ANTIBODY AND USES THEREOF
20230167179 · 2023-06-01
Assignee
Inventors
Cpc classification
C07K2317/76
CHEMISTRY; METALLURGY
A61P29/00
HUMAN NECESSITIES
C07K16/2866
CHEMISTRY; METALLURGY
C07K2317/92
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
An isolated monoclonal antibody against the interleukin 1-alpha or beta receptor antagonist, known as IL-1RA. The antibody inhibits the interaction of IL-1RA with the membrane-binding chain thereof, the interleukin-1 receptor. Also, nucleic acid molecule encoding for a light chain of the monoclonal antibody, and a nucleic acid molecule encoding for a heavy chain of the monoclonal antibody. Also, a method for treating an inflammatory, infectious or autoimmune disease, which includes administering the isolated monoclonal antibody or a nucleic acid coding for the isolated monoclonal antibody, and a method of or the diagnosis of an inflammatory, infectious or autoimmune diseases, which includes contacting a biological sample with the isolated monoclonal antibody.
Claims
1-14. (canceled)
15. An isolated monoclonal antibody against an interleukin 1 receptor antagonist, or IL-1RA, recognizing the peptide of amino acid sequence SEQ ID NO: 25, said antibody inhibiting the interaction between the interleukin-1 receptor antagonist and the interleukin-1 receptor, and having an affinity for the interleukin-1 receptor antagonist of less than 10.sup.−8 M, measured by the OCTET technique, or one of the derivative compounds or functional fragments of said antibody.
16. The antibody according to claim 15, recognizing a conformational or linear epitope of IL-1RA, said conformational or linear epitope comprising at least amino acid sequences SEQ ID NO: 36 and SEQ ID NO: 40 belonging to amino acid sequence SEQ ID NO: 25.
17. The antibody according to claim 16, wherein said conformational or linear epitope comprises at least sequences SEQ ID NO: 36, SEQ ID NO: 39 and SEQ ID NO: 40 belonging to amino acid sequence SEQ ID NO: 25.
18. The antibody according to claim 16, wherein said conformational or linear epitope further comprises amino acid sequences SEQ ID NO: 37 belonging to amino acid sequence SEQ ID NO: 25.
19. The antibody according to claim 15, comprising a light chain comprising at least one CDR of the group consisting of CDR-L1, CDR-L2 and CDR-L3, wherein: CDR-L1 comprises one of the sequences SEQ ID NO: 1 (KSSQSLLNSSNQKNYLA), SEQ ID NO: 4 and SEQ ID NO: 7, CDR-L2 comprises one of the sequences SEQ ID NO: 2, SEQ ID NO: 5, and SEQ ID NO: 8, CDR-L3 comprises one of the sequences SEQ ID NO: 3, SEQ ID NO: 6 and SEQ ID NO: 9, or one of its derivative compounds or functional fragments.
20. The antibody according to claim 15, comprising a heavy chain comprising at least one CDR of the group consisting of CDR-H1, CDR-H2 and CDR-H3, where CDR-H1 comprises one of the sequences SEQ ID NO: 10 (EYTMH), SEQ ID NO: 13 and SEQ ID NO: 16, CDR-H2 comprises one of the sequences SEQ ID NO: 11, SEQ ID NO: 14 and SEQ ID NO: 17, CDR-H3 comprises one of the sequences SEQ ID NO: 12, SEQ ID NO: 15 and SEQ ID NO: 18, or one of its derivative compounds or functional fragments.
21. The antibody according to claim 15, said antibody comprising a light chain comprising: the CDRs of sequences SEQ ID NO: 1 to 3, or the CDRs of sequences SEQ ID NO: 4 to 6, or the CDRs of sequences SEQ ID NO: 7 to 9.
22. The antibody according to claim 15, said antibody comprising a heavy chain comprising: the CDRs of sequences SEQ ID NO: 10 to 12, or the CDRs of sequences SEQ ID NO: 13 to 15, or the CDRs of sequences SEQ ID NO: 16 to 18.
23. The antibody according to claim 15, said antibody comprising: a variable part of the light chain comprising any one of the following sequences SEQ ID NO: 19 to 21, and a variable part of the heavy chain comprising any one of the following sequences SEQ ID NO: 22 to 24.
24. A Nucleic acid molecule coding for a light chain of the monoclonal antibody as defined in claim 15.
25. A Nucleic acid molecule coding for a heavy chain of the monoclonal antibody as defined in claim 15.
26. A method for treating an inflammatory, infectious or autoimmune disease, the method comprising the administration to an individual in a need thereof of an effective amount of one of: an isolated monoclonal antibody against the interleukin 1 receptor antagonist, or IL-1RA, recognizing the peptide of amino acid sequence SEQ ID NO: 25, wherein the antibody inhibits the interaction between the interleukin-1 receptor antagonist and the interleukin-1 receptor, and has an affinity for the interleukin-1 receptor antagonist of less than 10.sup.−8 M, measured by the OCTET technique, or a functional fragment thereof; and a nucleic acid molecule coding for the isolated monoclonal antibody or the functional fragment thereof.
27. A method for the diagnosis of an inflammatory, infectious or autoimmune diseases, the method comprising bringing a biological sample from an individual suspected of suffering from the inflammatory, infectious or autoimmune disease into contact with an isolated monoclonal antibody against an interleukin 1 receptor antagonist, or IL-1RA, recognizing the peptide of amino acid sequence SEQ ID NO: 25, said antibody inhibiting the interaction between the interleukin-1 receptor antagonist and the interleukin-1 receptor, and having an affinity for the interleukin-1 receptor antagonist of less than 10.sup.−8 M, measured by the OCTET technique, detecting the presence or absence of, or the amount of, the IL-1RA protein in said sample, and comparing the presence or absence of, or the amount of, the IL-1RA protein with the presence or absence of, or the amount of, the IL-1RA protein in at least one reference sample, whether it is a positive control or a negative control or both.
28. The antibody according to claim 15, said antibody comprising one of: a variable part of the light chain of sequence SEQ ID NO: 19 and a variable part of the heavy chain of sequence SEQ ID NO: 22, or a variable part of the light chain of sequence SEQ ID NO: 20 and a variable part of the heavy chain of sequence SEQ ID NO: 23, or a variable part of the light chain of sequence SEQ ID NO: 21 and a variable part of the heavy chain of sequence SEQ ID NO: 24.
29. The method according to claim 26, wherein the inflammatory, infectious or autoimmune disease is a Lyme disease.
30. The method according to claim 26, wherein the inflammatory, infectious or autoimmune disease is a chronic disseminated form of Lyme disease.
31. The method according to claim 27, wherein the inflammatory, infectious or autoimmune disease is a Lyme disease.
32. The method according to claim 27, wherein the inflammatory, infectious or autoimmune disease is a chronic disseminated form of Lyme disease.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0215]
[0216] The Y axis represents the optical density measured at 450 nm. For each sample, the first two columns represent testing with 20 and 10 ng/mL of biotinylated IL-1RA antigen, respectively, and the third column represents testing with the antigen interacting with the other antibody.
[0217]
[0218]
[0219]
[0220]
[0221]
[0222]
[0223]
[0224]
[0225]
DETAILED DESCRIPTION
Examples
Example 1: Production and Characterization of Murine Anti-IL-1RA Antibody
[0226] Immunization
[0227] BALB/C mice were immunized by injection into the footpads five times (weekly injections) with recombinant IL-1RA of sequence SEQ ID NO: 25.
[0228] Serum Test
[0229] The screening is carried out using the ELISA technique with a biotinylated IL-1RA antigen. The IL-1RA antigen is used at 20 ng and 10 ng/well.
[0230] The sera are diluted from 1/200 to 1/1600 with a dilution factor of 2, at the rate of 100 μL/well.
[0231] The incubation time is 1 hour at room temperature.
[0232] Serum from a mouse immunized with an antigen unrelated to IL-1RA is used as a negative control.
[0233] The anti-IL-1 RA antibody MAB280 from R&D Systems is used as a positive control.
[0234] The results obtained are shown in
[0235] Of the 5 sera tested, only serum 1 gives a signal. This signal is not very significant (OD less than 1 for a 1/200 dilution with 20 ng/well of biotinylated IL-1RA), but is specific to biotinylated IL-1RA because no signal is observed with a biotinylated antigen unrelated to IL-1RA as a negative control (TAc).
[0236] Cell Fusion
[0237] At the end of the immunization process, the blood and lymph node cells were fused with the X63/AG.8653 myeloma following conventional cell fusion protocols to obtain hybridomas.
All the fused cells are distributed in 12 96-well plates.
[0238] Selection of Clones
[0239] Following immunizations and fusions, 16 candidates were selected and cloned. [0240] 10 secrete IgG1 [0241] 1 secretes IgG2a [0242] 3 secrete a mixture of IgG1 and Ig2b [0243] 1 secretes a mixture of IgG2a and IgM [0244] 1 secretes IgG1+ as well as traces of IgG2a and Ig2b.
[0245] Only 8 of the 10 IgG1-secreting hybridomas are saved, and clonally isolated, then amplified and frozen for later experiments.
Example 2: Study of the Biological Activity of Antibodies on Murine T Line D10S
[0246] The biological activity of the 8 anti-IL-1RA antibodies was studied on murine T lymphocyte line D10S (ATCC® TIB-224), known to proliferate in the presence of IL-1. The commercial antibody MAB280 from R&D Systems, an antibody supplied as an IL-1RA blocker, was used as a positive control. D1 OS cells, weaned in IL-113 the day before the test, were cultured in the presence of IL-113 (25 pg/mL), IL-1RA (50 ng/mL) and purified anti-IL-1RA antibodies (10, 5, 2.5 and 1.25 μg/mL) for 72h. Cell proliferation was analyzed using the Guava EasyCyte Plus cytometer.
[0247] The 8 clones tested are as follows [0248] 903.8D8B1 [0249] 908.9E11B6 [0250] 908.9G5B9 [0251] 908.10E12C1 [0252] 908.10G3E12 [0253] 908.11A2H9 [0254] 908.11G7D4 [0255] 908.11H10C3
[0256] The antibodies serving as controls used are as follows: [0257] MAB280: commercial anti-IL-1RA (R&D Systems) [0258] B-D38 (CTRL IgG1) [0259] B-F33 (CTRL IgG2b).
[0260] The results obtained are shown in
[0261] The presence of IL-113 increases the proliferation of the D10S line by 2.5 times (line at 60,000). In the presence of IL-1RA, the proliferation of D10S is reduced by a factor of 1.7 (line at 35,000). Proliferation is totally restored in the presence of the 908.10E12C1 (A) and 908.9E11B6 (B) antibodies or partially restored in the presence of the 908.9G5B9 (C) antibody. The other 5 antibodies have little or no blocking activity. The R&D Systems antibody MAB280, described as blocking by the supplier, shows very weak blocking activity in this test. The isotype controls, B-D38 and B-F33, show no neutralizing effect.
[0262] Three anti-IL-1RA antibodies exhibit blocking activity of a biological function resulting from the interaction between IL-1β and its receptor: [0263] 908.10E12C1 (IgG1) [0264] 908.9E11B6 (IgG1), [0265] 908.9G5B9 (IgG1).
Example 3: Study of the Biological Activity of Antibodies on Human Osteosarcoma Cell Line MG63
[0266] Human osteosarcoma line MG-63 (ATCC CRL-1427) is known in particular to produce IL-6, easily measured by ELISA technique, in response to treatment with IL-1 (beta or alpha). We therefore selected this line to develop a biological test in which MG-63 is incubated in the presence of IL-1 beta to obtain synthesis of IL-6. Synthesis of IL-6, which will be neutralized by the addition of an excess of IL-1RA, which will compete with IL-1 beta, preventing the latter from acting.
[0267] The monoclonal antibodies are then added at different concentrations to measure their ability to neutralize the action of IL-1RA and therefore then allow IL-1 beta to act and induce the synthesis of IL-6. IL-6 which then measured by ELISA. A strong induction of IL-6 will then reflect the blocking nature of the anti-IL-1RA antibody studied.
[0268] The MG63 cell is seeded in triplicates in 96-well plates with flat bottoms, at the rate of 10,000 per well, under a volume of 100 microliters of RPMI medium+10% fetal calf serum. This is done in the presence of fixed quantities of IL-1 beta (1 ng/mL, R&D Systems) and IL-1RA (100 ng/mL, R&D Systems) and decreasing dilutions of the various anti-IL-RA antibodies ranging from 50 micrograms/mL, 10 micrograms/mL, 2 micrograms/mL to 0.4 micrograms/mL, and appropriate controls, as shown in
[0269] After 48 hours of culture in an incubator at 37° C. and 10% CO2, the culture supernatants are sampled and their IL-6 content assayed by ELISA (R&D Systems), following the recommendations of the kit supplier. The levels of IL-6 measured are expressed in pg/mL as represented on the Y axis of
[0270] All of the 8 antibodies studied show a more or less significant neutralizing activity with respect to IL-1RA. The most potent neutralizing antibodies to IL-1RA are: 9089E 11B6, 9089E G5B9 and 9089E E12C1.
Example 4: Affinity Study by OCTET
[0271] The affinity for the IL-1RA antigen of the 3 blocking antibodies is evaluated using Octet technology on streptavidin biosensors.
[0272] The analysis was performed with a 1:1 fit model.
[0273] The antibodies used are [0274] 908.9E11B6 [0275] 908.9G5B9 [0276] 908.10E12C1, [0277] B-D38 (CTRL isotypic IgG1), and [0278] MAB280 (R&D Systems), positive control
[0279] The 5 antibodies mentioned above were biotinylated at a 1:1 ratio (1 mole of biotin for 1 mole of antibody) and immobilized on the streptavidin biosensors at a rate of 5 μg/mL.
[0280] The IL-1RA antigen has a molecular weight of 17.25 kDa. This antigen was tested at 12 nM at the first point, then diluted 1.5 times on 6 points for the first 4 antibodies. For the MAB280 antibody, this antigen was tested at 50 nM at the first point, then diluted 1.5 times on 5 points.
[0281] The results are shown in
[0282] For each antibody, 4 concentrations were used to calculate the KD. The constant KD is related to the rate of complex formation (described by the rate constant of association, kon) and the rate of dissociation (described by the rate constant of dissociation, kdis), with KD=kdis/kon. A high affinity interaction is characterized by a low KD, rapid recognition (high kon) and stability of the complexes formed (low kdis). The R2 makes it possible to estimate the reliability of the results obtained (the closer it is to 1, the more reliable the results).
TABLE-US-00001 TABLE 1 Conc. IL-IRA KD kon kdis Antibody (nM) Response (M) (1/ms) (1/s) R2 908.9E11B6 8 0.3128 4.86E−09 1.78E+05 8.65E−04 0.9933 908.9E11B6 5.33 0.2289 4.86E−09 1.78E+05 8.65E−04 0.9933 908.9E11B6 3.55 0.1538 4.86E−09 1.78E+05 8.65E−04 0.9933 908.9E11B6 2.37 0.101 4.86E−09 1.78E+05 8.65E−04 0.9933 908.9G5B9 5.33 0.2 3.84E−09 3.42E+05 1.31E−03 0.9908 908.9G5B9 3.55 0.1318 3.84E−09 3.42E+05 1.31E−03 0.9908 908.9G5B9 2.37 0.092 3.84E−09 3.42E+05 1.31E−03 0.9908 908.9G5B9 1.58 0.0602 3.84E−09 3.42E+05 1.31E−03 0.9908 908.10E12C1 5.33 0.21 1.76E−09 2.64E+05 4.64E−04 0.9917 908.10E12C1 3.55 0.1499 1.76E−09 2.64E+05 4.64E−04 0.9917 908.10E12C1 2.37 0.107 1.76E−09 2.64E+05 4.64E−04 0.9917 908.10E12C1 1.58 0.0793 1.76E−09 2.64E+05 4.64E−04 0.9917 MAB280 50 0.1508 5.08E−08 1.42E+05 7.18E−03 0.9966 MAB280 33.3 0.1212 5.08E−08 1.42E+05 7.18E−03 0.9966 MAB280 22.2 0.1047 5.08E−08 1.42E+05 7.18E−03 0.9966 MAB280 14.8 0.0761 5.08E−08 1.42E+05 7.18E−03 0.9966 MAB280 9.87 0.0638 5.08E−08 1.42E+05 7.18E−03 0.9966
[0283] The three anti-IL-1RA antibodies tested all have a KD of the order of 10.sup.−9 M, which means that their affinity for IL-1RA is strong; the 908.10E12C1 antibody appears to be the most affined of the three because its KD is the lowest. The MAB280 antibody has an affinity 10 times lower (greater than 10.sup.−8 M), or even more, than the affinity of the antibodies selected in examples 2, 3 and is therefore not suitable for further development, according to the criteria retained by the pharmaceutical industry.
Example 5: Cloning
[0284] In order to clone the sequences encoding the three antibodies selected in Examples 2, 3 and 4, as well as the 903.8D8B1 and 908.11A2H9 antibodies, the cells that secrete said antibodies were cultured in order to collect the total RNAs.
[0285] The RNAs are subjected to two reverse transcription reactions using 5′CDS primers.
[0286] The reverse transcription products are then amplified by PCR-RACE using either a primer for the heavy chain or for the light chain.
[0287] The PCR products are then cloned into shuttle vectors, for amplification.
[0288] The insertion sequences are then sequenced.
[0289] Sequencing data was analyzed using the IgBlast database (http://www.ncbi.nlm.nih.gov/igblast/).
[0290] The sequences are given below.
[0291] The isotype of the antibody from clone 908.9G5 is IgG1/Kappa, that from clone 908.9E11 is IgG1/Lambda, that from clone 10E12 is IgG1/Kappa, that from clone 908.11A2H9 is IgG1/Kappa and that from clone 903.8D8B1 is IgG1/Kappa.
[0292] The sequences obtained are described in Table 2 below (the “leader” peptide is in bold):
TABLE-US-00002 TABLE 2 Clone Chain SEQ-ID Sequence 908.10E12 Light (VL) 27 ATGGAATCACAGACCCAGGTCCTCATGTTTCTTCTGCTCTGGGTAT CTGGTGCCTGTGCAGACATTGTGATGACACAGTCTCCATCCTCCCT GGCTATGTCAGTAGGACAGAAGGTCACTATGAGCTGCAAGTCCAGT CAGAGCCTTTTAAATAGTAGTAATCAAAAGAACTATTTGGCCTGGT ACCAGCAGAAACCAAGACAGTCTCCTAAACTTCTGGTATACTTTGC ATCCACTAGGGATTCTGGGGTCCCTGATCGCTTCTTAGGCAGTGGA TCTGGGACAGATTTCACTCTTACCATCAACCGTGTGCAGGCTGAAG ACCTGGCAGATTACTTCTGTCAGCAACATTATATTCTTCCTCCCAC GTTCGGTGCTGGGACCAAGCTGGAGCTGAAA Heavy (VH) 28 ATGGGATGGAGCTGGATCTTTCTCTTTCTCCTGTCAGGAACTGCAG GTGTCCTCTCTGAGGTCCAGCTGCAACAGTCTGGACCTGAGCTGGT GAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGACTTCTGGATAC ACATTCACTGAATACACCATGCACTGGGTGAAGCAGAGCCATGGAA AGAGCCTTGAGTGGATTGGAAGTATTAATCCTAACAATGGTGGTAC TAACTACAACCAGAAGTTCAAGGGCAAGGCCACATTGACTGTAGAC AAGTCCTCCAACACAGCCTACATGGAGCTCCGCAGCCTGACATCTG GTGATTCTGCAGTCTATTACTGTGCAAGAACTCTCTACTATGCTAT GGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCA 908.9E11 Light (VL) 29 ATGGCCTGGATTTCACTTATACTCTCTCTCCTGGCTCTCAGCTCAG GGGCCATTTCCCAGGCTGTTGTGACTCAGGAATCTGCACTCACCAC ATCACCTGGTGAAACAGTCACACTCACTTGTCGCTCAAGTACTGGG GCTGTTACAACTAGTAACTATGCCAACTGGGTCCAAGAAAAACCAG ATCATTTATTCACTGGTCTAATAGGTGGTACCAACAACCGAGCTCC AGGTGTTCCTGCCAGATTCTCAGGCTCCCTGATTGGAGACAAGGCT GCCCTCACCATCACAGGGGCACAGACTGAGGATGAGGCAATATATC ACTGTGCTCTATGGTACAGCAACCTTTGGGTGTTCGGTGGAAGAAC CAAACTGACTGTCCTA Heavy (VH) 30 ATGGCTGTCCTGGTGCTGTTCCTCTGCCTGGTTGCATTTCCAAGCT GTGTCCTGTCCCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGT GGCGCCCTCACAGAGCCTGTCCATCACTTGCACTGTCTCTGGGTTT TCATTAACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAA AGGGTCTGGAGTGGCTGGGAGTAATATGGGCTGGTGGAGTCACACA TTATAATTCGGCTCTCATGTCCAGACTGAACATCAGCAAAGACAAC TCCCAGAGCCAAGTTTTCTTAAAAATGAACAGTCTACGAACTGATG ACACAGCCATGTACTACTGTGCCAGAGGTGGGGCATTACTTCGGTC TCACTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCA 908.9G5 Light (VL) 31 ATGAGTGTGCCCACTCAGGTCCTGGGGTTGCTGCTGCTGTGGCTTA CAGGTGCCAGATGTGACATCCAGATGACTCAGTCTCCAGCCTCCCT ATCTGCATCTGTGGGAGAAACTGTCACCATCACATGTCGAGCAAGT GAGAATATTTTCATTTATTTAGCATGGTATCAGCAAAAACAGGGAA AATCTCCTCAGCTCCTGGTCTATAATGCAAAGACCTTAGCAGAAGG TGTGCCATCAAGGTTCAGTGGCAGTGGATCAGGCACACAGTTTTCT CTGAAGATCAACAGCCTTCTGCCTGAAGATTTTGGGAGTTATTACT GTCAACATCATTATGGTATTCCATTCACGTTCGGCTCGGGGACAAA GTTGGAAATAGAA Heavy (VH) 32 ATGAAATGCAGCTGGGTTATCTTCTTCCTGATGGCAGTGGTTACAG GGGTCAATTCAGAGGTTCAGCTGCAGCAGTCTGGGGCAGAGCTTGT GAAGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGTTTCTGGTTTC AACATTACAGACACCTATATACACTGGGTGAAGCAGAGGCCTGAAA AGGGCTTGGAGTGGATTGGAAGGATTGATCCTGCGAATGGTAATAC TAAATATGACCCGAAGTTACAGGGCAAGGCCACTATAACAGCAGAC ACATCCTCCAACACAGCCTACCTGCAGCTCAGCAGCCTGACATCTG AGGACACTGCCGTCTATTACTGTGCTAGAGATGGTACCTACGTTTA CTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCC TCA 903.8D8 Light (VL) 44 ATGGATTTTCAAGTGCAGATTTTCAGCTTCCTGCTAATGAGTGCCT CAGTCATAATGTCCAGGGGACAAATTGTTCTCACCCAGTCTCCAGC ACTCATGTCTGCATCTCCAGGGGAGAAGGTCACCATGACCTGCAGT GCCAGCTCAAGTGTAAGTTACATGTACTGGTACCAGCAGAAGCCAA GATCCTCCCCCAAACCCTGGATTTATCTCACATCCAACCTGGCTTC TGGAGTCCCTGCTCGCTTCAGTGGCAGTGGGTCTGGGACCTCTTAC TCTCTCACAATCAGCAGCATGGAGGCTGAAGATGCTGCCACTTATT ACTGCCAGCAGTGGAGTAGTAACCCACTCACGTTCGGTGCTGGGAC CAAGCTGGAGCTGAAA Heavy (VH) 45 ATGATGGTGTTAAGTCTTCTGTACCTGTTGACAGCCCTTCCGGGTA TCCTGTCAGACGTGCAGCTTCAGGATCAGGACCTAGCCTCGTGAAA CCTTCTCAGACTCTGTCCCTCACCTGTTCTGTCACTGGCGACTCCA TCACAGTGGTTACTGGAACTGGATCCGGAAATTCCCAGGGAATAAA CTTGAGTACATGGGGTACATAAGCTACGTGGTAGCACTTACTACAA TCCATCTCTCAAAAGTCGAATCTCCATCACTCGAGACACATCCAAG AACCATACTACCTGCAGTTGAATTCTGTGACTACTGAGGACACAGC CACATATTACTGTGCAAGATGGGGGCATGTTACTACGGTAGTAGCT ACTGGTACTTCGATGTCTGGGGCGCAGGGACCACGGTCACCGTCTC CTCA 908.11A2 Light (VL) 46 ATGGTATCCACACCTCAGTTCCTTGTATTTTTGCTTTTCTGGATTC CAGCCTCCAGAAGTGACATCTTGCTGACTCAGTCTCCAGCCATCCT GTCTGTGAGTCCAGGAGACAGAGTCAGTTTCTCCTGCAGGGCCAGT CAGACCATTGGCACAAACATACACTGGTATCACCAAACAACAAATG GTTCTCCAAGGCTTCTCATTAAGTATGCTTCTGAGTCTATCTCTGG GATCCCTTCCAGGTTTAGTGGCAGTGGATCAGGGACAGATTTTACT CTTACCATCATCAGTGTGGAGTCTGAAGATATTGCAGATTATTACT GTCAACAAAGTAATAGCTGGCCGCTCACGTTCGGTGCTGGGACCAA GCTGGAGCTGAAA Heavy (VH) 47 ATGGGATGGAGCTGTATCATCCTCTTCTTGGTAGCAACAGCTACAG GTGTCCACTCCCAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTGGT GAGGCCTGGGGCTTCAGTGAACCTGTCCTGCAAGGCTTCTGGCTAC ACCTTCACCAACTACTGGATAAACTGGGTGAAGCAGAGGCCTGGAC AAGGCCTTGAGTGGATCGGAAATATTCATCCTTATGATAGTTATAC TCACTACAATCAAAAGTTCAAGGGCAAGGCCACATTGACTGTAGAC AAATCCTCCAGCACGGCCTACATGCAGCTCAGCAGCCCGACATCTG AGGACTCTGCAGTCTATTTCTGTACAAGGAGGGGGGTACGACGGGA CGACTACTACTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTC TCCTCA
Example 6: Specificity Test
[0293] The inventors tested the specificity of the antibodies of the invention by measuring the interaction of said antibodies with IL-1α and IL-1β, with IL-1R1 soluble form, IL-1R11 soluble form and co-receptor IL-1RAcP soluble form.
[0294] The experiments are carried out by sandwich capture. A first antibody is fixed on a support; the molecule to be tested is then added to allow an interaction, then a second biotinylated antibody is added. After washing, the fixed antibody-tested molecule-biotinylated antibody interaction is measured by adding steptavidin-HRP (horseradish peroxidase), then the revelation is done by measuring the luminescence at 450 nm in the presence of chromogenic substrate 3,3′,5,5′-tetramethylbenzidine (TMB).
[0295] The capture antibodies are fixed on the support at the rate of 1 μg/well.
[0296] The recombinant proteins to be tested are incubated for 2 h at ambient temperature on the fixed antibodies at the rate of 1 ng/mL of recombinant protein over 7 half-fold dilutions. The recombinant proteins are: [0297] IL-1RA (R&D Systems, ref. 280-RA-050) [0298] IL-1 (R&D Systems, ref. 200-LA-002/CF)α [0299] IL-1 (R&D Systems, ref. 201-LB-005/CF)β [0300] IL-1R1 soluble form (R&D Systems, ref. 269-21R-100/CF) [0301] IL-1R11 soluble form (R&D Systems, ref. 263-2R-050/CF) [0302] IL-1RAcP soluble form (R&D Systems, ref. 9176-CP-100)
[0303] This is followed by incubation for 1 hour at ambient temperature of the biotinylated revealing antibodies.
[0304] Several pairs of antibodies are used: [0305] fixed 908.9G5/biotinylated 908.9E11 [0306] fixed 908.10G3/biotinylated 908.9E11 [0307] fixed 908.9G5/biotinylated 908.10E12 [0308] fixed 908.10G3/biotinylated 908.10E12, and [0309] fixed 908.10G3/biotinylated 908.11H10.
[0310] The results for each pair are shown in
[0311] As the 5 curves show, whatever the pair of antibodies tested, no cross-reactivity is observed with IL-1α, IL-1β, the IL-1RI receptor, the IL-1RII receptor or the IL-1RAcP co-receptor.
Example 7: Recognition of the Natural IL-1RA Protein
[0312] In order to ensure that the antibodies of the invention are capable not only of recognizing recombinant IL-1RA, but also native IL-1RA produced by human cells, the inventors took advantage of the properties of the THP-1 cell line to secrete soluble IL-1RA under stimulation with phorbol 12-myristate 13-acetate (PMA).
[0313] Thus, 5.Math.10.sup.5 cells per mL of THP1 cells were cultured with 100 nM of PMA. The culture supernatants (SN) were harvested at 72 h and then tested on different pairs of antibodies.
[0314] The experimental conditions are as follows: Test conditions [0315] Fixing: the capture antibodies are fixed at a rate of 1 μg/well [0316] Incubation for 2 hours at room temperature of the recombinant IL-1RA range 1 ng/mL at ½ on 5 points or 10 μl of THP1+/− PMA cell supernatant [0317] Incubation for 1 hour at room temperature of biotinylated revealing antibodies [0318] Addition of streptavidin-HRP, then of TMB [0319] Reading at 450 nm
[0320] Representative results obtained are shown in
[0321] Antibodies 908.11G7 and 908.11H10 are not very effective as capture antibodies and antibody 908.11A2 as biotinylated antibodies, so detection of soluble IL-1RA secreted by THP1 cells is not effective.
[0322] However, antibodies [0323] 908.9E11B6, [0324] 908.9G5B9, and [0325] 908.10E12C1,
[0326] are very effective and make it possible to recognize both the recombinant form and the natural form secreted by the THP1 cells.
Example 8: IL-1RA Assay in Human Serum
[0327] The inventors also attempted to assay IL-1RA in serum from individuals, using antibody pairs according to the protocol used in Example 7, where the sera were diluted to 1/5 then to 1/2 on 4 points (100 μL per well). The capture antibodies are fixed at a rate of 1 μg/well.
[0328] The results are represented in the following tables:
TABLE-US-00003 Dilution O.D. [IL-1RA 1 pg/mL Serum No. 1 ⅕ 1.435 64 1/10 1.007 80 1/20 0.686 88 1/40 0.401 50 Serum No. 2 ⅕ 1.858 87 1/10 0.908 69 1/20 0.613 72 1/40 0.331 19 Serum No. 3 ⅕ 0.571 16 1/10 0.381 10 1/20 0.431 32 1/40 0.381 41 Serum No. 4 ⅕ 1.328 58 1/10 0.709 47 1/20 0.46 38 1/40 0.368 35
[0329] fixed 908.9G5/biotinylated 908.9E11
TABLE-US-00004 TABLE 4 Dilution O.D. [IL-1RA 1 pg/mL Serum No. 1 ⅕ 1.192 107 1/10 0.869 141 1/20 0.606 163 1/40 0.462 196 Serum No. 2 ⅕ 2.048 204 1/10 0.784 122 1/20 0.546 136 1/40 0.433 170 Serum No. 3 ⅕ 0.626 43 1/10 0.445 45 1/20 0.341 43 1/40 0.303 52 Serum No. 4 ⅕ 1.171 105 1/10 0.699 103 1/20 0.426 82 1/40 0.325 72
[0330] fixed 908.10G3/biotinylated 908.9E11
TABLE-US-00005 TABLE 5 Dilution O.D. [IL-1RA 1 pg/mL Serum No. 1 ⅕ 1.109 50 1/10 0.652 49 1/20 0.472 59 1/40 0.456 111 Serum No. 2 ⅕ 1.41 66 1/10 0.637 48 1/20 0.439 52 1/40 0.329 55 Serum No. 3 ⅕ 0.46 14 1/10 0.364 18 1/20 0.299 21 1/40 0.288 37 Serum No. 4 ⅕ 1.029 45 1/10 0.535 36 1/20 0.419 47 1/40 0.265 27
[0331] coated 908.9G5/biotinylated 908.10E12
TABLE-US-00006 TABLE 6 Dilution O.D. [IL-1RAIpg/mL Serum No. 1 ⅕ 1.65 95 1/10 1.057 107 1/20 0.647 97 1/40 0.54 134 Serum No. 2 ⅕ 2.548 159 1/10 1.031 103 1/20 0.716 117 1/40 0.366 35 Serum No. 3 ⅕ 0.785 34 1/10 0.429 18 1/20 0.337 9 1/40 0.393 50 Serum No. 4 ⅕ 1.513 86 1/10 0.775 67 1/20 0.471 47 1/40 0.371 38
[0332] coated 908.10G3/biotinylated 908.10E12
[0333] These results show that the selected pairs do not assay IL-1 RA containing in human serum in an equivalent way: [0334] The two pairs fixed 908.10G3/biotinylated 908.9E11 and fixed 908.10G3/biotinylated 908.10E12 give concentrations that come closest to those described in the bibliography (of the order of 100 μg/mL, depending on the sera tested), and [0335] The two coated 908.9G5/biotinylated 908.9E11 and coated 908.9G5/biotinylated 908.10E12 pairs assay lower serum IL-1RA (of the order of 50 ng/mL).
[0336] The two fixed 908.10G3/biotinylated 908.9E11 and fixed 908.10G3/biotinylated 908.10E12 pairs seem best suited for assaying serum IL-1RA.
Example 9: “Spiking” Test
[0337] This test is based on a so-called “spiking” test with a calculation of the percentage of recovery, ratio of the quantity of protein assayed to the quantity of protein expected.
[0338] A test to assess the interaction of IL-RA with IL-1α, IL-1β, IL-1R1 soluble form, IL-1RII soluble form or IL-1RAcP soluble form was carried out on previously selected pairs, namely: [0339] fixed 908.9G5/biotinylated 908.9E11, [0340] fixed 908.10G3/biotinylated 908.9E11, [0341] fixed 908.9G5/biotinylated 908.10E12, and [0342] fixed 908.10G3/biotinylated 908.10E12.
[0343] The results obtained are as follows:
[0344] 1—Fixed 908.9G5/biotinylated 908.9E11 pair [0345] capture antibodies: 1 μg/well [0346] IL-RA range 50 μg/mL at ¼ on 4 points diluted in a solution at 500 μg/mL [0347] IL-1α (R&D Systems, ref. 200-LA-002/CF), [0348] IL-1β (R&D Systems, ref. 201-LB-005/CF), [0349] IL-1RI soluble form (R&D Systems, ref. 269-21R-100/CF), [0350] IL-1RII soluble form (R&D Systems, ref. 263-2R-050/CF) [0351] or IL-1RAcP soluble form (R&D Systems, ref. 9176-CP-100)
[0352] The labels and the incubation times, as well as the revelation, are the same as those described in the previous example.
[0353] The results are confined in the following Table 7:
TABLE-US-00007 TABLE 7 IL-1RA IL-1α [IL-1RA assayed after spiking] pg/mL “spiked” 51 23 12 5 with Recovery % 102 92 96 78 IL-1β [IL-1RA assayed after spiking] pg/mL 52 19 8 2 Recovery % 104 78 62 37 IL-1RI [IL-1RA assayed after spiking] pg/mL soluble 46 15 8 4 form Recovery % 91 62 60 61 IL-1RII [IL-1RA assayed after spiking] pg/mL soluble 43 18 7 2 form Recovery % 85 73 55 34 IL-1RAcP [IL-1RA assayed after spiking] pg/mL soluble 45 16 7 3 form Recovery % 90 65 57 47
[0354] 2—Fixed 908.10G3/biotinylated 908.9E11 pair [0355] capture antibodies: 1 μg/well [0356] IL-RA range 100 μg/mL at ¼ on 4 points diluted in a 1 ng/mL solution [0357] IL-1α (R&D Systems, ref. 200-LA-002/CF), [0358] IL-1β (R&D Systems, ref. 201-LB-005/CF), [0359] IL-1R1 soluble form (R&D Systems, ref. 269-21R-100/CF), [0360] IL-1R11 soluble form (R&D Systems, ref. 263-2R-050/CF) [0361] or IL-1RAcP soluble form (R&D Systems, ref. 9176-CP-100)
[0362] The results are confined in the following Table 8:
TABLE-US-00008 TABLE 8 IL-1RA IL-1α [IL-1RA assayed after spiking] pg/mL “spiked” 85 37 21 13 with Recovery % 85 74 86 107 IL-1β [IL-1RA assayed after spiking] pg/mL 89 37 22 12 Recovery % 89 75 86 98 IL-1RI [IL-1RA assayed after spiking] pg/mL soluble 63 24 15 10 form Recovery % 63 48 58 84 IL-1RII [IL-1RA assayed after spiking] pg/mL soluble 83 40 19 12 form Recovery % 83 80 75 92 IL-1RAcP [IL-1RA assayed after spiking] pg/mL soluble 84 31 17 11 form Recovery % 84 62 69 91
[0363] 3—Fixed 908.9G5/biotinylated 908.10E12 pair [0364] capture antibodies: 1 μg/well [0365] IL-1RA range 50 μg/mL at ½ on 4 points diluted in a solution at 500 μg/mL [0366] IL-1α (R&D Systems, ref. 200-LA-002/CF), [0367] IL-1β (R&D Systems, ref. 201-LB-005/CF), [0368] IL-1R1 soluble form (R&D Systems, ref. 269-21R-100/CF), [0369] IL-1R11 soluble form (R&D Systems, ref. 263-2R-050/CF) [0370] or IL-1RAcP soluble form (R&D Systems, ref. 9176-CP-100)
[0371] The results are confined in the following Table 8:
TABLE-US-00009 TABLE 9 IL-1RA IL-1α [IL-1RA assayed after spiking] pg/mL “spiked” 46 19 10 5 with Recovery % 93 75 77 77 IL-1β [IL-1RA assayed after spiking] pg/mL 50 19 10 6 Recovery % 100 78 82 99 IL-1RI [IL-1RA assayed after spiking] pg/mL soluble 43 19 9 4 form Recovery % 86 75 72 68 IL-1RII [IL-1RA assayed after spiking] pg/mL soluble 49 18 10 5 form Recovery % 98 73 82 88 IL-1RAcP [IL-1RA assayed after spiking] pg/mL soluble 44 20 10 5 form Recovery % 87 79 80 87
[0372] 4—Fixed 908.10G3/biotinylated 908.10E12 [0373] capture antibodies: 1 μg/well [0374] IL-RA range 100 μg/mL at ½ on 4 points diluted in a solution at 500 μg/mL [0375] IL-1α (R&D Systems, ref. 200-LA-002/CF), [0376] IL-1β (R&D Systems, ref. 201-LB-005/CF), [0377] IL-1R1 soluble form (R&D Systems, ref. 269-21R-100/CF), [0378] IL-1R11 soluble form (R&D Systems, ref. 263-2R-050/CF) [0379] or IL-1RAcP soluble form (R&D Systems, ref. 9176-CP-100)
[0380] The results are confined in the following Table 8:
TABLE-US-00010 TABLE 10 IL-1RA IL-1α [IL-1RA assayed after spiking] pg/mL “spiked” 46 21 11 6 with Recovery % 92 83 87 97 IL-1β [IL-1RA assayed after spiking] pg/mL 44 21 12 6 Recovery % 89 84 95 98 IL-1RI [IL-1RA assayed after spiking] pg/mL soluble 40 19 10 6 form Recovery % 80 77 77 99 IL-1RII [IL-1RA assayed after spiking] pg/mL soluble 44 21 12 6 form Recovery % 89 84 95 93 IL-1RAcP [IL-1RA assayed after spiking] pg/mL soluble 45 19 11 8 form Recovery % 90 78 92 122
[0381] A recovery percentage is considered good for values between 80 and 120%, i.e. a variation of 20% between the quantity measured and the quantity theoretically added. In general, the lower the quantity of protein to be detected, the more the variation in the recovery percentage tends to increase beyond 20%.
[0382] In this test, the interactions between proteins are evaluated at a ratio of 10 at the first point, but this ratio is almost 100 for the fourth point, which makes good quantification even more difficult at low concentrations.
[0383] The recovery percentages found in these tests are good or very good
[0384] This means that the evaluated proteins do not interfere with the assay of IL-1RA, at least for an assay carried out with the first four pairs.
Example 10: Epitope Mapping
[0385] The epitope mapping of the 3 blocking antibodies selected in examples 2, 3 and 4 and of two non-blocking antibodies (903.8D8B1 and 908.11A2H9) was evaluated using the MAbTope software (MabSilico).
[0386] This software allows the construction of 3D structural models of the target end of antibodies from models used to model the heavy chain domain (VH) and the light chain domain (VL) as well as the relative orientation between the VH and VL domains.
[0387] The modeling data used for the 5 antibodies are summarized in the following table:
TABLE-US-00011 TABLE 11 Orientation based Antibody VH Model VL Model on 908.9E11B6 PBD: 3vfg PBD: 7jti PBD: 3vfg 908.10E12C1 PBD: 1a6t PBD: 6bt3 PBD: 1a6t 908.9G5B9 PBD: 5hdb PBD: 1kb5 PBD: 5hdb 903.8D8B1 PBD: 1dqd PBD: 1sy6 PBD: 1dqd 908.11A2H9 PBD: 1iqw PBD: 4krp PBD: 1iqw
[0388] The results obtained are presented in
[0389] In
[0390] From the results obtained, 5 common recognition sequences (modules numbered from I to V) were able to be determined. Regarding the mapping of the 903.8D8B1 antibody, particular sequences (unboxed) can also be considered (SEQ ID NO: 41, SEQ ID NO: 42 and SEQ ID NO: 43) to define the epitope.
[0391] In
[0392] It is also noted that sequence IV of IL-1RA is recognized by all of the blocking antibodies and none of the non-blocking antibodies.
[0393] Sequence II, corresponding to the third binding site of IL-1RA, is recognized by two (908.10E12C1 and 908.9G5B9) of the three blocking antibodies and by the two non-blocking antibodies. The results obtained by this evaluation of the epitopes are consistent with the blocking and non-blocking functions of the antibodies.
[0394]
Example 11: Diagnosis of the Chronic Form of Lyme Disease
[0395] In this example, the inventors have shown that an ELISA using the anti-IL-1RA monoclonal antibodies according to the invention advantageously makes it possible to obtain diagnostic results in patients suffering from a chronic form of Lyme disease. In addition, the inventors have demonstrated that using the antibodies according to the invention in the context of determining the ratio of IL-1RA/interferon-γ concentrations makes it possible to be discriminating with respect to several groups of patients affected by Lyme disease at different stages. To this end, the 908.10G3 antibody was used as the fixing antibody, and the 908.9E11 antibody conjugated with biotin was used as the tracer, as described in detail in the aforementioned table no. 4
[0396] The patients tested were separated into 4 groups: Group A (healthy control); Group B (patients with an acute form of Lyme disease—without immunosuppression); Group C (patients with an acute form of Lyme disease who relapsed from the initial treatment); Group D (patients developing remote Lyme pathology in a chronic form).
[0397] The results are shown in
[0398] These results show that the ratio of IL-1RA/interferon-γ concentrations is identical in healthy people (Group A) and patients who have just been bitten by a tick infected with Borrelia (Group B) (p=0.881). The results also show that the ratio of IL-1RA/interferon-γ concentrations is significantly different between group A and group C or D (p=0.012; p=0.022), between group B and group C or D (p=0.050; p=0.017) as well as between group C and group D (p=0.041).
[0399] It can be concluded from these results that the antibodies according to the invention can be used for diagnosis of the complex forms of Lyme disease and differentiation in patients of the different stages of the disease. Furthermore, these results strengthen the diagnostic link between the amounts of IL-1RA and IFN differentially synthesized by healthy people or people developing an acute response with cutaneous inflammation, versus people who show immunosuppression during a relapse to the initial treatment or late and chronic forms of the disease.
Example 12: Treatment of the Chronic Form of Lyme Disease
[0400] The treatment of the chronic form of Lyme disease was carried out on a mouse model and a rhesus macaque model. The objective was to analyze the effect of blocking IL-1RA in resolving late Lyme disease in these animals, and the possibility of reversing the development of the disease by treating them with antibodies neutralizing the IL-1RA associated with antibiotics. Another aspect of the analysis was also to study the effect of exogenous IL-1RA intake during the disease, and to analyze the impact on the increase in the pathological response.
[0401] To this end, the inventors used IL-1RA neutralizing antibodies according to the invention, isotype control IgG antibodies, and mouse or macaque IL-1RA. Response tracking essentially focused on the analysis of the osteo-articular component of the disease.
[0402] The mice/macaques were infected with the N40 strain of B. burgdorferi (50,000 bacteria) as previously described for the mouse model (Jie Feng et al., Discov Med 27(148):125-138, March 2019).
[0403] For each experiment (mice and macaques), 13 groups of 6 individuals each were distributed as follows:
[0404] (1) Doxycycline treatment only
[0405] (2) infection only
[0406] (3) infection+doxycycline
[0407] (4) doxycycline+anti-IL-1RA antibodies
[0408] (5) infection+anti-IL-1RA antibodies
[0409] (6) infection+doxycycline+anti-IL-1RA antibodies
[0410] (7) infection control+doxycycline+IgG
[0411] (8) doxycycline+IgG control
[0412] (9) infection control+IgG
[0413] (10) infection control+doxycycline+IgG
[0414] (11) doxycycline+IL-1RA
[0415] (12) infection+IL-1RA
[0416] (13) infection+doxycycline+IL-1RA
[0417] For the mice, the injections of anti-IL-1RA antibodies and the IgG control consisted of intraperitoneal (IP) injections (90 micrograms) once a week, starting on day 21 (days 21, 28, 35). Doxycycline treatment consisted of oral administration twice a day for 21 days. IL-1RA injections consisted of IP injections (2 micrograms/injection) every 3 days, starting on day 21 (days 21, 24, 27, 30, 33, 36 and 39). Treatments began on day 21 post-infection. An autopsy was early endpoint at day 49 (n=3), or late endpoint at day 90 (n=3). Joint swelling was measured with a caliper up to 6 times between days 14 and 28 of infection. Blood was collected on day 0, every 2 weeks until autopsy, and on days 1, 3, and 5 during antibody and/or doxycycline treatment.
[0418] The treatment protocol for rhesus macaques was the same as for mice, notwithstanding that the dosages and reagents were adapted to the size and species of macaques.
[0419] Furthermore, the inventors have carried out preclinical tests on humans using an IL-1RA neutralizing antibody according to the invention to prevent the inflammation of the Borrelia burgdorferi infection. A preclinical test of the impact of the cytokine IL-1RA on the increase in the pathological response was also carried out.