e.g. by about 95% or about 100% relative to the same organism (e.g. a cell) which lacks the nucleic acid sequence encoding the artificial microRNA.

(33) As used herein, “encodes” or “encoding” refers to a DNA sequence which can be processed to generate an RNA and/or polypeptide.

(34) As used herein, “expression” or “expressing” refers to production of a functional product, such as, the generation of an RNA transcript from a DNA sequence. The term may also refer to a polypeptide produced from an mRNA generated from a DNA precursor. Thus, expression of a nucleic acid fragment may refer to transcription of the nucleic acid fragment and/or translation of RNA into a polypeptide.

(35) “Plant” includes reference to whole plants, plant organs, plant tissues, seeds and plant cells and progeny of same. Plant cells include, without limitation, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores. Preferably, the plant cells used herein are monocotyledonous or dicotyledonous plant cells, but also lower plants such as algae or mosses like Physcomitrella patens or else.

(36) An example of a monocotyledonous cell is a maize cell. Preferably, the plant cell is a dicot plant cell. Examples of dicot plant cells include soybean, rapeseed, sunflower, flax, cotton, barley, bean, pea, tobacco, and Arabidopsis.

(37) The term “introduced” means providing a nucleic acid (e.g., expression construct) or protein into a cell. Introduction of nucleic acid into plant cells is referred to herein also as “transformation”. The transformation may be transient or stable.

(38) Method for Introducing a Polynucleotide into Plant Protoplast Cells:

(39) According to a first aspect, the present invention pertains to a method for introducing a polynucleotide into plant protoplast cells, comprising the following steps: (a) providing a solid support having immobilized thereto the polynucleotide in dry state; (b) contacting the plant protoplasts with the polynucleotide on the solid support so as to obtain transformed plant protoplast cells; and (c) optionally washing the plant protoplasts.

(40) Preferably, the plant protoplast cells used herein are derived from monocotyledonous or dicotyledonous plants or lower plants. The phrase “derived from” means “obtained from” or “isolated from”. An example of a monocotyledonous plant is maize. Preferably, the plant protoplast cells are derived from dicotyledonous plants. Examples of dicotyledonous plants include soybean, rapeseed, sunflower, flax, cotton, barley, bean, pea, tobacco, and Arabidopsis. Most preferably, the plant protoplast cells are derived from Arabidopsis, e.g. Arabidopsis thaliana.

(41) Methods for isolating plant protoplast cells are known to the skilled person. Suitable protocols can be found in, e.g., Arabidopsis protocols, 2.sup.nd edition 2005 (Methods in molecular biology) edited by Julio Salinas and Jose J. Sanchez-Serrano (ISBN 978-1-61737-539-2); Davey and Anthony, Plant Cell Culture: Essential Methods, 1.sup.st ed. 2010, (ISBN 978-0470686485).

(42) The solid support may be made of any material which does not adversely affect the growth of plant protoplast cells. Preferably, the solid support does not contain tungsten or gold, or it does not consist of tungsten or gold. More preferably the solid support does not contain a metal, or it does not consist of a metal. The solid support is preferably made of a water-impermeable material. Suitable materials include, but are not limited to, glass, polystyrene, polypropylene, polycarbonate. Preferably, the solid support is suitable to allow one or more of optical absorbance, fluorescence and luminescence detection. Typically, the solid support comprises one or more planar or concave surfaces; and/or the solid support does not have a spherical form. In a preferred embodiment, the solid support has a plurality of locations, preferably cavities, where different polynucleotides may be immobilized. This embodiment is preferably a multi-well plate having a plurality of “wells” or “cavities”. At the bottom of the cavities, the surface is preferably planar or concave. Suitable types include multi-well culture plates in 6-, 12-, 24-, 48-, 96-, 384- or higher well formats. Preferred are 24-well plates, more preferred are 48-well plates, most preferred are 96-well plates. The nominal volume of each well is preferably from 0.1 ml to about 2 ml, most preferably it is about 0.5-1 ml.

(43) In a preferred embodiment, the polynucleotide is immobilized on the solid support by adding a solution containing the polynucleotide onto the solid support and removing the water from the solution on the solid support. The removal of the water can be achieved by letting evaporate the water over about 6-48 h, preferably over about 12-36 h, e.g. 24 h. This is preferably done under sterile conditions, e.g. under a sterile flow hood. Alternatively, the water may be removed by vacuum exsiccation.

(44) Typically, 0.1 μg to 10 μg, preferably 0.2 μg to 5 μg, more preferably 0.3 μg to 2 μg, most preferably 0.5 μg to 1.5 μg of (each) polynucleotide is added to the solid support or to each separate location of the solid support.

(45) The dried DNA immobilized on the solid support can be stored, e.g. at −20° C. or lower, for at least 1 month, e.g. for at least 2 or 3 or 4 or 5 or 6 months or 12 months or longer.

(46) The transformation step may comprise adding to the solid support a suspension comprising the plant protoplasts. The protoplasts are preferably suspended in a suitable medium that does not adversely affect or inhibit later transformation, e.g. TM550 (see Table 1 infra). As an example, the following medium can be used: 0.5 mM MES (salt-free), 15 mM MgCl.sub.2, 0.48 mM mannitol, pH 5.8 (TM550).

(47) The cell density in the protoplast suspension may range from about 1×10.sup.4 to about 1×10.sup.8, preferably from about 1×10.sup.5 to about 1×10.sup.7, more preferably from about 5×10.sup.5 to about 2×10.sup.5, most preferably it is about 1×10.sup.6 protoplast cells per ml. The suspension of non-adhesively growing plant cells may be added directly to the dried DNA on the solid support. Alternatively, the dried DNA may first be re-dissolved in a suitable solution, followed by addition of the cell suspension. Preferably, 10 μl to 500 μl, more preferably 20 μl to 200 μl, still more preferably 25 μl to 100 μl, most preferably 30 μl to 50 μl of protoplast suspension is added to the DNA, e.g. in a cavity of a multi-well plate.

(48) Afterwards the cells are arranged in a layer on the solid support. Typically, the cells are sedimented so as to arrange them in a layer on the solid support (e.g. at the bottom of a well or cavity of a multi-well plate). The term “sedimenting”, as used herein, includes actively sedimenting the cells by applying a centrifugal force to the cells, and passively sedimenting the cells, i.e. allowing the cells to sediment (settle) on the solid support by way of the normal gravity. The cells may be allowed to sediment for about 0.3 to 60 min, preferably for about 0.5 to 10 min, most preferably for about 1 to 2 minutes (passive sedimentation). Alternatively, protoplasts could be centrifuged for at least 30 seconds at least 2 g, e.g. for 1 min at 10 g (Active sedimentation). After the sedimentation step the cells are arranged in a layer, preferably a monolayer, on the solid support, e.g. at the bottom of a well or cavity of a multi-well plate.

(49) Next the transformation of the cells is effected, preferably by a chemically induced nucleic acid uptake. Suitable procedures are known to those of skill in the art (Negrutiu I, Shillito R, Potrykus I, Biasini G, Sala F (1987) Hybrid genes in the analysis of transformation conditions. I. Setting up a simple method for direct gene transfer in plant protoplasts. Plant Mol Biol 8: 363-373; Koop H U, Steinmüller K, Wagner H, Rössler C, Eibl C, Sacher L (1996) Integration of foreign sequences into the tobacco plastome via polyethylene glycol-mediated protoplast transformation. Planta, 199:193-201; Yoo S D, Cho Y H, Sheen J (2007) Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc 2:1565-1572). Preferably, a transformation agent is added to the protoplast suspension comprising the polynucleotide in order to induce nucleic acid uptake. The transformation agent may be polyethylene glycol (PEG) or another suitable agent which induces DNA uptake into protoplasts. Alternative transformation agents include poly-L-ornithine, polyvinyl alcohol and divalent ions. Preferably, the PEG is PEG 1500. The transformation agent is usually comprised in a solution which is added to protoplast suspension. For example, an equal volume of 40% PEG 1500 may be added to the protoplast suspension. A preferred composition to be added to the protoplast suspension is as follows: 67 mM Ca(NO.sub.3).sub.2.4H.sub.2O, 270 mM Mannitol, 384 g/I PEG1500, pH 9.75 (see also Table 1 infra).

(50) After addition, the suspension is preferably incubated for about 7 to 10 minutes. After that, TM550 may be added, preferably about 40 to 60% of the volume of the suspension (protoplasts+transformation agent composition) already present in the well. After about further 1 to 3 minutes, e.g. 2 minutes, a suitable solution (e.g. TM550) is added to increase the total volume to about 1 ml. The protoplasts may be washed once or several times with a suitable medium, e.g. TM550, in order to remove the transformation agent, e.g. PEG, and Ca.sup.2+ ions. After the washing, the transformed protoplasts may be resuspended in a suitable solution, e.g. PCA (see Table 2 infra).

(51) As mentioned supra, the solid support is preferably a multi-well plate. Accordingly, it is preferred that a plurality of different polynucleotides are immobilized in different wells of the plate, respectively. Preferably, the number of different polynucleotides on the same solid support is at least 2, more preferably at least 6, more preferably at least 12, most preferably at least 24, e.g. 48 or 96. It is important that each polynucleotide is spatially separated from the other polynucleotides. This is of course accomplished if each polynucleotide is immobilized at the bottom of a different well of a multi-well plate.

(52) The polynucleotide is preferably plasmid DNA. The polynucleotide may comprise various nucleic acid sequences encoding different products. Usually, the polynucleotide comprises a nucleic acid sequence encoding a transformation marker. Suitable transformation markers include fluorescent proteins, e.g. red fluorescent protein (“mCherry”) or green fluorescent protein (GFP). In another embodiment, the polynucleotide comprises a nucleic acid sequence encoding plant microRNA. In a preferred embodiment, the polynucleotide comprises a nucleic acid sequence encoding a plant microRNA, and a nucleic acid sequence encoding the corresponding target gene. In the most preferred embodiment, the polynucleotide comprises a nucleic acid sequence encoding an artificial microRNA, a nucleic acid sequence representing the target gene of the artificial microRNA, and a nucleic acid sequence encoding a transformation marker. These nucleic acid sequences are preferably present on a single DNA plasmid. Preferred embodiments of the nucleic acid sequences, of the vectors and plasmids that may be used are disclosed infra in respect of the method of screening. These embodiments apply to this first aspect of the invention mutatis mutandis.

(53) The DNA uptake method of this invention can be carried out in a fully automated manner. A particular advantage is that the plates having the dried DNA immobilized thereto can be stored and shipped for later use, without loss in transformation efficiency. Another important advantage is that only small amounts of a plasmid are required for foreign polynucleotides uptake.

(54) Monolayer Embedding of Non-Adhesively Growing Cells:

(55) In another aspect, this invention relates to an automated method for analyzing cells, comprising the following steps providing a culture of non-adhesively growing cells, preferably of plant protoplast cells; arranging the cells in a monolayer; immobilizing the cells in the monolayer; and detecting at least one parameter by microscopic analysis.

(56) The non-adhesively growing cells according to this aspect include animal cells, yeast cells and plant cells. Preferably, the non-adhesively growing cells are plant protoplast cells.

(57) Protoplasts can be isolated and cultured by known methods, see supra. The protoplast culture may be provided in wells of a multi-well plate as described supra with respect to the transformation method of the invention. The protoplasts may or may not be transformed. The protoplasts are then suspended in a suitable immobilization medium which comprises at least one gelling substance. A gelling substance is a substance that can convert a solution into a gel. The conversion from a solution into a gel may require cooling or addition of divalent metal ions such as Ca.sup.2+. The gelling substance may be a water-soluble polysaccharide. Gelling substances include but are not limited to agar, κ-carrageenan, .Math. carrageenan, alginic acid, alginate, agarose, furcellaran, jellan gum, glucono-δ-lactone, azotobactor vinelandii gum, xanthan gum, pectin, guar gum, locust bean gum, tara gum, cassia gum, glucomannan, tragacanth gum, karaya gum, pullulan, gum arabic, arabinogalactan, dextran, sodium carboxymethyl cellulose, methyl cellulose, cyalume seed gum, starch, chitin, chitosan, and curdlan. Preferred gelling substances according to this invention include but are not limited to low melting temperature agarose, agar and alginic acid (ratios and concentrations may vary upon species used, but are preferably Ca.sup.2+ free).

(58) The immobilization medium preferably contains mannitol and MES (2-[N-morpholino] ethane-sulfonic acid). The concentration of MES may range from 1 mM to about 100 mM, preferably from about 5 mM to about 50 mM, most preferably from about 10 mM to about 20 mM.

(59) The concentration of mannitol in the immobilization medium may range from 10 mM to 1 M, preferably it is from 100 mM to 500 mM. The immobilization medium may further comprise calcium chloride, magnesium chloride and/or magnesium sulfate at suitable concentrations. Preferred immobilization media are disclosed in the examples section.

(60) If alginic acid is used as a gelling substance the immobilization medium should not comprise Ca.sup.2+ ions. A suitable immobilization medium for alginic acid mediated embedding is described supra. If low melting temperature agarose or agar is used as gelling substance, the immobilization medium may contain calcium ions, e.g. at a concentration from 1 mM to 1 M preferably from 10 mM to 100 mM.

(61) If agarose is used as a gelling substance, the concentration of agarose in the immobilization medium is preferably from 1% (w/w) to 5% (w/w), preferably it is about 2% (w/w). If low melting temperature agarose is used, it is important to maintain the temperature above 30° C., preferably above 35° C. in order to avoid generation of agarose aggregates.

(62) The concentration of alginic acid in the immobilization medium is preferably from 0.5% (w/v) to 5% (w/v), more preferably from 1.5% (w(v) to 3% (w/v).

(63) Next a gravity force is applied to form a cell monolayer at the bottom of the multi-well slide or plate. This can be achieved either by allowing the cells to sediment (passive sedimentation), e.g. for at least 5 minutes, or by centrifugation for at least 30 seconds at 2 g or more, e.g. for 1 min at 10 g (active sedimentation).

(64) The cells are then trapped at the bottom of the solid support (multi-well plate or slide) by solidification of the gelling substance. This may be achieved by lowering the temperature to below 40° C., preferably to below 35° C., preferably to below 30° C. (in case of agar or agarose), or by adding a solution containing at least 10 mM Ca.sup.2+ salts at the top of the protoplasts mixed with the alginic acid containing medium as microdrops (≤5 μl or smaller) (in case of alginic acid as gelling substance). If alginic acid is used as a gelling substance, the gelling is induced by increasing the calcium concentration to at least 1 mM, preferably to at least 50 mM, more preferably to at least 125 mM.

(65) For further culture, a suitable culture medium may be added on top of the gels formed, e.g. to the nominal filling volume of the well. The immobilized protoplast cells can be further cultured in their immobilized state by adding suitable media on top of the solidified protoplast composition. Similarly, the immobilized in that way protoplasts are accessible to exposure of any test substances in this stage, i.e. prior to analysis.

(66) The method according to this aspect of the invention therefore comprises in a specific embodiment the step of contacting the immobilized protoplast cells with a test compound, and determining the effect of the test compound on the protoplast cells. This is preferably done by (i) determining at least one parameter of the cells in the presence of test compound, (ii) determining at least one parameter of the cells in the absence of test compound, and (iii) comparing the parameters determined in (i) and (ii).

(67) The parameters are usually determined by microscopy and include, but are not limited to, fluorescence, morphology and combinations thereof. Methods of microscopy include, but are not limited to, those described in, e.g., Hasek J, Streiblová E. Fluorescence microscopy methods. Methods Mol Biol 53, 391-405 (1996), Ehlert A, Weltmeier F, Wang X, Mayer C S, Smeekens S, Vicente-Carbajosa J, Dröge-Laser W. Two-hybrid protein-protein interaction analysis in Arabidopsis protoplasts: establishment of a heterodimerization map of group C and group S bZIP transcription factors. Plant J 46, 890-900 (2006), Bücherl C, Aker J, de Vries S, Borst J W. Probing protein-protein Interactions with FRET-FLIM. Methods Mol Biol 655, 389-399 (2010).

(68) The method of this aspect of the invention is preferably combined with a preceding transformation of the protoplast cells prior to embedding/immobilization. In that embodiment, the method may comprise expression of transformed nucleic acid sequence(s) and determining the effect of that expression on the cells. Preferably, the polynucleotide transformed is one as defined above in respect of the method for introducing polynucleotides into plant protoplast cells according to the first aspect of the invention.

(69) All steps can be carried out in a fully automated manner, e.g. by using pipetting and dispersing robots known in the art.

(70) Any preferred embodiments described supra in respect of the method for introducing polynucleotides into plant protoplast cells can be applied to this aspect mutatis mutandis.

(71) miRNA Screening Method:

(72) Yet another aspect of the invention is a screening method to identify efficient plant microRNA sequences, comprising the following steps: introducing a plasmid into plant protoplast cells so as to obtain transformed plant protoplast cells, wherein said plasmid comprises a nucleic acid sequence encoding a candidate artificial microRNA, a nucleic acid sequence representing the target gene of the candidate artificial microRNA, and optionally a nucleic acid sequence encoding a transformation marker; culturing the transformed plant protoplast cells under conditions that allow expression at least of the nucleic acid sequence encoding the candidate artificial microRNA, and of the nucleic acid sequence representing the target gene of the candidate artificial microRNA; selecting as efficient microRNA that candidate artificial microRNA sequence which is capable of efficiently inhibiting expression of the target gene.

(73) The method is preferably carried out in combination with the method for introducing polynucleotides into plant protoplast cells described herein. All embodiments described above apply to this screening method as well.

(74) The screening method uses a vector comprising a nucleic acid sequence encoding a candidate artificial microRNA, a nucleic acid sequence representing the target gene of the candidate microRNA, and a nucleic acid sequence encoding a transformation marker. These components are present on a single vector. This avoids the need for transformation of multiple plasmids or the like. Typical elements of plant transformation plasmids may also be included in the plasmid used in accordance with this invention.

(75) Preferably, the three main elements of the vector, (i) the nucleic acid sequence encoding the candidate artificial microRNA, (ii) the nucleic acid sequence representing the target gene of the candidate microRNA (“the target sequence”), and (iii) the nucleic acid sequence encoding the transformation marker are expressed in the protoplast cell. Efficient expression can be achieved by using a suitable promoter operably linked to the respective nucleic acid sequence. Various promoters can be used. The promoter may also contain, if desired, a promoter regulatory region (e.g., one conferring inducible, constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific/selective expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal. Constitutive, tissue-preferred or inducible promoters can be employed. Examples of constitutive promoters include the cauliflower mosaic virus (CaMV) 35S transcription initiation region, the 1′- or 2′-promoter derived from T-DNA of Agrobacterium tumefaciens, the ubiquitin 1 promoter, the Smas promoter, the Nos promoter, the pEmu promoter, the rubisco promoter, the GRP1-8 promoter and other transcription initiation regions from various plant genes known to those of skill.

(76) The artificial candidate microRNA may be designed on the basis of known design tools, e.g. that described in Ossowski, S., Schwab, R. & Weigel, D. Gene silencing in plants using artificial microRNAs and other small RNAs. Plant J 53, 674-690 (2008). However, it surprisingly turned out that only a small fraction of the so designed microRNAs were efficient in silencing the target gene. Thus, there is a need for a screening process in order to identify microRNA sequences which are actually efficient in silencing a given target molecule.

(77) Target sequences may include coding regions and non-coding regions such as promoters, enhancers, terminators, introns and the like. Preferably, target sequences are located within coding regions.

(78) The transformation marker is used to label cells that have been successfully transformed. Suitable transformation markers used in the invention include, but are not limited to, any fluorescent proteins, e.g. those described in Shaner, N.C. et al. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol 22, 1567-1572 (2004).

(79) The nucleic acid encoding the target sequence is preferably fused to a nucleic acid encoding a marker, e.g. a fluorescent protein such as green fluorescent protein, a luminescent protein such as luciferase, or an enzyme which catalyzes a detectable reaction. This “target marker” can then be detected as a measure of the level of expression of the target sequence. If the target gene is an enzyme, it may be possible that the expression product of the target gene is the target marker itself.

(80) The method thus comprises in a preferred embodiment the steps of: determining the expression of the “target marker”, comparing the level of expression of the target marker to that of a control cell, e.g. a protoplast cell transformed with a control vector comprising a nucleic acid sequence encoding a mock artificial miRNA or with a control vector lacking a nucleic acid sequence encoding the candidate miRNA sequence, and selecting the candidate miRNA sequence as efficient miRNA sequence if the level of expression of the target marker in the cell transformed with the vector encoding the candidate miRNA is significantly lower (e.g. by at least 10%, preferably by at least 25%, more preferably by at least 50%, most preferably by at least 75% or at least 90%) than that in the control cell transformed with the control vector.

(81) The present screening method can be advantageously combined with the other aspects of the invention, namely the method for introducing a polynucleotide into plant protoplast cells, and the immobilization/embedding technique described supra.

(82) A particular embodiment, which is applicable to all aspects of the present invention, includes the use of PCR products for transformation, preferably for transient transformation. In the methods of the invention the polynucleotide or DNA to be transformed may therefore be a PCR product comprising the DNA of interest, preferably a promoter, an open reading frame, and a terminator. The PCR product is directly used for transformation without cloning it into a plasmid or vector. Most preferably, the polynucleotide or DNA to be transformed consists of a promoter, an open reading frame, and a terminator. That is, the PCR product contains substantially no flanking regions. The advantage is that such PCR product will lead to much higher transformation efficiencies than PCR products including flanking regions (see Example 9).

(83) The use of PCR products for transformation is advantageous as it is much faster than the classical cloning approach involving the use of plasmids for transformation. This embodiment is therefore particularly suited for automated methods and high-throughput processes.

EXAMPLES

(84) Some media and solutions used in the examples are listed in the following tables:

(85) TABLE-US-00001 TABLE 1 Solutions for protoplast isolation and immobilization. Unit is mM, pH 5.8-5.83 unless indicated otherwise.″ PEG Alg-A W5.sup.c TM550 MMC600 MSC600 Alginic acid 2.8% (w/v) MES 10 mM  5 mM 10 mM 10 mM CaCl.sub.2•2H.sub.20 125 mM 20 mM 20 mM Ca(NO.sub.3).sub.2•4H.sub.20  67 mM Glucose  5 mM KCl  5 mM MgCl.sub.2•6H.sub.20 10 mM 15 mM MgSO.sub.4•7H.sub.2O 10 mM Mannitol.sup.a 270 mM 550 mOsm  550 mOsm  600 mOsm NaCl 150 mM Sucrose.sup.b  600 mOsm PEG1500 (g/l) 384.6 .sup.aapproximately 90 g for 1 l of medium give 550 mOsm; .sup.bapproximately 165 g for 1 l of medium; .sup.caccording to Menczel et al. Effect of radiation dosage efficiency of chloroplast transfer by protoplast fusion in Nicotiana. Genetics 100, 487-495 (1982)

(86) TABLE-US-00002 TABLE 2 Plant culture, preplasmolysis and culture protoplasts media. Unit is mg/l unless indicated otherwise, pH 5.8-5.83 F-PIN.sup.a F-PCN.sup.b SCN.sup.c PCA.sup.d SCA.sup.e KNO.sub.3 1012 1012 2527.5 2527.5 2527.5 CaCl.sub.2•2H.sub.20 640 640 150 450 150 MgSO.sub.4•7H.sub.2O 370 370 246.5 746 1140 KH.sub.2PO.sub.4 170 170 NaH.sub.2PO.sub.4•H.sub.20 150 150 150 (NH.sub.4).sub.2SO.sub.4 134 134 134 NH.sub.4-succinate (mM) 20 20 EDTAFe(III) Na Salt 40 40 40 40 40 KI 0.83 0.83 0.75 0.75 0.75 H.sub.3BO.sub.3 6.2 6.2 3 3 3 MnSO.sub.4•H.sub.20 22.3 22.3 10 10 10 ZnSO.sub.4•7H.sub.20 8.6 8.6 2 2 2 Na.sub.2MoO.sub.4•2H.sub.20 0.25 0.25 0.25 0.25 0.25 CuSO.sub.4•5H.sub.20 0.025 0.025 0.025 0.025 0.025 CoCl.sub.2•6H.sub.20 0.025 0.025 0.025 0.025 0.025 Inositol 200 200 100 200 100 Pyridoxine-HCl 2 2 1 2 1 Thiamin-HCl 1 1 10 1 10 Ca-panthotenate 2 2 2 Biotin 0.2 0.2 0.2 Nicotinic acid 2 2 1 2 1 MES 976 976 976 Sucrose 130 20 20 15 Glucose 65 80 Coconut water (ml) 20 BAP 1 1 Dicamba 4 NAA 0.1 0.1 0.5 Agar (g) 8 Gelrite (g) 2 .sup.a,b,caccording to Dovzhenko et al. (1998) Protoplasma 204, 114-118 .sup.d,eaccording to Dovzhenko et al. (2003) Protoplasma 222, 107-111

(87) TABLE-US-00003 TABLE 3 Artificial miRNAs (amiR) and their passenger strands (amiR*) amiR (5′-3′) SEQ ID NO: amiR* (5'-3') SEQ ID NO: P1 TAAGCGAATATATCTCAGCGC 136 GCACTGAGATATAATCGCTTT 137 P2 TAAGCGAATATATCTCAGGGT 132 ACACTGAGATATAATCGCTTT 133 P3 TAAATTACCATACATGCCTCT 128 AGCGGCATGTATGCTAATTTT 129 P4 TTTGGGCGAAAACATCCCTCG 124 CGCGGGATGTTTTGGCCCAAT 125 P5 TTCGAGTAAATATCGGACGTT 120 AAAGTCCGATATTAACTCGAT 121 P6 TTCGAGTAAATATCAGACGTT 116 AAAGTCTGATATTAACTCGAT 117 P7 TTTAAAACTAGAGCCACGCGG 112 CCACGTGGCTCTACTTTTAAT 113 P8 TAAAGTTAGAGTTCCGACGAC 108 GTAGTCGGAACTCAAACTTTT 109 P9 TGATTACGAATAAGTTTCCTG 104 CAAGAAACTTATTGGTAATCT 105 P10 TAAGCGAATATATCTCGGCGC 100 GCACCGAGATATAATCGCTTT 101 P11 TAACGTGGTAGAAGTGCGCGG  96 CCACGCACTTCTAGCACGTTT  97 P12 TGATGCCGAATAAACTGGAGC  92 GCCCCAGTTTATTGGGCATCT  93 P13 TTAGCCGTCATAACGTGGTGG  88 CCCCCACGTTATGTCGGCTAT  89 P14 TTAGCCGTCATAACGTGGCAG  84 CTACCACGTTATGTCGGCTAT  85 P15 TTAGCCGTCATAACGTGGTAC  80 GTCCCACGTTATGTCGGCTAT  81 P16 TAAAGTTAGAGTTCCGACCGC  76 GCAGTCGGAACTCAAACTTTT  77 P17 TATAATGGCAACATGGGGGGG  72 CCACCCCATGTTGGCATTATT  73 P18 TATAATGGCAACATGCAGGGG  68 CCACTGCATGTTGGCATTATT  69 P19 TAACGTGGTAGAAGTCCGCGG  64 CCACGGACTTCTAGCACGTTT  65 P20 TAAAACTAGAGCCACGTGCCG  60 CGACACGTGGCTCAAGTTTTT  61 P21 TTATAACGGAACCATAGCCCT  56 AGAGCTATGGTTCGGTTATAT  57 P22 TTGATGCCGAATAAACTGCAG  52 CTACAGTTTATTCCGCATCAT  53 P23 TGATTACGAATAAGTTTCCTC  48 GAAGAAACTTATTGGTAATCT  49 P24 TCCAAAGTTAGAGTTGCGACG  44 CGCCGCAACTCTATCTTTGGT  45 P25 TTATAACGGAACCATAGGCCT  40 AGACCTATGGTTCGGTTATAT  41 P26 TATGATTAAAACTACAGCCGC  36 GCAGCTGTAGTTTAAATCATT  37 P27 TATAATGAAACCTCCCAGGTC  32 GAACTGGGAGGTTACATTATT  33 P28 TTTAAAACTAGAGCGACGCGG  30 CCACGTCGCTCTACTTTTAAT  31 P29 TAAATTACCATACATGCCTTT  26 AACGGCATGTATGCTAATTTT  27 P30 TATGACGGCAGGTCGAACGAG  22 CTAGTTCGACCTGGCGTCATT  23 P31 TTTACCGAAACTAAACTGCTC  18 GAACAGTTTAGTTACGGTAAT  19 P32 TTTGGGCGAAAACATCCCTGC  14 GCCGGGATGTTTTGGCCCAAT  15 P33 TACGATTTGAACCATGAGGCC  10 GGACTCATGGTTCTAATCGTT  11 P34 TAACGGTTTATGCCGCAGCGT   8 ACACTGCGGCATATACCGTTT   9 P35 TGTTGGGCGAAAACATCCGTG   4 CAAGGATGTTTTCCCCCAACT   5 P36 TAATATCAGACCTTGGAGCGT 138 ACACTCCAAGGTCAGATATTT 139 P37 TCCAAAGTTAGAGTTCCGACG 134 CGCCGGAACTCTATCTTTGGT 135 P38 TTTATGGGCAACGCGACCGAC 130 GTAGGTCGCGTTGGCCATAAT 131 P39 TAACGGTTTATGCCCGAGCGT 126 ACACTCGGGCATATACCGTTT 127 P40 TAATATCAGACCTTCAAGCGT 122 ACACTTGAAGGTCAGATATTT 123 P41 TATGACTAGAGTGTTGCGGGG 118 CCACGCAACACTCAAGTCATT 119 P42 TTAGTTGGAAGGTCTCGGACT 114 AGCCCGAGACCTTGCAACTAT 115 P43 TTCGTTACTATTCCCCTGACG 110 CGCCAGGGGAATACTAACGAT 111 P44 TTTATGGGCAACGCGGTCGAC 106 GTAGACCGCGTTGGCCATAAT 107 P45 TATGACGGCAGGTCGAACGGC 102 GCAGTTCGACCTGGCGTCATT 103 P46 TGAAGAGTTATGGGCAACGGG  98 CCAGTTGCCCATATCTCTTCT  99 P47 TGTGGAGTAATCGGCGTGCTG  94 CAACACGCCGATTTCTCCACT  95 P48 TATGACTAGAGTGTTCGGGGG  90 CCACCGAACACTCAAGTCATT  91 P49 TGAAGAGTTATGGGCGACCCG  86 CGAGTCGCCCATATCTCTTCT  87 P50 TAGATTCGAAGGTCTACGTCT  82 AGCCGTAGACCTTGGAATCTT  83 P51 TAACGTGGTAGAAGTCCCGCG  78 CGAGGGACTTCTAGCACGTTT  79 P52 TTCGAGTAAATATCAGGCCCT  74 AGAGCCTGATATTAACTCGAT  75 P53 TGTTGGGCGAAAACGTCCGTG  70 CAAGGACGTTTTCCCCCAACT  71 P54 TAAAGTTAGAGTTCGGACCGC  66 GCAGTCCGAACTCAAACTTTT  67 P55 TAACGTGGTAGAAGTGCGCGG  62 CCACGCACTTCTAGCACGTTT  63 P56 TGGAAAGAGAGGAGTGGGACG  58 CGCCCCACTCCTCACTTTCCT  59 P57 TGGACGGCGAAGACGGCGACA  54 TGCCGCCGTCTTCCCCGTCCT  55 P58 TGTCATCACACTTGTTGGCGG  50 CCACCAACAAGTGAGATGACT  51 P59 TTGAAGTGGAAAGACAGGACT  46 AGCCCTGTCTTTCGACTTCAT  47 P60 TTCCGGAGCATTGGTCGGGAG  42 CTACCGACCAATGGTCCGGAT  43 P61 TACTGAACATAGCCATGCCTA  38 TAAGCATGGCTATCTTCAGTT  39 P62 TTGAAGTGGAAAGAGACGACT  34 AGCCGTCTCTTTCGACTTCAT  35 GFP-6 TTCTGGTAAAAGGACAGGGCC  28 GGACCTGTCCTTTAACCAGAT  29 GFP-7 TTAATGATCAGCGAGTTGCAC  24 GTACAACTCGCTGTTCATTAT  25 GFP-9 TTGTATTCCAACTTGTGGCCG  20 CGACCACAAGTTGCAATACAT  21 GFP-10 TGATCAGCGAGTTGCACGCCG  16 CGACGTGCAACTCCCTGATCT  17 GFP-11 TTGACTTCAGCACGTGTCTTG  12 CACGACACGTGCTCAAGTCAT  13 mock TATCATAAGAGCAGGTCCTGA   6 TCCGGACCTGCTCATATGATT   7

Example 1. Monolayer Embedding of Tobacco Leaf Protoplasts for Continuous Cell Tracking

(88) Wholly expanded leaves from 3-4 weeks old tobacco plant cultures (Nicotiana tabacum cv. Petite Havana) were used for protoplast isolation. Two leaves were cut in stripes 1-2 mm in width and preplasmolysed for 1 h in 10 ml of F-PIN medium as described in Dovzhenko et al. (1998) Protoplasma 204, 114-118. Preplasmolysis medium was replaced with 10 ml of fresh F-PIN supplemented with Cellulase Onozuka R-10 (DUCHEFA) and Macerozyme Onozuka R-10 (DUCHEFA) 0.25% each. Digestion was performed overnight (14 h) in the dark. Digestion medium was further filtered through 100 μm sieves in 12 ml tube (Greiner, Germany) to remove non-digested tissues. Afterwards 2 ml of TM550 were overlaid on a top of filtered F-PIN containing protoplasts. Intact protoplasts were collected from the interlayer between TM550 and protoplast/digestion mixture after 10 min flotation at 100 g and transferred to a new tube. Total volume was adjusted to 10 ml with W5 medium and protoplast number was estimated. Protoplasts were further pelleted for 5 min at 100 g and supernatant was discarded. After the last centrifugation step protoplast pellet was mixed with TM550 to achieve density of 2.10.sup.4 cells per 1 ml. Protoplasts/TM550 mixture was further mixed at ratio 1:1 with Alg-A medium for Ca.sup.2+-alginate embedding or with TM550 containing 2% of low melting temperature agarose for agarose embedding. It is important to maintain temperature above 30° C. (recommended 35° C.) until formation of a cell layer at a well bottom and to avoid generation of agarose aggregates.

(89) For cell immobilisation using low melting temperature agarose 100 μl or 200 μl of protoplast embedding mixture per were transferred into 96-well plates or 8-well slides respectively (FIG. 1, A, 1). After formation of cell layers at 30-35° C. achieved either by centrifugation for at least 1 min at 10 g or by sedimentation for at least 20-30 min (FIG. 1, A, 2) plates can be placed at room temperature for agarose solidification (FIG. 1, A, 3). Embedded cells should be washed twice for 15 min with the culture F-PCN medium and 200 μl of fresh F-PCN were added after the last washing (FIG. 1, A, 4). It is important to note, that within first 24 h of culture mild expansion of agarose gel with embedded cells was not avoidable due to long lasting water uptake from the culture medium.

(90) For cell immobilisation using Ca.sup.2+-alginate embedding 100 μl or 200 μl of protoplast embedding mixture per were transferred into 96-well plates or 8-well slides respectively (FIG. 1, B, 1). To form a cell layer protoplasts could be either centrifuged at 10 g for at least 1 min or sedimented for at least 20-30 min (FIG. 1, B, 2). Afterwards the upper surface of the protoplast embedding mixture was covered with 20 μl or 40 μl for 96-well plates or 8-well slides respectively of W5 or another osmotically adjusted solution with a high Ca.sup.2+-salt (≥20 mM) content in a form of micro-droplets 1 μl droplets if manually or 100-500 nl droplets if using dispersing robots, FIG. 1, B, 3; FIG. 2). After 5 min final volume of W5 medium was adjusted to 200 μl and after additional at least 15 min cell immobilisation was achieved (FIG. 1, B, 4). W5 medium was replaced with 200 μl of the culture F-PCN medium for washing. After two washings, 200 μl of fresh F-PCN were added for subsequent protoplast culture (FIG. 1, B, 5). Embedded cells were observed with 24 h interval and their development was documented by imaging of the same area using inverted microscope (Axiovert 200M, Zeiss) for a period of 1 week (FIG. 3). Due to formation of a single cell layer at the bottom of culture wells and subsequent immobilization this technique was named protoplast-monolayer-embedding technique (PME).

Example 2. Effect of R113 Compound on Development of Tobacco Leaf Protoplasts

(91) Protoplast isolation was done as described in the example 1 prior the washing with the culture medium. Cell immobilisation was performed in 8-well slides (IBIDI). After the removal of W5 medium, F-PCN with various concentration of compound R113 per well was used for washing and further cell culture. Analysis of cell division efficiency (FIG. 4) was performed using inverted microscope (Axiovert 200M, Zeiss).

Example 3. Monolayer Embedding of Arabidopsis Protoplasts for Continuous Cell Tracking

(92) Arabidopsis protoplasts were isolated from hypocotyls of 7-days old Arabidopsis seedlings (Col-0) germinated on SCA medium according to Dovzhenko et al. (2003) Protoplasma 222, 107-111. Explants were cut in 0.5-1 mm fragments and preplasmolysed in MMC600 for 1 h. Afterwards the medium was substituted with fresh MMC600 supplemented with 0.5% Cellulase Onozuka R-10 (DUCHEFA), 0.5% Macerozyme Onozuka R-10 and 0.05% Driselase (SIGMA). After 14 h of digestion, protoplast containing medium was filtered through 32 μm sieves. Protoplasts containing medium was further mixed with an equal volume of TM550 and collected by centrifugation for 10 min at 100 g. Supernatant was removed and the pellet was mixed with TM550:Alg-A mixture (1:1) to achieve density 1.10.sup.4 protoplasts per 100 μl. 100 μl aliquots of protoplast embedding mixture were transferred in 96-well plate and immobilized as described in the example 1. After the removal of W5 medium, PCA medium was used for washing and culture steps. Cell observations (FIG. 5) were done using inverted microscope (Axiovert 200M, Zeiss).

Example 4. Analysis of Promoter Activity Using Monolayer Embedding

(93) Cotyledons from 7-days old Arabidopsis seedlings (DR5-GFP line, Col-0 background) were removed and cut in 0.5-1 mm fragments. Preplasmolysis and digestion was performed as describe in the example 3, however no Driselase was used for digestion. After filtration through 56 μm sieves, protoplasts were collected in 12 ml tube and pelleted for 10 min at 100 g. Supernatant was discarded and 10 ml of MSC600 was added. For flotation 2 ml of TM550 were overlayed on a top of MSC600 and centrifuged for 10 min at 100 g. Interlayer was collected and transferred into a new 12 ml tube. Total volume was adjusted to 10 ml with W5 medium. Protoplasts were washed for 5 min at 50 g and afterwards pellet was resuspended in TM550 to achieve density 2.Math.10.sup.4 protoplasts per 100 μl. After mixing 1:1 with Alg-A medium, 100 μl aliquots of protoplast embedding mixture were used for cell immobilisation in 96-well plates. Immobilisation and subsequent culture procedure were performed as described in example 3. While GFP fluorescence was detected only in 3% of freshly isolated protoplasts, it was observed in over than 95% of intact cells after 48 h of culture thus demonstrating activity of DR5 promoter (FIG. 6).

Example 5. Transient Transformation of Arabidopsis Shoot Protoplasts Using Dried DNA

(94) Purified plasmid DNA was dissolved in ultra-pure sterile water. Aliquots of aqueous DNA solution at various concentrations (0, 0.1, 0.5, 1 and 5 μg per 10 μl) were transferred inside 96-well plate (ABIGene). Water evaporation took place under the sterile bench overnight (FIGS. 1, C, 1 & 2). After complete evaporation plates could be used either immediately or stored at −20° C.

(95) Arabidopsis shoots from 3-weeks old seedlings (Col-0) were used. Digestion and isolation were performed as described in example 4. After last washing step cell density was adjusted to 1×10.sup.5 and aliquots of 30 μl were transferred into the wells containing dried DNA (FIG. 1, C, 3). Afterwards cells were left to sediment for at least 2 min (FIG. 1, C, 4). Alternatively, protoplasts could be centrifuged for 1 min at 10 g. Further PEG-mediated DNA uptake was performed by adding an equal volume of 40% PEG1500 solution to protoplasts in wells (FIG. 1, C, 5). After 8 min of the PEG treatment, a half of the total volume of TM550 was added and after additional 2 min total volume was increased to 1 ml using TM550 (FIG. 1, C, 6). To avoid formation of protoplast-aggregates, well contents were mixed using 1 ml 8-well pipette. Sedimentation for at least 30 min was performed to collect cells. Alternatively, protoplasts could be centrifuged for 10 min at 50 g. Supernatant (950 μl) was discarded and protoplast pellet was resuspended in 300 μl of PCA. Transformation efficiencies (FIG. 7) were estimated after 30 hours using inverted microscope (Axiovert 200M, Zeiss).

(96) Co-transformation with at least two (or more) either plasmids or PCR amplified fragments was performed. Plasmids carrying expression cassette of GFP or endoplasmic reticulum-mCherry were either mixed and dried upon water evaporation under a sterile bench inside 96-well plates or mixed and used directly for transformation. Transformation was carried out as described above. Equal amount of each plasmid was used (0.5 μg per plasmid). To simulate a simple pipetting robot, all manipulations (adding cells, adding reagents prior washing step after transformation) were performed by using multichannel pipette. Cells were added directly to wells containing either dried DNA or DNA dissolved in water and no further mixing was performed prior adding PEG1500 solution. Comparison of transformation and co-transformation efficiencies was performed after 24 h. Images were acquired using iMIC (TILL Photonics, Germany) automated microscope, and image analysis was performed using ImageJ free software. At least 250 cells per individual transformation were analysed (Table 4).

(97) TABLE-US-00004 TABLE 4 Analysis of GFP and ER-mCherry co-transformation efficiencies using dried DNA or DNA dissolved in water. Each line represents one transformation experiment. Co-transformed cells out Co-transformed cells out of all transformed, % of all cells, % Dried DNA DNA in solution Dried DNA DNA in solution 92.41 88.0 20.33 6.1 85.15 86.0 12.76* 5.9 94.12 85.7 21.05 7.2 92.31 91.6 20.47 13.9 91.39 88.4 19.11 13.4 92.41 84.6 18.31 17.6 96.2 34.2 93.5 42.1 87.7 31.2 *wrong amount of PEG (~½ of required volume) was added during this transformation, due to defect of pipette's channel

(98) Significant variation of co-transformation efficiencies was observed using DNA dissolved in water, while using dried DNA approach highly reproducible results could be obtained (FIG. 8). This criteria is essential for automation of the whole procedure.

Example 6. Transient Transformation of Tobacco Leaf Protoplasts Using Dried DNA in Combination with Continuous Cell Tracking

(99) Plasmid DNA aliquots (1 μg per 10 μl of ultrapure water) were dried as described in the example 5 (FIG. 1, C).

(100) Tobacco leaf protoplasts were isolated as described in the Example 1 prior the embedding procedure. After protoplast pelleting in W5 medium and removal of the supernatant, cell density was adjusted to 2.Math.10.sup.6 cells/ml with TM550. Aliquots of 30 μl (2-2.5.Math.10.sup.5 cells) were transferred into the wells using 8-channel pipette. Afterwards cells were left to sediment for at least 2 min. Alternatively, protoplasts could be centrifuged for 1 min at 10 g. Further PEG-mediated DNA uptake was performed by adding an equal volume of 40% PEG1500 solution to protoplasts in wells. After 8 min of the PEG treatment, a half of the total volume of TM550 was added and after additional 2 min total volume was increased to 1 ml using TM550. To avoid formation of protoplast-aggregates, well contents were mixed using 1 ml-tip pipette. Sedimentation for at least 30 min was performed to collect cells. Alternatively, protoplasts could be centrifuged for 10 min at 50 g. Supernatant (950 μl) was discarded and protoplast pellet was resuspended in 250 μl of TM550. Protoplasts were further mixed with Alg-A medium for embedding. Embedding was further performed as described in the example 1 (FIG. 1, B). After the embedding transformation efficiencies, protein localisation and effect of gene expression was analysed using automated inverted microscope (iMIC or MORE, TILL Photonics, FIG. 9) and confocal laser scanning microscope (LSMSMETA, Zeiss, FIG. 10).

Example 7. RNAi-Mediated Gene Knock-Down Using Artificial miRNAs

(101) Arabidopsis shoots from 3-weeks old seedlings (35S:GFP in Col-0 background) were used. Digestion and isolation were performed as described in example 4. After last washing step cell density was adjusted to 1.Math.10.sup.5 and aliquots of 30 μl were transferred into 96-well plate. 1-2 μg DNA in 5 μl of ultra-pure sterile water was mixed with protoplasts. PEG-mediated DNA uptake was performed by adding an equal (35 μl) volume of 40% PEG1500 solution. After 8 min of the PEG treatment, a half of the total volume of TM550 was added and after additional 2 min total volume was increased to 1 ml using TM550. After careful mixing with 1 ml pipette for separation of protoplast aggregates, sedimentation for at least 30 min was performed to collect cells. Supernatant (950 μl) was discarded and protoplast pellet was resuspended in 75 μl of TM550. Protoplasts were further mixed with Alg-A medium for embedding. Embedding and subsequent culture were performed as described in the example 3. Effect of artificial miRNA (amiRNA) on gene expression (FIG. 11) was analysed for a period of 6 days using automated inverted microscope (Axiovert 200M, Zeiss).

Example 8. Screening of Artificial miRNA Efficiency

(102) Arabidopsis shoots from 3-weeks old seedlings (Col-0) were used. Digestion, isolation, and culture procedures were performed as described in example 5. Transformation was performed as described in the example 7. Efficiencies of amiRNAs were estimated as a read-out of fluorescence intensity of the target gene translationally fused with the reporter gene (FIG. 12). Randomly selected amiRNA constructs were further used for generation of transgenic plants which exhibited phenotypes confirming microscopy-based conclusions on amiRNA efficiency (FIG. 13).

Example 9. Cloning Free Screening Approach in Plant Cells

Experiment 1. Transient Transformation and Co-Transformation Using PCR Product Transient Transformation (PPTT)

(103) We compared impact of extra flanks around the “promoter-gene-GFP-terminator” expression cassette against transformation using plasmid DNA. Protoplast isolation and transformation using either tobacco or Arabidopsis leaf protoplasts was performed as previously described in this application. PCR products were amplified as shown on FIG. 17. Primers were designed to match this design: P1-gactagagccaagctgatctcctt (SEQ ID NO:140), P2-aggtcactggattttggttttagg (SEQ ID NO:141), P3-tgccggtgatcttctcggaaaaca (SEQ ID NO:142), P4-agaaaccatcggcgcagctattta (SEQ ID NO:143), P5-tcacttcctcgctgcgctcaagtg (SEQ ID NO:144), P6-tcgtattgggaatccccgaacatc (SEQ ID NO:145).

(104) Transformation using dried or liquid PCR-amplified DNA product was performed, and both transformation procedures were efficient. Intriguingly, PPTT is working much more efficient in comparison to a standard, plasmid DNA-based transient transformation (FIG. 18). Furthermore, for plant species such as tobacco, in which transformation efficiencies when using plasmid DNA are always worse than in Arabidopsis increased number of transformed cells was observed (FIG. 18).

Experiment 2. Co-Expression of ER-mCherry Marker and At1g01730-GFP in Tobacco and Arabidopsis Protoplasts

(105) After PCR amplification and purification, ER-mCherry and At1g01730-GFP expression cassettes were mixed, dried, and PEG-mediated DNA uptake was performed. Microscopy analysis revealed co-expression of both genes in more than 95% of transformed cells for both, Arabidopsis and tobacco protoplasts.

Experiment 3, amiRNA, Split-FP Screenings Using PPTT

(106) Our further aim to combine PPTT with amiRNA and other functional screenings such as split-GFP, split-YFP etc. Since co-expression of vectors works perfect, split screenings could be done straight away using confirmed interacting pair. Transformation with the luciferase reporter and subsequent luciferase activity measurements were successfully tested using auxin sensor construst (FIG. 19).

(107) The amiRNA fluorescence based marker screening can be redesigned with luciferase activity evaluation using PPTT (FIGS. 20A and 20B). This design will allow completely automated sample manipulations, measurements and data reading where human will be responsible only for providing consumables and material, and transfer the screening plates from the robot to incubator and a reading instrument (microscope, plate-readers etc.). If needed, each step can be automated.

Example 10. Quantitative Analysis of Cellular Expansion Using PING, an Intracellular Modulator of Auxin Homeostasis

(108) Plant hormone auxin is an important regulator of plan growth, development and responses to environmental stimuli. The molecular mechanisms to actively transport this compound was evolved achieving the maximal complexity in higher plants. There are several protein families which are involved in regulation of auxin transport and generation of auxin gradients. One of them is PIN protein family which consists of 8 members in Arabidopsis, AtPIN1-AtPIN8. AtPINs are expressed specifically in different tissues being typically localized to the plasma membrane. Understanding of AtPIN function was crucial to understand the mechanism of auxin efflux as well as the auxin gradient formation in tissues and organs. However, currently there is no understanding, of how auxin is moved within the cell until it reaches the nucleus, where auxin-mediated regulation of gene expression takes place. Here we used single plant cells and intracellularly localized AtPIN5 and AtPIN8 to address this question.

(109) Experiment Design:

(110) We compared the effect of auxin concentration on cell elongation over a continuous period (4-6 days) using tobacco leaf protoplasts from wild type tobacco and from the tobacco line overexpressing AtPIN8 translationally fused with Venus fluorescent marker protein (PIN8VenusOx). Two strategies were used: effect of PIN5 and PIN8 expression on cell elongation using transient transformation with dried DNA, protoplast immobilization and culture with manual cell imaging and tracking. effect of auxin concentration (0, 1 pM, 10 pM, 100 pM, 500 pM, 1 nM, 10 nM, 100 nM, 500 nM, 1 μM, 2.5 μM, 5 μM, 10 μM, 25 μM and 50 μM) and quantitative analysis of cell elongation to compare wild type and PIN8VenusOx protoplasts using automated imaging (every 24 h for 4 days, 5 reference points) and computational image analysis.

Experiment 1. Functional Analysis of AtPIN5, AtPIN8 and AtPIN8Venus Expression in Tobacco Leaf Protoplast

(111) Three plasmids were generated and used: pAM-PAT-mCherry-PIN5 (PIN5, FIG. 21) pAM-PAT-mCherry-PIN8 (PIN8, FIG. 21) p2GW7,0-PIN8Venus (PIN8-Venus, FIG. 21)

(112) pAM-PAT-mCherry-PIN5 and pAM-PAT-mCherry-PIN8 (both have backbone as in pAM-PAT-AtPIN1, FIG. 16 of the current application) contain mCherry expression cassette to identify transformed cells (transformation marker) and PIN5 or PIN8 expression cassettes without tags respectively. These constructs were used to compare the effect of PIN5 and PIN8 expression during protoplast development using cell tracking. Effect of Venus tag insertion in the coding sequence of AtPIN8 was compared using pAM-PAT-mCherry-PIN8 and p2GW7,0-PIN8Venus (this plasmid was used also in the Example 6, and FIG. 15 of the current application). As illustrated on images below, we observed no effect of PIN5 on cell elongation, while both, AtPIN8 and AtPIN8Ox had a similar effect resulting in enhanced cell elongation.

(113) Transient PIN5 expression does not affect developmental program of tobacco leaf protoplasts, while expression of PIN8 arrests cell division and enhances elongation (FIG. 21).

Experiment 2. Quantitative Analysis of Transient AtPIN8 Expression on Expansion of Tobacco Leaf Protoplasts

(114) ER-targeting of AtPIN5 has been previously reported (Mravec et al. (2009) Subcellular homeostasis of phytohormone auxin is mediated by the ER-localized PIN5 transporter. Nature 459:1136-1140) we used Spinning-disk and TIRF microscopy method to analyze localization of AtPIN8, which is also targeted to ER (FIG. 22). It is important to stress, that our immobilization method allows using TIRF approach, which allows to study processes near plasma membrane and is possible only if the object (cell) is in a close proximity to a surface of imaging slide/plate.

(115) Therefore quantitative analysis and comparison of ER-marker, PIN5 and PIN8 was performed. pFGC19-ER-yb (Nelson B K et al. (2007) A multi-color set of in vivo organelle markers for colocalization studies in Arabidopsis and other plants Plant Journal 51:1126-1136) and pAM-PAT-mCherry-PIN5 and pAM-PAT-mCherry-PIN8 were used to transiently transform tobacco leaf protoplasts. Cell tracking, cell division analysis and quantitative measurements of cell diameter using ImageJ freeware were performed manually. AtPIN5 did not affect cell division rates in analyzed cells, while PIN8 inhibited cell divisions (Table 1). Only AtPIN8 enhanced cell elongation (FIG. 23).

(116) TABLE-US-00005 TABLE 5 Analysis of cell division rates in transiently transformed cells. Sample ER PIN5 PIN8 total number of cells 26 26 30 dead cells (6dat) 3 6 12 non-dividing cells (6dat) 10 7 18 divided cells (6dat) 13 13 0 dead cells (6dat), % 11.5 23 40 non-divided cells (6dat), % 38.5 27 60 divided cells (6dat), % 50 50 0

Experiment 3. Modulation of Intracellular Auxin Homeostasis Using AtPIN8 and Quantitative Analysis

(117) Protoplasts were isolated and immobilized using our procedure described in the current patent application. Culture medium with final auxin concentration of 0, 1 pM, 10 pM, 100 pM, 500 pM, 1 nM, 10 nM, 100 nM, 500 nM, 1 μM, 2.5 μM, 5 μM. 10 μM. 25 μM and 50 μM was used for washing steps and cell culture afterwards in corresponding wells. Automated image acquisition in a form of volume stacks was performed using iMIC microscope (TILL Photonics GmbH, Germany) in 24 h interval starting from the embedding (0 h, 24 h, 48 h, 72 h, 96 h). Recording coordinates were stored, and the plate was removed from the microscope after each imaging session. This results in non-significant shift in imaging areas, which did not affect further image analysis, and these cannot be achieved using any other existing protoplast culture systems at this or even greater scale. Image analysis (segmentation, cell identification, cell classification and parameter measurements, in this particular case a cell diameter) were performed by a tool which was specifically developed. This experiment allowed to extract quantitative information for hundreds cells per group, the whole experiment was performed in a single 96-well plate. Several training loops using expert knowledge were performed to achieve accuracy of cell identification over every time point (above 90%). This data were used for analysis of PIN8 effect (FIGS. 24A and 24B) and currently provide the basis of the primary mathematical model describing how auxin should move within the cell in order to achieve the nucleus and regulate gene expression.