RING NUCLEASE
20230167423 · 2023-06-01
Inventors
Cpc classification
C12N9/22
CHEMISTRY; METALLURGY
G01N2500/02
PHYSICS
International classification
Abstract
A family of structurally related proteins has been found to have enzymatic activity. The protein family may comprise DUF1874 proteins. Members of this family can be used to modulate the structure, function and/or activity of a cellular signalling molecule that is associated with a cellular antiviral response. In particular, the proteins described herein exhibit an ability to modulate the function, structure and/or activity of cyclic oligoadenylate (cOA); that is to say they can be used to inhibit, destroy, ablate and/or breakdown cOA activity, structure and/or function. The disclosed proteins (all of which belong to the DUF1874 protein family) are generally referred to as “ring nucleases”.
Claims
1. A method of modulating the function, structure and/or activity of cyclic oligoadenylate (cOA), said method comprising contacting the cOA with a DUF1874 protein, wherein the DUF1874 protein acts as a ring nuclease enzyme.
2. The method of claim 1, wherein the DUF1874 protein comprises one or more of the features selected from the group consisting of: (i) a conserved catalytic site for the degradation of cyclic oligoadenylate (cOA); (ii) a key catalytic histidine residue; and (iii) a GH active site motif.
3. The method of claim 1, wherein the DUF1874 protein comprises a sequence selected from the group consisting of: (i) SEQ ID NO 1; (ii) SEQ ID NO: 2; (iii) SEQ ID NO: 3; (iv) SEQ ID NO: 4; and (v) SEQ ID NO: 5.
4. The method of claim 1, wherein the DUF1874 protein comprises a sequence at least 95% identical to one or more sequences selected from the group consisting of: (i) SEQ ID NO: 6; (ii) SEQ ID NO: 7; (iii) SEQ ID NO: 8; (iv) SEQ ID NO: 9; (v) SEQ ID NO: 10; (vi) SEQ ID NO: 11; (vii) SEQ ID NO: 12; (viii) SEQ ID NO: 13; (ix) SEQ ID NO: 14; (x) SEQ ID NO: 15; (xi) SEQ ID NO: 16; (xii) SEQ ID NO: 17; (xiii) SEQ ID NO: 18; and (xiv) A functional fragment of any one of sequences (i)-(xiii).
5. The method of claim 1, wherein the DUF1874 protein comprises a sequence at least 95% identical to SEQ ID NO: 6 (THSA-485A (orf Tsac_2833)).
6.-7. (canceled)
8. A method of treating and/or preventing a bacterial infection or disease or condition associated with a bacterial infection, said method comprising administering a subject in need thereof a DUF1874 protein.
9. The method of claim 8, wherein the bacterial infection is caused or contributed to by one or more bacteria selected from the group consisting of: (i) Mycobacterium tuberculosis (ii) Neisseria meningitidis (iii) Neisseria mucosa (iv) Staphylococcus aureus (v) Streptococcus pyogenes (vi) Streptococcus mutans (vii) Pectobacterium carotovorum; and (viii) Dickeya dadantii; and the disease or condition is selected from the group consisting of: (i) tuberculosis; (ii) bacterial meningitis and sepsis; (iii) endocarditis; (iv) sepsis and toxic shock; (v) sepsis, pharyngitis; (vi) tooth decay; (vii) ubiquitous plant pathogen; and (xiii) crop pathogen.
10.-13. (canceled)
14. A method of detecting a ring nuclease amino acid or nucleic acid sequence in a sample, said method comprising probing said sample for the presence of a sequence corresponding to any one of SEQ ID NOS: 1-24, a nucleic acid encoding any one of SEQ ID NOS: 1-24 or a function fragment of any of these sequences, wherein detection of a sequence corresponding to any one of SEQ ID NOS: 1-24, a nucleic acid encoding any one of SEQ ID NOS: 1-24 or a function fragment of any of these sequences indicates that the sample comprises a ring nuclease amino acid or nucleic acid sequence.
15. A method of identifying a modulator of a ring nuclease having a sequence at least 95% identical to a sequence provided by any one of SEQ ID NOS: 1-24 or a functional fragment thereof, said method comprising: contacting a test agent with a ring nuclease having a sequence at least 95% identical to a sequence provided by any one of SEQ ID NOS: 1-24 or a functional fragment thereof; assessing the function or activity of the ring nuclease enzyme in the presence of the test agent; wherein modulation of the function or activity of the ring nuclease indicates that the test agent may be a ring nuclease modulator.
16. The method of claim 15, wherein the function or activity of the ring nuclease enzyme may be compared to a standard or normal level of ring nuclease activity or function.
17.-18. (canceled)
Description
DETAILED DESCRIPTION
[0161] The present invention will now be described in detail with reference to the following Figures which show:
[0162]
[0163]
[0164] Thin layer chromatography (TLC) analysis shows that, under multiple-turnover conditions (49 μM protein; 450 μM substrate) at 70° C., SIRV1 gp29 rapidly degrades cA.sub.4 and cA.sub.6, but does not degrade cyclic-AMP, or the cyclic dinucleotides, cyclic-di-AMP, cyclic-di-GMP or cyclic-CAMP.
[0165]
[0169]
[0172]
[0173] The recombinant ring nuclease proteins encoded by B. subtilis yddf (green), THSA-485A Tsac_2833 (blue) and Crenothrix polyspora (orange) all cleave cA.sub.4 rapidly in vitro.
[0174]
[0175] Ring nuclease (Tsac_2833, 2 μM dimer) was incubated with the indicated concentration of cA.sub.6 for 60 min at 37° C. The cA.sub.6-activated HEPN family ribonuclease StCsm6′ was then added along with radioactively labelled substrate RNA and incubated for 60 min at 37° C. before denaturing gel electrophoresis and phosphor imaging. cA.sub.6 degradation resulted in protection of the substrate RNA due to deactivation of StCsm6′. Control c1 is RNA in the absence of protein, c2 is RNA incubated with Tsac_2833 and c3 is RNA incubated with StCsm6′ in the absence of cA6 activator. vRN—ring nuclease.
[0176]
[0177] Ring nuclease (SIRV1_114a, 2 μM; labelled “vRN”) was incubated with the indicated concentration of cA.sub.6 for 20 or 60 min at 70° C. and cooled on ice for 5 min. The cA.sub.6-activated HEPN family ribonuclease StCsm6′ was then added along with radioactively labelled substrate RNA and incubated for 60 min at 37° C. before gel electrophoresis. cA.sub.6 degradation resulted in protection of the substrate RNA due to deactivation of StCsm6′.
[0178]
[0183]
[0184] Plasmid transformation assay (1 and 4 day's growth) using a plasmid with a match to a spacer in the CRISPR array. If the plasmid was successfully targeted by the CRISPR system, fewer transformants were expected. Cells using a cA.sub.4-based (Csx1) system only reduced plasmid transformation when the DUF1874 protein Tsac_2833 was not present, suggesting that the DUF1874 ring nuclease was effective in neutralising a cA.sub.4-mediated CRISPR defence. The control strain lacked cOA-dependent ribonucleases. These results are representative from two biological replicates with four technical replicates each (n=8).
[0185]
[0186] This multiple sequence alignment includes representative archaeal virus proteins (SIRV1, STIV, AFV3, ARV1, SIFV, SMV4 and ATV), along with the phage proteins THSA-485A Tsac_2833, Synechococcus phage S-CBWM1, Fusobacterium phage Fnu1 and Hydrogenobaculum phage 1, and proteins found in bacterial genomes (ICEBs1 protein from Bacillus subtilis, and the Crn2 protein from Crenothrix polyspora). Light and dark grey shading indicate regions of partial and strong sequence conservation respectively.
METHODS
[0187] The methods used herein are described below.
[0188] Cloning and Purification
[0189] For cloning, synthetic genes (g-blocks) were purchased from Integrated DNA Technologies (IDT), Coralville, USA, and cloned into the vector pEhisV5spacerTev between NcoI and BamHI sites. Competent DH5a (Escherichia coli) cells were then transformed with the construct and sequence integrity confirmed by sequencing (Eurofins Genomics). Plasmid was then transformed into Escherichia coli C43 (DE3) cells for protein expression. For expression of SIRV1 gp29, YddF, THSA-485A Tsac_2833, and Crenothrix polyspora CRENPOLY SF2_1390015, 2 L of culture was grown at 37° C. to an OD.sub.600 of 0.8 with shaking at 180 rpm. Protein expression was then induced with 0.4 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) and cells grown at 25° C. overnight before harvesting by centrifugation at 4000 rpm (Beckman Coulter Avanti JXN-26; JLA8.1 rotor) at 4° C. for 15 min.
[0190] For protein purification the cell pellet was resuspended in four volumes equivalent of lysis buffer containing 50 mM 2-amino-2-(hydroxymethyl)-1,3-propanediol (Tris)-HCl 7.0, 0.5 M NaCl, 10 mM imidazole and 10% glycerol supplemented with mini EDTA-free protease inhibitor tablets (Roche; 1 tablet per 20 ml buffer) and lysozyme (1 mg/ml). Cells were then lysed by sonicating six times 1.5 min with 1.5 min rest intervals on ice at 4° C., and the lysate was ultracentrifuged at 40,000 rpm (70 Ti rotor) at 4° C. for 45 min. The lysate was then filtered using a 0.45 μm syringe filter and loaded onto a 5 ml HisTrap FF column (GE Healthcare) equilibrated with wash buffer containing 50 mM Tris-HCl pH 7.0, 0.5 M NaCl, 30 mM imidazole and 10% glycerol. Unbound protein was washed away with 20 column volumes (CV) of wash buffer prior to elution of his-tagged protein using a linear gradient of elution buffer containing 50 mM Tris-HCl pH 7.0, 0.5 M NaCl, 0.5 M imidazole and 10% glycerol. SDS-PAGE was then carried out to identify fractions containing the protein of interest, and the relevant fractions were pooled and concentrated using an ultracentrifugal concentrator (MERK). The his-tag was removed by incubating concentrated protein overnight with Tobacco Etch Virus (TEV) protease (1 mg per 10 mg protein) while dialysing in buffer containing 20 mM Tris-HCl pH 7.0, 0.5 M NaCl and 1 mM DTT. The his-tag removed protein was then isolated using a 5 ml HisTrapFF column, eluting the protein using 2 CV wash buffer. His-tag removed protein was further purified by size-exclusion chromatography (S200 16/60; GE Healthcare) in buffer containing 20 mM Tris-HCl pH 7.0, 0.5 M NaCl and 1 mM DTT using an isocratic gradient. After SDS-PAGE, fractions containing protein of interest were concentrated and protein was aliquoted and stored at −80° C.
[0191] Radiolabelled cA.sub.4 Cleavage Assays
[0192] Cyclic oligoadenylate (cOA) was generated by incubating 120 μg Sulfolobus solfataricus (Sso) Type III-S (Csm) complex with 5 nM α-.sup.32P-ATP, 1 mM ATP, 100 nM A26 RNA target and 2 mM MgCl.sub.2 in Csx1 buffer containing 20 mM 2-(N-morpholino)ethanesulfonic acid (MES) pH 5.5, 100 mM K-glutamate and 1 mM DTT for 2 h at 70° C. in a 100 μl reaction volume. cOA product was extracted by phenol-chloroform (Ambion) extraction followed by chloroform extraction (Sigma-Aldrich), and stored at −20° C.
[0193] For single turnover kinetics experiments SIRV1 gp29 and variants (4 μM protein dimer) were assayed for radiolabelled cA.sub.4 degradation by incubating with 1/400 diluted .sup.32P-labelled SsoCsm cOA (˜80 nM; generated in a 100 μl cOA synthesis reaction) in Csx1 buffer at 50° C. Whereas Bacillus subtilis YddF (8 μM dimer), THSA-485A Tsac_2833 (8 μM dimer) and CRENPOLY SF2_1390015 (2 μM dimer) were incubated with 1/400 diluted .sup.32P-labelled SsoCsm cOA at 37° C. in K buffer and B buffer described in Table 2. At desired time points, a 10 μl aliquot of the reaction was removed and quenched by adding to chilled phenol-chloroform. Subsequently, 5 μl of deproteinised reaction product was extracted into 5 μl 100% formamide xylene-cyanol loading dye if intended for denaturing polyacrylamide gel electrophoresis (PAGE), or products were further isolated by chloroform extraction if indented for thin-layer chromatography (TLC). A reaction incubating cOA in buffer without protein to the endpoint of each experiment was included as a control. All experiments were carried out in triplicate. cA.sub.4 degradation was visualised by phosphor imaging following denaturing PAGE (7M Urea, 20% acrylamide, 1×TBE) or TLC.
[0194] For thin layer chromatography (TLC), 1 μl of radiolabelled product was spotted 1 cm from the bottom of a 20×20 cm silica gel TLC plate (Supelco Sigma-Aldrich). The TLC plate was then placed in a sealed glass chamber pre-warmed at 37° C. and containing 0.5 cm of a running buffer composed of 30% H.sub.2O, 70% ethanol and 0.2 M ammonium bicarbonate, pH 9.2. The buffer was allowed to rise along the plate through capillary action until the migration front reached 15 cm. The plate was then air dried and sample migration was visualised by phosphor imaging.
[0195] For kinetic analysis, cA.sub.4 cleavage was quantified using the Bio-Formats plugin (24) of ImageJ as distributed in the Fiji package (25) and fitted to a single exponential curve (y=m1+m2*(1−exp(−m3*x));m1=0.1;m2=1;m3=1;) using Kaleidagraph (Synergy Software), as described previously (Stenberg et al, RNA, 2012, 18(4): 661-672).
[0196] The compositions of the reaction buffers used in these methods are shown in Table 2 below.
TABLE-US-00003 TABLE 2 Reaction Protein assayed buffer name Composition (1X) in buffer Csx1 buffer 20 mM MES pH 5.5, SIRV1 gp29 (s-t 100 mM K-glutamate, kinetics) 1 mM DTT, 3 units SUPERase•In ™ Inhibitor B buffer 20 mM MES pH 6.0, SsoCsm, SIRV1 gp29 100 mM NaCl, 1 mM and SsoCsx1 (coupled DTT, 3 units deactivation assay) SUPERase•In ™ SIRV1 gp29 and Inhibitor StCsm6′ (coupled deactivation assay) THSA-485A Tsac_2833 (s-t kinetics) THSA-485A Tsac_2833 and StCsm6′ (coupled deactivation assay) K buffer 20 mM Tris-HCl pH 8.0, B. subtilis YddF 150 mM NaCl, 1 mM (s-t kinetics) DTT, 1 mM EDTA, 3 units SUPERase•In ™ Inhibitor
[0197] Deactivation of HEPN Nucleases by Ring Nucleases in Coupled Assays
[0198] Csm complex (4 μg; μ140 nM Csm carrying crRNA targeting A26) was incubated at 70° C. for 60 min in the presence of Sso2081 (2 μM dimer) or SIRV1 gp29 (2 μM dimer) and A26 RNA target (50, 20, 5, 2, or 0.5 nM) in buffer containing 20 mM MES pH 6.0, 100 mM NaCl, 2 mM MgCl.sub.2 and 0.5 mM ATP. 5′-end labelled A1 RNA (AGGGUAUUAUUUGUUUGUUUCUUCUAAACUAUAAGCUAGUUCUGGAGA) and 0.5 μM dimer SsoCsx1 was then added to the reaction at 60 min and the reaction was allowed to proceed for a further 60 min before quenching by deproteination with phenol-chloroform extraction. A1 RNA cleavage was visualised by phosphor imaging after denaturing PAGE. Control reactions without SIRV1 gp29 were also included to compare to the effect of ring nuclease presence. cA.sub.4 synthesis by SsoCsm in response to A26 RNA target and subsequent cA.sub.4 degradation by Sso2081 or SIRV1 gp29, if present, was visualised by adding 5 nM α-.sup.32P-ATP with the 0.5 mM ATP at the start of the reaction. Reactions were quenched at 60 min and cA.sub.4 degradation products were visualised by phosphor imaging following TLC. Control reactions incubating RNA in buffer, RNA with SsoCsx1 in the absence of Csm, RNA with Csm or SIRV1 gp29 with RNA for 60 min were also carried out.
[0199] For evaluation of the cA.sub.4 degradation capacity of the ring nuclease SIRV1 gp29 versus the cellular ring nuclease Sso2081, SIRV1 gp29 (2 μM dimer) was incubated with 200-0.5 μM unlabelled cA.sub.4 (BIOLOG Life Science Institute, Bremen, Germany) in Csx1 buffer at 70° C. for 30 min before introducing SsoCsx1 (0.5 μM dimer) and radio-labelled A1 RNA (50 nM). The reaction was left to proceed for a further 60 min at 70° C. before deproteinising by phenol-chloroform extraction before denaturing PAGE to visualize RNA degradation.
[0200] When investigating cA.sub.6 degradation capacity, THSA-485A Tsac_2833 (2 μM dimer) was incubated with cA.sub.6 (50-0.5 μM) for 20 min or 60 min at 37° C. prior to adding 0.5 μM dimer StCsm6′ and 50 nM radio-labelled RNA A1. Reactions were then left to proceed for 60 min at 37° C. before quenching reactions by phenol-chloroform extraction and visualising RNA degradation by phosphor imaging following denaturing PAGE.
[0201] Substrate Specificity of Ring Nuclease SIRV Gp29 (Orf 114a)
[0202] For determining ring nuclease specificity toward cA4 and cA6, 49 μM SIRV1 gp29 was incubated with 400 μM cA4, cA6, cyclic-AMP, cyclic-di-AMP, cyclic-di-GMP, or cyclic-GAMP at 70° C. for 60 min. The reactions were then deproteinised by phenol-chloroform extraction followed by chloroform extraction and products separated by TLC. Substrate degradation was visualised and imaged under short-wave (254 nM) UV light.
[0203] Liquid Chromatography High-Resolution Mass Spectrometry
[0204] SIRV1 gp29 (40 μM dimer) was incubated with 400 μM cA.sub.4 in Csx1 buffer for 2 min or 60 min at 70° C. and deproteinised by phenol-chloroform extraction followed by chloroform extraction. Liquid chromatography-high resolution mass spectrometry (LC-HRMS) analysis was performed on a Thermo Scientific Velos Pro instrument equipped with HESI source and Dionex UltiMate 3000 chromatography system. Compounds were separated on a Kinetex 2.6 μm EVO C18 column (2.1×100 mm, Phenomenex) using a linear gradient of acetonitrile (B) against 20 mM ammonium bicarbonate (A): 0-5 min 2% B, 5-33 min 2-15% B, 33-35 min 15-98% B, 35-40 min 98% B, 40-41 min 98-2% B, 41-45 min 2% B. The flow rate was 350 μl min.sup.−1 and column temperature was 40° C. UV data were recorded at 254 nm. Mass data were acquired on the FT mass analyser in negative ion mode with scan range m/z 150-1500 at a resolution of 30,000. Source voltage was set to 3.5 kV, capillary temperature was 350° C., and source heater temperature was 250° C. Data were analysed using Xcalibur (Thermo Scientific).
[0205] Plasmid Immunity from a Reprogrammed Type III System in E. coli
[0206] Plasmids pCsm1-5_ΔCsm6 (containing the type III Csm interference genes cas10, csm3, csm4, csm5 from M. tuberculosis and csm2 from M. canettii), pCRISPR_TetR (containing M. tuberculosis cas6 and tetracycline resistance gene-targeting CRISPR array), pRAT-Target (tetracycline-resistance, target plasmid) and M. tuberculosis (Mtb)Csm6/Thioalkalivibrio sulfidiphilus (Tsu)Csx1 expression constructs were used. pRAT-Duet was constructed by replacing the pUC19 lacZα gene of pRAT-Target with the multiple cloning sites (MCSs) of pACYCDuet-1 by restriction digest (5′-NcoI, 3′-XhoI). The viral ring nuclease (duf1874) gene from Thermoanaerobacterium phage THSA_485A, tsac_2833, was PCR-amplified from its pEHisTEV expression construct and cloned into the 5′-NdeI, 3′-XhoI sites of MCS-2. The cOA-dependent nuclease (tsu csx1) was cloned into the 5′-NcoI, 3′-SalI sites of MCS-1 by restriction digest. Csx1 was cloned with and without the viral ring nuclease; pRAT-Duet without insert and pRAT-Duet containing only the viral ring nuclease were used as controls. E. coli C43 containing pCsm1-5_ΔCsm6 and pCRISPR_TetR were transformed with 100 ng of pRAT-Duet target plasmid containing different combinations of cOA-dependent nuclease and viral ring nuclease. After outgrowth at 37° C. for 2 h, cells were collected and resuspended in 200 μl LB. A series of 10-fold dilutions was applied onto LB agar containing 100 μg ml.sup.−1 ampicillin and 50 μg ml.sup.−1 spectinomycin to determine the cell density of the recipient cells and onto LB agar additionally containing 25 μg ml.sup.−1 tetracycline, 0.2% (w/v) d-lactose and 0.2% (w/v) I-arabinose to determine the cell density of viable transformants. Plates were incubated at 37° C. for 16-18 h; further incubation was carried out at room temperature.
[0207] Results
[0208] Identification of the Ring Nuclease Family of Anti-CRISPRs
[0209] Previously, the inventors investigated a number of hypothetical proteins in archaeal viruses of unknown function. As part of that study, the structures of ORF 114a of the Sulfolobus islandicus rudivirus 1 (SIRV1), ORF 109 from Acidianus filamentous virus 3 (AFV3) and ORF B116 of Sulfolobus turreted icosahedral virus (STIV) were solved and found to be closely related (see, for example, Oke et al. (2010) J Struct Funct Genomics 11:167-180, J Keller et al (2007), Virol J 4:12 and Larson et al (2007) Virology 363(2):387-396(18). In particular, these proteins were found to share a dimeric organisation with a central pocket flanked by conserved residues.
[0210] These proteins are part of a widely conserved family with members present in a variety of archaeal virus genomes and baceteriophages (
[0211] The function of this protein family was not known. However, disruption of ORF B116 in STIV resulted in a viable virus with delayed infection kinetics and a marked small plaque phenotype (Wirth et al (2011) Virology 415(1):6-11) and B116 is expressed early in the STIV infection cycle (Ortmann et al (2008) J Virol 82(10):4874-4883).
[0212] Therefore the present inventors hypothesised that this family may have an important role in the initiation of infection and explored possibility of an aCR function using SIRV1 gp29 (orf114a) as an exemplar.
[0213] It was surprisingly discovered that SIRV1 gp29 has a potent ring nuclease activity. As shown in
[0214] The initial product of this reaction was determined as linear di-adenylate (ApA>P) with a cyclic 2′,3′ phosphate, but this was rapidly converted to ApAp with a 3′ phosphate (
[0215] Mutation of the conserved histidine H47 to an alanine (H47A variant) reduces the catalytic rate constant by 50,000-fold, indicating the important role of this residue in catalysis (
[0216] In keeping with the rapid kinetics, SIRV1 gp29 was also observed to de-activate the cA.sub.4-activated HEPN nuclease Csx1 far more effectively than the cRN Sso2081, over a wider range of RNA and cA.sub.4 concentrations (
[0217] Other Ring Nucleases
[0218] Three further DUF1874 family members: Yddf from Bacillus subtilis, Tsac_2833 from the bacteriophage THSA-485A and WP_087145848.1 from the bacterium Crenothrix polyspora have been tested for ring nuclease activity.
[0219] All three have been shown to be highly active ring nucleases in vitro (
[0220] Degradation of cA6
[0221] The family of ring nucleases disclosed herein have also been observed to degrade cA.sub.6, albeit with slower kinetics.
[0222] A deactivation assay was carried out using the S. thermophilus HEPN ribonuclease StCsm6′, a ribonuclease activated by cA.sub.6. Clear inhibition of substrate RNA cleavage was observed at lower concentrations of cA.sub.6 when the activator was pre-incubated with the ring nuclease Tsac_2833 (
[0223] This demonstrates that the ring nuclease family described herein have a broad specificity and can degrade both the cOA activators described in the literature.
[0224] Structure and Mechanism of the DUF1874 Ring Nuclease Family
[0225] The structures of DUF1874 ring nuclease family members are believed to share a central binding pocket lined by conserved residues that may play a role in catalysis. Prominent amongst these is a histidine residue that may be absolutely conserved across the ring nuclease family.
[0226] Starting with the structure of SIRV1 gp29, the cOA molecule cA.sub.4 was modelled into the binding site (
[0227] Since the degradation of cA.sub.4 is believed to be independent of the presence of a metal ion and generates initial products with a cyclic 2′,3′ phosphate, it is hypothesised that the mechanism is related to the cellular ring nucleases whereby the 2′-hydroxyl of the substrate acts as the nucleophile. The role of the conserved histidine in the ring nucleases disclosed herein may be to act as a proton donor and acceptor during catalysis, which could explain the much more rapid cA.sub.4 degradation kinetics compared to the cRNs.
[0228] Phylogenetic Distribution and Genomic Context of the DUF1874 Family
[0229] Members of the ring nuclease family disclosed herein may be annotated as DUF1874 (domain of unknown function). The gene is most prominent in the archaeal viruses, where it found in at least seven distinct viral classes (
[0230] A clear homologue has been identified in a bacteriophage genome (THSA-485A of the Siphoviridae family, infecting the clostridial species Thermoanaerobacterium saccharolyticum). However, this may reflect the lack of sequence information for phage. In bacterial genomes, orthologues have been found in the Firmicutes including multiple bacilli and clostridia species, cyanobacteria and also in representatives of the alpha, beta, delta and gamma-proteobacteria. The yddF gene in B. subtilis is part of an integrated prophage, but in other species such as Methylomagnum ishizawai, Crenothrix polyspora, Methylovulum psychrotolerans and Nitrosomonas marina the ring nuclease gene is associated with type III CRISPR systems. There is also an example (Marinitoga piezophilia uniprot accession H2J4R5) of DUF1874 fused to a cOA-activated HEPN ribonuclease of the Csx1 family. Since both active sites are conserved, this fusion protein may have cA.sub.4 activated ribonuclease activity coupled with a cA.sub.4 degradative ring nuclease. This fusion protein may therefore provide an explicit linkage between the DUF1874 family and the type III CRISPR system.
[0231] Use of a DUF1874 Ring Nuclease in Providing Type III CRISPR Immunity In Vivo
[0232] A recombinant type III CRISPR system from Mycobacterium tuberculosis in an Escherichia coli host was used to explore efficacy of ring nucleases in vivo. A strain that was capable of cA.sub.4-based immunity was transformed with a plasmid that was targeted for interference due to a match in the tetracycline resistance gene to a spacer in the CRISPR array. Efficient interference (lack of plasmid transformation) was observed after one day in the absence of the duf1874 gene (Tsac_2833) from bacteriophage THSA-485A. However, the presence of the duf1874 gene (Tsac_2833 THSA-486A) on the plasmid reduced immunity for cA.sub.4-mediated CRISPR defence. These results are shown in
[0233] These observations indicate that a DUF1874 can act as a ring nuclease against cA.sub.4-mediated type III CRISPR defence.
REFERENCES
[0234] 1. Pursey E, Sunderhauf D, Gaze W H, Westra E R, & van Houte S (2018) CRISPR-Cas antimicrobials: Challenges and future prospects. PLoS Pathog 14(6):e1006990. [0235] 2. Borges A L, Davidson A R, & Bondy-Denomy J (2017) The Discovery, Mechanisms, and Evolutionary Impact of Anti-CRISPRs. Annu Rev Virol 4(1):37-59. [0236] 3. Pyenson N C, Gayvert K, Varble A, Elemento O, & Marraffini L A (2017) Broad Targeting Specificity during Bacterial Type III CRISPR-Cas Immunity Constrains Viral Escape. Cell Host Microbe 22(3):343-353e343. [0237] 4. Kazlauskiene M, Kostiuk G, Venclovas C, Tamulaitis G, & Siksnys V (2017) A cyclic oligonucleotide signaling pathway in type III CRISPR-Cas systems. Science 357(6351):605-609. [0238] 5. Niewoehner O, Garcia-Doval C, Rostol J T, Berk C, Schwede F, Bigler L, Hall J, Marraffini L A, & Jinek M (2017) Type III CRISPR-Cas systems produce cyclic oligoadenylate second messengers. Nature 548(7669):543-548. [0239] 6. Rouillon C, Athukoralage J S, Graham S, Grüschow S, & White M F (2018) Control of cyclic oligoadenylate synthesis in a type III CRISPR system. eLife 7:e36734. [0240] 7. Makarova K S, Anantharaman V, Grishin N V, Koonin E V, & Aravind L (2014) CARF and WYL domains: ligand-binding regulators of prokaryotic defense systems. Frontiers in genetics 5:102. [0241] 8. Sheppard N F, Glover C V, 3rd, Terns R M, & Terns M P (2016) The CRISPR-associated Csx1 protein of Pyrococcus furiosus is an adenosine-specific endoribonuclease. RNA 22(2):216-224. [0242] 9. Deng L, Garrett R A, Shah S A, Peng X, & She Q (2013) A novel interference mechanism by a type IIIB CRISPR-Cmr module in Sulfolobus. Mol. Microbiol. 87(5):1088-1099. [0243] 10. Jiang W, Samai P, & Marraffini L A (2016) Degradation of Phage Transcripts by
[0244] CRISPR-Associated RNases Enables Type III CRISPR-Cas Immunity. Cell 164(4):710-721. [0245] 11. Foster K, Kalter J, Woodside W, Terns R M, & Terns M P (2018) The ribonuclease activity of Csm6 is required for anti-plasmid immunity by Type III-A CRISPR-Cas systems. RNA Biol:1-12. [0246] 12. Athukoralage J S, Rouillon C, Graham S, Grüschow S, & White M F (2018) Ring nucleases deactivate Type III CRISPR ribonucleases by degrading cyclic oligoadenylate. Nature 562(7726):277-280. [0247] 13. Pawluk A, Steals R H, Taylor C, Watson B N, Saha S, Fineran P C, Maxwell K L, & Davidson A R (2016) Inactivation of CRISPR-Cas systems by anti-CRISPR proteins in diverse bacterial species. Nat Microbiol 1(8):16085. [0248] 14. Maxwell K L (2016) Phages Fight Back: Inactivation of the CRISPR-Cas Bacterial Immune System by Anti-CRISPR Proteins. PLoS Pathog 12(1):e1005282. [0249] 15. He F, Bhoobalan-Chitty Y, Van L B, Kjeldsen A L, Dedola M, Makarova K S, Koonin E V, Brodersen D E, & Peng X (2018) Publisher Correction: Anti-CRISPR proteins encoded by archaeal lytic viruses inhibit subtype I-D immunity. Nat Microbiol 3(9):1076. [0250] 16. Oke M, Carter L G, Johnson K A, Liu H, McMahon S A, Yan X, Kerou M, Weikart N D, Kadi N, Sheikh M A, et al. (2010) The Scottish Structural Proteomics Facility: targets, methods and outputs. J Struct Funct Genomics 11:167-180. [0251] 17. Keller J, Leulliot N, Cambillau C, Campanacci V, Porciero S, Prangishvili D, Forterre P, Cortez D, Quevillon-Cheruel S, & van Tilbeurgh H (2007) Crystal structure of AFV3-109, a highly conserved protein from crenarchaeal viruses. Virol J 4:12. [0252] 18. Larson E T, Eilers B J, Reiter D, Ortmann A C, Young M J, & Lawrence C M (2007) A new DNA binding protein highly conserved in diverse crenarchaeal viruses. Virology 363(2):387-396. [0253] 19. Wirth J F, Snyder J C, Hochstein R A, Ortmann A C, Willits D A, Douglas T, & Young M J (2011) Development of a genetic system for the archaeal virus Sulfolobus turreted icosahedral virus (STIV). Virology 415(1):6-11. [0254] 20. Ortmann A C, Brumfield S K, Walther J, Mclnnerney K, Brouns S J, van de Werken H J, Bothner B, Douglas T, van de Oost J, & Young M J (2008) Transcriptome analysis of infection of the archaeon Sulfolobus solfataricus with Sulfolobus turreted icosahedral virus. J Virol 82(10):4874-4883. [0255] 21. Rouillon C, Athukoralage J S, Graham S, Grüschow S, & White M F (2019) Investigation of the cyclic oligoadenylate signalling pathway of type III CRISPR systems. Method Enzymol 616:191-218. [0256] 22. Yang W (2011) Nucleases: diversity of structure, function and mechanism. Q Rev Biophys 44(1):1-93. [0257] 23. Anderson R E, Kouris A, Seward C H, Campbell K M, & Whitaker R J (2017) Structured
[0258] Populations of Sulfolobus acidocaldarius with Susceptibility to Mobile Genetic Elements. Genome biology and evolution 9(6):1699-1710. [0259] 24. Kelley L A & Sternberg M J (2009) Protein structure prediction on the Web: a case study using the Phyre server. Nature protocols 4(3):363-371. [0260] 25. Sulakvelidze A, Alavidze Z, & Morris J G, Jr. (2001) Bacteriophage therapy. Antimicrob Agents Chemother 45(3):649-659. [0261] 26. Louwen R, Staals R H, Endtz H P, van Baarlen P, & van der Oost J (2014) The role of CRISPR-Cas systems in virulence of pathogenic bacteria. Microbiol Mol Biol Rev 78(1):74-88. [0262] 27. Gootenberg J S, Abudayyeh 00, Kellner M J, Joung J, Collins J J, & Zhang F (2018) Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Science 360(6387):439-444. [0263] 28. Linkert M, Rueden C T, Allan C, Burel J M, Moore W, Patterson A, Loranger B, Moore J, Neves C, Macdonald D, et al. (2010) Metadata matters: access to image data in the real world. J Cell Biol 189(5):777-782. [0264] 29. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, et al. (2012) Fiji: an open-source platform for biological-image analysis. Nat Methods 9(7):676-682. [0265] 30. Sternberg S H, Haurwitz R E, & Doudna J A (2012) Mechanism of substrate selection by a highly specific CRISPR endoribonuclease. RNA 18(4):661-672.