DEPLETION OF EXT1 EXPRESSION AND/OR ACTIVITY IMPROVES CELLULAR PRODUCTION OF BIOLOGICAL ENTITIES

20230167449 · 2023-06-01

Assignee

Inventors

Cpc classification

International classification

Abstract

The use of an inhibitor of EXT1 expression and/or activity for the production of a biological entity in a cell. Also, the use of a cell having at least depleted EXT1 expression and/or activity for the production of a biological entity. Further, evidence is provided about the role of glycosylation in rapid dynamism of ER shaping and function. In particular, depletion of EXT1 results in a recomposed ER shaping, which could benefit production of recombinant proteins.

Claims

1-15. (canceled)

16. A method for the production of a biological entity in a cell, said method comprising the steps of: a) providing a cell population having at least depleted EXT1 expression and/or activity; b) transfecting the cell population of step a) with an oligonucleotide encoding the biological entity, preferably a polypeptide or a viral particle.

17. The method according to claim 16, wherein said cell is a eukaryotic cell.

18. The method according to claim 16, wherein said biological entity is selected in a group comprising a recombinant polypeptide and/or a viral particle.

19. The method according to claim 16, wherein said cell comprises a partial or total knockout of the EXT1 gene.

20. The method according to claim 16, wherein said at least depleted EXT1 expression and/or activity is obtained by the treatment of said cell with an inhibitor of EXT1 expression and/or activity.

21. The method according to claim 20, wherein said inhibitor of the EXT1 expression and/or activity is selected from a group comprising an oligonucleotide, an aptamer, an oligopeptide, a polypeptide, a chemical compound and an analog thereof.

22. The method according to claim 20, wherein said inhibitor of the EXT1 expression is selected from a group comprising or consisting of an antisense RNA, a miRNA, a guide RNA, a siRNA, and a shRNA.

23. The method according to claim 20, wherein said inhibitor of the EXT1 expression and/or activity is selected in a group comprising an oligonucleotide having at least 75% identity with any one of sequences SEQ ID NO: 1 to SEQ ID NO: 27 and SEQ ID NO: 33 to SEQ ID NO: 53.

24. The method according to claim 20, wherein said inhibitor of the EXT1 expression and/or activity is selected in a group comprising an oligonucleotide represented by any one of sequences SEQ ID NO: 1 to SEQ ID NO: 27 and SEQ ID NO: 33 to SEQ ID NO: 53.

25. The method according to claim 16, wherein said method further comprises the step of: d) extracting and/or purifying the synthesized polypeptide or viral particle.

26. A method for the production of a biological entity in a cell, said method comprising the steps of: a) providing a cell population; b) transfecting the cell population of step a) with an oligonucleotide encoding the biological entity. c) inhibiting EXT1 expression in the said cell by using an inhibitor of EXT1 expression and/or activity.

27. The method according to claim 26, wherein said cell is a eukaryotic cell.

28. The method according to claim 26, wherein said biological entity is selected in a group comprising a recombinant polypeptide and/or a viral particle.

29. The method according to claim 26, wherein said inhibitor of the EXT1 expression and/or activity is selected from a group comprising an oligonucleotide, an aptamer, an oligopeptide, a polypeptide, a chemical compound and an analog thereof.

30. The method according to claim 26, wherein said inhibitor of the EXT1 expression is selected from a group comprising or consisting of an antisense RNA, a miRNA, a guide RNA, a siRNA, and a shRNA.

31. The method according to claim 26, wherein said inhibitor of EXT1 expression and/or activity is an oligonucleotide having at least 75% identity with any one of sequences SEQ ID NO: 1 to SEQ ID NO: 27 and SEQ ID NO: 33 to SEQ ID NO: 53.

32. The method according to claim 26, wherein said inhibitor of the EXT1 expression and/or activity is an oligonucleotide represented by any one of sequences SEQ ID NO: 1 to SEQ ID NO: 27 and SEQ ID NO: 33 to SEQ ID NO: 53.

33. The method according to claim 26, wherein said method further comprises the step of: d) culturing the transfected cell population obtained at step b) in a suitable culture medium, so as to synthesize the polypeptide or the viral particle.

34. The method according to claim 33, wherein said method further comprises the step of: e) extracting and/or purifying the synthesized polypeptide or viral particle.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0145] FIGS. 1A-1B are a combination of histograms showing the average Pearson’s correlation coefficient of indicated markers and EXT1 protein (A) in Cos7 cells transiently expressing SYFP2-EXT1 and endogenous markers calnexin, PDIA3, GM130; or (B) in Cos7 cells co-expression of SYFP2-EXT1 and the markers Lnp1, ATL1, RTN4a (n = 12).

[0146] FIGS. 2A-2D are photographs showing: (A) the efficient depletion of EXT1 protein by shRNA. HSP70 protein is used as a loading control; Cos7 cells stably expressing indicated markers: (B) Lnp1, (C) ATL1, (D) RTN4a. Boxed regions magnified show ER tubular network. Scale bar, 4 .Math.m.

[0147] FIGS. 3A-3B are a combination of photographs and graph showing the localization of mEmerald-Sec61b in Cos7 cells expressing shCTRL (upper panels) or shEXT1 (lower panels): (A) original image; (B) skeleton.

[0148] FIG. 4 is a graph showing the ER metrics analysis of cells co-expressing mEmerald-Sec61b and shCTRL or shEXT1. The boxplot indicates the mean, and whiskers show the minimum, and maximum values (n =24). Tubule mean length is expressed in .Math.m.

[0149] FIG. 5 is a combination of photographs showing live imaging of activated PA-GFP-KDEL in Cos7 cells expressing shCTRL (upper panel) or shEXT1 (lower panel). Scale bar, 5 .Math.m.

[0150] FIG. 6 is a graph showing the mean normalized fluorescence intensity (a.u.) after the addition of biotin in HeLa cells expressing shCTRL (circles) or shEXT1 (squares).

[0151] FIG. 7 is a graph showing the average Pearson’s correlation coefficient of VSVG-GFP localized at membranes of HeLa cells, at the indicated time points (n = 10). Mean number + SD. One-way ANOVA: **p<0.01; ***p<0.001; n.s., not significant.

[0152] FIG. 8 is a combination of photographs showing TEM analysis of trans-Golgi area of HeLa cells expressing shCTRL (left panel) or shEXT1 (right panel). Higher magnification of the boxed area is shown. Scale bar, 1 .Math.m.

[0153] FIG. 9 is a graph showing the number of secretion vesicles in the trans-Golgi area quantified based on TEM images from FIG. 8 (n = 17-18). HeLa cells expressing shCTRL (dark grey) or shEXT1 (light grey). Mean number + SD. One-way ANOVA: ****p<0.0001.

[0154] FIGS. 10A-10B is a combination of photographs showing TEM analysis of Golgi apparatus in HeLa cells expressing shCTRL (A) or shEXT1 (B). Higher magnification of the boxed area is shown. Scale bar, 500 nm.

[0155] FIGS. 11A-11B is a combination of photographs showing schematic representations of the Golgi apparatus in cells expressing shCTRL (A) or shEXT1 (B), as used for the statistical analysis of the different parameters (length, number of cisternae/stack).

[0156] FIG. 12 is a graph showing the number of Golgi cisternae/stack in HeLa cells expressing shCTRL (dark grey) or shEXT1 (light grey). Mean number + SD. (n = 18-21). Oneway ANOVA: ****p<0.0001.

[0157] FIG. 13 is a graph showing the maximum length of individual Golgi cisternae (nm) in HeLa cells expressing shCTRL (dark grey) or shEXT1 (light grey). Mean length + SD. (n = 18-21). Oneway ANOVA: ****p<0.0001.

[0158] FIGS. 14A-14B is a combination of photographs showing TEM analysis of the ultrastructure ER of HeLa cells expressing shCTRL (A) or shEXT1 (B). Scale bar, 2 .Math.m.

[0159] FIGS. 15A-15C is a combination of photographs and graph showing the TEM analysis of ER morphology in HEK293 cells expressing shCTRL (A) or shEXT1 (B) (Scale bar, 2 .Math.m); and (C), the relative mRNA expression level of EXT1 gene was analyzed by qPCR in HEK293 cells expressing shCTRL (dark grey) or shEXT1 (light grey). One-way ANOVA: ****p<0.0001.

[0160] FIGS. 16A-16B is a combination of graphs showing the quantitative proteomic analysis of microsomes. (A), pie chart illustrating the number of up- and down-regulated proteins; (B), heatmap shows the PSMs number of 23 ER integral proteins.

[0161] FIGS. 17A-17B is a combination of graphs showing the N-glycans profiles of microsomes isolated from HeLa cells expressing shCTRL (dark grey) or shEXT1 (light grey). (A), graph showing the relative abundance of fucosylated, mono-fucosylated and difucosylated glycans; (B), graph showing the relative abundance of sialylated, mono-sialylated, di-sialylated, and 3+sialytated N-glycans.

[0162] FIGS. 18A-18B is a combination of graphs showing the glycomics analysis of microsomes. (A) bars indicate the fold change of the total N- and O- glycans intensity; (B) graph representing the relative abundance of each N-glycan in microsomes; the variations are plotted by N-glycan mass (m/z).

[0163] FIGS. 19A-19B is a combination of photographs showing the TEM analysis of HeLa cells expressing shCTRL (A) or shEXT1 (B). Scale bar, 2 .Math.m.

[0164] FIGS. 20A-20B is a combination of graphs showing the schematic representation of ER-mitochondria and ER-nuclear envelope contact sites in Hela cells expressing shCTRL (A) or shEXT1 (B).

[0165] FIGS. 21A-21B is a combination of graphs showing the quantification of contact sites (n = 10-18), as expressed as the number of contact sites in ER per nuclear envelop (A) or the percentage of mitochondria/ER contact sites (B) in HeLa cells expressing shCTRL or shEXT1.

[0166] FIG. 22 is a graph showing the quantification of the total rough Endoplasmic reticulum (RER) length (nm)/cell (n = 10), in HeLa cells expressing shCTRL or shEXT1. Boxplot indicates the mean and whiskers show the minimum and maximum values. One-way ANOVA: ****p<0.0001.

[0167] FIG. 23 is a graph showing the fractional contribution from .sup.13C.sub.6-Glucose to TCA metabolites (n = 3) in cells expressing shCTRL (dark grey) or shEXT1 (light grey). Mean number + SD is plotted. One-way ANOVA: ****p<0.0001.

[0168] FIG. 24 is a graph showing the comparison of mass isotopomer distribution (MID) of citrate derivatives in HEK293 cells expressing shCTRL (dark grey) or shEXT1 (light grey). Mean number + SD is plotted. One-way ANOVA: ***p<0.001; ****p<0.0001; n.s., not significant.

[0169] FIG. 25 is a graph showing the metabolomic analysis from .sup.13C.sub.5-Pentose of pentose phosphate pathway metabolites in HEK293 cells. Fold change in the abundance of the metabolites in shEXT1/shCTRL. One-way ANOVA: *p<0.05; ****p<0.0001; n.s., not significant.

[0170] FIG. 26 is a graph showing the cell abundance from .sup.13C.sub.6-glucose of pentose phosphate pathway metabolites. Fold change in the abundance of the metabolites in shEXT1/shCTRL. Mean number + SD is plotted. One-way ANOVA: *p<0.05; ****p<0.0001; n.s., not significant.

[0171] FIG. 27 is a graph showing the percentage of energy charge. Mean number + SD is plotted. One-way ANOVA: ***p<0.001.

[0172] FIG. 28 is a graph showing the relative production of lentiviral VsVg viral particles in cells expressing shCTRL or shEXT1.

[0173] FIG. 29 is a graph showing the relative production of AAV2 viral particles in HEK293 cells expressing shCTRL or shEXT1.

[0174] FIG. 30 is a graph showing the relative production of recombinant NOTCH protein in HEK293 cells expressing shCTRL or shEXT1.

[0175] FIG. 31 is a graph showing the relative production of luciferase from a VsVg lentivirus in HeLa cells expressing shCTRL or shEXT1.

[0176] FIGS. 32A-32C is a set of photographs showing the expression of EXT1 profile in different HEK293 cell lines transfected with shRNA constructs by Western blot. The numbers correspond to shRNA constructs in Table 4. (A): shRNAs#1, 2, 3, 6, 7 and C; (B): shRNAs#10, 13, 16, 17, 18, 19 and C; (C): shRNAs#4, 5, 8, 9, 11, 12, 15 and C. “C” refers to control shRNA. Stained proteins (human EXT1) and GAPDH are indicated. Arrows indicated EXT1 knock down compared to the control (C).

[0177] FIGS. 33A-33B is a set of graphs showing (A) the nano-luciferase activities after transduction of HEK293 cell lines knocked down for EXT1 using indicated shRNA sequences; and (B) the fluorescence intensities following transduction using AAV2-GFP virus. The numbers of shRNA correspond to Table 4. Statistical analysis of three independent experiments: One-way ANOVA: ****p<0.0001; ***p<0.001; **p<0.01; ****p<0.1; ns: not significant.

EXAMPLES

[0178] The present invention is further illustrated by the following examples.

Example 1: Depletion of EXT1 Results in an Altered Endoplasmic Reticulum (ER)

1- Material and Methods

1.1- Plasmids

[0179] HA-SEC13 pRK5 (#46332), mEmerald-Sec61b-C1 (#90992), pEGFP-SEC16b (#66607), pEGFP-SEC23A(66609), Str-KDEL-TNF-SBP-mCherry (#65279), b4GALT1-pmTirquoise2-N1 (#36205) constructs were obtained from Addgene®. ts045-VSVG-GFP (#11912) is a gift from Dr. Florian Heyd (Freie Universität Berlin, Berlin, Germany). EXT1-YFP and Flag-EXT1 were previously described in Daakour et al. (BMC Cancer 16, 335 (2016)).

[0180] Additional cloning vectors used here are: pDEST-mCherry, mEmerald-C1 (Addgene® #53975) and pSYFP2-C1 (Addgene® #22878) or pCS2 EIF ires GFP. The lentiviral constructs used are: shCTRL (anti-eGFP, SHC005, Sigma-Aldrich®) or pLV U6 shRNA NT PGK GFP-T2A-Neo and targeting EXT1 (sh438: TRCN0000039993, sh442: TRCN0000039997, Sigma-Aldrich®). The shRNAs targeting EXT2, EXTL1, EXTL2, and EXTL3 were designed using Vector Builder online platform (https://en.vectorbuilder.com/) and cloned into lentiviral vector pLV-PURO-U6.

[0181] Nucleic acids encoding shRNAs used herein are depicted in Table 1 below:

TABLE-US-00001 Nucleic acids encoding shRNAs used herein Name Sequence SEQ ID NO: shEXT1-1 CCGGAGAGCCAGATTGTGCCAACTACTCGAGTAGTTGGCACAATCTGGCTCTTTTTTG SEQ ID NO: 1 shEXT1-2 CCGGCCTTCGTTCCTTGGGATCAATCTCGAGATTGATCCCAAGGAACGAAGGTTTTTG SEQ ID NO: 2 shEXT1-3 AGCAGACACAATTCTTGTGGGAGGCTTATTTTTCTTCAGTT SEQ ID NO: 3 shEXT1-4 ATTACAGATTCCTTCTACAATCAGGTCTATTCATCAGGATA SEQ ID NO: 4 shEXT1-5 AAACTTCCGACCCAACTTTGATGTTTCTATTCCCCTCTTTT SEQ ID NO: 5 shEXT1-6 AGACAACACCGAGTATGAGAAGTATGATTATCGGGAAATGC SEQ ID NO: 6 shEXT1-7 CTCTGCGCCCCTTCGTTCCTTGGGATCAATTGGAAAACGAG SEQ ID NO: 7 shEXT1-8 TCATCAGCAGAGCCAGATTGTGCCAACTATCCAAAAACTTA SEQ ID NO: 8 shEXT1-9 GCTCTGCGCCCCTTCGTTCCTTGGGATCAATTGGAAAACGA SEQ ID NO: 9 shEXT1-10 ACTCATCAGCAGAGCCAGATTGTGCCAACTATCCAAAAACT SEQ ID NO: 10 shEXT1-11 TAAAATCCTAGCACTTAGACAGCAGACACAATTCTTGTGGG SEQ ID NO: 11 shEXT1-12 CAGCCGGAGAGAAGAACACAGCGGTAGGAATGGCTTGCACC SEQ ID NO: 12 shEXT1-13 ACCAATTGGCCAATTGTGAGGACATTCTCATGAACTTCCTG SEQ ID NO: 13 shEXT1-14 CGCATGGAGTCCTGCTTCGATTTCACCCTTTGCAAGAAAAA SEQ ID NO: 14 shEXT1-15 CCGGCCCAACTTTGATGTTTCTATTCTCGAGAATAGAAACATCAAAGTTGGGTTTTTG SEQ ID NO: 15 shEXT1-17 CCGGGCACTTAGACAGCAGACACAACTCGAGTTGTGTCTGCTGTCTAAGTGCTTTTTG SEQ ID NO: 16 shEXT1-18 CCGGCCTGCTTCGATTTCACCCTTTCTCGAGAAAGGGTGAAATCGAAGCAGGTTTTTG SEQ ID NO: 17 shEXT1-20 CCGGCAAGACTAGGTTGGTACAGTTCTCGAGAACTGTACCAACCTAGTCTTGTTTTTG SEQ ID NO: 18 shEXT1-21 CCGGAAGAACACAGCGGTAGGAATCTCGAGATTCCTACCGCTGTGTTCTTCTTTTTG SEQ ID NO: 19 shEXT1-22 CCGGCAATTGTGAGGACATTCTCATCTCGAGATGAGAATGTCCTCACAATTGTTTTTG SEQ ID NO: 20 shEXT1-23 CCGGATTCTTGTGGGAGGCTTATTTCTCGAGAAATAAGCCTCCCACAAGAATTTTTTG SEQ ID NO: 21 shEXT1-24 CCGGAGCCAGATTGTGCCAACTATCCTCGAGGATAGTTGGCACAATCTGGCTTTTTTG SEQ ID NO: 22 shEXT1-25 CCGGCTTCGTTCCTTGGGATCAATTCTCGAGAATTGATCCCAAGGAACGAAGTTTTTG SEQ ID NO: 23 shEXT1-27 CCGGGAGTATGAGAAGTATGATTATCTCGAGATAATCATACTTCTCATACTCTTTTTG SEQ ID NO: 24

mCherry-RTN4a, mCheryy-ATL1, Lnp1-mCherry lentiviral constructs were a gift from Dr. Tom Rapoport (Dept of Cell Biology, Harvard Medical School, MA, USA). LV-PA-KDEL-GFP is a gift from Dr. Vicky C Jones (University of Central Lancashire, Preston, UK), Lenti-ATL3-GFP is a gift from Dr. Vincent Timmerman (University of Antwerp, Antwerp, Belgium). Lentivirus production and instructions on its use were kindly provided by Viral Vectors core facility (Viral Vectors platform, University of Liege).

1.2- Mammalian Cell Lines Generation and Culture

[0182] All cell lines HeLa, HEK293, Jurkat, and Cos7 were cultured as previously described in Daakour et al. (see above) and in Hu et al. (Cell 138, 549-561 (2009)). All stable cell lines were generated by lentiviral transduction. Briefly, HEK293T Lenti-x 1B4 cells (Clontech®-Lenti-x HEK293T cells) were transfected with calcium phosphate with three plasmids: the vector of interest, pVSV-G (PT3343-5, Clontech®) and psPAX2 (#12260, Addgene®). The supernatants containing the second-generation viral vectors were harvested and concentrated by ultracentrifugation. The cells (HeLa, HEK293, Jurkat, Cos7) were transduced with the viral vector of interest with MOI (50, 80, 100 depending on the production). After 72 h, the cells were selected for puromycin (Invivogen®) for 3-4 days. For fluorescence-protein-tagged constructs, positive cells were selected by flow cytometry sorting. The cells were finally tested for the presence of mycoplasma (MycoAlert Detection Kit, Lonza® LT07-318), and recombinant viral particles (Lentiviral qPCR TitrationKit, abmGood® #LV900).

1.3- DNA-siRNA Transfection

[0183] DNA was transfected into HeLa and Cos7 with polyethylenimine (PEI 25 K, Polysciences) as previously described in Daakour et al. (see above). For siRNA transfection, Cos7 and HeLa cells were transfected at 40-50% confluence with 2 nmol of siRNA using a classical calcium-phosphate method according to manufacturer’s instructions (ProFection Mammalian Transfection kit, Promega®). The medium was changed 24 h later and cells were collected 48 h post-transfection. When experiments involved both DNA and siRNA transfection, siRNA transfection was performed, and 24 h later cells were transfected with DNA as described previously (Daakour et al.). Cells were collected 24 h later. The following siRNA duplexes were purchased from Eurogentec® (Belgium) and are depicted in Table 2:

TABLE-US-00002 siRNAs used herein Name Sequence (from 5′ to 3′) SEQ ID NO: siEXT1(1) GGAUCAUCCCAGGACAGGA SEQ ID NO: 25 siEXT1(2) GGAUUCCAGCGUGCACAUU SEQ ID NO: 26 siEXT1(3) GGCUUAUUUUUCUUCAGUU SEQ ID NO: 27 siCTRL GGCUGCUUCUAUGAUUAUG SEQ ID NO: 28

1.4- RNA Extraction and RT-qPCR

[0184] For expression studies, total RNA was extracted from the cell pellet using Nucleospin RNA kit (Macherey-Nagel®) according to the manufacturer’s instructions. Real-time qPCR was performed using LightCycler® 480 SYBR Green I Master (Roche®) and analyzed in triplicate on a LightCycler (Roche®). The relative expression levels were calculated for each gene using the ΔΔCt method with GAPDH as an internal control. Primer sequences for qPCR are depicted in Table 3 below:

TABLE-US-00003 primers used herein Name Sequence (from 5′ to 3′) SEQ ID NO: EXT1 Forward GCTCTTGTCTCGCCCTTTTGT SEQ ID NO: 29 EXT1 Reverse TGGTGCAAGCCATTCCTACC SEQ ID NO: 30 GAPDH Forward TTGCCATCAATGACCCCTTCA SEQ ID NO: 31 GAPDH Reverse CGCCCCACTTGATTTTGGA SEQ ID NO: 32

1.5- Immunofluorescence and Confocal, Super-Resolution Microscopy

[0185] 3×10.sup.4 Cos7 and 5×10.sup.4 HeLa cells were grown on 18 mm round glass coverslips and transfected with 500 ng of DNA/well. For immunostaining, the cells were washed with PBS (pH 7.4) and fixed with 4% paraformaldehyde in PBS for 15 min at RT. Cells were permeabilized with 0.5% Triton X-100 for 10 min and incubated with blocking solution (0.025% Tween-20 and 10% FBS) for 30 min. Primary antibody staining was performed overnight at 4° C. in 5% blocking solution: mouse-anti-betacatenin 1:1,000 (Santa Cruz®), mouse-anti-Calnexin 1:500 (Abcam®), rabbit-anti-EXT1 1:100 (Prestige Antibodies Sigma-Aldrich®), mouse-anti-HS (10E4) (1:100, USBio®), rabbit-anti-GM130 1:3,200 (Cell Signaling®), mouse-anti-PDIA3 1:1,000 (Prestige Antibodies Sigma-Aldrich®), mouse-anti-SEC31 1:500 (BD Bioscience®). Goat-antirabbit, donkey-anti-rabbit or goat-anti-mouse secondary antibodies labeled with Alexa Fluor 488 or Texas Red (ThermoFisher Scientific®), anti-mouse-STAR-Red (Abberior®) were used at a 1:2,000 dilution for 1 h. Cells were stained with DAPI (Thermo Fisher Scientific®) when needed for 5 min at RT, washed 5 times with PBS and mounted with Prolong Antifade Mountants (Thermo Fisher Scientific®). Slides were analyzed by confocal microscopy with a Leica TCS SP8 microscope using the 100× oil objective. Images were taken at 2068×2068 pixel resolution and deconvoluted with Huygens Professional software. SYFP2-EXT1 was analyzed by Stimulated Emission Depletion (STED) microscopy with a Leica SP8 STED 592 nm laser. Images were taken at 2068×2068 pixel resolution and deconvoluted with Huygens Professional software. SEC31 was analyzed with Stedycon STED laser 775 nm. mEmerald-EXT1 was analyzed by Structured Illumination Microscopy (SIM) super-resolution. SIM imaging was performed at the Cell Imaging and Cytometry Core facility (Turku University) using a DeltaVision OMX SR V4 microscope using a 60x/1.42 Olympus Plan Apo N SIM objective and sCMOS cameras (Applied Precision®), 2560×2160 pixel resolution. The SIM image reconstruction was performed with DeltaVision softWoRf 7.0 software. For live imaging of Cos7 cells expressing mCherry-ATL1 or Lnp1-mCherry, 3×10.sup.4 cells were plated and imaged at 37° C. and 5% CO.sub.2 in a thermostat-controlled chamber on a Zeiss LSM800 AiryScan Elyra S1 SR confocal microscope using the 63× oil objective at 1 frame/100 ms for 5 s. Further analysis was performed in ImageJ software.

1.6- Image Analysis

[0186] For colocalization analysis, the average Pearson’s correlation coefficient test was performed with the plugin Colocalization Threshold in ImageJ software. To track the displacement of main junctions during successive frames, the dynamic features of the cell were retrieved from the time-lapses of Cos7 cells expressing mCherry-ATL1 or Lnp1-mCherry with the following image processing procedure. Images were preprocessed to uniformize the intensities. Then, each image was binarized and skeletonized using Matlab2016a. The skeleton was labeled using AnalyzeSkeleton plugin from ImageJ. From this process, each pixel of the skeleton was classified according to its neighborhood leading to three-pixel classes: end-point, junctions and tubules. To reflect the structure of the ER, the ratio of the junctions over the tubules was computed for mCherry-ATL1 and Lnp1-mCherry proteins. The dynamics of the ER was assessed by the main junctions displacement during a timelapse. To achieve the tracking of the displacement, the junctions larger than three pixels were kept segmented. Then, the segmented objects were multiplied by the initial image intensity to consider the initial light intensity. Finally, a gaussian blur was applied to these objects. The tracking of the bright spot was achieved by using a single-particles tracking algorithm, the “simple LAP tracker” available in ImageJ plugin TrackMate. The parameters were set following the recommendations for Brownian motion like’s movements, i.e., a max linking distance of seven pixels, a max closing distance of ten pixels and a max frame gap of three pixels. From the results of Trackmate, only the tracks longer than ten frames were kept in order to reduce the noise. Finally, using all velocity vectors measured, a cumulative velocity distribution was computed. Furthermore, a diffusion coefficient based on instantaneous velocity was computed using the Matlab as described previously in Holcman et al. (Nat. Cell Biol. 20, 1118-1125 (2018)). In AnalyzER, original images were imported, and the regions of interest segmented using Otsu’s method (Threshold Selection Method from Gray-Level Histograms. IEEE Trans. Syst. Man. Cybern. 9, 62-66 (1979)). Cisternae are identified using an image opening function and active contour refinement. The tubular network is enhanced using phase congruency, and the resulting enhanced network is skeletonized to produce a single-pixel wide skeleton running along each tubule. Regions fully enclosed by the skeletonized tubular network and the cisternae are defined as polygonal regions, and features such as area, circularity, and elongations are extracted.

1.7- Photoactivatable GFP Imaging

[0187] Using an adaptation of a published assay (Krols et al. Cell Rep. 23, 2026-2038 (2018)), 3×10.sup.4 Cos7 cells expressing PA-GFP-KDEL were plated, and live imaging was performed at 37° C. and 5% CO.sub.2 in a thermostat-controlled chamber on a Zeiss LSM800 AiryScan Elyra S1 SRconfocal microscope using the 100× oil-objective. PA-GFP-KDEL was activated at a perinuclear ER region using the 405 nm laser at 100%, after which the cell was imaged at 1 frame/500 ms for 90 s using the 488 nm laser. Fluorescence intensities were measured using ImageJ software, and data analysis and curve fitting were performed in Graphpad Prism 8 (Graphpad Software). To avoid inter-cell variability, the activation site was at the perinuclear area of cells with the same ER density. The integrated fluorescence intensity of each region of interest (ROI) at fixed distances (8, 12, 16 .Math.m) from the activation region was measured in ImageJ. Normalization of raw values was done, by defining the initial fluorescence to zero and the maximum fluorescence to 1 for each ROI. Image analysis was performed in ImageJ.

1.8- Rush Assay

[0188] HeLa cells were transfected with Str-KDEL-TNF-SBP-mCherry construct as described above, and 24 h after transfection mCherry positive cells were sorted. 5 × 10.sup.4 cells were cultured on 35 mm imaging dish. The day after, cells were transferred at 37° C. in a thermostat-controlled chamber. At time point zero, the medium was removed and replaced with medium containing D-biotin (Sigma-Aldrich) at 40 .Math.M concentration. The timelapse acquisition was made using a Zeiss LSM800 AiryScan Elyra S1 SR confocal microscope. Images were acquired using a 63× oil-objective. For each time point, the integrated intensity of a region of interest (ROI) was measured. The integrated intensity of an identical size ROI corresponding to background was measured and subtracted from the values of the integrated intensity for each time point. The values were then normalized to the maximum value. These quantifications were performed using the Zeiss Black software.

1.9- Export Assay

[0189] 3 ×10.sup.4 Cos7 cells were cultured on 35 mm imaging dish, and transfected with the ts045-VSVG-GFP reporter construct and immediately incubated at 40° C. overnight to retain the reporter protein in the ER. After the addition of cycloheximide, cells were transferred in a thermostat-controlled chamber at 40° C. The temperature was shifted to 32° C., and cells were processed for immunofluorescence at t=0, t=45 and t=90 min and stained with mouse-anti-beta-catenin antibody as described above. The acquisition was made using a Zeiss LSM800 AiryScan Elyra S1 SR confocal microscope. Images were acquired using a 40x oil-objective.

1.10- Calcium Flux Detection Assay

[0190] 2×10.sup.5 Cos7 cells were washed twice and processed for immunofluorescence. Fluo-4, AM Loading Solution was added on the cells according to manufacturer’s instructions (Fluo-4 Calcium Imaging Kit, Thermo Fisher Scientific®). Images were acquired using a Leica TCS SP5 confocal microscope and the 63× oil objective; the analysis was performed in ImageJ software.

1.11- Transmission Electron Microscopy

[0191] HeLa, HEK293 and Jurkat shCTRL (Sigma cat#SHC005) and shEXT1 (shEXT1-1), were fixed for 90 min at 4° C. with 2.5% glutaraldehyde in Sorensen 0.1 M phosphate buffer (pH 7.4), and post-fixed for 30 min with 2% osmium tetroxide. Following, dehydration in graded ethanol, samples were embedded in Epon. Ultrathin sections obtained with a Reichert Ultracut S ultramicrotome were contrasted with uranyl acetate and lead citrate. The analysis was performed with a JEOL JEM-1400 transmission electron microscope at 80 kV and in a Tecnai Spirit T12 at 120 kV (Thermo Fisher Scientific®).

1.12- Immunohistochemistry

[0192] Immunohistochemical experiments were performed using a standard protocol previously described in Hubert et al. (J. Pathol. 234, 464-77 (2014)). In the present study, the antigen retrieval step was: citrate pH 6.0 and the following primary antibody was used: anti-EXT1 (⅟50, ab 126305, Abcam®). The rabbit Envision kit (Dako®) was used for the secondary reaction.

1.13- Preparation of Microsomes From Cultured Cells

[0193] HeLa cells expressing FLAG-EXT1 or HeLa shCTRL and shEXT1 (2×10.sup.8) were harvested and washed with PBS and with a hypotonic extraction buffer (10 mM HEPES, pH 7.8, with 1 mM EGTA and 25 mM potassium chloride) supplemented with a protease inhibitors cocktail. Cells were resuspended in an isotonic extraction buffer (10 mM HEPES, pH 7.8, with 0.25 M sucrose, 1 mM EGTA, and 25 mM potassium chloride) supplemented with a protease inhibitors cocktail and homogenized with 10 strokes using a Dounce homogenizer. The suspension was centrifuged at 1,000×g for 10 min at 4° C. The supernatant was centrifuged at 12,000×g for 15 min at 4° C. The following supernatant fraction, which is the post mitochondrial fraction (PMF), is the source for microsomes. The PMF was centrifuged for 60 min at 100,000×g at 4° C. The pellet was resuspended in isotonic extraction buffer supplemented with a protease inhibitors cocktail and stored in -80° C. Isolated membranes were boiled 5 min in 2× SDS-loading buffer. Then, solubilized samples were separated on SDS-PAGE and analyzed by western blotting.

1.14- Western Blotting and Antibodies

[0194] Cells were lysed in immunoprecipitation low salt buffer (IPLS: 25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40 and 5% glycerol, complete Protease Inhibitor (Roche®) and Halt Phosphatase Inhibitors (Thermo Fisher Scientific®)). Concentrations were determined using the Bradford assay. SDS-PAGE and western blotting were performed using standard protocols. The following primary antibodies were used: mouse-anti-Calnexin 1:2,000 (Abeam®), rabbit-anti-EXT1 1:500 (Prestige Antibodies, Sigma-Aldrich®), mouse-anti-NogoA (Santa Cruz®), rabbit-anti-FLAG 1:4,000 (Sigma-Aldrich®), mouse-anti-FLAG 1:4,000 (Sigma-Aldrich®), goat-anti-actin 1:2,000 (Santa Cruz®), rabbit-anti-HSP70 1:3,000 (Santa Cruz®). Dad1, STT3b, STT3a, Sec61A, Trap-alpha, TRAP-beta, SEC62, SEC63 were a kind gift from Dr. Richard Zimmermann (Medical Biochemistry and Molecular Biology, Saarland University, Homburg, Germany). The following conjugated secondary antibodies were used: a-mouse-HRP 1:5,000 (Santa Cruz®), a-rabbit-HRP 1:5,000 (Santa-Cruz®), anti-goat 1:5,000 (Santa-Cruz®).

1.15- Affinity Purification for Mass Spectrometry

[0195] 2× solubilization buffer (3.5% digitonin, 100 mM HEPES (pH 7.5), 800 mM KOAc, 20 mM MgOAc2, 2 mM DTT) was mixed in a ratio 1:1 with the microsomal fraction and incubated 10 min on ice. Samples were centrifuged for 15 min at 14,000 rpm to isolate the solubilized material and remove the insoluble material. The supernatant was further used for immunoprecipitation. Equilibrated agarose beads M2-FLAG (Sigma-Aldrich®) were added in the microsomal fraction (15 .Math.l of beads per half of a 10-cm cell culture dish), and rotation was performed overnight at 4° C. Beads were washed 3 times for 15 min with glycine 50 mM pH 3.0 for protein elution. The supernatant was supplemented with Tris-HCL pH 8.0. Eluted proteins were then subjected to trypsin digestion and identified by mass spectrometry. Mass spectrometry analyses were performed by the GIGA-Proteomics facility, University of Liege or the proteomic core facility of de Duve Institute, Brussels, Universite Catholique de Louvain, Belgium. As a control, beads were washed five times with IPLS and eluted by boiling 5 min in 2× SDS-loading buffer. Then, solubilized samples were separated on SDS-PAGE and analyzed by western blotting.

1.16- Mass Spectrometry

[0196] Peptides were dissolved in solvent A (0.1% TFA in 2% ACN), directly loaded onto reversed-phase pre-column (Acclaim PepMap 100, Thermo Fisher Scientific®). Peptide separation was performed over 140 min using a reversed-phase analytical column (Acclaim PepMap RSLC, 0.075×250 mm, Thermo Fisher Scientific®) with a linear gradient of 4%-32% solvent B (0.1% FA in 98% ACN) for 100 min, 32%-60% solvent B for 10 min, 60%-95% solvent B for 1 min and holding at 95% for the last 6 min at a constant flow rate of 300 nl/min on an Ultimate 3000 UPLC system. The resulting peptides were analyzed by Orbitrap Fusion Lumos tribrid mass spectrometer using a high-low data-dependent scan routine for protein identification and an acquisition strategy termed HCD product-dependent EThcD/CID (Thermo Fisher Scientific®) for glycopeptides analysis.

[0197] Briefly for the latter, the peptides were subjected to NSI source and were detected in the Orbitrap at a resolution of 120,000. Peptides were selected for MS/MS using HCD setting as 28 and detected in the Orbitrap at a resolution of 30,000. If predefined glycan oxonium ions were detected in the low m/z region it triggered an automated EThcD and CID spectra on the glycopeptide precursors in the Orbitrap. A data-dependent procedure that alternated between one MS scan every 3 seconds and MS/MS scans was applied for the top precursor ions above a threshold ion count of 2.5.sup.E4 in the MS survey scan with 30. 0 s dynamic exclusion. MS1 spectra were obtained with an AGC target of 4.sup.E5 ions and a maximum injection time of 50 ms, and MS2 spectra were acquired in the Orbitrap at a resolution of 30.000 with an AGC target of 5.sup.E4 ions and a maximum injection time of 300 ms. For MS scans, the m/z scan range was 350 to 1,800. For glycopeptide identification the resulting MS/MS data was processed using Byonic 3.5 (Protein Metrics®) search engine within Proteome Discoverer 2.3 against a human database obtained from Uniprot, the glycan database was set to “N-glycan 182 human no multiple fucose or O-glycan 70 human”. Trypsin was specified as cleavage enzyme allowing up to 2 missed cleavages, 5 modifications per peptide and up to 7 charges. Mass error was set to 10 ppm for precursor ions and 20 ppm for fragment ions. Oxidation on Met, carbamidomethyl (+57.021 Da) were considered as variable modifications on Cys. Glycopeptides with a Byoinic score >= 300 and with a Log Prob >= 4.0 were retained and their identification was manually validated.

1.17- SILAC Labeling

[0198] HeLa cells (shCTRL, shEXT1) were cultured for at least five cell doublings in either isotopically light or heavy SILAC DMEM obtained from Thermo Scientific® (catalog number A33969) containing 10% FBS and 50 .Math.g/ml streptomycin and 50 units/ml penicillin (Lonza®). For the heavy SILAC medium, 50 mg of 13C6 L-Lysine-2HCl (heavy) and 50 mg of L-Arginine-HCl was added. In light SILAC medium 50 mg of LLysine-2HCl (light) and 50 mg of L-Arginine-HCl was added. 2×10.sup.5 cells adapted to grow in DMEM. The cell pellet was suspended in 150 .Math.L of modified RIPA buffer and sonicated followed by incubation at 60° C. for 15 min. Samples were clarified by centrifugation; each replicate was pooled and quantified by Qubit (Invitrogen®): 20 .Math.g of the sample was separated on a 4-12% Bis-Tris Novex mini-gel (Invitrogen®) using the MOPS buffer system. The gel was stained with Coomassie, and gel bands were excised at 50 kDa and 100 kDa. Gel pieces were processed using a robot (ProGest, DigiLab). They were washed with 25 mM ammonium bicarbonate followed by acetonitrile and reduced with 10 mM dithiothreitol at 60° C. followed by alkylation with 50 mM iodoacetamide at RT and digested with trypsin at 37° C. for 4 h. Finally, they were quenched with formic acid, and the supernatant was analyzed directly without further processing. For the SILAC analysis performed by MS Bioworks LLC (MI, USA), the samples were pooled 1:1 and 20 .Math.g was separated on a 4-12% Bis-Tris Novex minigel (Invitrogen®) using the MOPS buffer system. The gel was stained with Coomassie, and the lanes excised into 40 equal segments using a grid. For mass spectrometry, the gel digests were analyzed by nano-LC/MS/MS with a Waters NanoAcquity HPLC system interfaced to a Thermo Fisher Q Exactive. Peptides were loaded on a trapping column and eluted over a 75 .Math.m analytical column at 350 nL/min. Both columns were packed with Luna C18 resin (Phenomenex®). The mass spectrometer was operated in data-dependent mode, with MS and MS/MS performed in the Orbitrap at 70,000 FWHM and 17,500 FWHM resolution, respectively. The fifteen most abundant ions were selected for MS/MS. Data were processed through the MaxQuant software 1.5.3.0 (www.maxquant.org) which served several functions such as the recalibration of MS data, the filtering of database search results at the 1% protein and peptide false discovery rate (FDR), the calculation of SILAC heavy: light ratios and data normalization. Data were searched using a local copy of Andromeda with the following parameters, Enzyme set as trypsin, database set as Swissprot Human (concatenated forward and reverse plus common contaminant proteins), fixed modification: Carbamidomethyl (C), variable modifications: Oxidation (M), Acetyl (Protein N-term), 13C6 (K) and fragment Mass Tolerance: 20 ppm.

1.18- Metabolomics Profiling

[0199] For metabolite quantification, HEK293 shCTRL, and shEXT1 cells were seeded in triplicate (n=3) in 6-well plates with DMEM supplemented with 10% FBS. After 24 h, the media was removed and replaced with fresh media containing stable isotopic tracer 13C-glucose. For one well per condition, the medium was replaced with 1-12Cglucose.

[0200] Upon reaching 70% confluency, the supernatant was stored in -80° C. and cells were washed twice with PBS, harvested and the cell pellet stored in -80° C. until Liquid Chromatography/Mass Spectrometry identification of metabolites at the University of Leuven metabolomics core facility.

1.19- N-Glycans and O-Slycans Profiling

[0201] Microsomes were isolated as described above, and glycans profiling performed by Creative Proteomics (NY, USA). For the preparation of N-glycans ~250 .Math.gof lyophilized protein samples are required. The dry samples are resuspended in fresh 2 mg/ml solution of 1,4-dithiothreitol in 0.6 M TRIS buffer pH 8.5 and incubated at 50° C. for 1 h. Fresh 12 mg/ml solution of iodoacetamide in 0.6 M TRIS buffer pH 8.5 was added to the DTT-treated samples and incubated at RT in the dark for 1 h. Samples were dialyzed against 50 mM ammonium bicarbonate at 4° C. for 16-24 h, changing the buffer 3 times. The molecular cut-off should be between 1 and 5 kDa. After dialysis, the samples were transferred into 15 ml tubes and lyophilized. Following resuspension of the dry samples in 0.5 ml of a 50 .Math.g/ml solution of TPCK-treated trypsin in 50 mM ammonium bicarbonate and overnight incubation at 37° C. The reactions stopped by adding 2 drops of 5% acetic acid. Condition a C18 Spe-Pak (50 mg) column with methanol, 5% acetic acid, 1-propanol and 5% acetic acid. Trypsin-digested samples were loaded onto the C18 column and then column was washed with 4 ml of 5% acetic acid and the peptides eluted from the C18 column with 2 ml of 20% 1-propanol, then 2 ml 40% 1-propanol, and finally 2 ml of 100% isopropanol. All the eluted fractions were pooled and lyophilized. The dried material was resuspended thoughtfully in 200 .Math.l of 50 mM ammonium bicarbonate and 2 .Math.l of PNGaseF was added, following incubation at 37° C. for 4 h. Then, another 3 .Math.l of PNGaseF was added for overnight incubation at 37° C. To stop the reaction addition of 2 drops of 5% acetic acid is required. Condition a C18 Spe-Pak (50 mg) column with methanol, 5% acetic acid, isopropanol and 5% acetic acid and the PNGaseF-digested samples were loaded onto the C18 column, and flow-through was collected. The column was washed with 4 ml of 5% acetic acid, and fractions were collected. Flow-through and wash fractions were pooled, samples were lyophilized and proceeded to permethylation.

[0202] For the O-glycans preparation, 1 ml of 0.1 M NaOH was added to 55 mg of NaBH.sub.4 in a clean glass tube and mixed well, and 400 .Math.l of the borohydride solution was added to the lyophilized sample (collected peptides/glycopeptides after PNGaseF digestion). Following, incubation at 45° C. overnight, the reaction was terminated by the addition of 4-6 drops of pure (100%) acetic acid, until fizzing stops. A stock solution of Dowex 50 W ×8 (mesh size 200-400) was made by washing three times 100 g of resin with 100 ml of 4 M HCl. The resin was washed with 300 ml of Milli-Q water, and the wash step was repeated for ~15 times until the pH remained stable. The resin was then washed with 200 ml of 5% acetic acid three times. A desalting column with 2-3 ml of the Dowex resin prepared above in a small glass column. The column was washed with 10 ml of 5% acetic acid. Acetic acid-neutralized samples were loaded onto the column and washed with 3 ml of 5% acetic acid. Flow-through was pooled and washed. The collected material was lyophilized, supplemented with 1 ml of acetic acid: methanol (1:9; v/v=10%) solution, vortexed thoroughly and dried under a stream of nitrogen. This co-evaporation step was repeated for three more times. Condition a C18 Spe-Pak column with methanol, 5% acetic acid, isopropanol and 5% acetic acid. The dried sample was resuspended in 200 .Math.l of 50% methanol and loaded onto the conditioned C18 column. The column was washed with 4 ml of 5% acetic acid. Flowthrough was collected, pooled, and washed. Lyophilized samples were processed to permethylation.

[0203] For the permethylation, the preparation of the slurry NaOH/DMSO solution is made fresh every time. Mortar, pestle, and glass tubes were washed with Milli-Q water and dried beforehand. Whenever possible, liquid reagents were handled with disposable glass pipettes. Solvents are HPLC grade or higher. With a clean and dry mortar and pestle grind 7 pellets of NaOH in 3 ml of DMSO. One ml of this slurry solution was added to a dry sample in a glass tube with a screw cap and supplemented with 500 .Math.l of Iodomethane and incubated at RT for 30 min. The mixture turns white and even becomes solid as it reaches completion. One ml of Milli-Q water was added to stop the reaction, and the tube was vortexed until all solids were dissolved. The sample was supplemented with 1 ml of Chloroform and additional 3 ml of Milli-Q water, vortexed and centrifuged briefly to separate the chloroform and the water phases (~5,000 rpm, <20 sec). The aqueous top layer was discarded and wash 2 more times. Chloroform fraction dried with a SpeedVac (~20-30 min). Condition a C18 Spe-Pak (200 mg) column with methanol, Milli-Q water, and acetonitrile. Dry samples were resuspended in 200 .Math.l of 50% methanol and loaded onto the column. The tube was washed with 1 ml of 15% acetonitrile and loaded onto the column. The column was washed with 2 ml of 15% acetonitrile, then eluted in a clean glass tube with 3 ml of 50% acetonitrile. Lyophilized eluted fraction for MS analysis was used. MS data were acquired on a Bruker UltraFlex II MALDI-TOF Mass Spectrometer instrument. The positive reflective mode was used, and data were recorded between 500 m/z and 6,000 m/z for N-glycans and between 0 m/z and 5,000 m/z for O-glycans. For each MS N- and O-glycan profiles the aggregation of 20,000 laser shots or more were considered for data extraction. Mass signals of a signal/noise ratio of at least 2 were considered and only MS signals matching an N- and O-glycan composition was considered for further analysis and annotated. Subsequent MS post-data acquisition analysis was made using mMass (see Strohalm et al., Anal. Chem. 82, 4648-4651 (2010)).

1.20- Glycosyltransferase Assay

[0204] Glycosyltransferase activity of microsomes from HeLa shCTRL, and shEXT1 was determined with the Glycosyltransferase Activity Kit (R&D Systems®). A glycosyltransferase reaction was carried out in 50 .Math.L of reaction buffer in a 96-well plate at room temperature for 20 min, according to the manufacturer’s instructions. The absorbance value for each well was measured at 620 nm with a microplate reader TECAN Infinite®200 PRO.

1.21- RNA Sequencing

[0205] RNA sequencing analysis was previously described in Daakour et al. (see above). Model generation and flux balance analysis Model generation and in silico flux balance analysis was done using the Constraint-Based Reconstruction Analysis (COBRA) toolbox V3.0 in the Matlab 2018a environment with an interface to IBM Cplex and GLPK solvers provided in the COBRA toolbox. Linear programing problems were solved on a macOS Sierra version 10.12.6. To generate the control and EXT1 knocked down specific models, the gene expression mRNA data for samples of control EXT1 knocked down cells (RNA seq) were integrated with the COBRA human model, RECON2. The integration step uses the GIMME algorithm, available in the COBRA toolbox. Because GIMME requires binary entries for the indication of the presence or absence of genes, we used a gene expression threshold value equals to the first quartile RPKM (reads per kilobase of transcript per million) for genes in control and EXT1 knocked-down cells. GIMME only integrates reactions associated with active genes, leaving those associated with the lowly expressed genes inactive. Therefore, genes with expression values below the threshold were given the value of 0 (inactive), and those with expression values higher than the threshold were given a value of 1 (active). Flux balance analysis (FBA) calculates the flow of metabolites through a metabolic network, thereby predicting the flux of each reaction contributing to an optimized biological objective function such as growth rate. Simulating growth rate requires the inclusion of a reaction that represents the production of biomass, which corresponds to the rate at which metabolic precursors are converted into biomass components, such as lipids, nucleic acids, and proteins. For both models generated after the integration step, we used the biomass objective function as defined in the RECON2 model to obtain the FBA solution using the COBRA Toolbox command, optimizeCbModel. After identification of the objective function in the model, the entries to the command optimizeCbModel are: the model and the required optimization of the objective function (maximum production). The command output is the FBA solution, which includes the value of the maximum production rate of the biomass and a column vector for the conversion rate value (reaction fluxes) of each metabolite accounted for in the model.

1.22- Statistical Analysis

[0206] Graph values are represented as mean + s.d. (standard deviation) of the mean calculated on at least three independent experiments/samples. The analyses were performed in Prism 8 (Graphpad Software). The statistical significance between means was determined using one-way ANOVA followed by two-tailed, unpaired Student’s t-test. p-values thresholds depicted as follows: *p<0.05, **p<0.01; ***p<0.001; ****p<0.0001; n.s., not significant. Significance for PA-GFP-KDEL was performed using two-way ANOVA followed by Sidak’s multiple comparisons test. Significance for Rush assay was performed using the two-stage linear step-up procedure of Benjamini, Krieger and Yekutieli, with Q=1%. Each time point was analyzed individually, without assuming a consistent SD.

2- Results

2.1- EXT1 Subcellular Localization in ER Tubules and Sheet Matrices

[0207] Using conventional confocal microscopy, previous studies have shown that overexpressed EXT1 localizes predominantly to the ER. To overcome spatial limitations of optical microscopy and precisely characterize EXT1 localization in ER structures, super-resolution imaging (SR) was used. EXT1 construct tagged with SYFP2 and mEmerald, two fluorophores with different photostability properties were transiently expressed in Cos7 cells. Using two SR technologies, Stimulated Emission Depletion (STED) and Structured Illumination Microscopy (SIM) it was observed that EXT1 localized in dense sheets and the peripheral ER tubules. EXT1 largely co-localized with the ER luminal marker protein disulfide isomerase family A member 3 (PDIA3) and to a lesser extent with lectin chaperone calnexin and Golgi marker GM130 (FIG. 1A). Also, EXT1 almost perfectly colocalized with ER-shaping proteins Lunaparkl (Lnpl), ATL1 and RTN4a in tubules and the ER three-way junctions (FIG. 1B), further confirming the localization of EXT1 in ER structures.

2.2- EXT1 Depletion Affects ER Morphology and Luminal Dynamics

[0208] The ER morphology was significantly altered in Cos7 KD_EXT1 (knockdown of EXT1) cells where it appeared asymmetrically dispersed in its periphery in comparison with control cells (FIGS. 2A-D).

[0209] To analyze the ER luminal structural rearrangements, ER membrane structures marked with SEC61b were quantified by using a segmentation algorithm that excludes insufficient fluorescent intensity to give a single-pixel-wide network and allows quantification of individual tubule morphological features. ER cisternae were detected independently using the image opening function followed by active contour refinement. The tubular ER network was altered in KD _EXT1 cells and exhibited a denser reticulated phenotype in comparison to control (FIGS. 3A-B). Measurements of the polygonal area of ER tubular network confirmed our observations with a reduction from 0.946 .Math.m.sup.2 in control to 0.778 .Math.m.sup.2 in KD_EXT1 condition. Other tubular and cisternal ER metrics (such as, e.g., tubules mean length), cisternae mean area, perimeter mean length) remained unaffected (FIG. 4), suggesting that the denser tubular network might indicate a more crowded ER lumen in KD_EXT1 cells. Accordingly, the molecular chaperone calnexin, which assists protein folding in the ER, exhibited an aggregation pattern in KD_EXT1 cells. This aggregation might result in a decreased movement of molecules through the ER lumen. To assess how a reduced polygonal area following EXT1 knockdown might influence ER luminal protein mobility and network continuity, the relative diffusion and active transport through the ER lumen of a photoactivable ER lumen marker (PA-GFP-KDEL) was quantified. It was observed that PA-GFP-KDEL was spread throughout the entire ER network, suggesting that the continuity of ER was not affected in cells knocked down for EXT1. However, in KD_EXT1 cells, it was observed a significantly higher dynamic of fluorescence intensity in regions closer to the nucleus (FIG. 5) suggesting that the structural rearrangements of the ER following EXT1 knockdown actively participate in luminal protein transport. Altogether, these data demonstrate that EXT1 induces ER morphological changes that impair protein movement through the ER.

2.3- EXT1 Knockdown Results in Increased Secretory Cargo Trafficking

[0210] To comprehensively assess the function of EXT1 in the ER, interactome analysis was combined with imaging approaches. First, the EXT1 interactome in ER microsomes was captured by affinity purification and mass spectrometry analysis. Consistent with a role in ER morphology, spatial analysis of functional enrichment (SAFE) analysis identified three functional modules within EXT1 interactors, two of which being translation initiation and protein targeting to the ER. Next, potential connections between EXT1 and the secretory pathway were investigated by comparing the proteome isolated from control and KD_EXT1 cells after stable isotope labeling by amino acids (SILAC). To further assess the changes in the secretory pathway, anterograde transport was monitored using the retention selective hook (RUSH) system that enables the synchronization of cargo trafficking. By tracking cargo transport from the ER to the Golgi using live imaging, it was observed a slower dynamic response in KD_EXT1 cells resulting in an increased residency of the cargo within the secretory pathway (FIG. 6). This finding was confirmed using an additional ER export assay based on the vesicular-stomatitis-virus glycoprotein (VSVG) (FIG. 7), and by examining COPII coat structural components SEC16 and SEC31. Finally, transmission electron microscopy (TEM) indicated a higher number of trans-Golgi secretory vesicles (2.41±1.58 and 11.83±7.00 secretion vesicles/cell, shCTRL, and shEXT1, respectively) following depletion of EXT1 in HeLa cells (FIG. 8 and FIG. 9). Altogether, these observations demonstrate that the EXT1 structural role in the ER correlates with functional consequences on secretion.

2.4- EXT1 Depletion Induces ER Extension and Golgi Re-Organization

[0211] In the Golgi apparatus, EXT1 catalyzes the polymerization of HS chain. TEM ultrastructural examination of KD _EXT1 cells revealed structural changes in the Golgi apparatus size and shape (FIGS. 10A-B). The number of Golgi cisternae per stack was reduced from 3.80±0.98 to 3.00±0.86 (shCTRL and shEXT1, respectively) (FIGS. 11A-B, FIG. 12) and stacks appeared dilated and upon quantification showed shorter length (1,036±312 nm compared to 729.2±329.0 nm, shCTRL and shEXT1, respectively) in KD_EXT1 compared to control cells (FIGS. 11A-B, FIG. 13). The ultrastructural ER morphology was subsequently assessed and it was observed well-organized ER tubular extensions in HeLa KD_EXT1 cells, with an average length of 109.60±25.29 .Math.m compared to 19.00±8.02 .Math.m in control cells (FIGS. 14A-B). These observations are in agreement with the above results demonstrating a perturbation of ER-to-Golgi, and trans-Golgi secretory vesicles system and support coordinated biogenesis and maintenance of ER and Golgi structures. Similar ER morphology defects were also observed in other cell types, including HEK293 (FIGS. 15A-C), Jurkat, and ex-vivo activated T-cells from peripheral lymph organs. Also, depletion of other members of the exostosin family (EXT2, EXTL1-3) did not lead to similar ER defects.

2.5- Reprogramming the Proteome and the Glycome, in the ER Membranes

[0212] To understand the molecular mechanism of EXT 1-mediated ER membrane structuration, ER microsomes were isolated from KD_EXT1 and control cells. TEM revealed that ER membrane fragments of KD_EXT1 cells appeared vesicle-like, compared to the normal heterogeneous microsomes observed in control cells. Compared to control, microsomes isolated from KD_EXT1 cells were depleted in various ER-resident proteins, including the luminal chaperone calnexin, the ER-integrated components of the translocon complex Sec62 and Sec63, the translocon-associated protein complex (TRAP) and the oligosaccharyl-transferase complex (OST) members STT3A, STT3B and Dad1, further confirming the involvement of EXT1 in protein transport and targeting to the ER membranes. To evaluate the global role of EXT1 in the ER membrane composition, the proteome, lipidome, and glycome of ER membrane were comprehensively profiled from control and KD_EXT1 cells. 226 proteins differentially expressed in ER membranes depleted for EXT1 were identified, including 23 ER-resident proteins (FIGS. 16A-B). While RTN4 and ATL3 shaping proteins were downregulated, proteins such as valosin-containing protein (VCP), an ATPase involved in lipids recruitment during transitional ER formation, and glycan-binding protein ERGIC/p53, a component of the ER-Golgi intermediate compartment involved in ER reorganization for cargo transport, were up-regulated in KD_EXT1 ER membranes (FIG. 16B), further confirming the above observations on secretion.

[0213] N- and O-glycans were next quantified by MALDI-TOF-MS, enabling absolute and relative estimation of glycans abundance on glycoproteins. Knockdown of EXT1 did not change the composition of glycans on membrane proteins (FIGS. 17A-B). However, the total amount of N-glycans was reduced, and we observed a significant shift towards higher molecular weight glycans compared to control ER membranes (FIGS. 18A-B). This deregulation appears to occur at the level of the first step during protein N-glycosylation involving the OST complex, whose catalytic subunits STT3A and STT3B are reduced following EXT1 depletion. The specific N-glycans attached to asparagine (N) residues of STT3A, STT3B and RPN1 OST subunits were identified. The corresponding sequon of yeast Stt3 was shown, by cryo-EM, to mediate the assembly of the OST subcomplexes via interaction with Wbp1 and Swp1. Depletion of EXT1 induced less N-glycosylation of the OST catalytic subunits (STT3A and STT3B) at N548 and N627 residues, respectively, confirming the observation that EXT1 is involved in the stability of the OST complex in ER microsomes. It was also observed an increase in O-glycans in KD_EXT1 ER membranes (FIG. 18A), consistent with their higher content in GalNAc transferase 2 (GALNT2) and the overall higher glycosyltransferase activity in ER microsomes following knockdown of EXT1. These results indicate that depletion of EXT1 leads to a displacement of glycosylation equilibrium of ER membrane proteins.

2.6- Biological Significance

[0214] The Hela cellsize was examined and it was observed that ER extension in KD _EXT1 cells correlated with a ~2-fold increase in cellular area (68.52±12.52 and 133.9±36.79 .Math.m.sup.2 in shCTRL and shEXT1, respectively) (FIGS. 19A-B). Cell size is of fundamental importance from bacteria to mammals, and it is strictly regulated to keep a balance between cell growth and cell division. Interestingly, it was not observed any significant effect on proliferation following EXT1 depletion suggesting an important adaptive change of the size threshold following ER extension and internal cellular architecture rearrangement in KD_EXT1 cells. ER interactions with other organelles were next analyzed and it was possible to count significantly more peripheral ER-nuclear envelope (2.30±1.18 and 0.55±0.85 shEXT1 and shCTRL, respectively) and less ER-mitochondria (21.6%±10.2 and 35.38%±9.32 shEXT1 and shCTRL, respectively), contact sites in KD_EXT1 compared to control condition (FIGS. 20A-B, FIGS. 21A-B). The latter observation was highly unexpected given the ~5,7-fold increase in ER length (FIG. 22). However, it correlated with an impaired calcium flux and loss of interaction between EXT1 and the Sarco/endoplasmic reticulum Ca.sup.2+ ATPase 2. Taken together, the above results suggest that cells underwent a metabolic switch following EXT1 knockdown.

[0215] To further assess the implications of EXT1 in cell metabolism, two different strategies were used. Firstly, based on previous transcriptomics data in cells treated with siRNA targeting EXT1 and control cells (Daakour et al.; see above), two in silico flux balance analysis (FBA) models were reconstructed using Constraint-Based Reconstruction Analysis (COBRA) tools based on human RECON2 metabolic model. 34 and 39 reactions were uniquely found active in the KD_EXT1 or control models, respectively. These reactions are involved in the Tricarboxylic Acid (TCA) cycle, glycerophospholipid metabolism, pyruvate, methane, and sphingolipid metabolism. These predictions were confirmed with high throughput metabolomic analysis of the relative abundance and fractional contribution of intracellular metabolites from major metabolic pathways in living cells. It was not observed significant changes in glycolysis between control and KD_EXT1 cells. In contrast, it was found that several nucleotides, amino acids, and metabolites from the TCA cycle were dysregulated in cells depleted for EXT1, in agreement with our FBA in-silico analysis. The fractional contribution of glucose carbons into these pools of metabolites was also decreased in KD_EXT1 cells (FIG. 23). For instance, citric acid (change 12.51%, p < 0.001), a-ketoglutarate (change 13.87%, p < 0.0001), fumarate (change 11.61%, p < 0.001), malate (change 13.74%, p < 0.0001) and oxaloacetate (change 15.97%, p < 0.0001) showed significant drops in fractional contribution (FIG. 23). Iso-topologue profile analysis of TCA intermediates pointed towards a less oxidative mode of action of the mitochondria of cells depleted for EXT1, as evidenced by the drop in iso-topologues m04, m05 and m06 of citric acid (FIG. 24). In contrast, metabolite pools of the pentose phosphate pathway, as well as the m05 of different nucleotides (ATP, UTP, GTP, and CTP), and the energy charge was increased in the KD_EXT1 cells (FIGS. 25-27), indicating a higher de novo synthesis and consumption rate of these nucleotides necessary for the synthesis of sugar intermediates such as UDP-hexoses and UDP-GlcNAc.

2.7- Discussion

[0216] In vitro, the formation of the ER tubular network requires only a small set of membrane-curvature and stabilizing proteins that includes RTNs, REEPs, and large ATLs GTPases. However, these effectors cannot account for the diversity and adaptability of ER size and morphology observed in individual cell types. It is expected that in vivo, dynamics of tubular three-way junctions and rearrangements of the tubules to accommodate luminal flow mobility rely on additional proteins or mechanisms. Despite the discovery of glycoproteins in intracellular compartments 30 years ago, the knowledge about the glycoproteome is still biased towards secreted and plasma membrane proteins, including cell surface receptors and peripheral membrane proteins, for which glycosylation heavily influences their function. Here, it was demonstrated that, by depleting a single ER-resident glycosyltransferase, EXT1, we could induce an alternative glycosylation pattern of ER membrane proteins and lipids that correlates with extensive ER architectural and functional remodeling.

[0217] These findings suggest an adaptive cellular mechanism that facilitates the equilibrium towards complex N-glycosylation and redistribution of HSPGs when EXT1 is depleted.

[0218] Herein is provided a new edge to the role of EXT1 in cell physiology, besides heparan sulfate biosynthesis at the cell surface. EXT1 is required for dictating macromolecules composition that govern ER morphology and luminal trafficking. At the fundamental level, these findings argue for a general biophysical model of ER membrane-extension and functions regulated by resident glycosyltransferase enzymes.

Example 2: Depletion of EXT1 in HEK293T and in HeLa Cell Lines Increases The Production of Recombinant Proteins and Viral Particles

1- Materials and Methods

1.1- Lentiviral Production

[0219] HEK293 cells (shEXT1 or ShCTRL) are cultivated in 175 cm.sup.2 bottle at a density of 10.sup.6 cells and incubated at 37° C. with 5% CO.sub.2 for 72 hours in DMEM (Dulbecco’s Modified Eagle Medium) with 10% FBS. Prior to transfection, the media is changed and cells are co-transfected with the packaging plasmid psPAX2, envelop plasmid pVSV-G and the transfer plasmid coding for EmGFP, using the calcium-phosphate method. Cells are left in the incubator for 24 hours, the media is changed and replaced by 12 ml of fresh DMEM for additional 24 hours. The supernatant is treated with DNase for 20 min at 37° C., filtered under 0.20 .Math.m, centrifuged for 1h45 min at 16,000 rpm and the viral pellets were suspended into 300 .Math.l of HEPES buffer. Virus titration is performed by qPCR using the LV900 kit (www.abmgood.com).

1.2- Adeno Associated Virus Production

[0220] HEK293 cells (shEXT1 or ShCTRL) are cultivated in 175 cm.sup.2 bottle at a density of 1,7× 10.sup.6 cells and incubated at 37° C. with 5% CO.sub.2 for 72 hours in DMEM with 10% FBS. Prior to transfection, the media is changed and cells are co-transfected with plasmids RepCap, pHelper and the transfer plasmid coding for the red fluorescent protein (RFP), using the calcium-phosphate method. Cells are left in the incubator for 12 hours; the media is changed and replaced by fresh DMEM for additional 72 hours. Cells are harvested with media and centrifuged at 1,000xg for 10 min at 4° C. Viruses in the 100 ml of supernatant are obtained by incubating with 25 ml of 40% PEG, followed by a centrifugation of the precipitated viruses at 3,000xg for 15 min at 4° C. Viruses in the cell pellets are obtained after cells lysis by 3 cycles of freeze-thaw, centrifugation at 3,000xg for 15 min at 4° C. The protocol for viruses purification and validation is detailed at https://www.addgene.org/protocols/aav-purification-iodixanol-gradient-ultracentrifugation/. Virus titration is performed by qPCR using the ABMGood G931 kit (www.abmgood.com).

1.3- Protein Production

[0221] HEK293 cells (shEXT1 or ShCTRL) are cultivated in 175 cm.sup.2 bottle at a density of 10.sup.6 cells and incubated at 37° C. with 5% CO.sub.2 for 72 hours in DMEM with 10% FBS. Prior to transfection, the media is changed and cells are transfected with a plasmid expressing Notch1 tagged with Flag epitope. Cells are left in the incubator for 12 hours; the media is changed and replaced by fresh DMEM for additional 72 hours. Cells are harvested with media and centrifuged at 1000×g for 10 min at 4° C. Cells are lysed with 1% Tween and analyzed by western blot using an anti-Flag antibody.

[0222] In another experiment, HEK293 cells (shEXT1 or ShCTRL) are infected with VSVG lentiviruses with a transfer plasmid coding for the nano-luciferase enzyme. Cells are left in the incubator for 24 hours; and the nano-luciferase is measured using nano-Glo luciferase assay system (www.promega.com)

2. Results

2.1- Lentiviral Production

[0223] HEK293 shEXT 1 produce approximately four times more viruses than HEK293 shCTRL cells (respectively 2×10.sup.6 versus 5×10.sup.5 lentiviral particles/ml) (FIG. 28).

2.2- Adeno Associated Virus Production

[0224] HEK293 shEXT1 produce approximately three times more AAV2 pseudo-typed viruses than HEK293 shCTRL cells (respectively 8.9×10.sup.12 vs 2.8×10.sup.12 viral particles/ml) (FIG. 29).

2.3- Protein Production

[0225] HEKshEXT1 cells express 2.9 times more Notchl-Flag protein than control cells (FIG. 30). HEKshEXTl cells express 1.7 times more nano-luciferase enzyme than control cells (FIG. 31).

Example 3: siRNA Efficiently Deplete Cells of EXT1

[0226] In addition to shRNA, two different siRNA were used to demonstrate that EXT1 knockdown affect the protein secretory pathway. To this end Calnexin marker was used, which is a protein involved in quality control of the secretory pathway. Cells treated with shRNA or siRNA EXT1 were stained with a mouse antibody for calnexin (www.abcam.com). Accordingly, the molecular chaperone calnexin, which assists protein folding in the ER, exhibited an aggregation pattern in KD_EXT1 cells. This aggregation might result in a decreased movement of molecules through the ER lumen.

Example 4: Additional shRNAs Efficiently Deplete Cells of EXT1

1. Methods

[0227] shRNA (Table 4) targeting human EXT1 gene and, as a control, an irrelevant sequence (shRNA control) were cloned into a lentiviral plasmid containing an ampicillin and puromycin resistant genes for selection in bacteria and in animal cells respectively. The plasmids were amplified using E. coli DH5 strain (Thermo Fisher Scientific®, Cat# 18265017), and DNA midi-preparation performed using a NucleoBond Xtra midi kit from Macherey-Nagel® (Cat# REF 740410.50).

TABLE-US-00004 selected nucleic acids encoding shRNA sequences targeting human EXT1 Vector Name EXT1 mRNA Target sequence SEQ ID NO: pLV[shRNA]-Puro-U6>hEXT1 [shRNA#1] ATTCTTGTGGGAGGCTTATTT SEQ ID NO: 33 pLV[shRNA]-Puro-U6>hEXT1 [shRNA#2] CCTTCTACAATCAGGTCTATT SEQ ID NO: 34 pLV[shRNA]-Puro-U6>hEXT1 [shRNA#3] CCCAACTTTGATGTTTCTATT SEQ ID NO: 35 pLV[shRNA]-Puro-U6>hEXT1 [shRNA#4] GAGTATGAGAAGTATGATTAT SEQ ID NO: 36 pLV[shRNA]-Puro-U6>hEXT1 [shRNA#5] CTTCGTTCCTTGGGATCAATT SEQ ID NO: 37 pLV[shRNA]-Puro-U6>hEXT1 [shRNA#6] AGCCAGATTGTGCCAACTATC SEQ ID NO: 38 pLV[shRNA]-Puro-U6>hEXT1 [shRNA#7] ATTTCGGAGGCTTGCAGTTTA SEQ ID NO: 39 pLV[shRNA]-Puro-U6>hEXT1 [shRNA#8] GTCCTGAGTCTGGATACTTTA SEQ ID NO: 40 pLV[shRNA]-Puro-U6>hEXT1 [shRNA#9] GCACTTAGACAGCAGACACAA SEQ ID NO: 41 pLV[shRNA]-Puro-U6>hEXT1 [shRNA#10] GAAGAACACAGCGGTAGGAAT SEQ ID NO: 42 pLV[shRNA]-Puro-U6>hEXT1 [shRNA#11] CAATTGTGAGGACATTCTCAT SEQ ID NO: 43 pLV[shRNA]-Puro-U6>hEXT1 [shRNA#12] CCTGCTTCGATTTCACCCTTT SEQ ID NO: 44 pLV[shRNA]-Puro-U6>hEXT1 [shRNA#13] CCTCAGTATGTGCACAATTTG SEQ ID NO: 45 pLV[shRNA]-Puro-U6>hEXT1 [shRNA#14] AGACACCAGGAATGCCTTATA SEQ ID NO: 46 pLV[shRNA]-Puro-U6>hEXT1 [shRNA#15] TGCCATTCTCTGAAGTGATTA SEQ ID NO: 47 pLV[shRNA]-Puro-U6>hEXT1 [shRNA#16] GGCGATGAGAGATTGTTATTA SEQ ID NO: 48 pLV[shRNA]-Puro-U6>hEXT1 [shRNA#17] CAGTTGAGAAGATTGTATTAA SEQ ID NO: 49 pLV[shRNA]-Puro-U6>hEXT1 [shRNA#18] CAATGGTAGGAATCATTTAAT SEQ ID NO: 50 pLV[shRNA]-Puro-U6>hEXT1 [shRNA#19] TCCTTACTACTATGCTAATTT SEQ ID NO: 51 pLV[shRNA]-Puro-U6>hEXT1 [shRNA#20] GTTGACAGGAGCTGCTATTTA SEQ ID NO: 52 pLV[shRNA]-Puro-U6>hEXT1 [shCTRL] TCCGCAGGTATGCACGCGTGAATT SEQ ID NO: 53

10×10.sup.6 HEK293 cells (ATCC®# CRL 1573) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum, 2 mmol/L L-glutamine and 100 I.U./ml penicillin and 100 .Math.g/ml streptomycin. Cells were incubated at 37° C. with 5% CO.sub.2 and 95% humidity. Cells we transfected with 10 .Math.gof each DNA construct (Table 4) using 10 .Math.l of Polyethylenimine (MW 25,000, Polysciences® cat# 9002-98-6). Forty-eight hours post-transfection, cells were cultured in the presence of 1 .Math.g/ml of puromycin (Sigma Aldrich®, Cat# P8833), to select for the expression of shRNA molecules. After selection, resistant cells were amplified and frozen.

[0228] For western blot, cells were lysed in immunoprecipitation low salt buffer (IPLS: 25 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40, and 5% glycerol, complete Protease Inhibitor (Roche®) and Halt Phosphatase Inhibitors (Thermo Fisher Scientific®)). SDS-PAGE and western blotting were performed using standard protocols. The following primary antibodies were used: rabbit-anti-GAPDH 1:2,000 (Abeam® ab8245), rabbit-anti-EXT1 1:500 (Prestige Antibodies, Sigma-Aldrich®, cat# HPA044394). A secondary anti-rabbit HRP-conjugated antibody (Santa Cruz®, Cat# sc-2357) was finally used to reveal positive immunoblotting.

[0229] For viral infectivity and transgene expression, the different EXT1-targeting shRNAs (#1 to #20) expressing HEK293 cell lines were cultured in 24-well plates in DMEM supplemented with 10% fetal bovine serum, 2 mmol/1 L-glutamine and 100 I.U./ml penicillin and 100 .Math.g/ml streptomycin. Cells were then infected with lentiviral or AAV2 particles expressing Nano-luciferase (NLuc) enzyme or green fluorescent protein (GFP), respectively. Twenty-four hours post-infection, NLuc activities or GFP fluorescence intensities were quantified using a Nanoluciferase kit (Promega® cat# N1120), or the Incucyte S3 live cells instrument (Sartorius®).

2. Results

[0230] Examination of the western blot results, after immunoblotting of cell lysates using anti-EXT1 and anti-GAPDH (FIGS. 32A-C), indicates that not all shRNA sequences used are able to reduce the levels of EXT1 expression in HEK293 cells. We identified 8 out of 20 tested shRNA sequences able to induce reduction of EXT1 levels in cells (Table 5).

TABLE-US-00005 nucleic acids encoding selected shRNA sequences targeting human EXT1 shRNA# EXT1 mRNA Target sequence SEQ ID NO: shRNA#3 CCCAACTTTGATGTTTCTATT SEQ ID NO: 35 shRNA#4 GAGTATGAGAAGTATGATTAT SEQ ID NO: 36 shRNA#7 ATTTCGGAGGCTTGCAGTTTA SEQ ID NO: 39 shRNA#11 CAATTGTGAGGACATTCTCAT SEQ ID NO: 43 shRNA#12 CCTGCTTCGATTTCACCCTTT SEQ ID NO: 44 shRNA#16 GGCGATGAGAGATTGTTATTA SEQ ID NO: 48 shRNA#18 CAATGGTAGGAATCATTTAAT SEQ ID NO: 50 shRNA#20 GTTGACAGGAGCTGCTATTTA SEQ ID NO: 52

[0231] To examine whether HEK293 knocked down for EXT1 expression could express transgenes from lentiviral particles and AAV2 serotypes viruses, we transduced knockdown confirmed cells with a nanoluciferase expressing lentivirus or a GFP expressing AAV2 virus at 1 plaque-forming unit (PFU). shRNA#3 and # 7 exhibited the highest productivity in both lentiviral and AAV systems (FIGS. 33A-B). Other EXT1 knockdown cells lines also showed significant productivity compared to controls cells, namely shEXT1#12, 16 and 20 for lentiviruses (FIG. 33A); and shEXT1# 11, 12, 16 and 20 for AAV viruses (FIG. 33B).

3. Conclusion

[0232] In addition to characterized shRNA and siRNA sequences targeting EXT1 (see examples 1-3), 8 additional sequences targeting EXT1 were further validated (Table 5), and a positive correlation between knockdown of EXT1 and HEK293 cell productivity was hereby confirmed.