Compositions and methods for treating and preventing graft versus host disease

11260083 · 2022-03-01

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided herein are compositions and methods for administering bacterial strains to reduce GvHD and improve survival after allogeneic BMT.

Claims

1. A method of treating Graft versus Host Disease (GvHD), the method comprising administering to the digestive tract of a subject in need thereof a therapeutically effective amount of a bacterial composition, the bacterial composition comprising bacterial strains comprising 16S rDNA sequences of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO: 11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, and SEQ ID NO:17, wherein said bacterial composition is administered prior to and following a bone marrow transplant.

2. The method of claim 1, wherein one or more of the bacterial strains does not have an antibiotic resistance gene.

3. The method of claim 1, wherein one or more of the bacterial strains is not resistant to vancomycin.

4. The method of claim 1, wherein one or more of the bacterial strains produces butyrate.

5. The method of claim 1, wherein the method does not include the administration of an antibiotic.

6. The method of claim 1, wherein the bacterial composition is administered every other day for 14 days prior to bone marrow transplant.

7. The method of claim 1, wherein the bacterial composition is administered every other day for at least 21 days after bone marrow transplant.

8. The method of claim 1, wherein the subject has chronic GvHD.

9. The method of claim 1, wherein the subject has acute GvHD.

10. The method of claim 1, wherein the bacterial composition is a pharmaceutical composition.

11. The method of claim 10, wherein the pharmaceutical composition comprises a pharmaceutical acceptable excipient.

12. The method of claim 10, wherein the pharmaceutical composition is formulated for oral administration.

13. The method of claim 10, wherein the pharmaceutical composition is formulated for delivery to the intestine.

14. The method of claim 10, wherein the pharmaceutical composition is formulated for delivery to the colon.

15. The method of claim 1, wherein one or more of the bacterial strains is lyophilized.

16. The method of claim 10, wherein the pharmaceutical composition is in the form of a capsule.

17. The method of claim 10, wherein the pharmaceutical composition further comprises a pH sensitive composition comprising one or more enteric polymers.

Description

DESCRIPTION OF THE FIGURES

(1) FIG. 1. (FIG. 1A) Schematic of fatty acid analysis. (FIG. 1B) Fatty acid levels (short and long chain) in the intestinal luminal contents (stool) and (FIG. 1C) in the intestinal tissue of animals in experimental groups.

(2) FIG. 2. (FIG. 2A) Expression level of SLC5A8 (transporter) and (FIG. 2B) GPR43 (signaling receptor) in CD326+ purified intestinal epithelial cells (IECs) of syngeneic (BALB/c.fwdarw.BALB/c) or allogeneic (C57BL/6.fwdarw.BALB/c) BMT recipients. (FIG. 2C) Level of acetyl-histone H4 (FIG. 2D) levels of histone deacetylase (HDAC) and (FIG. 2E) histone acetyltransferase (HAT) enzymes in IECs (CD326+) of syngeneic and allogeneic transplant recipients.

(3) FIG. 3. (FIG. 3A) Acetylated histone-H4 of CD326+ purified intestinal epithelial cells of syngeneic (BALB/c.fwdarw.BALB/c) or allogeneic (C57BL/6.fwdarw.BALB/c) BMT recipients treated daily with intragastric vehicle or butyrate (10 mg/kg) for 21 days. (FIG. 3B) Weight loss on day 21 (FIG. 3C) GVHD clinical score (FIG. 3D) survival and (FIG. 3E) intestinal histopathology of recipients of bone marrow transplant receiving intragastric butyrate or vehicle.

(4) FIG. 4. (FIG. 4A) Transmission electron microscopy (TEM) of intestines, isolated from recipients of syngeneic or allogeneic transplant with or without intragastric gavage of butyrate; stained with ruthenium red (0.1%). Arrows indicate cell junctions. (FIG. 4B) Level of FITC-dextran translocation across the GI-barrier into blood serum. (FIG. 4C) Total intestinal cell recovery (FIG. 4D) intestinal immunophenotypical analysis and (FIG. 4E) ratio of Treg (FoxP3+) to effector cells (FoxP3-) in recipients of allo-BMT treated with vehicle (custom character) and butyrate (custom character).

(5) FIG. 5. (FIG. 5A) CD326+ purified intestinal epithelial cells (IECs) cultured in the presence or absence of butyrate and withheld (left panel) or subjected to (right panel) irradiation (6 Gy). (FIG. 5B) Allogeneic CD8+ T cell killing assay. CD326+ IECs incubated with or without butyrate overnight followed by co-culture with allo-primed CD8+ T cells. (FIG. 5C) Chromatin immunoprecipitation (ChIP) of primary CD326+ IECs treated in the presence or absence of butyrate overnight. qPCR analysis of the promoter region of the BCL-B gene. (FIG. 5D) Culture of intestinal stem cells in the presence or absence of butyrate. (FIG. 5E) mRNA expression of claudins. (FIG. 5F) Expression level of pro-apoptotic proteins BAK (left) and BAX (right) (FIG. 5G) anti-apoptotic protein BCL-B, and (FIG. 5H), junctional proteins in CD326+ purified IECs isolated 21 days following allo-BMT.

(6) FIG. 6. (FIG. 6A) 16S rRNA-encoding gene sequencing of stool for percent of 17 Clostridal strains in total GI community on day −1 and day +35, relative to BMT on day 0. (FIG. 6B) GVHD clinical score and (FIG. 6C) survival following syngeneic (BALB/c.fwdarw.BALB/c) and allogeneic BMT (C57BL/6.fwdarw.BALB/c) with vehicle or 17-strain administration. (FIG. 6D) Obligate anaerobes of C57BL/6 (H-2b) mice were targeted with antibiotic mixture (ampicillin 5 mg, metronidazole 4 mg, clindamycin 5 mg, and vancomycin 5 mg) by intragastric gavage for 6 days followed by colonization withcocktails of indicated bacteria, 4 and 6 days later. Animals received BMT from donor B10.BR (H-2k) mice and (FIG. 6E) followed for survival.

(7) FIG. 7. SEQ ID NOs:1-17.

DEFINITIONS

(8) As used herein, the term “host cell” refers to any eukaryotic or prokaryotic cell (e.g., bacterial cells such as E. coli, yeast cells, mammalian cells, avian cells, amphibian cells, plant cells, fish cells, and insect cells), whether located in vitro or in vivo. For example, host cells may be located in a transgenic animal.

(9) As used herein, the term “prokaryotes” refers to a group of organisms that usually lack a cell nucleus or any other membrane-bound organelles. In some embodiments, prokaryotes are bacteria. The term “prokaryote” includes both archaea and eubacteria.

(10) As used herein, the term “subject” refers to individuals (e.g., human, animal, or other organism) to be treated by the methods or compositions of the present disclosure. Subjects include, but are not limited to, mammals (e.g., murines, simians, equines, bovines, porcines, canines, felines, and the like), and most preferably includes humans. In the context of the disclosure, the term “subject” generally refers to an individual who will receive or who has received treatment for a condition characterized by the presence of biofilm-forming bacteria, or in anticipation of possible exposure to biofilm-forming bacteria.

(11) As used herein the term, “in vitro” refers to an artificial environment and to processes or reactions that occur within an artificial environment. In vitro environments include, but are not limited to, test tubes and cell cultures. The term “in vivo” refers to the natural environment (e.g., an animal or a cell) and to processes or reaction that occur within a natural environment.

(12) As used herein, the term “effective amount” refers to the amount of a composition (e.g., a composition comprising bacteria described herein) sufficient to effect beneficial or desired results. An effective amount can be administered in one or more administrations, applications or dosages and is not intended to be limited to a particular formulation or administration route.

(13) As used herein, the term “administration” refers to the act of giving a drug, prodrug, or other agent, or therapeutic treatment (e.g., compositions comprising bacteria described herein) to a physiological system (e.g., a subject or in vivo, in vitro, or ex vivo cells, tissues, and organs). Exemplary routes of administration to the human body can be through the eyes (ophthalmic), mouth (oral), skin (transdermal), nose (nasal), lungs (inhalant), oral mucosa (buccal), ear, by injection (e.g., intravenously, subcutaneously, intratumorally, intraperitoneally, etc.), topical administration and the like.

(14) As used herein, the term “co-administration” refers to the administration of at least two agent(s) (e.g., bacteria described herein in combination with an additional agent) or therapies to a subject. In some embodiments, the co-administration of two or more agents or therapies is concurrent. In other embodiments, a first agent/therapy is administered prior to a second agent/therapy. Those of skill in the art understand that the formulations and/or routes of administration of the various agents or therapies used may vary. The appropriate dosage for co-administration can be readily determined by one skilled in the art. In some embodiments, when agents or therapies are co-administered, the respective agents or therapies are administered at lower dosages than appropriate for their administration alone. Thus, co-administration is especially desirable in embodiments where the co-administration of the agents or therapies lowers the requisite dosage of a potentially harmful (e.g., toxic) agent(s).

(15) As used herein, the term “pharmaceutical composition” refers to the combination of an active agent (e.g., bacteria described herein) with a carrier, inert or active, making the composition especially suitable for diagnostic or therapeutic use in vitro, in vivo or ex vivo.

(16) The terms “pharmaceutically acceptable” or “pharmacologically acceptable,” as used herein, refer to compositions that do not substantially produce adverse reactions, e.g., toxic, allergic, or immunological reactions, when administered to a subject.

(17) As used herein, the term “pharmaceutically acceptable carrier” refers to any of the standard pharmaceutical carriers including, but not limited to, phosphate buffered saline solution, water, emulsions (e.g., such as an oil/water or water/oil emulsions), and various types of wetting agents, any and all solvents, dispersion media, coatings, sodium lauryl sulfate, isotonic and absorption delaying agents, disintrigrants (e.g., potato starch or sodium starch glycolate), and the like. The compositions also can include stabilizers and preservatives. For examples of carriers, stabilizers, and adjuvants. (See e.g., Martin, Remington's Pharmaceutical Sciences, 15th Ed., Mack Publ. Co., Easton, Pa. (1975), incorporated herein by reference). In certain embodiments, the compositions of the present disclosure may be formulated for veterinary, horticultural or agricultural use. Such formulations include dips, sprays, seed dressings, stem injections, sprays, and mists. In certain embodiments, compositions of the present disclosure may be used in any application where it is desirable to alter (e.g., inhibit) the formation of biofilms, e.g., food industry applications; consumer goods (e.g., medical goods, goods intended for consumers with impaired or developing immune systems (e.g., infants, children, elderly, consumers suffering from disease or at risk from disease), and the like.

(18) As used herein, the term “therapeutic agent,” refers to compositions that decrease the infectivity, morbidity, or onset of mortality in a subject (e.g., a transplant recipient) or that prevent infectivity, morbidity, or onset of mortality in a host. As used herein, therapeutic agents encompass agents used prophylactically, e.g., before transplant. Such agents may additionally comprise pharmaceutically acceptable compounds (e.g., adjuvants, excipients, stabilizers, diluents, and the like). In some embodiments, the therapeutic agents of the present disclosure are administered in the form of topical compositions, injectable compositions, ingestible compositions, and the like. When the route is topical, the form may be, for example, a solution, cream, ointment, salve or spray.

(19) The terms “bacteria” and “bacterium” refer to all prokaryotic organisms, including those within all of the phyla in the Kingdom Procaryotae. It is intended that the term encompass all microorganisms considered to be bacteria including Mycoplasma, Chlamydia, Actinomyces, Streptomyces, and Rickettsia. All forms of bacteria are included within this definition including cocci, bacilli, spirochetes, spheroplasts, protoplasts, etc. Also included within this term are prokaryotic organisms that are Gram-negative or Gram-positive. “Gram-negative” and “Gram-positive” refer to staining patterns with the Gram-staining process, which is well known in the art. (See e.g., Finegold and Martin, Diagnostic Microbiology, 6th Ed., CV Mosby St. Louis, pp. 13-15 (1982)). “Gram-positive bacteria” are bacteria that retain the primary dye used in the Gram-stain, causing the stained cells to generally appear dark blue to purple under the microscope. “Gram-negative bacteria” do not retain the primary dye used in the Gram-stain, but are stained by the counterstain. Thus, Gram-negative bacteria generally appear red.

(20) The term “non-pathogenic bacteria” or “non-pathogenic bacterium” includes all known and unknown non-pathogenic bacterium (Gram-positive or Gram-negative) and any pathogenic bacterium that has been mutated or converted to a non-pathogenic bacterium. Furthermore, a skilled artisan recognizes that some bacteria may be pathogenic to specific species and non-pathogenic to other species; thus, these bacteria can be utilized in the species in which it is non-pathogenic or mutated so that it is non-pathogenic.

(21) As used herein, the term “cell culture” refers to any in vitro culture of cells, including, e.g., prokaryotic cells and eukaryotic cells. Included within this term are continuous cell lines (e.g., with an immortal phenotype), primary cell cultures, transformed cell lines, finite cell lines (e.g., non-transformed cells), bacterial cultures in or on solid or liquid media, and any other cell population maintained in vitro.

(22) As used herein, the term “sample” is used in its broadest sense. In one sense, it is meant to include a specimen or culture obtained from any source, as well as biological and environmental samples. Biological samples may be obtained from animals (including humans) and encompass fluids, solids, tissues, and gases. Biological samples include blood products, such as plasma, serum and the like. Such examples are not however to be construed as limiting the sample types applicable to the present disclosure.

DETAILED DESCRIPTION

(23) Provided herein are compositions and methods for administering bacterial strains to reduce GvHD and improve survival after allogeneic BMT.

(24) Graft-versus-host disease (GvHD) is a medical complication following the receipt of transplanted tissue from a genetically different person. GvHD is commonly associated with stem cell transplant (bone marrow transplant), but the term also applies to other forms of tissue graft. Immune cells (white blood cells) in the donated tissue (the graft) recognize the recipient (the host) as foreign (non-self). The transplanted immune cells then attack the host's body cells. GvHD can also occur after a blood transfusion if the blood products used have not been irradiated or treated with an approved pathogen reduction system.

(25) Whereas transplant rejection occurs when the host rejects the graft, GvHD occurs when the graft rejects the host. The underlying principle (alloimmunity) is the same, but the details and course may differ. In the classical sense, acute graft-versus-host-disease is characterized by selective damage to the liver, skin (rash), mucosa, and the gastrointestinal tract. Newer research indicates that other graft-versus-host-disease target organs include the immune system (the hematopoietic system, e.g., the bone marrow and the thymus) itself, and the lungs in the form of immune-mediated pneumonitis. Biomarkers can be used to identify specific causes of GvHD, such as elafin in the skin. Chronic graft-versus-host-disease also attacks the above organs, but over its long-term course can also cause damage to the connective tissue and exocrine glands.

(26) Acute GvHD of the GI tract can result in severe intestinal inflammation, sloughing of the mucosal membrane, severe diarrhea, abdominal pain, nausea, and vomiting. This is typically diagnosed via intestinal biopsy. Liver GvHD is generally measured by the bilirubin level in acute patients. Skin GvHD results in a diffuse red maculopapular rash, sometimes in a lacy pattern. Mucosal damage to the vagina can result in severe pain and scarring, and appears in both acute and chronic GvHD. This can result in an inability to have sexual intercourse.

(27) Acute GvHD is staged as follows: overall grade (skin-liver-gut) with each organ staged individually from a low of 1 to a high of 4. Patients with grade IV GvHD usually have a poor prognosis. If the GvHD is severe and requires intense immunosuppression involving steroids and additional agents to get under control, the patient may develop severe infections as a result of the immunosuppression and may die of infection.

(28) In the oral cavity, chronic graft-versus-host-disease manifests as lichen planus with a higher risk of malignant transformation to oral squamous cell carcinoma in comparison to the classical oral lichen planus. Graft-versus-host-disease-associated oral cancer may have more aggressive behavior with poorer prognosis, when compared to oral cancer in non-hematopoietic stem cell transplantation patients.

(29) In the clinical setting, graft-versus-host-disease is divided into acute and chronic forms, and scored or graded on the basis of the tissue affected and the severity of the reaction. The acute or fulminant form of the disease (aGvHD) is normally observed within the first 100 days post-transplant, and is a major challenge to transplants owing to associated morbidity and mortality.

(30) The chronic form of graft-versus-host-disease (cGvHD) normally occurs after 100 days. The appearance of moderate to severe cases of cGvHD adversely influences long-term survival.

(31) Intravenously administered glucocorticoids, such as prednisone, are the standard of care in acute GvHD and chronic GvHD. The use of these glucocorticoids is designed to suppress the T-cell-mediated immune onslaught on the host tissues; however, in high doses, this immune-suppression raises the risk of infections and cancer relapse and has other undesirable side effects.

(32) I. Compositions

(33) In one aspect, the disclosure provides methods comprising bacterial compositions, wherein the bacterial composition comprises one or more bacterial strains selected from the group consisting of VE202-1, VE202-3, VE202-4, VE202-6, VE202-7, VE202-8, VE202-9, VE202-13, VE202-14, VE202-15, VE202-16, VE202-18, VE202-21, VE202-26, VE202-27, VE202-28, and VE202-29. The VE-202 strains have been described in detail, for instance in Atarashi et al. Nature 2013, 500: 232-237 and supplemental materials, Narushima et al., Gut Microbes 2014: 5(3): 333-339, and PCT published application WO2013/080561, all of which are incorporated by reference in their entirety. A summary of the seventeen VE-202 strains is provided in Table 1. The genomes of the VE-202 strains have been deposited in the NCBI database, and the Genbank Assembly Accession ID of each of the VE202 strains is provided in Table 1. In addition, Table 1 provides the SEQ ID NOs of the 16S rDNA sequences determined from the Genbank Assembly Accession ID nucleotide sequences and/or through targeted sequencing. The 16S rDNA sequences are a subsequence of the Genbank Accession IDs, also depicted in Table 1.

(34) In one aspect, the disclosure provides methods comprising bacterial compositions, wherein the bacterial composition comprises at least two bacterial strains selected from the group consisting of VE202-1, VE202-3, VE202-4, VE202-6, VE202-7, VE202-8, VE202-9, VE202-13, VE202-14, VE202-15, VE202-16, VE202-18, VE202-21, VE202-26, VE202-27, VE202-28, and VE202-29. In some embodiments of the methods provided herein, the bacterial composition comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 bacterial strains.

(35) In one aspect, the disclosure provides methods comprising bacterial compositions, wherein the bacterial composition comprises VE202-1, VE202-3, VE202-4, VE202-6, VE202-7, VE202-8, VE202-9, VE202-13, VE202-14, VE202-15, VE202-16, VE202-18, VE202-21, VE202-26, VE202-27, VE202-28, and VE202-29. In one aspect, the disclosure provides methods comprising bacterial compositions, wherein the bacterial composition essentially consists of VE202-1, VE202-3, VE202-4, VE202-6, VE202-7, VE202-8, VE202-9, VE202-13, VE202-14, VE202-15, VE202-16, VE202-18, VE202-21, VE202-26, VE202-27, VE202-28, and VE202-29. As used herein, “essentially consist of” refers to bacterial compositions that do not include any additional clostridial strains (Such compositions may include additional non-clostridial strains, such as e.g., E. coli or Bacteroides). In one aspect, the disclosure provides methods comprising bacterial compositions, wherein the bacterial composition consists of VE202-1, VE202-3, VE202-4, VE202-6, VE202-7, VE202-8, VE202-9, VE202-13, VE202-14, VE202-15, VE202-16, VE202-18, VE202-21, VE202-26, VE202-27, VE202-28, and VE202-29. As used herein, “consist of” refers to bacterial compositions that do not include any additional bacterial strains.

(36) In one aspect, the disclosure provides methods comprising bacterial compositions, wherein the bacterial composition comprises one or more bacterial strains selected from the group consisting of VE202-1, VE202-3, VE202-4, VE202-6, VE202-7, VE202-8, VE202-9, VE202-13, VE202-14, VE202-15, VE202-16, VE202-18, VE202-21, VE202-26, VE202-27, VE202-28, and VE202-29. The closest relatives of the VE-202 sequences have been determined, e.g., by comparing the 16S rDNA sequences and/or the whole genome of a particular VE-202 sequence against bacterial sequences available in public databases such as the NCBI (See e.g., Atarashi et al. Nature 2013, 500: 232-237 and supplemental materials). The closest relatives of VE202-1 are Clostridium saccharogumia, Clostridium ramosum and Clostridium spiroforme. The closest relatives of VE202-3 are Flavonifractor plautii, Pseudoflavonifractor capillosus and Lachnospiraceae bacterium. The closest relatives of VE202-4 are Clostridium hathewayi and Clostridium saccharolyticum. The closest relatives of VE202-6 are Blautia coccoides, Lachnospiraceae bacterium and Blautia producta. The closest relatives of VE202-7 is Clostridium bolteae. The closest relative of VE202-8 is Clostridiacieae bacterium. The closest relatives of VE202-9 are Clostridium indolis and Anaerostipes caccae. The closest relative of VE202-13 is Anaerotruncus colihominis. The closest relatives of VE202-14 are Ruminococcus sp., Lachnospiraceae bacterium and Coprococcus comes. The closest relatives of VE202-15 are Clostridium lavalense and Clostridium asparagiforme. The closest relatives of VE202-16 is Clostridium symbiosum. The closest relative of VE202-18 is Clostridium ramosum. The closest relatives of VE202-21 are Eubacterium contortum, Eubacterium fissicatena and Clostridium D5. The closest relatives of VE202-26 are Clostridium scindens and Lachnospiraceae bacterium. The closest relative of VE202-27 is Lachnospiraceae bacterium. The closest relatives of VE202-28 are Clostridium bacterium and Clostridium aldenense. The closest relative of VE202-29 is Lachnospiraceae bacterium. Thus, in some embodiments, the disclosure provides methods comprising bacterial compositions, wherein the bacterial composition comprises one or more bacterial strains selected from the group consisting of Clostridium saccharogumia, Clostridium ramosum, Clostridium spiroforme, Flavonifractor plautii, Pseudoflavonifractor capillosus, Lachnospiraceae bacterium, Clostridium hathewayi, Clostridium saccharolyticum, Blautia coccoides, Blautia producta, Clostridium bolteae, Clostridiacieae bacterium, Clostridium indolis, Anaerostipes caccae, Anaerotruncus colihominis, Ruminococcus sp., Coprococcus comes, Clostridium lavalense, Clostridium asparagiforme, Clostridium symbiosum, Eubacterium contortum, Eubacterium fissicatena, Clostridium D5, Clostridium scindens, Clostridium bacterium, and Clostridium aldenense. In some embodiments of the methods provided herein, the bacterial composition comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 bacterial strains.

(37) In one aspect, the disclosure provides methods comprising bacterial compositions, wherein the bacterial composition comprises seventeen bacterial strains (1) Clostridium saccharogumia, Clostridium ramosum or Clostridium spiroforme, and (2) Flavonifractor plautii, Pseudoflavonifractor capillosus or Lachnospiraceae bacterium, and (3) Clostridium hathewayi or Clostridium saccharolyticum, and (4) Blautia coccoides, Lachnospiraceae bacterium or Blautia producta, and (5) Clostridium bolteae, and (6) Clostridiacieae bacterium, and (7) Clostridium indolis or Anaerostipes caccae, and (8) Anaerotruncus colihominis, and (9) Ruminococcus sp., Lachnospiraceae bacterium or Coprococcus comes, and (10) Clostridium lavalense and Clostridium asparagiforme, and (11) Clostridium symbiosum, and (12) Clostridium ramosum, and (13) Eubacterium contortum, Eubacterium fissicatena or Clostridium D5, and (14) Clostridium scindens or Lachnospiraceae bacterium, and (15) Lachnospiraceae bacterium, and (16) Clostridium bacterium or Clostridium aldenese, and (17) Lachnospiraceae bacterium. In one aspect, the disclosure provides methods comprising bacterial compositions, wherein the bacterial composition essentially consists of seventeen bacterial strains (1) Clostridium saccharogumia, Clostridium ramosum or Clostridium spiroforme, and (2) Flavonifractor plautii, Pseudoflavonifractor capillosus or Lachnospiraceae bacterium, and (3) Clostridium hathewayi or Clostridium saccharolyticum, and (4) Blautia coccoides, Lachnospiraceae bacterium or Blautia producta, and (5) Clostridium bolteae, and (6) Clostridiacieae bacterium, and (7) Clostridium indolis or Anaerostipes caccae, and (8) Anaerotruncus colihominis, and (9) Ruminococcus sp., Lachnospiraceae bacterium or Coprococcus comes, and (10) Clostridium lavalense and Clostridium asparagiforme, and (11) Clostridium symbiosum, and (12) Clostridium ramosum, and (13) Eubacterium contortum, Eubacterium fissicatena or Clostridium D5, and (14) Clostridium scindens or Lachnospiraceae bacterium, and (15) Lachnospiraceae bacterium, and (16) Clostridium bacterium or Clostridium aldenese, and (17) Lachnospiraceae bacterium. In one aspect, the disclosure provides methods comprising bacterial compositions, wherein the bacterial composition consists of seventeen bacterial strains (1) Clostridium saccharogumia, Clostridium ramosum or Clostridium spiroforme, and (2) Flavonifractor plautii, Pseudoflavonifractor capillosus or Lachnospiraceae bacterium, and (3) Clostridium hathewayi or Clostridium saccharolyticum, and (4) Blautia coccoides, Lachnospiraceae bacterium or Blautia producta, and (5) Clostridium bolteae, and (6) Clostridiacieae bacterium, and (7) Clostridium indolis or Anaerostipes caccae, and (8) Anaerotruncus colihominis, and (9) Ruminococcus sp., Lachnospiraceae bacterium or Coprococcus comes, and (10) Clostridium lavalense and Clostridium asparagiforme, and (11) Clostridium symbiosum, and (12) Clostridium ramosum, and (13) Eubacterium contortum, Eubacterium fissicatena or Clostridium D5, and (14) Clostridium scindens or Lachnospiraceae bacterium, and (15) Lachnospiraceae bacterium, and (16) Clostridium bacterium or Clostridium aldenese, and (17) Lachnospiraceae bacterium.

(38) TABLE-US-00001 TABLE 1 16S Genbank rDNA VE-202 Assembly Seq ID Genbank strain # Accession ID NO Accession ID closest relatives notes VE202-1 GCA_000508865.1 1 BAHP02000171.1 Clostridium Vancomycin saccharogumia; resistant* Clostridium ramosum; Clostridium spiroforme VE202-3 GCA_000508885.1 2 BAHQ02000607.1 Flavonifractor plautii; Vancomycin Pseudoflavinofractor resistant* capillosus; Lachnospiraceae bacterium VE202-4 GCA_000508905.1 3 BAHR02000208.1 Clostridium hathewayi; Clostridium saccharolyticum VE202-6 GCA_000508925.1 4 BAHT02000283.1 Blautia coccoides; Vancomycin Lachnospiraceae resistant* bacterium; Blautia producta VE202-7 GCA_000508945.1 5 BAHU02000044.1 Clostridium bolteae VE202-8 GCA_000508965.1 6 BAHV02000026.1 Clostridiacieae Vancomycin bacterium resistant* VE202-9 GCA_000508985.1 7 BAHW02000064.1 Clostridium indolis; Strong Anaerostipes caccae butyrate producer* VE202-13 GCA_000509005.1 8 BAIA02000175.1 Anaerotruncus colihominis VE202-14 GCA_000509025.1 9 BAIB02000026.1 Ruminococcus sp.; Lachnospiraceae bacterium; Coprococcus comes VE202-15 GCA_000509045.1 10 BAIC02000310.1 Clostridium lavalense; Clostridium asparagiforme VE202-16 GCA_000509065.1 11 BAID02000318.1 Clostridium symbiosum Strong butyrate producer* VE202-18 GCA_000509085.1 12 BAIE02000084.1 Clostridium ramosum Vancomycin resistant* VE202-21 GCA_000509105.1 13 BAIF02000133.1 Eubacterium contortum; Eubacterium fissicatena; Clostridium D5 VE202-26 GCA_000509125.1 14 BAII02000026.1 Clostridium scindens; Lachnospiraceae bacterium VE202-27 GCA_000509145.1 15 BAIJ02000227.1 Lachnospiraceae Strong bacterium butyrate producer* VE202-28 GCA_000509165.1 16 ABQR01000074.1 (1) Clostridium bacterium; Clostridium aldenense VE202-29 GCA_000509185.1 17 ACTP02000021.1 (2) Lachnospiraceae Strong bacterium butyrate producer* *Narushima et al., Gut Microbes 2014: 5(3): 333-339 (1) Clostridiales bacterium 1_7_47FAA (2) Lachnospiraceae_bacterium 3_1_57FAA

(39) In one aspect, the disclosure provides methods comprising bacterial compositions comprising one or more bacterial strains comprising nucleotide sequences of at least 95% homology to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:17. In some embodiments, the bacterial strain has at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or up to 100% homology.

(40) In one aspect, the disclosure provides methods comprising bacterial compositions comprising one or more bacterial strains of at least 95% homology to nucleotide sequences found in bacterial strains defined by the Genbank Assembly Accession IDs GCA_000508865.1, GCA_000508885.1, GCA_000508905.1, GCA_000508925.1, GCA 000508945.1, GCA 000508965.1, GCA 000508985.1, GCA 000509005.1, GCA_000509025.1, GCA_000509045.1, GCA_000509065.1, GCA_000509085.1, GCA000509105.1, GCA000509125.1, GCA000509145.1, GCA000509165.1, or GCA 000509185.1. In some embodiments, the bacterial strain has at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or up to 100% homology.

(41) In one aspect, the disclosure provides methods comprising bacterial compositions comprising one or more bacterial strains comprising 16S rDNA sequences of at least 95% homology to nucleotide sequences found in bacterial strains defined by the Genbank Assembly Accession IDs GCA_000508865.1, GCA_000508885.1, GCA_000508905.1, GCA_000508925.1, GCA_000508945.1, GCA_000508965.1, GCA_000508985.1, GCA 000509005.1, GCA 000509025.1, GCA 000509045.1, GCA 000509065.1, GCA_000509085.1, GCA_000509105.1, GCA_000509125.1, GCA_000509145.1, GCA 000509165.1, or GCA 000509185.1. In some embodiments, the bacterial strain has at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or up to 100% homology.

(42) In one aspect, the disclosure provides methods comprising bacterial compositions comprising one or more bacterial strains comprising 16S rDNA sequences of at least 95% homology to nucleotide sequences found in bacterial strains defined by the Genbank Accession IDs: BAHP0200017.1, BAHQ02000607.1, BAHR02000208.1, BAHT02000283.1, BAHU02000044.1, BAHV02000026.1, BAHW02000064.1, BAIA02000175.1, BAIB02000026.1, BAIC02000310.1, BAID02000318.1, BAIE02000084.1, BAIF02000133.1, BAII02000026.1, BAIJ02000227.1, ABQR01000074.1, or ACPT02000021.1. In some embodiments, the bacterial strain has at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or up to 100% homology.

(43) In one aspect, the disclosure provides methods comprising bacterial compositions comprising one or more bacterial strains of at least 95% homology to nucleotide sequences found in bacterial strains defined by the Genbank Accession IDs BAHPOi20001711, BAHQ02000607.1, BAHR02000208.1, BAHT02000283.1, BAHU02000044.1, BAHV02000026.1, BAHWO2000064.1, BAIA02000175.1, BAIB02000026.1, BAIC02000310.1, BAID02000318.1, BAIE02000084.1, BAIF02000133.1, BAII02000026.1, BAIJ02000227.1, ABQR01000074.1, or ACPT02000021.1. In some embodiments, the bacterial strain has at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or up to 100% homology.

(44) In one aspect, the disclosure provides methods comprising bacterial compositions comprising one or more bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:17. It should be appreciated that SEQ ID NOs:1-17 correspond to the 16S rDNA sequences of VE202-1, VE202-3, VE202-4, VE202-6, VE202-7, VE202-8, VE202-9, VE202-13, VE202-14, VE202-15, VE202-16, VE202-18, VE202-21, VE202-26, VE202-27, VE202-28, and VE202-29 respectively (See Table 1). Additional nucleotide sequences that correspond to the 16S rDNA regions of the VE202 strains are found in WO2013/080561; herein incorporated by reference in its entirety. Bacteria with similar 16S RNA sequences are closely related to each other. Furthermore, closely related bacteria are expected to have similar genes and properties. For example, a bacterial strain that has a 16S RNA sequence that is similar to SEQ ID NO:1, which is the 16S RNA sequence of VE202-1, is expected to have properties similar to VE202-1. Similarly, in another example, a bacterial composition comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4 is expected to have the same properties as a bacterial composition comprising VE202-1, VE202-3, VE202-4, and VE202-6.

(45) In one aspect, the disclosure provides methods comprising bacterial compositions, wherein the bacterial compositions comprise bacterial strains. It should be appreciated that the terms bacteria, strains, and bacterial strains are used interchangeably herein. The bacterial strains of the bacterial compositions disclosed herein can be identified by their 16S rRNA (or 16S rDNA) nucleic acid sequence. In some embodiments, the bacterial strains have 16S RNA sequences corresponding to SEQ ID NO: 1-17. In general, bacteria are classified as belonging to a specific species and/or genus based on their 16S rRNA nucleic acid sequence. Bacteria, such as bacteria derived from the microbiome, may also be classified into phylogenetic clusters with other closely related strains and species. (See e.g., Rajilic-Stojanovic, M., and de Vos, W. M. (2014). The first 1000 cultured species of the human gastrointestinal microbiota. FEMS Microbiol Rev 38, 996-1047). Methods for determining the identity of specific bacterial species based on their 16S rRNA (or 16S rDNA) nucleic acid sequence are well known in the art (See e.g., Jumpstart Consortium Human Microbiome Project Data Generation Working, G. (2012). Evaluation of 16S rDNA-based community profiling for human microbiome research. PLoS One 7, e39315).

(46) In one aspect, the disclosure provides methods comprising bacterial compositions comprising one or more bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO: 17. In some embodiments of the methods provided herein, the bacterial composition comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 bacterial strains.

(47) In one aspect, the disclosure provides methods comprising bacterial compositions comprising at least two bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO: 17. In some embodiments of the methods provided herein, the bacterial composition comprises at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 bacterial strains.

(48) In one aspect, the disclosure provides methods comprising bacterial compositions comprising bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, and SEQ ID NO: 17. In one aspect, the disclosure provides methods comprising bacterial compositions comprising bacterial strains essentially consisting of 16S rDNA sequences of at least 95% homology to SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, and SEQ ID NO: 17. In one aspect, the disclosure provides methods comprising bacterial compositions comprising bacterial strains consisting of 16S rDNA sequences of at least 95% homology to SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, and SEQ ID NO: 17.

(49) It should be appreciated that for all compositions provided herein, in some embodiments, the bacterial strains are purified. Thus, for example the disclosure provides purified bacterial strains comprising a 16S rDNA sequence with a nucleic acid sequence selected from the group consisting of SEQ ID NOs:1-17. In addition, for example, the disclosure provides bacterial compositions comprising purified bacterial strains comprising a 16S rDNA sequence with a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-17. The bacterial strains disclosed herein originally may have been obtained and purified from the microbiota of one or more human individuals or obtained from sources other than the human microbiota, including soil and non-human microbiota. As provided herein, in some embodiments, bacteria isolated from the human microbiota, non-human microbiota, soil, or any alternative source are purified prior to use in the compositions and methods provided herein.

(50) It should further be appreciated that the bacterial strains disclosed herein that have a 16S rDNA sequence with a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-17, are also homologous to other strains based on their whole genome sequence, or subset of their whole genome sequence. Thus, it should be appreciated that, in one aspect, the disclosure also provides compositions and methods comprising bacterial species with close homology to the bacterial strains that have a 16S rDNA sequence with a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-17.

(51) In one aspect, the disclosure provides methods and bacterial compositions comprising bacterial strains with 16S rDNA sequences that have homology to a nucleic acid sequence of any one of the sequences of the bacterial strains or species described herein. In some embodiments, the bacterial strain has at least 60%, at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or up to 100% homology relative to any of the strains or bacterial species described herein over a specified region or over the entire sequence. It would be appreciated by one of skill in the art that the term “homology” or “percent homology,” in the context of two or more nucleic acid sequences or amino acid sequences, refers to a measure of similarity between two or more sequences or portion(s) thereof. The homology may exist over a region of a sequence that is at least about 50 nucleotides in length, or more preferably over a region that is 100 to 500 or 1000 or more nucleotides in length. In some embodiments, the homology exists over the length the 16S rRNA or 16S rDNA sequence, or a portion thereof.

(52) Additionally, or alternatively, two or more sequences may be assessed for the identity between the sequences. The terms “identical” or percent “identity” in the context of two or more nucleic acids or amino acid sequences, refer to two or more sequences or subsequences that are the same. Two sequences are “substantially identical” if two sequences have a specified percentage of amino acid residues or nucleotides that are the same (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identical) over a specified region or over the entire sequence, when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. Optionally, the identity exists over a region that is at least about 50 nucleotides in length, or more preferably over a region that is 100 to 500 or 1000 or more nucleotides in length. In some embodiments, the identity exists over the length the 16S rRNA or 16S rDNA sequence.

(53) Additionally, or alternatively, two or more sequences may be assessed for the alignment between the sequences. The terms “alignment” or percent “alignment” in the context of two or more nucleic acids or amino acid sequences, refer to two or more sequences or subsequences that are the same. Two sequences are “substantially aligned” if two sequences have a specified percentage of amino acid residues or nucleotides that are the same (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% identical) over a specified region or over the entire sequence, when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. Optionally, the alignment exists over a region that is at least about 50 nucleotides in length, or more preferably over a region that is 100 to 500 or 1000 or more nucleotides in length. In some embodiments, the identity exists over the length the 16S rRNA or 16S rDNA sequence.

(54) For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. Methods of alignment of sequences for comparison are well known in the art. See, e.g., by the local homology algorithm of Smith and Waterman (1970) Adv. Appl. Math. 2:482c, by the homology alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48:443, 1970, by the search for similarity method of Pearson and Lipman. Proc. Natl. Acad. Sci. USA 85:2444, 1988, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group. Madison. Wis.), or by manual alignment and visual inspection (see. e.g., Brent et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (Ringbou ed., 2003)). Two examples of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., Nuc. Acids Res. 25:3389-3402, 1977; and Altschul et al., J. Mol. Biol. 215:403-410, 1990, respectively.

(55) In some embodiments of the compositions provided herein, one or more of the bacterial strains are human-derived bacteria. In some embodiments of the compositions provided herein, all of the bacterial strains are human-derived bacteria. In some embodiments of the compositions provided herein, the bacterial strains are derived from more than one human donor.

(56) The bacterial strains used in the compositions provided herein generally are isolated from the microbiome of healthy individuals. In some embodiments, the compositions include strains originating from a single individual. In some embodiments, the compositions include strains originating from multiple individuals. In some embodiments, the bacterial strains are obtained from multiple individuals, isolated and grown up individually. The bacterial compositions that are grown up individually may subsequently be combined to provide the compositions of the disclosure. It should be appreciated that the origin of the bacterial strains of the compositions provided herein is not limited to the human microbiome from a healthy individual. In some embodiments, the bacterial strains originate from a human with a microbiome in dysbiosis. In some embodiments, the bacterial strains originate from non-human animals or the environment (e.g., soil or surface water). In some embodiments, the combinations of bacterial strains provided herein originate from multiple sources (e.g., human and non-human animals).

(57) In one aspect, the disclosure provides methods comprising bacterial strains wherein the bacterial strains produce butyrate. In some embodiments, the bacterial strains produce butyrate when introduced in the intestine of the subject. Butyrate producing bacterial strains are known in the art. In addition, butyrate producing bacterial strains can be identified, for instance, by sequencing the genome to identify the presence of a set of genes that allows for butyrate production and/or assessing if a particular strain produces butyrate upon introduction in the intestine (e.g., by detecting the presence of butyrate in the stool).

(58) In some embodiments of the methods comprising compositions of butyrate producing bacterial strains, the composition comprises one or more bacterial strains selected from the group consisting of VE202-1, VE202-3, VE202-4, VE202-6, VE202-7, VE202-8, VE202-9, VE202-13, VE202-14, VE202-15, VE202-16, VE202-18, VE202-21, VE202-26, VE202-27, VE202-28, and VE202-29. The VE-202 strains have been described in detail, for instance in Atarashi et al. Nature 2013, 500: 232-237 and supplemental materials, Narushima et al., Gut Microbes 2014: 5(3): 333-339, and PCT published application WO2013/080561, all of which are incorporated by reference in their entirety. The combination of the seventeen VE202 strains produces butyrate. In addition, it has been shown (See e.g., Narushima et al.) that each of the 17 strains individually is able to produce butyrate. Thus, in some embodiments, the methods disclosed herein provide for the administration of a composition of butyrate producing bacterial strains, wherein composition of butyrate producing bacterial comprises one or more bacterial strains selected from the group consisting of VE202-1, VE202-3, VE202-4, VE202-6, VE202-7, VE202-8, VE202-9, VE202-13, VE202-14, VE202-15, VE202-16, VE202-18, VE202-21, VE202-26, VE202-27, VE202-28, and VE202-29. In some embodiments of the methods provided herein, the composition of butyrate producing bacterial strains comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 bacterial strains. As further shown in Narushima et al., VE202-9, VE202-16, VE202-27, and VE202-29 are strong butyrate producers (See also Table 1). Thus, in some embodiments, the methods disclosed herein provide for the administration of a composition of butyrate producing bacterial strains, wherein the composition of butyrate producing bacterial comprises one or more bacterial strains selected from the group consisting of VE202-9, VE202-16, VE202-27, and VE202-29. In some embodiments, the composition of butyrate producing bacterial strains comprises VE202-9, VE202-16, VE202-27, and VE202-29. In some embodiments, the composition of butyrate producing bacterial strains comprises VE202-9, VE202-16, and VE202-27. In some embodiments, the composition of butyrate producing bacterial strains comprises VE202-9, VE202-16, and VE202-29. In some embodiments, the composition of butyrate producing bacterial strains comprises VE202-9, VE202-27 and VE202-29. In some embodiments, the composition of butyrate producing bacterial strains comprises VE202-16, VE202-27 and VE202-29. In some embodiments, the composition of butyrate producing bacterial strains comprises VE202-9 and VE202-29. In some embodiments, the composition of butyrate producing bacterial strains comprises VE202-16 and VE202-29. In some embodiments, the composition of butyrate producing bacterial strains comprises VE202-27 and VE202-29. In some embodiments, the composition of butyrate producing bacterial strains comprises VE202-9 and VE202-27. In some embodiments, the composition of butyrate producing bacterial strains comprises VE202-16 and VE202-27. In some embodiments, the composition of butyrate producing bacterial strains comprises VE202-9 and VE202-16. In each of the compositions of butyrate producing bacterial strains provided herein, in some embodiments, the composition may include additional bacterial strains selected from the group consisting of VE202-1, VE202-3, VE202-4, VE202-6, VE202-7, VE202-8, VE202-9, VE202-13, VE202-14, VE202-15, VE202-16, VE202-18, VE202-21, VE202-26, VE202-27, VE202-28, and VE202-29. It should further be appreciated that in some embodiments, in each of the compositions of butyrate producing bacterial strains provided herein, the composition may include additional bacterial strains that are known butyrate producers, wherein the additional bacterial strains are not VE202 strains.

(59) In some embodiments of the methods comprising compositions of butyrate producing bacterial strains, the composition comprises one or more bacterial strains selected from the group consisting of VE202-1, VE202-3, VE202-4, VE202-6, VE202-7, VE202-8, VE202-9, VE202-13, VE202-14, VE202-15, VE202-16, VE202-18, VE202-21, VE202-26, VE202-27, VE202-28, and VE202-29. The closest relatives of VE202-1 are Clostridium saccharogumia, Clostridium ramosum and Clostridium spiroforme. The closest relatives of VE202-3 are Flavonifractor plautii, Pseudoflavonifractor capillosus and Lachnospiraceae bacterium. The closest relatives of VE202-4 are Clostridium hathewayi and Clostridium saccharolyticum. The closest relatives of VE202-6 are Blautia coccoides, Lachnospiraceae bacterium and Blautia producta. The closest relatives of VE202-7 is Clostridium bolteae. The closest relative of VE202-8 is Clostridiacieae bacterium. The closest relatives of VE202-9 are Clostridium indolis and Anaerostipes caccae. The closest relative of VE202-13 is Anaerotruncus colihominis. The closest relatives of VE202-14 are Ruminococcus sp., Lachnospiraceae bacterium and Coprococcus comes. The closest relatives of VE202-15 are Clostridium lavalense and Clostridium asparagiforme. The closest relatives of VE202-16 is Clostridium symbiosum. The closest relative of VE202-18 is Clostridium ramosum. The closest relatives of VE202-21 are Eubacterium contortum, Eubacterium fissicatena and Clostridium D5. The closest relatives of VE202-26 are Clostridium scindens and Lachnospiraceae bacterium. The closest relative of VE202-27 is Lachnospiraceae bacterium. The closest relatives of VE202-28 are Clostridium bacterium and Clostridium aldenese. The closest relative of VE202-29 is Lachnospiraceae bacterium. Thus, in some embodiments, the disclosure provides methods comprising butyrate producing bacterial strains wherein the bacterial composition comprises one or more bacterial strains selected from the group consisting of Clostridium saccharogumia, Clostridium ramosum, Clostridium spiroforme, Flavonifractor plautii, Pseudoflavonifractor capillosus, Lachnospiraceae bacterium, Clostridium hathewayi, Clostridium saccharolyticum, Blautia coccoides, Blautia product, Clostridium bolteae, Clostridiacieae bacterium, Clostridium indolis, Anaerostipes caccae, Anaerotruncus colihominis, Ruminococcus sp., Coprococcus comes, Clostridium lavalense, Clostridium asparagiforme, Clostridium symbiosum, Eubacterium contortum, Eubacterium fissicatena, Clostridium D5, Clostridium scindens, Clostridium bacterium, and Clostridium aldenense. In some embodiments of the methods provided herein, the bacterial composition comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 bacterial strains. As further shown in Narushima et al., VE202-9, VE202-16, VE202-27, and VE202-29 are strong butyrate producers (See also Table 1). Thus, in some embodiments, the methods disclosed herein provide for the administration of a composition of butyrate producing bacterial strains, wherein the composition of butyrate producing bacterial comprises one or more bacterial strains selected from the group consisting of Clostridium indolis, Anaerostipes caccae, Clostridium symbiosum and Lachnospiraceae bacterium. In some embodiments, the composition of butyrate producing bacterial strains comprises Clostridium indolis, Anaerostipes caccae, Clostridium symbiosum and Lachnospiraceae bacterium. In some embodiments, the composition of butyrate producing bacterial strains comprises Anaerostipes caccae, Clostridium symbiosum and Lachnospiraceae bacterium. In some embodiments, the composition of butyrate producing bacterial strains comprises Clostridium indolis, Clostridium symbiosum and Lachnospiraceae bacterium. In some embodiments, the composition of butyrate producing bacterial strains comprises Clostridium indolis, Anaerostipes caccae, and Lachnospiraceae bacterium. In some embodiments, the composition of butyrate producing bacterial strains comprises Clostridium indolis, Anaerostipes caccae, and Clostridium symbiosum. In some embodiments, the composition of butyrate producing bacterial strains comprises Clostridium indolis and Lachnospiraceae bacterium. In some embodiments, the composition of butyrate producing bacterial strains comprises Anaerostipes caccae and Lachnospiraceae bacterium. In some embodiments, the composition of butyrate producing bacterial strains comprises Clostridium symbiosum and Lachnospiraceae bacterium. In some embodiments, the composition of butyrate producing bacterial strains comprises Clostridium indolis and Clostridium symbiosum. In some embodiments, the composition of butyrate producing bacterial strains comprises Anaerostipes caccae and Clostridium symbiosum. In some embodiments, the composition of butyrate producing bacterial strains comprises Anaerostipes caccae and Clostridium symbiosum. In each of the compositions of butyrate producing bacterial strains provided herein, in some embodiments, the composition may include additional bacterial strains selected from the group consisting of Clostridium saccharogumia, Clostridium ramosum, Clostridium spiroforme, Flavonifractor plautii, Pseudoflavonifractor capillosus, Lachnospiraceae bacterium, Clostridium hathewayi, Clostridium saccharolyticum, Blautia coccoides, Blautia product, Clostridium bolteae, Clostridaceae bacterium, Clostridium indolis, Anaerostipes caccae, Anaerotruncus colihominis, Ruminococcus sp., Coprococcus comes, Clostridium lavalense, Clostridium asparagiforme, Clostridium symbiosum, Eubacterium contortum, Eubacterium fissicatena, Clostridium D5, Clostridium scindens, Clostridium bacterium, and Clostridium aldenese. It should further be appreciated that in some embodiments, in each of the compositions of butyrate producing bacterial strains provided herein, the composition may include additional bacterial strains that are known butyrate producers, wherein the additional bacterial strains are not Clostridium saccharogumia, Clostridium ramosum, Clostridium spiroforme, Flavonifractor plautii, Pseudoflavonifractor capillosus, Lachnospiraceae bacterium, Clostridium hathewayi, Clostridium saccharolyticum, Blautia coccoides, Blautia product, Clostridium bolteae, Clostridaceae bacterium, Clostridium indolis, Anaerostipes caccae, Anaerotruncus colihominis, Ruminococcus sp., Coprococcus comes, Clostridium lavalense, Clostridium asparagiforme, Clostridium symbiosum, Eubacterium contortum, Eubacterium fissicatena, Clostridium D5, Clostridium scindens, Clostridium bacterium or Clostridium aldenese.

(60) As noted above, SEQ ID NOs:1-17 correspond to the 16S rDNA sequences of VE202-1, VE202-3, VE202-4, VE202-6, VE202-7, VE202-8, VE202-9, VE202-13, VE202-14, VE202-15, VE202-16, VE202-18, VE202-21, VE202-26, VE202-27, VE202-28, and VE202-29, respectively (See Table 1). Thus, in some embodiments, the methods disclosed herein provide for the administration of a composition of butyrate producing bacterial strains, wherein the composition of butyrate producing bacterial comprises one or more bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:17. In some embodiments of the methods provided herein, the composition of butyrate producing bacterial strains comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 bacterial strains. As further shown in Narushima et al., VE202-9, VE202-16, VE202-27, and VE202-29 are very strong butyrate producers (See also Table 1). Thus, in some embodiments, the methods disclosed herein provide for the administration of a composition of butyrate producing bacterial strains, wherein the composition of butyrate producing bacterial comprises one or more bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:7 SEQ ID NO:11, SEQ ID NO:15, and SEQ ID NO:17. In some embodiments, the composition of butyrate producing bacterial strains comprises bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:15, and SEQ ID NO:17. In some embodiments, the composition of butyrate producing bacterial strains comprises bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:15, and SEQ ID NO: 17. In some embodiments, the composition of butyrate producing bacterial strains comprises bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:7 SEQ ID NO: 11, and SEQ ID NO: 15. In some embodiments, the composition of butyrate producing bacterial strains comprises bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:7, SEQ ID NO:11, and SEQ ID NO: 17. In some embodiments, the composition of butyrate producing bacterial strains comprises bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:7, SEQ ID NO:15, and SEQ ID NO:17. In some embodiments, the composition of butyrate producing bacterial strains comprises bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO: 11, SEQ ID NO: 15, and SEQ ID NO: 17. In some embodiments, the composition of butyrate producing bacterial strains comprises bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:7, and SEQ ID NO: 17. In some embodiments, the composition of butyrate producing bacterial strains comprises bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:11 and SEQ ID NO: 17. In some embodiments, the composition of butyrate producing bacterial strains comprises bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:15, and SEQ ID NO:17. In some embodiments, the composition of butyrate producing bacterial strains comprises bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:7, and SEQ ID NO: 15. In some embodiments, the composition of butyrate producing bacterial strains comprises bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:7, and SEQ ID NO:11. In some embodiments, the composition of butyrate producing bacterial strains comprises bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO: 11, and SEQ ID NO: 15. In each of the compositions of butyrate producing bacterial strains provided herein, in some embodiments, the composition may include additional bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO: 17. It should further be appreciated that in some embodiments, in each of the compositions of butyrate producing bacterial strains provided herein, the composition may include additional bacterial strains that are known butyrate producers, wherein the additional bacterial strains do not include 16S rDNA sequences of at least 95% homology to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:17.

(61) In one aspect, the disclosure provides methods comprising compositions of bacterial strains. In some embodiments of the compositions provided herein, one or more of the bacterial strains does not have an antibiotic resistance gene. In some embodiments of the compositions provided herein, the bacterial strains do not have an antibiotic resistance gene that renders the bacterial strain resistant to vancomycin.

(62) In some embodiments of the compositions provided herein, the compositions do not include bacterial strains that are resistant to one or more antibiotics. It should be appreciated that it may be desirable to have a mechanism to remove the bacterial compositions provided herein from the body after administration. One such mechanism is to remove the bacterial compositions by antibiotic treatment. Thus, in some embodiments, the compositions do not include bacterial strains that are resistant to one or more antibiotics. In some embodiments, the compositions do not include bacterial strains that are resistant to one or more antibiotics selected from the group consisting of penicillin, benzylpenicillin, ampicillin, sulbactam, amoxicillin, clavulanate, tazobactam, piperacillin, cefmetazole, vancomycin, imipenem, meropenem, metronidazole and clindamycin. In some embodiments, the compositions do not include bacterial strains that are resistant to vancomycin.

(63) In one aspect, the disclosure provides methods comprising bacterial compositions that do not include bacterial strains that are resistant to vancomycin. As shown in Narushima et al., VE202-1, VE202-3, VE202-6, VE202-8, and VE202-18 are resistant to vancomycin. Thus, in some embodiment, the disclosure provides methods comprising bacterial compositions that do not include bacterial strains that are resistant to vancomycin, wherein the composition does not include VE202-1, VE202-3, VE202-6, VE202-8, and VE202-18. In some embodiments of the methods comprising compositions that do not include bacterial strains, the composition comprises one or more bacterial strains selected from the group consisting of VE202-4, VE202-7, VE202-9, VE202-13, VE202-14, VE202-15, VE202-16, VE202-21, VE202-26, VE202-27, VE202-28, and VE202-29. In some embodiments, the composition comprises one or more bacterial strains selected from the group consisting of VE202-4, VE202-7, VE202-9, VE202-13, VE202-14, VE202-15, VE202-16, VE202-21, VE202-26, VE202-27, VE202-28, and VE202-29, and in addition the composition does not include any bacterial strains that are resistant to vancomycin. In some embodiments, the composition comprises bacterial strains VE202-4, VE202-7, VE202-9, VE202-13, VE202-14, VE202-15, VE202-16, VE202-21, VE202-26, VE202-27, VE202-28, and VE202-29. In some embodiments, the composition essentially consists of bacterial strains VE202-4, VE202-7, VE202-9, VE202-13, VE202-14, VE202-15, VE202-16, VE202-21, VE202-26, VE202-27, VE202-28, and VE202-29. In some embodiments, the composition consists of bacterial strains VE202-4, VE202-7, VE202-9, VE202-13, VE202-14, VE202-15, VE202-16, VE202-21, VE202-26, VE202-27, VE202-28, and VE202-29.

(64) In one aspect, the disclosure provides methods comprising bacterial compositions that do not include bacterial strains that are resistant to vancomycin. As shown in Narushima et al., VE202-1, VE202-3, VE202-6, VE202-8, and VE202-18 are resistant to vancomycin. The closest relatives of VE202-1 are Clostridium saccharogumia, Clostridium ramosum and Clostridium spiroforme. The closest relatives of VE202-3 are Flavonifractor plautii, Pseudoflavonifractor capillosus and Lachnospiraceae bacterium. The closest relatives of VE202-6 are Blautia coccoides, Lachnospiraceae bacterium and Blautia producta. The closest relative of VE202-8 is Clostridaceae bacterium. The closest relative of VE202-18 is Clostridium ramosum. Thus, in some embodiment, the disclosure provides methods comprising bacterial compositions that do not include bacterial strains that are resistant to vancomycin, wherein the composition does not include Clostridium saccharogumia, Clostridium ramosum, Clostridium spiroforme, Flavonifractor plautii, Pseudoflavonifractor capillosus, Lachnospiraceae bacterium, Blautia coccoides, Blautia product, Clostridaceae bacterium and Clostridium ramosum. In some embodiments of the methods comprising compositions that do not include bacterial strains, the composition comprises one or more bacterial strains selected from the group consisting of Clostridium hathewayi, Clostridium saccharolyticum, Clostridium bolteae, Clostridium indolis, Anaerostipes caccae, Anaerotruncus colihominis, Ruminococcus sp., Coprococcus comes, Clostridium lavalense, Clostridium asparagiforme, Clostridium symbiosum, Eubacterium contortum, Eubacterium fissicatena, Clostridium D5, Clostridium scindens, Clostridium bacterium, and Clostridium aldenese. In some embodiments, the composition comprises one or more bacterial strains selected from the group consisting of Clostridium hathewayi, Clostridium saccharolyticum, Clostridium bolteae, Clostridium indolis, Anaerostipes caccae, Anaerotruncus colihominis, Ruminococcus sp., Coprococcus comes, Clostridium lavalense, Clostridium asparagiforme, Clostridium symbiosum, Eubacterium contortum, Eubacterium fissicatena, Clostridium D5, Clostridium scindens, Clostridium bacterium, and Clostridium aldenese, and in addition the composition does not include any bacterial strains that are resistant to vancomycin. In some embodiments, the composition comprises bacterial strains Clostridium hathewayi, Clostridium saccharolyticum, Clostridium bolteae, Clostridium indolis, Anaerostipes caccae, Anaerotruncus colihominis, Ruminococcus sp., Coprococcus comes, Clostridium lavalense, Clostridium asparagiforme, Clostridium symbiosum, Eubacterium contortum, Eubacterium fissicatena, Clostridium D5, Clostridium scindens, Clostridium bacterium, and Clostridium aldenese. In some embodiments, the composition essentially consists of bacterial strains Clostridium hathewayi, Clostridium saccharolyticum, Clostridium bolteae, Clostridium indolis, Anaerostipes caccae, Anaerotruncus colihominis, Ruminococcus sp., Coprococcus comes, Clostridium lavalense, Clostridium asparagiforme, Clostridium symbiosum, Eubacterium contortum, Eubacterium fissicatena, Clostridium D5, Clostridium scindens, Clostridium bacterium, and Clostridium aldenese. In some embodiments, the composition consists of bacterial strains Clostridium hathewayi, Clostridium saccharolyticum, Clostridium bolteae, Clostridium indolis, Anaerostipes caccae, Anaerotruncus colihominis, Ruminococcus sp., Coprococcus comes, Clostridium lavalense, Clostridium asparagiforme, Clostridium symbiosum, Eubacterium contortum, Eubacterium fissicatena, Clostridium D5, Clostridium scindens, Clostridium bacterium, and Clostridium aldenense.

(65) In one aspect, the disclosure provides methods comprising bacterial compositions that do not include bacterial strains that are resistant to vancomycin. As shown in Narushima et al., VE202-1, VE202-3, VE202-6, VE202-8, and VE202-18 are resistant to vancomycin. VE202-1, VE202-3, VE202-6, VE202-8, and VE202-18 correspond to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:12, respectively. Thus, in some embodiment, the disclosure provides methods comprising bacterial compositions that do not include bacterial strains that are resistant to vancomycin, wherein the composition does not include bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:12. In some embodiments of the methods comprising compositions that do not include bacterial strains, the composition comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:17. In some embodiments, the composition comprises one or more bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO:15, SEQ ID NO: 16, or SEQ ID NO: 17, and in addition the composition does not include any bacterial strains that are resistant to vancomycin. In some embodiments, the composition comprises bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO: 16, and SEQ ID NO: 17. In some embodiments, the composition essentially consists of bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO: 17. In some embodiments, the composition consists of bacterial strains comprising 16S rDNA sequences of at least 95% homology to SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:17.

(66) In some embodiments, the compositions include bacterial strains that are susceptible to at least four antibiotics that are efficacious in humans. In some embodiments, the compositions include bacterial strains that are susceptible to at least three antibiotics that are efficacious in humans. In some embodiments, the compositions include bacterial strains that are susceptible to at least two antibiotics that are efficacious in humans. In some embodiments, the compositions include bacterial strains that are susceptible to at least one antibiotic that is efficacious in humans. In some embodiments, the compositions include only bacterial strains that are susceptible to at least four antibiotics that are efficacious in humans. In some embodiments, the compositions include only bacterial strains that are susceptible to at least three antibiotics that are efficacious in humans. In some embodiments, the compositions include only bacterial strains that are susceptible to at least two antibiotics that are efficacious in humans. In some embodiments, the compositions include bacterial strains that are susceptible to at least one antibiotic that is efficacious in humans. (An “antibiotic that is efficacious in a human” as used herein is an antibiotic that has been used to successfully treat bacterial infections in a human).

(67) In some embodiments of the compositions provided herein, the composition includes one or more anaerobic bacteria. In some embodiments of the compositions provided herein, the composition includes only anaerobic bacteria. In some embodiments of the compositions provided herein, the composition includes one or more facultative anaerobic bacteria. In some embodiments of the compositions provided herein, the composition includes only facultative anaerobic bacteria. In some embodiments of the compositions provided herein, the composition includes one or more obligate anaerobic bacteria. In some embodiments of the compositions provided herein, the composition includes only obligate anaerobic bacteria.

(68) In some embodiments of the compositions provided herein, one or more of the bacterial strains is a spore-former. In some embodiments of the compositions provided herein, one or more of the bacterial strains is in spore form. In some embodiments of the compositions provided herein, one or more of the bacterial strains is a non-spore former.

(69) In some embodiments, the compositions described herein comprise spore forming and non-spore forming bacterial strains. In some embodiments, the compositions described herein comprise spore-forming bacterial strains. In some embodiments, the compositions described herein comprise only spore-forming bacterial strains. In some embodiments, the compositions described herein comprise only non-spore forming bacterial strains. The spore-forming bacteria can be in spore form (i.e., as spores) or in vegetative form (i.e., as vegetative cells). In spore form, bacteria are generally more resistant to environmental conditions, such as heat, acid, radiation, oxygen, chemicals, and antibiotics. In contrast, in the vegetative state or actively growing state, bacteria are more susceptible to such environmental conditions, compared to in the spore form. In general, bacterial spores are able to germinate from the spore form into a vegetative/actively growing state, under appropriate conditions. For instance, bacteria in spore format may germinate when they are introduced in the intestine.

(70) In some embodiments, at least one (e.g., 1, 2, 3, 4, 5, or more) of the bacterial strains in the composition is a spore former. In some embodiments, at least one (e.g., 1, 2, 3, 4, 5, or more) of the bacterial strains in the composition is in spore form. In some embodiments, at least one (e.g., 1, 2, 3, 4, 5, or more) of the bacterial strains in the composition is a non-spore former. In some embodiments, at least one (e.g., 1, 2, 3, 4, 5, or more) of the bacterial strains in the composition is in vegetative form (As discussed above, spore forming bacteria can also be in vegetative form). In some embodiments, at least one (e.g., 1, 2, 3, 4, 5, or more) of the bacterial strains in the composition is in spore form and at least one (e.g., 1, 2, 3, 4, 5, or more) of the bacterial strains in the composition is in vegetative form. In some embodiments, at least one bacterial strain that is considered able to form spores (i.e., a spore-former) but is present in the composition in vegetative form. In some embodiments, at least one bacterial strain that is considered able to form spores is present in the composition both in spore form and in vegetative form.

(71) It is envisioned that the bacterial strains of the compositions provided herein are alive and will be alive when they reach the target area (e.g., the intestines). Bacterial spores are considered to be alive in this regards. In some embodiments, bacteria that are administered as spores may germinate in the target area (e.g., the intestines). It should further be appreciated that not all of the bacteria are alive and the compositions can include a percentage (e.g., by weight) that is not alive. In addition, in some embodiments, the compositions include bacterial strains that are not alive when administered or at the time when the composition reaches the target area (e.g., the intestines). It is envisioned that non-living bacteria may still be useful by providing some nutrients and metabolites for the other bacterial strains in the composition.

(72) In any of the compositions provided herein, in some embodiments, the bacterial strains are purified. In any of the compositions provided herein, in some embodiments, the bacterial strains are isolated. Any of the bacterial strains described herein may be isolated and/or purified, for example, from a source such as a culture or a microbiota sample (e.g., fecal matter). The bacterial strains used in the compositions provided herein generally are isolated from the microbiome of healthy individuals. However, bacterial strains can also be isolated from individuals that are considered not to be healthy. In some embodiments, the compositions include strains originating from multiple individuals. As used herein, the term “isolated” bacteria that have been separated from one or more undesired component, such as another bacterium or bacterial strain, one or more component of a growth medium, and/or one or more component of a sample, such as a fecal sample. In some embodiments, the bacteria are substantially isolated from a source such that other components of the source are not detected. As also used herein, the term “purified” refers to a bacterial strain has been separated from one or more components, such as contaminants. In some embodiments, the bacterial strain is substantially free of contaminants. In some embodiments, one or more bacterial strains of a composition may be independently purified from one or more other bacteria produced and/or present in a culture or a sample containing the bacterial strain. In some embodiments, a bacterial strain is isolated or purified from a sample and then cultured under the appropriate conditions for bacterial replication, e.g., under anaerobic culture conditions. The bacteria that is grown under appropriate conditions for bacterial replication can subsequently be isolated/purified from the culture in which it is grown.

(73) In one aspect, the disclosure provides bacterial strains and mixtures of bacterial strains with unique biological properties. In some embodiments of the compositions provided herein, the composition of bacterial strains produces butyrate when introduced in the intestine.

(74) In one aspect, the disclosure provides methods comprising pharmaceutical compositions comprising the bacterial compositions provided herein. In some embodiments, the pharmaceutical compositions provided herein comprise bacterial compositions. In some embodiments of the pharmaceutical compositions provided herein, the pharmaceutical composition comprises a pharmaceutical acceptable excipient. In some embodiments of the pharmaceutical compositions provided herein, the pharmaceutical composition is formulated for oral administration. In some embodiments of the pharmaceutical compositions provided herein, the pharmaceutical composition is formulated for rectal administration. In some embodiments of the pharmaceutical compositions provided herein, the pharmaceutical composition is formulated for delivery to the intestine. In some embodiments of the pharmaceutical compositions provided herein, the pharmaceutical composition is formulated for delivery to the colon. In some embodiments of the pharmaceutical compositions provided herein, one or more of the bacterial strains is lyophilized. In some embodiments of the pharmaceutical compositions provided herein, the pharmaceutical composition is in the form of a capsule. In some embodiments of the pharmaceutical compositions provided herein, the pharmaceutical composition further comprises a pH sensitive composition comprising one or more enteric polymers.

(75) Any of the bacterial compositions described herein, including the pharmaceutical compositions and food products comprising the compositions, may contain bacterial strains in any form, for example in an aqueous form, such as a solution or a suspension, embedded in a semi-solid form, in a powdered form or freeze dried form. In some embodiments, the composition or the bacterial strains of the composition are lyophilized. In some embodiments, a subset of the bacterial strains in a composition is lyophilized. Methods of lyophilizing compositions, specifically compositions comprising bacteria, are well known in the art. See, e.g., U.S. Pat. Nos. 3,261,761; 4,205,132; PCT Publications WO 2014/029578 and WO 2012/098358, herein incorporated by reference in their entirety. The bacteria may be lyophilized as a combination and/or the bacteria may be lyophilized separately and combined prior to administration. A bacterial strain may be combined with a pharmaceutical excipient prior to combining it with the other bacterial strain or multiple lyophilized bacteria may be combined while in lyophilized form and the mixture of bacteria, once combined may be subsequently be combined with a pharmaceutical excipient. In some embodiments, the bacterial strain is a lyophilized cake. In some embodiments, the compositions comprising the one or more bacterial strains are a lyophilized cake.

(76) The bacterial strains of the bacterial compositions provided herein can be manufactured using fermentation techniques well known in the art. In some embodiments, the active ingredients are manufactured using anaerobic fermenters, which can support the rapid growth of anaerobic bacterial species. The anaerobic fermenters may be, for example, stirred tank reactors or disposable wave bioreactors. Culture media such as BL media and EG media, or similar versions of these media devoid of animal components, can be used to support the growth of the bacterial species. The bacterial product can be purified and concentrated from the fermentation broth by traditional techniques, such as centrifugation and filtration, and can optionally be dried and lyophilized by techniques well known in the art.

(77) In some embodiments, the composition of bacterial strains may be formulated for administration as a pharmaceutical composition. The term “pharmaceutical composition” as used herein means a product that results from the mixing or combining of at least one active ingredient, such as any purified bacterial strains described herein, and one or more inactive ingredients, which may include one or more pharmaceutically acceptable excipient.

(78) An “acceptable” excipient refers to an excipient that must be compatible with the active ingredient and not deleterious to the subject to which it is administered. In some embodiments, the pharmaceutically acceptable excipient is selected based on the intended route of administration of the composition, for example a composition for oral or nasal administration may comprise a different pharmaceutically acceptable excipient than a composition for rectal administration. Examples of excipients include sterile water, physiological saline, solvent, a base material, an emulsifier, a suspending agent, a surfactant, a stabilizer, a flavoring agent, an aromatic, an excipient, a vehicle, a preservative, a binder, a diluent, a tonicity adjusting agent, a soothing agent, a bulking agent, a disintegrating agent, a buffer agent, a coating agent, a lubricant, a colorant, a sweetener, a thickening agent, and a solubilizer.

(79) Pharmaceutical compositions of the disclosure can be prepared in accordance with methods well known and routinely practiced in the art (see e.g., Remington: The Science and Practice of Pharmacy, Mack Publishing Co. 20th ed. 2000). The pharmaceutical compositions described herein may further comprise any carriers or stabilizers in the form of a lyophilized formulation or an aqueous solution. Acceptable excipients, carriers, or stabilizers may include, for example, buffers, antioxidants, preservatives, polymers, chelating reagents, and/or surfactants. Pharmaceutical compositions are preferably manufactured under GMP conditions. The pharmaceutical compositions can be used orally, nasally or parenterally, for instance, in the form of capsules, tablets, pills, sachets, liquids, powders, granules, fine granules, film-coated preparations, pellets, troches, sublingual preparations, chewables, buccal preparations, pastes, syrups, suspensions, elixirs, emulsions, liniments, ointments, plasters, cataplasms, transdermal absorption systems, lotions, inhalations, aerosols, injections, suppositories, and the like.

(80) In some embodiments, the bacteria are formulated for delivery to the intestines (e.g., the small intestine and/or the colon). In some embodiments, the bacteria are formulated with an enteric coating that increases the survival of the bacteria through the harsh environment in the stomach. The enteric coating is one which resists the action of gastric juices in the stomach so that the bacteria which are incorporated therein will pass through the stomach and into the intestines. The enteric coating may readily dissolve when in contact with intestinal fluids, so that the bacteria enclosed in the coating will be released in the intestinal tract. Enteric coatings may consist of polymer and copolymers well known in the art, such as commercially available EUDRAGIT (Evonik Industries). (See e.g., Zhang, AAPS PharmSciTech, 2016, 17 (1), 56-67).

(81) The bacteria may also be formulated for rectal delivery to the intestine (e.g., the colon). Thus, in some embodiments, the bacterial compositions may be formulated for delivery by suppository, colonoscopy, endoscopy, sigmoidoscopy or enema. A pharmaceutical preparation or formulation and particularly a pharmaceutical preparation for oral administration, may include an additional component that enables efficient delivery of the compositions of the disclosure to the intestine (e.g., the colon). A variety of pharmaceutical preparations that allow for the delivery of the compositions to the intestine (e.g., the colon) can be used. Examples thereof include pH sensitive compositions, more specifically, buffered sachet formulations or enteric polymers that release their contents when the pH becomes alkaline after the enteric polymers pass through the stomach. When a pH sensitive composition is used for formulating the pharmaceutical preparation, the pH sensitive composition is preferably a polymer whose pH threshold of the decomposition of the composition is between about 6.8 and about 7.5. Such a numeric value range is a range in which the pH shifts toward the alkaline side at a distal portion of the stomach, and hence is a suitable range for use in the delivery to the colon. It should further be appreciated that each part of the intestine (e.g., the duodenum, jejunum, ileum, cecum, colon and rectum), has different biochemical and chemical environment. For instance, parts of the intestines have different pHs, allowing for targeted delivery by compositions that have a specific pH sensitivity. Thus, the compositions provided herein may be formulated for delivery to the intestine or specific parts of the intestine (e.g., the duodenum, jejunum, ileum, cecum, colon and rectum) by providing formulations with the appropriate pH sensitivity. (See e.g., Villena et al., Int J Pharm 2015, 487 (1-2): 314-9).

(82) Another embodiment of a pharmaceutical preparation useful for delivery of the compositions to the intestine (e.g., the colon) is one that ensures the delivery to the colon by delaying the release of the contents (e.g., the bacterial strains) by approximately 3 to 5 hours, which corresponds to the small intestinal transit time. In one embodiment of a pharmaceutical preparation for delayed release, a hydrogel is used as a shell. The hydrogel is hydrated and swells upon contact with gastrointestinal fluid, with the result that the contents are effectively released (released predominantly in the colon). Delayed release dosage units include drug-containing compositions having a material which coats or selectively coats a drug or active ingredient to be administered. Examples of such a selective coating material include in vivo degradable polymers, gradually hydrolyzable polymers, gradually water-soluble polymers, and/or enzyme degradable polymers. A wide variety of coating materials for efficiently delaying the release is available and includes, for example, cellulose-based polymers such as hydroxypropyl cellulose, acrylic acid polymers and copolymers such as methacrylic acid polymers and copolymers, and vinyl polymers and copolymers such as polyvinylpyrrolidone.

(83) Additional examples of pharmaceutical compositions that allow for the delivery to the intestine (e.g., the colon) include bioadhesive compositions which specifically adhere to the colonic mucosal membrane (for example, a polymer described in the specification of U.S. Pat. No. 6,368,586) and compositions into which a protease inhibitor is incorporated for protecting particularly a biopharmaceutical preparation in the gastrointestinal tracts from decomposition due to an activity of a protease.

(84) Another example of a system enabling the delivery to the intestine (e.g., the colon) is a system of delivering a composition to the colon by pressure change in such a way that the contents are released by utilizing pressure change caused by generation of gas in bacterial fermentation at a distal portion of the stomach. Such a system is not particularly limited, and a more specific example thereof is a capsule which has contents dispersed in a suppository base and which is coated with a hydrophobic polymer (for example, ethyl cellulose).

(85) A further example of a system enabling the delivery of a composition to the intestine (e.g., the colon), is a composition that includes a coating that can be removed by an enzyme present in the gut (e.g., the colon), such as, for example, a carbohydrate hydrolase or a carbohydrate reductase. Such a system is not particularly limited, and more specific examples thereof include systems which use food components such as non-starch polysaccharides, amylose, xanthan gum, and azopolymers.

(86) The compositions provided herein can also be delivered to specific target areas, such as the intestine, by delivery through an orifice (e.g., a nasal tube) or through surgery. In addition, the compositions provided herein that are formulated for delivery to a specific area (e.g., the cecum or the colon), may be administered by a tube (e.g., directly into the small intestine). Combining mechanical delivery methods such as tubes with chemical delivery methods such as pH specific coatings, allow for the delivery of the compositions provided herein to a desired target area (e.g., the cecum or the colon).

(87) The compositions comprising bacterial strains are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those of skill in the art. Dosage regimens are adjusted to provide the optimum desired response (e.g., the prophylactic or therapeutic effect). In some embodiments, the dosage form of the composition is a tablet, pill, capsule, powder, granules, solution, or suppository. In some embodiments, the pharmaceutical composition is formulated for oral administration. In some embodiments, the pharmaceutical composition is formulated such that the bacteria of the composition, or a portion thereof, remain viable after passage through the stomach of the subject. In some embodiments, the pharmaceutical composition is formulated for rectal administration, e.g. as a suppository. In some embodiments, the pharmaceutical composition is formulated for delivery to the intestine or a specific area of the intestine (e.g., the colon) by providing an appropriate coating (e.g., a pH specific coating, a coating that can be degraded by target area specific enzymes, or a coating that can bind to receptors that are present in a target area).

(88) Dosages of the active ingredients in the pharmaceutical compositions of the present disclosure can be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired pharmaceutical response for a particular subject, composition, and mode of administration, without being toxic or having an adverse effect on the subject. The selected dosage level depends upon a variety of factors including the activity of the particular compositions of the present disclosure employed, the route of administration, the time of administration, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compositions employed, the age, sex, weight, condition, general health and prior medical history of the subject being treated, and like factors.

(89) A physician, veterinarian or other trained practitioner, can start doses of the pharmaceutical composition at levels lower than that required to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect (e.g., treatment of a pathogenic infection, reduction of bacterial burden of pathogenic infection, reduction or inhibition of toxin production) is achieved. In general, effective doses of the compositions of the present disclosure, for the prophylactic treatment of groups of people as described herein vary depending upon many different factors, including routes of administration, physiological state of the subject, whether the subject is human or an animal, other medications administered, and the therapeutic effect desired. Dosages need to be titrated to optimize safety and efficacy. In some embodiments, the dosing regimen entails oral administration of a dose of any of the compositions described herein. In some embodiments, the dosing regimen entails oral administration of multiple doses of any of the compositions described herein. In some embodiments, the composition is administered orally the subject once, twice, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, or at least 10 times.

(90) The compositions, including the pharmaceutical compositions disclosed herein, include compositions with a range of active ingredients (e.g., live bacteria, bacteria in spore format). The amount of bacteria in the compositions may be expressed in weight, number of bacteria and/or CFUs (colony forming units). In some embodiments, the pharmaceutical compositions disclosed herein contain about 10, about 10.sup.2, about 10.sup.3, about 10.sup.4, about 10.sup.5, about 10.sup.6, about 10.sup.7, about 10.sup.8, about 10.sup.9, about 10.sup.10, about 10.sup.11, about 10.sup.12, about 10.sup.13 or more of each of the bacteria of the composition per dosage amount. In some embodiments, the pharmaceutical compositions disclosed herein contain about 10, about 10.sup.2, about 10.sup.3, about 10.sup.4, about 10.sup.5, about 10.sup.6, about 10.sup.7, about 10.sup.8, about 10.sup.9, about 10.sup.10, about 10.sup.11, about 10.sup.12, about 10.sup.13 or more total bacteria per dosage amount. It should further be appreciated that the bacteria of the compositions may be present in different amounts. Thus, for instance, as a non-limiting example, a composition may include 10.sup.3 of bacteria A, 10.sup.4 of bacteria B and 10.sup.6 of bacteria C. In some embodiments, the pharmaceutical compositions disclosed herein contain about 10, about 10.sup.2, about 10.sup.3, about 10.sup.4, about 10.sup.5, about 10.sup.6, about 10.sup.7, about 10.sup.8, about 10.sup.9, about 10.sup.10, about 10.sup.11, about 10.sup.12, about 10.sup.13 or more CFUs of each of the bacteria in the composition per dosage amount. In some embodiments, the pharmaceutical compositions disclosed herein contain about 10.sup.1, about 10.sup.2, about 10.sup.3, about 10.sup.4, about 10.sup.5, about 10.sup.6, about 10.sup.7, about 10.sup.8, about 10.sup.9, about 10.sup.10, about 10.sup.11, about 10.sup.12, about 10.sup.13 or more CFUs in total for all of the bacteria combined per dosage amount. As discussed above, bacteria of the compositions may be present in different amounts. In some embodiments, the pharmaceutical compositions disclosed herein contain about 10.sup.−7, about 10.sup.−6, about 10.sup.−5, about 10.sup.−4, about 10.sup.−3, about 10.sup.−2, about 10.sup.−1 or more grams of each of the bacteria in the composition per dosage amount. In some embodiments, the pharmaceutical compositions disclosed herein contain about 10.sup.−7, about 10.sup.−6, about 10.sup.−5, about 10.sup.−4, about 10.sup.−3, about 10.sup.−2, about 10.sup.−1 or more grams in total for all of the bacteria combined per dosage amount. In some embodiment, the dosage amount is one administration device (e.g., one table, pill or capsule). In some embodiment, the dosage amount is the amount that is administered in a particular period (e.g., one day or one week).

(91) In some embodiments, the pharmaceutical compositions disclosed herein contain between 10 and 10.sup.13, between 10.sup.2 and 10.sup.13, between 10.sup.3 and 10.sup.13, between 10.sup.4 and 10.sup.13, between 10.sup.5 and 10.sup.13, between 10.sup.6 and 10.sup.13, between 10.sup.7 and 10.sup.13, between 10.sup.8 and 10.sup.13, between 10.sup.9 and 10.sup.13, between 10.sup.10 and 10.sup.13, between 10.sup.11 and 10.sup.13, between 10.sup.12 and 10.sup.13, between 10 and 10.sup.12, between 10.sup.2 and 10.sup.12, between 10.sup.3 and 10.sup.12, between 10.sup.4 and 10.sup.12, between 10.sup.5 and 10.sup.12, between 10.sup.6 and 10.sup.12, between 10.sup.7 and 10.sup.12, between 10.sup.8 and 10.sup.12, between 10.sup.9 and 10.sup.12, between 10.sup.10 and 10.sup.12, between 10.sup.11 and 10.sup.12, between 10 and 10.sup.11 between 10.sup.2 and 10.sup.11, between 10.sup.3 and 10.sup.13, between 10.sup.4 and 10.sup.13, between 10.sup.5 and 10.sup.13, between 10.sup.6 and 10.sup.13, between 10.sup.7 and 10.sup.11, between 10.sup.8 and 10.sup.11, between 10.sup.9 and 10.sup.11, between 10.sup.10 and 10.sup.11, between 10 and 10.sup.10, between 10.sup.2 and 10.sup.10, between 10.sup.3 and 10.sup.10, between 10.sup.4 and 10.sup.10, between 10.sup.5 and 10.sup.10, between 10.sup.6 and 10.sup.10, between 10.sup.7 and 10.sup.10, between 10.sup.8 and 10.sup.10, between 10.sup.9 and 10.sup.10, between 10 and 10.sup.9, between 10.sup.2 and 10.sup.9, between 10.sup.3 and 10.sup.9, between 10.sup.4 and 10.sup.9, between 10.sup.5 and 10.sup.9, between 10.sup.6 and 10.sup.9, between 10.sup.7 and 10.sup.9, between 10.sup.8 and 10.sup.9, between 10 and 10.sup.8, between 10.sup.2 and 10.sup.8, between 10.sup.3 and 10.sup.8, between 10.sup.4 and 10.sup.8, between 10.sup.5 and 10.sup.8, between 10.sup.6 and 10.sup.8, between 10.sup.7 and 10.sup.8, between 10 and 10.sup.7, between 10.sup.2 and 10.sup.7, between 10.sup.3 and 10.sup.7, between 10.sup.4 and 10.sup.7, between 10.sup.5 and 10.sup.7, between 10.sup.6 and 10.sup.7, between 10 and 10.sup.6, between 10.sup.2 and 10.sup.6, between 10.sup.3 and 10.sup.6, between 10.sup.4 and 10.sup.6, between 10.sup.5 and 10.sup.6, between 10 and 10.sup.5, between 10.sup.2 and 10.sup.5, between 10.sup.3 and 10.sup.5, between 10.sup.4 and 10.sup.5, between 10 and 10.sup.4, between 10.sup.2 and 10.sup.4, between 10.sup.3 and 10.sup.4, between 10 and 10.sup.3, between 10.sup.2 and 10.sup.3, or between 10 and 10.sup.2 of each of the bacteria of the composition per dosage amount. In some embodiments, the pharmaceutical compositions disclosed herein contain between 10 and 10.sup.13, between 10.sup.2 and 10.sup.13, between 10.sup.3 and 10.sup.13, between 10.sup.4 and 10.sup.13, between 10.sup.5 and 10.sup.13, between 10.sup.6 and 10.sup.13, between 10.sup.7 and 10.sup.13, between 10.sup.8 and 10.sup.13, between 10.sup.9 and 10.sup.13, between 10.sup.10 and 10.sup.13, between 10.sup.11 and 10.sup.13, between 10.sup.12 and 10.sup.13, between 10 and 10.sup.12, between 10.sup.2 and 10.sup.12, between 10.sup.3 and 10.sup.12, between 10.sup.4 and 10.sup.12, between 10.sup.5 and 10.sup.12, between 10.sup.6 and 10.sup.12, between 10.sup.7 and 10.sup.12, between 10.sup.8 and 10.sup.12, between 10.sup.9 and 10.sup.12, between 10.sup.10 and 10.sup.12, between 10.sup.11 and 10.sup.12, between 10 and 10.sup.11, between 10.sup.2 and 10.sup.11, between 10.sup.3 and 10.sup.13, between 10.sup.4 and 10.sup.13, between 10.sup.5 and 10.sup.13, between 10.sup.6 and 10.sup.13, between 10.sup.7 and 10.sup.11, between 10.sup.8 and 10.sup.11, between 10.sup.9 and 10.sup.11, between 10.sup.10 and 10.sup.11, between 10 and 10.sup.10, between 10.sup.2 and 10.sup.10, between 10.sup.3 and 10.sup.10, between 10.sup.4 and 10.sup.10, between 10.sup.5 and 10.sup.10, between 10.sup.6 and 10.sup.10, between 10.sup.7 and 10.sup.10, between 10.sup.8 and 10.sup.10, between 10.sup.9 and 10.sup.10, between 10 and 10.sup.9, between 10.sup.2 and 10.sup.9, between 10.sup.3 and 10.sup.9, between 10.sup.4 and 10.sup.9, between 10.sup.5 and 10.sup.9, between 10.sup.6 and 10.sup.9, between 10.sup.7 and 10.sup.9, between 10.sup.8 and 10.sup.9, between 10 and 10.sup.8, between 10.sup.2 and 10.sup.8, between 10.sup.3 and 10.sup.8, between 10.sup.4 and 10.sup.8, between 10.sup.5 and 10.sup.8, between 10.sup.6 and 10.sup.8, between 10.sup.7 and 10.sup.8, between 10 and 10.sup.7, between 10.sup.2 and 10.sup.7, between 10.sup.3 and 10.sup.7, between 10.sup.4 and 10.sup.7, between 10.sup.5 and 10.sup.7, between 10.sup.6 and 10.sup.7, between 10 and 10.sup.6, between 10.sup.2 and 10.sup.6, between 10.sup.3 and 10.sup.6, between 10.sup.4 and 10.sup.6, between 10.sup.5 and 10.sup.6, between 10 and 10.sup.5, between 10.sup.2 and 10.sup.5, between 10.sup.3 and 10.sup.5, between 10.sup.4 and 10.sup.5, between 10 and 10.sup.4, between 10.sup.2 and 10.sup.4, between 10.sup.3 and 10.sup.4, between 10 and 10.sup.3, between 10.sup.2 and 10.sup.3, or between 10 and 10.sup.2 total bacteria per dosage amount.

(92) In some embodiments, the pharmaceutical compositions disclosed herein contain between 10 and 10.sup.13, between 10.sup.2 and 10.sup.13, between 10.sup.3 and 10.sup.13, between 10.sup.4 and 10.sup.13, between 10.sup.5 and 10.sup.13, between 10.sup.6 and 10.sup.13, between 10.sup.7 and 10.sup.13, between 10.sup.8 and 10.sup.13, between 10.sup.9 and 10.sup.13, between 10.sup.10 and 10.sup.13, between 10.sup.11 and 10.sup.13, between 10.sup.12 and 10.sup.13, between 10 and 10.sup.12, between 10.sup.2 and 10.sup.12, between 10.sup.3 and 10.sup.12, between 10.sup.4 and 10.sup.12, between 10.sup.5 and 10.sup.12, between 10.sup.6 and 10.sup.12, between 10.sup.7 and 10.sup.12, between 10.sup.8 and 10.sup.12, between 10.sup.9 and 10.sup.12, between 10.sup.10 and 10.sup.12, between 10.sup.11 and 10.sup.12, between 10 and 10.sup.11, between 10.sup.2 and 10.sup.11, between 10.sup.3 and 10.sup.13, between 10.sup.4 and 10.sup.13, between 10.sup.5 and 10.sup.13, between 10.sup.6 and 10.sup.13, between 10.sup.7 and 10.sup.11, between 10.sup.8 and 10.sup.11, between 10.sup.9 and 10.sup.11, between 10.sup.10 and 10.sup.11, between 10 and 10.sup.10, between 10.sup.2 and 10.sup.10, between 10.sup.3 and 10.sup.10, between 10.sup.4 and 10.sup.10, between 10.sup.5 and 10.sup.10, between 10.sup.6 and 10.sup.10, between 10.sup.7 and 10.sup.10, between 10.sup.8 and 10.sup.10, between 10.sup.9 and 10.sup.10, between 10 and 10.sup.9, between 10.sup.2 and 10.sup.9, between 10.sup.3 and 10.sup.9, between 10.sup.4 and 10.sup.9, between 10.sup.5 and 10.sup.9, between 10.sup.6 and 10.sup.9, between 10.sup.7 and 10.sup.9, between 10.sup.8 and 10.sup.9, between 10 and 10.sup.8, between 10.sup.2 and 10.sup.8, between 10.sup.3 and 10.sup.8, between 10.sup.4 and 10.sup.8, between 10.sup.5 and 10.sup.8, between 10.sup.6 and 10.sup.8, between 10.sup.7 and 10.sup.8, between 10 and 10.sup.7, between 10.sup.2 and 10.sup.7, between 10.sup.3 and 10.sup.7, between 10.sup.4 and 10.sup.7, between 10.sup.5 and 10.sup.7, between 10.sup.6 and 10.sup.7, between 10 and 10.sup.6, between 10.sup.2 and 10.sup.6, between 10.sup.3 and 10.sup.6, between 10.sup.4 and 10.sup.6, between 10.sup.5 and 10.sup.6, between 10 and 10.sup.5, between 10.sup.2 and 10.sup.5, between 10.sup.3 and 10.sup.5, between 10.sup.4 and 10.sup.5, between 10 and 10.sup.4, between 10.sup.2 and 10.sup.4, between 10.sup.3 and 10.sup.4, between 10 and 10.sup.3, between 10.sup.2 and 10.sup.3, or between 10 and 10.sup.2 CFUs of each of the bacteria of the composition per dosage amount. In some embodiments, the pharmaceutical compositions disclosed herein contain between 10 and 10.sup.13, between 10.sup.2 and 10.sup.13, between 10.sup.3 and 10.sup.13, between 10.sup.4 and 10.sup.13, between 10.sup.5 and 10.sup.13, between 10.sup.6 and 10.sup.13, between 10.sup.7 and 10.sup.13, between 10.sup.8 and 10.sup.13, between 10.sup.9 and 10.sup.13, between 10.sup.10 and 10.sup.13, between 10.sup.11 and 10.sup.13, between 10.sup.12 and 10.sup.13, between 10 and 10.sup.12, between 10.sup.2 and 10.sup.12, between 10.sup.3 and 10.sup.12, between 10.sup.4 and 10.sup.12, between 10.sup.5 and 10.sup.12, between 10.sup.6 and 10.sup.12, between 10.sup.7 and 10.sup.12, between 10.sup.8 and 10.sup.12, between 10.sup.9 and 10.sup.12, between 10.sup.10 and 10.sup.12, between 10.sup.11 and 10.sup.12, between 10 and 10.sup.11, between 10.sup.2 and 10.sup.11, between 10.sup.3 and 10.sup.13, between 10.sup.4 and 10.sup.13, between 10.sup.5 and 10.sup.13, between 10.sup.6 and 10.sup.13, between 10.sup.7 and 10.sup.11, between 10.sup.8 and 10.sup.11, between 10.sup.9 and 10.sup.11, between 10.sup.10 and 10.sup.11, between 10 and 10.sup.10, between 10.sup.2 and 10.sup.10, between 10.sup.3 and 10.sup.10, between 10.sup.4 and 10.sup.10, between 10.sup.5 and 10.sup.10, between 10.sup.6 and 10.sup.10, between 10.sup.7 and 10.sup.10, between 10.sup.8 and 10.sup.10, between 10.sup.9 and 10.sup.10, between 10 and 10.sup.9, between 10.sup.2 and 10.sup.9, between 10.sup.3 and 10.sup.9, between 10.sup.4 and 10.sup.9, between 10.sup.5 and 10.sup.9, between 10.sup.6 and 10.sup.9, between 10.sup.7 and 10.sup.9, between 10.sup.8 and 10.sup.9, between 10 and 10.sup.8, between 10.sup.2 and 10.sup.8, between 10.sup.3 and 10.sup.8, between 10.sup.4 and 10.sup.8, between 10.sup.5 and 10.sup.8, between 10.sup.6 and 10.sup.8, between 10.sup.7 and 10.sup.8, between 10 and 10.sup.7, between 10.sup.2 and 10.sup.7, between 10.sup.3 and 10.sup.7, between 10.sup.4 and 10.sup.7, between 10.sup.5 and 10.sup.7, between 10.sup.6 and 10.sup.7, between 10 and 10.sup.6, between 10.sup.2 and 10.sup.6, between 10.sup.3 and 10.sup.6, between 10.sup.4 and 10.sup.6, between 10.sup.5 and 10.sup.6, between 10 and 10.sup.5, between 10.sup.2 and 10.sup.5, between 10.sup.3 and 10.sup.5, between 10.sup.4 and 10.sup.5, between 10 and 10.sup.4, between 10.sup.2 and 10.sup.4, between 10.sup.3 and 10.sup.4, between 10 and 10.sup.3, between 10.sup.2 and 10.sup.3, or between 10 and 10.sup.2 total CFUs per dosage amount.

(93) In some embodiments, the pharmaceutical compositions disclosed herein contain between 10.sup.−7 and 10.sup.−1, between 10.sup.−6 and 10.sup.−1, between 10.sup.−5 and 10.sup.−1, between 10.sup.−4 and 10.sup.−1, between 10.sup.−3 and 10.sup.−1, between 10.sup.−2 and 10.sup.−1, between 10.sup.−7 and 10.sup.−2, between 10.sup.−6 and 10.sup.−2, between 10.sup.−5 and 10.sup.−2, between 10.sup.−4 and 10.sup.−2, between 10.sup.−3 and 10.sup.−2, between 10.sup.−7 and 10.sup.−3, between 10.sup.−6 and 10.sup.−3, between 10.sup.−5 and 10.sup.−3, between 10.sup.−4 and 10.sup.−3, between 10.sup.−7 and 10.sup.−4, between 10.sup.−6 and 10.sup.−4, between 10.sup.−5 and 10.sup.−4, between 10.sup.−7 and 10.sup.−5, between 10.sup.−6 and 10.sup.−5, or between 10.sup.−7 and 10.sup.−6 grams of each of the bacteria in the composition per dosage amount. In some embodiments, the pharmaceutical compositions disclosed herein contain between 10.sup.−7 and 10.sup.−1, between 10.sup.−6 and 10.sup.−1, between 10.sup.−5 and 10.sup.−1, between 10.sup.−4 and 10.sup.−1, between 10.sup.−3 and 10.sup.−1, between 10.sup.−2 and 10.sup.−1, between 10.sup.−7 and 10.sup.−2, between 10.sup.−6 and 10.sup.−2, between 10.sup.−5 and 10.sup.−2, between 10.sup.−4 and 10.sup.−2, between 10.sup.−3 and 10.sup.−2, between 10.sup.−7 and 10.sup.−3, between 10.sup.−6 and 10.sup.−3, between 10.sup.−5 and 10.sup.−3, between 10.sup.−4 and 10.sup.−3, between 10.sup.−7 and 10.sup.−4, between 10.sup.−6 and 10.sup.−4, between 10.sup.−5 and 10.sup.−4, between 10.sup.−7 and 10.sup.−5, between 10.sup.−6 and 10.sup.−5, or between 10.sup.−7 and 10.sup.−6 grams of all of the bacteria combined per dosage amount.

(94) In one aspect, the disclosure provides a food product comprising any of the compositions provided herein and a nutrient. Also with the scope of the present disclosure are food products comprising any of the bacterial strains described herein and a nutrient. Food products are, in general, intended for the consumption of a human or an animal. Any of the bacterial strains described herein may be formulated as a food product. In some embodiments, the bacterial strains are formulated as a food product in spore form. In some embodiments, the bacterial strains are formulated as a food product in vegetative form. In some embodiments, the food product comprises both vegetative bacteria and bacteria in spore form. The compositions disclosed herein can be used in a food or beverage, such as a health food or beverage, a food or beverage for infants, a food or beverage for pregnant women, athletes, senior citizens or other specified group, a functional food, a beverage, a food or beverage for specified health use, a dietary supplement, a food or beverage for patients, or an animal feed. Non-limiting examples of the foods and beverages include various beverages such as juices, refreshing beverages, tea beverages, drink preparations, jelly beverages, and functional beverages; alcoholic beverages such as beers; carbohydrate-containing foods such as rice food products, noodles, breads, and pastas; paste products such as fish hams, sausages, paste products of seafood; retort pouch products such as curries, food dressed with a thick starchy sauces, soups; dairy products such as milk, dairy beverages, ice creams, cheeses, and yogurts; fermented products such as fermented soybean pastes, yogurts, fermented beverages, and pickles; bean products; various confectionery products such as Western confectionery products including biscuits, cookies, and the like, Japanese confectionery products including steamed bean-jam buns, soft adzuki-bean jellies, and the like, candies, chewing gums, gummies, cold desserts including jellies, cream caramels, and frozen desserts; instant foods such as instant soups and instant soy-bean soups; microwavable foods; and the like. Further, the examples also include health foods and beverages prepared in the forms of powders, granules, tablets, capsules, liquids, pastes, and jellies.

(95) Food products containing bacterial strains described herein may be produced using methods known in the art and may contain the same amount of bacteria (e.g., by weight, amount or CFU) as the pharmaceutical compositions provided herein. Selection of an appropriate amount of bacteria in the food product may depend on various factors, including for example, the serving size of the food product, the frequency of consumption of the food product, the specific bacterial strains contained in the food product, the amount of water in the food product, and/or additional conditions for survival of the bacteria in the food product.

(96) Examples of food products which may be formulated to contain any of the bacterial strains described herein include, without limitation, a beverage, a drink, a bar, a snack, a dairy product, a confectionery product, a cereal product, a ready-to-eat product, a nutritional formula, such as a nutritional supplementary formulation, a food or beverage additive.

(97) II. Therapeutic Methods

(98) In one aspect, the disclosure provides bacterial compositions and methods of treatment for disease (e.g., GvHD) in a subject. In one aspect, the disclosure provides bacterial compositions and methods of increasing survival following bone marrow transplant. In some embodiments, survival after bone marrow transplant is increased because the methods provided herein decrease the risk of GvHD. In one aspect, and without being limiting, the bacterial compositions disclosed herein can treat disease and/or increase survival because their administration results in an increase in the amount of butyrate in the intestine of the subject. In one aspect, and without being limiting, the bacterial compositions disclosed herein can treat disease and/or increase survival because their administration results in an increase in the amount of histone acetylation in the intestine of the subject. In one aspect, and without being limiting, the bacterial compositions disclosed herein can treat disease and/or increase survival because their administration results in the increase in the amount of butyrate producing bacterial strains in the intestine of the subject.

(99) In one aspect, the disclosure provides methods of treating a disease in a subject and/or increase survival comprising administering any of the bacterial compositions provided herein to the subject in an effective amount to treat the disease and/or increase survival. In some embodiments of the methods provided herein, the administration of the bacterial composition to the subject results in an increase in the amount of butyrate in the intestine of the subject. In some embodiments of the methods provided herein, the amount of butyrate is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% when compared to the amount of butyrate present in the intestine of the subject before the administration of the bacterial composition. In some embodiments of the methods provided herein, the administration of the bacterial composition to the subject results in an increase in the amount of histone acetylation in the intestine of the subject. In some embodiments of the methods provided herein, the amount of histone acetylation is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% when compared to the amount of histone acetylation in the intestine of the subject before the administration of the bacterial composition. In some embodiments of the methods provided herein, the administration of the bacterial composition to the subject results in an increase in the amount of butyrate producing bacterial strains in the intestine of the subject. In some embodiments of the methods provided herein, the amount of butyrate producing bacterial strains is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% when compared to the amount of butyrate producing bacterial strains in the intestine of the subject before the administration of the bacterial composition. Without being limited to a specific mechanism, it is thought that an increase in the amount of butyrate producing bacterial strains in the intestine will result in an increase in the amount of butyrate in the intestine, which, is correlated with an increase in the amount of histone acetylation in the intestine.

(100) In one aspect, the methods provided herein comprise the administration of the bacterial compositions to a subject in a therapeutically effective amount to treat or prevent a disease (e.g., GvHD) and/or increase survival. The terms “treat” or “treatment” refer to reducing or alleviating one or more of the symptoms associated with a disease. The terms “prevent” or “prevention” encompass prophylactic administration and may reduce the incidence or likelihood of the occurrence of the disease. Accordingly, “increasing survival” is defined as a reduction in the likelihood that a subject will die from the consequences of a specific event (e.g., bone marrow transplant). In some embodiments, administration of the compositions provided herein result in a healthy microbiome that results in an increase in the amount of butyrate in the intestine thereby increasing protection of a subject against disease (e.g., GvHD) and/or increasing survival (e.g., following bone marrow transplant).

(101) As used herein, a “therapeutically effective amount” of composition, such as a pharmaceutical composition, is any amount that results in a desired response or outcome in a subject, such as those described herein, including but not limited to prevention or treatment of GvHD and/or increasing survival following bone marrow transplant. It should be appreciated that the term effective amount may be expressed in weight (e.g., gram or milligram), number of bacteria or CFUs (colony forming units) to be administered. It should further be appreciated that the bacteria can multiply once administered. Thus, administration of even a relatively small amount of bacteria may have therapeutic effects.

(102) In some embodiments, the therapeutically effective amount of any of the compositions described herein is an amount sufficient to treat the disease, e.g., prevention or treatment of GvHD and/or increasing survival following bone marrow transplant.

(103) Aspects of the present disclosure are related to methods for treating a disease or condition in a subject by administering a therapeutically effective amount of any of the compositions described herein. In some embodiments, the subject is a mammalian subject, such as a human, non-human primate, rodent, rabbit, sheep, pig, dog, cat, horse, or cow. In some embodiments, the subject is a human subject.

(104) The compositions and methods described herein may be utilized in conjunction with other types of therapy (i.e., combination treatment), such as additional therapeutic agents. Examples of additional combination therapies include, without limitation, surgery, radiation, gene therapy, and administration of additional therapeutic agents, such as chemotherapeutics, antibiotics, antivirals, anti-fungals, anti-parasitics, immunomodulatory agents, anti-inflammatory agents. In general, combination therapies can be administered simultaneously or sequentially (in any order) with the compositions and methods described herein. In some embodiments, any of the compositions described herein is administered simultaneously with one or more additional therapeutic agents, for example in a single dose or in multiple doses that are administered at substantially the same time.

(105) In some embodiments, the compositions described herein are administered to a subject concomitantly with one or more additional therapeutic agents. In some embodiments, the compositions described herein are administered to a subject followed by administration of one or more additional therapeutic agent. In some embodiments, any of the compositions described herein is administered at least about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 3 months, 4 months, 5 months, 6 months or more prior to administration of the one or more additional therapeutic agent. Alternatively, in some embodiments, one or more therapeutic agent administered to a subject followed by administration of any of the compositions described herein. In some embodiments, one or more therapeutic agent is administered at least about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 3 months, 4 months, 5 months, 6 months or more prior to administration of any the compositions described herein.

(106) In some embodiments, the one or more traditional therapeutic agent is an immunosuppressant such as a topical or systemic corticosteroid (e.g., prednisone, prednisolone or methylprednisolone) or ciclosporin. Additional treatments include, but are not limited to, infliximab (Remicade), entanercept, sirolimus, mycophenolate mofetil (MMF), and/or extracorporeal photopheresis.

(107) In some embodiments, the subject has not received a dose of an antibiotic prior to administration of the bacterial composition. In some embodiments, the subject has not been administered an antibiotic at least 1, at least 2, at least 3, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 60, at least 90, at least 120, at least 180 or at least 360 days prior to administration of the compositions provided herein.

(108) In some embodiments, the subject may be administered one or more doses of an antibiotic prior to or concurrently with a bacterial composition. Antibiotics may be administered for a variety of reasons. For instance, antibiotics may be administered to remove bacterial species from the colon and/or intestine prior to administration of the bacterial compositions provided herein. Antibiotics may also be administered to suppress unwanted infections in the case of cancer treatment. In some instances, antibiotics may be administered as a treatment method for an infectious disease.

(109) In some embodiments, the subject is administered a single dose of an antibiotic prior to the bacterial composition. In some embodiments, the subject is administered multiple doses of an antibiotic prior to the bacterial composition. In some embodiments, the subject is administered at least 2, 3, 4, 5 or more doses of an antibiotic prior to the bacterial composition. In some embodiments, the subject is administered a dose of an antibiotic at substantially the same time as the bacterial composition. Examples of antibiotics that can be administered include, without limitation, kanamycin, gentamicin, colistin, metronidazole, vancomycin, clindamycin, fidaxomicin, and cefoperazone.

(110) III. Additional Methods

(111) Also within the scope of the present disclosure are methods of assessing the amount of butyrate present in the intestine of a subject. In some embodiments, the methods provided herein will result in an increase in the amount of butyrate present in the intestine of the subject. In some embodiments, the disclosure provides methods of administering bacterial compositions, wherein the administration results in an increase in the amount of butyrate in the intestine of the subject. In some embodiments of the methods provided herein, the method comprises determining the amount of butyrate in the intestine of the subject prior to administration of the bacterial composition. In some embodiments of the methods provided herein, the method comprises determining the amount of butyrate in the intestine of the subject after administration of the bacterial composition. In some embodiments of the methods provided herein, the method comprises determining the amount of butyrate in the intestine of the subject prior to and after administration of the bacterial composition. In some embodiments, the disclosure provides methods comprising determining the amount of butyrate in the intestine of a subject, wherein if the amount of butyrate in the intestine of the subject is lower than the amount of butyrate in the intestine of a healthy individual, administering to the subject any of the bacterial compositions provided herein. In some embodiments, the amount of butyrate present in the intestine of the subject is determined prior to administration of any of the bacterial compositions disclosed herein. In some embodiments, if fewer than a threshold amount of butyrate is present in the intestine of the subject, any of the compositions described herein are administered to the subject to increase the amount of butyrate in the intestine of the subject. In some embodiments, the method comprises identifying the subject as a candidate for a treatment of the disease (e.g., GvHD), or needing an increase in survival following bone marrow transplant, based on the amount of butyrate present in the intestine. Thus, for instance, if the amount of butyrate present in the intestine of an individual is lower than the threshold amount, the individual is identified as a candidate for treatment, wherein, in some embodiments, treatment comprises administration of the bacterial compositions according to the methods provided herein. In some embodiments, the threshold amount is the amount of butyrate present in the intestine of a healthy individual (i.e., an individual not having, or being at risk of having, GvHD). In addition, the art can be relied on to provide the amount of butyrate in a healthy individual (See e.g., Huda-Faujan et al., Open Biochem J. 2010, 4: 53-58). Methods for determining the amount of butyrate in the intestine are known in the art and may include gas chromatography analysis of the metabolites and/or other components of a stool sample.

(112) In one aspect the disclosure provides methods of assessing the amount of histone acetylation present in the intestine of a subject. In some embodiments, the methods provided herein will result in an increase in the amount of histone acetylation present in the intestine of the subject. In some embodiments, the disclosure provides methods of administering bacterial compositions, wherein the administration results in an increase in the amount of histone acetylation in the intestine of the subject. In some embodiments of the methods provided herein, the method comprises determining the amount of histone acetylation in the intestine of the subject prior to administration of the bacterial composition. In some embodiments of the methods provided herein, the method comprises determining the amount of histone acetylation in the intestine of the subject after administration of the bacterial composition. In some embodiments of the methods provided herein, the method comprises determining the amount of histone acetylation in the intestine of the subject prior to and after administration of the bacterial composition. In some embodiments, the disclosure provides methods comprising determining the amount of histone acetylation in the intestine of a subject, wherein if the amount of histone acetylation in the intestine of the subject is lower than the amount of histone acetylation in the intestine of a healthy individual, administering to the subject any of the bacterial compositions provided herein. In some embodiments, the amount of histone acetylation present in the intestine of the subject is determined prior to administration of any of the bacterial compositions disclosed herein. In some embodiments, if fewer than a threshold amount of histone acetylation is present in the intestine of the subject, any of the compositions described herein are administered to the subject to increase the amount of histone acetylation in the intestine of the subject. In some embodiments, the method comprises identifying the subject as a candidate for a treatment of the disease (e.g., GvHD), or needing an increase in survival following bone marrow transplant, based on the amount of histone acetylation present in the intestine. Thus, for instance, if the amount of histone acetylation present in the intestine of an individual is lower than the threshold amount, the individual is identified as a candidate for treatment, wherein, in some embodiments, treatment comprises administration of the bacterial compositions according to the methods provided herein. In some embodiments, the threshold amount is the amount of histone acetylation present in the intestine of a healthy individual (i.e., an individual not having or being at risk of having GvHD). Methods for determining the amount of histone acetylation are known in the art and include Western blot and ELISA to determine the amount of acetylation on one or more histones isolated from one or more cell types in the intestine.

(113) In one aspect the disclosure provides methods of assessing the amount of butyrate producing bacterial strains present in the intestine of a subject. In some embodiments, the methods provided herein will result in an increase in the amount of butyrate producing bacterial strains present in the intestine of the subject. In some embodiments, the disclosure provides methods of administering bacterial compositions, wherein the administration results in an increase in the amount of butyrate producing bacterial strains in the intestine of the subject. In some embodiments of the methods provided herein, the method comprises determining the amount of butyrate producing bacterial strains in the intestine of the subject prior to administration of the bacterial composition. In some embodiments of the methods provided herein, the method comprises determining the amount of butyrate producing bacterial strains in the intestine of the subject after administration of the bacterial composition. In some embodiments of the methods provided herein, the method comprises determining the amount of butyrate producing bacterial strains in the intestine of the subject prior to and after administration of the bacterial composition. In some embodiments, the disclosure provides methods comprising determining the amount of butyrate producing bacterial strains in the intestine of a subject, wherein if the amount of butyrate producing bacterial strains in the intestine of the subject is lower than the amount of butyrate producing bacterial strains in the intestine of a healthy individual, administering to the subject any of the bacterial compositions provided herein. In some embodiments, the amount of butyrate producing bacterial strains present in the intestine of the subject is determined prior to administration of any of the bacterial compositions disclosed herein. In some embodiments, if fewer than a threshold amount of butyrate producing bacterial strains is present in the intestine of the subject, any of the compositions described herein are administered to the subject to increase the amount of butyrate producing bacterial strains in the intestine of the subject. In some embodiments, the method comprises identifying the subject as a candidate for a treatment of the disease (e.g., GvHD), or needing an increase in survival following bone marrow transplant, based on the amount of butyrate producing bacterial strains present in the intestine. Thus, for instance, if the amount of butyrate producing bacterial strains present in the intestine of an individual is lower than the threshold amount, the individual is identified as a candidate for treatment, wherein, in some embodiments, treatment comprises administration of the bacterial compositions according to the methods provided herein. In some embodiments, the threshold amount is the amount of butyrate producing bacterial strains present in the intestine of a healthy individual (i.e., an individual not having or being at risk of having GvHD). In general, the amount of butyrate producing bacterial strains in the intestine (e.g., presence or absence of one or more butyrate producing bacterial strains may be determined by assessing a sample obtained from the subject, such as a fecal sample. Such a fecal sample may be subjected to 16S RNA analysis, whole genome sequencing and additional methods to determine the amount and nature of the butyrate producing bacterial strains present in the intestine.

EXAMPLES

Example 1

(114) The impact of alterations in intestinal microbiota on microbial metabolites and on disease processes, such as graft-versus-host disease (GVHD), is not known. Experiments described herein used unbiased analysis to identify novel alterations in gastrointestinal microbiota-derived short chain fatty acids (SCFA) after allogeneic bone marrow transplant (allo-BMT). Alterations in the amounts of only one SCFA, butyrate, were observed only within the intestinal tissue. The reduced butyrate in CD326+ intestinal epithelial cells (IECs) after allo-BMT resulted in decreased histone acetylation, which was restored upon local administration of exogenous butyrate. Butyrate restoration improved IEC junctional integrity, decreased apoptosis, and mitigated decreased GVHD. Furthermore, alteration of the indigenous microbiota with 17 rationally selected strains of high butyrate producing Clostridia also decreased GVHD. These data demonstrate a heretofore unrecognized role of microbial metabolites and indicate that local and specific alteration of microbial metabolites has direct salutary effects on GVHD target tissues and can mitigate its severity.

(115) Alterations in the intestinal microbiome are associated with several disease processes (David, L. A. et al. Diet rapidly and reproducibly alters the human gut microbiome. Nature 505, 559-563 (2014); Turnbaugh, P. J. et al. A core gut microbiome in obese and lean twins. Nature 457, 480-484 (2009); Mathewson, N. & Reddy, P. The Microbiome and Graft Versus Host Disease. Curr Stem Cell Rep (2015); Jenq, R. R. et al. Regulation of intestinal inflammation by microbiota following allogeneic bone marrow transplantation. Journal of Experimental Medicine 209, 903-911 (2012); Eriguchi, Y. et al. Graft-versus-host disease disrupts intestinal microbial ecology by inhibiting Paneth cell production of α-defensins. Blood 120, 223-231 (2012)). However, the effect that changes in the community structure of the microbiome have on the production of microbial-derived metabolites is poorly explored. Microbial metabolites influence disease severity, but whether these alterations in microbial metabolites can impact outcomes after allogeneic bone marrow transplant (allo-BMT) are not known. Allo-BMT is a critical interventional therapy for patients with aggressive hematological malignancies (Jenq, R. R. & van den Brink, M. R. M. Allogeneic haematopoietic stem cell transplantation: individualized stem cell and immune therapy of cancer. Nature Reviews Cancer 10, 213-221 (2010); Choi, S. & Reddy, P. Graft-versus-host disease. Panminerva Med 52, 111-124 (2010)). Although allo-BMT is a curative and widely used treatment, approximately 40-50% of patients experience severe gastrointestinal damage from graft-versus-host disease (GVHD), which leads to high transplant-related mortality (Choi et al., supra; Ferrara, J. L. M., Levine, J. E., Reddy, P. & Holler, E. Graft-versus-host disease. Lancet 373, 1550-1561 (2009)).

(116) Studies have revealed that the intestinal microbiota is significantly altered in patients with GVHD and the alterations correlate with GVHD severity and pathogenesis (Jenq, R. R. et al. Regulation of intestinal inflammation by microbiota following allogeneic bone marrow transplantation. Journal of Experimental Medicine 209, 903-911 (2012); Taur, Y. et al. The effects of intestinal tract bacterial diversity on mortality following allogeneic hematopoietic stem cell transplantation. Blood 124, 1174-1182 (2014)). Nevertheless, the direct causality of the changes in the host microbiota on GVHD severity is unclear. More relevantly, whether changes in the microbiota result in alterations in levels of microbial metabolites and by-products that have biological impact on allogeneic-BMT remain unknown. Microbial metabolites such as short chain fatty acids (SCFA) are exclusively derived from the GI microbiota and are not made by the host. Some of these fatty acids (FAs), specifically the histone deacetylase inhibitor (HDACi) butyrate, is a preferred energy source for intestinal epithelial cells (IECs) (Ganapathy, V., Thangaraju, M., Prasad, P. D., Martin, P. M. & Singh, N. Transporters and receptors for short-chain fatty acids as the molecular link between colonic bacteria and the host. Curr Opin Pharmacol 13, 869-874 (2013); Fleming, L. L. & Floch, M. H. Digestion and absorption of fiber carbohydrate in the colon. Am. J Gastroenterol. 81, 507-511 (1986); Sealy, L. & Chalkley, R. The effect of sodium butyrate on histone modification. Cell 14, 115-121 (1978); Cook, S. I. & Sellin, J. H. Review article: short chain fatty acids in health and disease; Aliment. Pharmacol. Ther. 12, 499-507 (1998)) and administration of exogenous HDACi regulates GVHD (Reddy, P. et al. Histone deacetylase inhibitor suberoylanilide hydroxamic acid reduces acute graft-versus-host disease and preserves graft-versus-leukemia effect. Proc Natl Acad Sci USA 101, 3921-3926 (2004); Reddy, P. et al. Histone deacetylase inhibition modulates indoleamine 2,3-dioxygenasedependent DC functions and regulates experimental graft-versus-host disease in mice. J. Clin. Invest. 118, 2562-2573 (2008); Choi, S. W. et al. Vorinostat plus tacrolimus and mycophenolate to prevent graft-versus host disease after related-donor reduced-intensity conditioning allogeneic haemopoietic stem-cell transplantation: a phase ½ trial. Lancet Oncol. 15, 87-95 (2014)). But the impact that host indigenous microbial metabolites that function as HDACi have on GVHD remains Unknown (Fleming, L. L. & Floch, M. H. Digestion and absorption of fiber carbohydrate in the colon. Am. J Gastroenterol. 81, 507-511 (1986); 12. Sealy, L. & Chalkley, R. The effect of sodium butyrate on histone modification. Cell 14, 115-121 (1978); Cook, S. I. & Sellin, J. H. Review article: short chain fatty acids in health and disease. Aliment. Pharmacol. Ther. 12, 499-507 (1998)).

(117) Methods

(118) Reagents:

(119) RPMI, penicillin and streptomycin, and sodium pyruvate were purchased from Gibco (Grand Island, N.Y.); FCS from GemCell (Sacramento, Calif.); 2-ME from Sigma (St. Louis, Mo.); murine GM-CSF from Peprotech (Rocky Hill, N.J.). All antibodies (Abs) used for FACS were purchased from eBioscience (San Diego, Calif.). DMSO and butyrate was obtained from Sigma (St. Louis, Mo.), and lipopolysaccharide (LPS) from InvivoGen (San Diego, Calif.).

(120) Mice:

(121) Female C57BL/6J (H-2b; CD45.2+), BALB/c (H-2d) mice were purchased from National Cancer Institute and FoxP3.DTR (DREG) (H-2b) mice and C3H.sw (H-2b) mice were purchased from The Jackson Laboratory (Bar Harbor, Me.). The age of mice used for experiments ranged between 7 and 12 weeks. All animals were cared for under regulations reviewed and approved by the University Committee on Use and Care of Animals of the University of Michigan, based on University Laboratory Animal Medicine guidelines.

(122) Cell Isolation and Cultures:

(123) Primary intestinal epithelial cells (IECs) were obtained from C57BL/6J mice as described previously (Lefrangois, L. & Lycke, N. Isolation of Mouse Small Intestinal Intraepithelial Lymphocytes, Peyer's Patch, and Lamina Propria Cells. (John Wiley & Sons, Inc., 2001)). Briefly, luminal contents of intestine were flushed with CMF solution. Intestine was then minced into 0.5 cm pieces, washed with CMF four times, transferred to CMF/FBS/EDTA, and incubated at 37° C. for 60 minutes (shaking tubes every 10 minutes). Supernatant containing IECs was then transferred through 100 μM cell filter followed by incubation on ice for 10 minutes to allow sedimentation. Supernatant was again transferred through a 75 μM cell filter. CD326+ IECs were next purified utilizing either FACS or anti-APC magnetic microbeads (Miltenyi Biotec Ltd., Auburn, Calif.) and an autoMACs (Miltenyi Biotec). For viability assay, CD326+ IECs were seeded on gelatin coated 100 mm culture dishes and treated in the presence of absence of indicated butyrate concentrations overnight. Cells were then subjected to or withheld from irradiation (6 Gy) and cultured for another 24 hours.

(124) Bone Marrow Transplantation (BMT):

(125) BMTs were performed as previously described (Reddy, P. et al. A crucial role for antigen-presenting cells and alloantigen expression in graft-versus-leukemia responses. Nat. Med. 11, 1244-1249 (2005); 15). Briefly, syngeneic (BALB/c.fwdarw.BALC/c or C57BL/6J.fwdarw.C57BL/6J) and allogeneic (C57BL/6J.fwdarw.BALB/c or C3H.sw.fwdarw.C57BL/6J) recipients received lethal irradiation. On day −1, BALB/c recipients received a total of 800 cGy of irradiation (split dose separated by 3 hours) and B6 animals received a single dose of 1000 cGy. Donor splenic CD90.2+ T cells were magnetically separated using an autoMACs (Miltenyi Biotec; Bergisch Gladbach, Germany) and 0.5×10.sup.6 to 2.5×10.sup.6 T cells were transferred to BALB/c and C57BL/6J recipients. 5×10.sup.6 donor whole or TCD bone marrow was transferred to all recipients. Survival was monitored daily and the recipient body weight and GVHD clinical scores were determined weekly, as described previously42. Histopathologic analysis of the gastrointestinal (GI) tract was performed as described (Reddy, P. et al. A crucial role for antigen-presenting cells and alloantigen expression in graft-versus-leukemia responses. Nat. Med. 11, 1244-1249 (2005)). Animals received vehicle (sterile PBS, 0.0004 g Na+ per dose) or sodium butyrate (10 mg/kg, 0.00004 g Na+ per dose) by flexible 20G-1.5″ intragastric gavage needle daily for 1 week, then every other day thereafter.

(126) For BMTs performed at MSKCC, C57BL/6J mice were treated with an antibiotic cocktail to target obligate anaerobes (ampicillin 5 mg, metronidazole 4 mg, clindamycin 5 mg, and vancomycin 5 mg) gavaged daily for 6 days (BMT days −18 to −13) followed 4 and 6 days later by oral gavage with indicated bacteria (BMT days −9 and −7) or PBS. Clostridial bacteria were cultured individually on plates and resuspended in anaerobic PBS at a final OD (600 nm) of 0.02 to 0.06. One week later, mice were irradiated (12 Gy single dose) and transplanted with B10.BR BM (5×10.sup.6) and T cells (0.5×10.sup.6 CD5 MACS), and followed for development of clinical GVHD.

(127) Gas Chromatography Mass Spectrometry (GC/MS):

(128) To determine targeted fatty acid quantitation, samples (plasma, spleen, liver, intestine, and intestinal fecal content) from mice 7d and 21d post-transplant were harvested, homogenized, and snap-frozen in liquid N2. Equal volumes of plasma and homogenized tissue were utilized, while fecal content was weighed at necropsy. Samples were dispersed in acidified water spiked with stable isotope-labeled SCFA standards and extracted with diethyl ether. The ether layer was immediately analyzed by gas chromatography/mass spectroscopy using a Phenomenex ZB-WAX column on an Agilent 6890 GC with a 5973MS detector. Quantitation was performed by calibration to internal standards. The tissue levels were normalized by protein concentration of the homogenized tissue. Heatmap data was generated using GenePattern software from the Broad Institute (Cambridge, Mass.). Metabolomic data, mass spectral analytical parameters and spectral raw data from the study and meta data is available in the National Institutes of Health Metabolomics Data Repository Coordinating Center (DRCC) at the University of California San Diego

(129) Metabolic Flux Analysis (MFA) Assessing Label Incorporation into Luminal and Intestinal Tissue Butyrate Pools:

(130) Animals were intragastrically gavaged with a bolus (2 g/kg) of either labeled .sup.13C2-Butyrate or non-labeled .sup.12C-Butyrate. The small and large intestines were then harvested 6 hours later and prepared for analysis as above. The incorporation of .sup.13C2 labeled Butyrate (Sodium butyrate-1, 2-.sup.13C2) in the butyrate pools in the lumen and the intestinal tissue were measured using GC/MS as described previously (Mathew, A. V., Seymour, E. M., Byun, J., Pennathur, S. & Hummel, S. L. Altered Metabolic Profile with Sodium-restricted Dietary Approaches to Stop Hypertension Diet in Hypertensive Heart Failure with Preserved Ejection Fraction. J. Card. Fail. (2015); Mell, B. et al. Evidence for a link between gut microbiota and hypertension in the Dahl rat. Physiol. Genomics 47, 187-197 (2015)) and unlabeled (m/z 145) and labeled butyrate which is 2 a.m.u higher (m/z 147) were detected. The ratio of the labeled to unlabeled peak areas were adjusted to incorporate natural distribution of .sup.13C label and expressed as percentage of .sup.13C incorporation into the butyrate pool in the luminal contents (Lumen) and intestinal tissue.

(131) MFA Assessing Label Incorporation into Tricarboxylic Acid (TCA) Metabolite Pools:

(132) The incorporation of 13C2 labeled Butyrate (Sodium butyrate-1, 2-13C2; Sigma) into the TCA cycle metabolites in the intestinal tissue were measured using LC/MS performed an Agilent 6520 high resolution Q-TOF (quadrupole-time of flight instrument) coupled with an Agilent 1200 HPLC system (Agilent Technologies, New Castle, Del.), equipped with an electrospray source. The extract was subjected to hydrophilic interaction chromatography using Phenomenex Luna NH2 column (particle size 3 m; 1×150 mm) at a flow rate of 0.07 mL/min. Solvent A was 5 mM ammonium acetate with pH 9.9 and solvent B was acetonitrile. The column was equilibrated with 80% solvent B. The gradient was: 20-100% solvent A over 15 min; 100% solvent A over 5 min; 20% solvent B for 0.1 min 20% solvent A for 15.9 min. Liquid chromatography electrospray ionization (LC/ESI) MS in the negative mode was performed by Q-TOF instrument using the following parameters: spray voltage 3000 V, drying gas flow 10 L/min, drying gas temperature 3500 C, and nebulizer pressure 20 psi. Fragmentor voltage was 150 V in full scan mode. Mass range between m/z 100 to 1500 was scanned to obtain full scan mass spectra. Two reference masses at m/z 121.050873 and m/z 922.009798 were used to obtain accurate mass measurement within 5 ppm. All chromatograms and corresponding spectra of TCA metabolites: citrate, succinate and malate and their corresponding 13C labeled counterparts were extracted and deconvoluted using the MassHunter software (Agilent Technologies, New Castle, Del.).

(133) Retention time consistency were manually rechecked and compared to authentic compounds that were injected under similar chromatographic conditions. For tissue extracts, metabolite concentrations were normalized to protein content, which was determined by the Bradford-Lowry method. For the flux analyses, peak area of the labeled compounds were normalized to natural abundance of the label and represented as ratios to the total compound peak area.

(134) 16S Deep Sequencing:

(135) On indicated days, fecal pellets were collected from mice and stored at −80° C. DNA was extracted and purified with phenol-chloroform following bead-based lysis. Sequencing and analysis was performed as described (Koenigsknecht, M. J. et al. Dynamics and Establishment of Clostridium difficile Infection in the Murine Gastrointestinal Tract. Infect. Immun. 83, 934-941 (2015)). Briefly, the V4 region of the 16S rRNA gene was sequenced using Ilumina MiSeq technology. Sequencers were trimmed and analyzed using Mothur (Schloss, P. D. et al. Introducing mothur: open-source, platform-independent, communitysupported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 75, 7537-7541 (2009)). The 16S rRNA gene sequence from each strain in the 17 strain cocktail was added to the version 9 trainset sequences from the Ribosomal Database Project (Cole, J. R. et al. The Ribosomal Database Project: improved alignments and new tools for rRNA analysis. Nucleic Acids Res. 37, D141-5 (2009)). The resulting sequences were classified by comparing to described trainset with the requirement that the confidence score is 100%.

(136) MSKK 16S experiments were analyzed using the Illumina MiSeq platform to sequence the V4-V5 region of the 16S rRNA gene. Sequence data were compiled and processed using mothur version 1.34 (Schloss, P. D. et al. Introducing mothur: open-source, platform-independent, community supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 75, 7537-7541 (2009)), screened and filtered for quality (Schloss, P. D., Gevers, D. & Westcott, S. L. Reducing the effects of PCR amplification and sequencing artifacts on 16S rRNA-based studies. PLoS ONE 6, e27310 (2011)), then classified to the species level (Wang, Q., Garrity, G. M., Tiedje, J. M. & Cole, J. R. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl. Environ. Microbiol. 73, 5261-5267 (2007)) using the Greengenes reference database (DeSantis, T. Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl. Environ. Microbiol. 72, 5069-5072 (2006)).

(137) 17 Strain Mixture:

(138) The 17 strain mix was prepared as described (Atarashi, K. et al. Treg induction by a rationally selected mixture of Clostridia strains from the human microbiota. Nature (2013)). Briefly all strains were grown in 5 ml of EG media for 24 hours at 37° C. under anaerobic conditions. Each strain was grown to confluence, with the exception of St 3, 8, 13, 26, and 29. Cells were scraped from EG agar plates and added to the 5 ml culture to obtain the same approximate optical density as the other strains. All cultures were then mixed and glycerol was added to a final concentration of 20%. Aliqouts (1 ml) were individually frozen and stored at −80° C.

(139) Transmission Electron Microscopy (TEM):

(140) Samples were stained as previously described (Soler, A. P. et al. Increased tight junctional permeability is associated with the development of colon cancer. Carcinogenesis 20, 1425-1431 (1999)). Briefly, the intestines from mice that received butyrate or vehicle treatment were harvested 7 days and 21 days following syngeneic and allogeneic BMT and flushed with 0.1 M Sorensen's phosphate buffer (pH 7.4) to remove luminal contents using a 20G needle. The intestines were next gently flushed with 0.1% ruthenium red (RR) containing 2.5% glutaraldehyde fixative in Sorensen's buffer and immediately placed in a dish containing the stain/fixative. Cross sections were immediately sliced (2 mm wide) from the duodenum, jejunum, and illium. The tissue was then rinsed three times with Sorensen's buffer, containing 0.1 percent RR and post-fixed for one hour in one percent osmium tetroxide in the same buffer containing RR. The samples were again rinsed with Sorensen's buffer containing RR. Next, the tissue was dehydrated in ascending concentrations of ethanol, treated with propylene oxide, and embedded in Epon epoxy resin. Semi-thin sections were stained with toluidine blue for tissue identification. Selected regions of interest were ultra-thin sectioned (70 nm thick) mounted on copper grids, and post stained with uranyl acetate and lead citrate. The samples were examined using a Philips CM100 electron microscope at 60 kV. Images were recorded digitally using a Hamamatsu ORCA-HR digital camera system operated using AMT software (Advanced Microscopy Techniques Corp., Danvers, Mass.).

(141) FITC-Dextran Assay:

(142) Food and water was withheld from all mice for four hours on day 21 post bone marrow transplant. FITC-dextran (Sigma-Aldrich; St. Louis, Mo.) was administered by 20G-1.5″ flexible intragastric gavage needle (Braintree Scientific; Braintree, Mass.) at a concentration of 50 mg/ml in PBS. BMT recipients received 800 mg/kg (˜16 mg/mouse). Four hours later, serum was collected from peripheral blood, diluted 1:1 with PBS, and analyzed on a plate reader at excitation/emission wavelength of 485 nm/535 nm. Concentrations of FITCdextran experimental samples were determined based on a standard curve.

(143) Western Blot:

(144) CD326+ purified IECs were harvested from animals that received syngeneic (BALB/c.fwdarw.BALB/c) or allogeneic (C57BL/6J.fwdarw.BALB/c) BMT. Whole cell lysates were next obtained and protein concentrations determined with Pierce BCA Protein Assay (Thermo Scientific). Equal amounts of protein (20 μg) were separated by SDS-PAGE gel electrophoresis (120V, 1.5 h) and subsequently transferred to polyvinylidene difluoride (PVDF) membrane using a Bio-Rad semi-dry transfer cell (Hercules, Calif.) (20V, lh). The following antibodies were used to analyze the membranes with dilutions in accordance with the manufacturers specification sheet: α-tubulin (Cell Signaling, clone 11H10), Acetyl histone H4 (Lys5/8/12/16) (EMD Millipore, clone 3HH-4C10), SLC5A8 (abcam), GPR43 (abcam), Occludin (abcam, clone EPR8208), JAM (abcam, clone EP1042Y), and Claudin 5 (abcam). Secondary anti-rabbit antibody conjugated to HRP (Jackson ImmunoResearch, Cat No. 111-035-003) was used to detect primary antibodies, where needed. Densitometric analysis was performed using ImageJ software (National Institutes of Health; Bethesda, Mass.).

(145) Quantitative PCR:

(146) mRNA was isolated from samples using RNeasy kit following manufacturers instructions (Qiagen; Venlo, Netherlands). Using 1 μg of each mRNA template, cDNA was synthesized using SuperScript VILO (Invitrogen; Carlsbad, Calif.). qPCR primers were designed for murine targets. All primers were verified for the production of a single specific PCR product using a melting curve program and are shown below in Table 2.

(147) TABLE-US-00002 TABLE 2 qPCR Probe Forward Reverse GAPDH CCACAGTCCATGCCATCACTGC GCCCAAGATGCCCTTCAGTGGG SLC5A8 GCTGGATTTGCATCCGTAAT TGGGACTGGTTGACACCATA GPR43 CACGGCCTACATCCTCATCT TTGGTAGGTACCAGCGGAAG p300 TGCCTCCCATTGTTGATCCT ACTCGTTGCAGGTGTAGACA TIP60 TGGACGGAAGCGGAAATCTA CGGCCAAGCTCAATACACTC BAK CAGATGGATCGCACAGAGAG TCTGTGTACCACGAATTGGC BAX ACTAAAGTGCCCGAGCTGAT ATGGTCACTGTCTGCCATGT BCL-B (Bc12110) TCATAGTGACCCGAGACTGC TGTTGCAAAGAAGCCTGACA JAM ACTGCTCAATCTGACGTCCA ATAGGGAGCTGTGATCTGGC Occludin CTCTCAGCCAGCGTACTCTT CTCCATAGCCACCTCCGTAG E-Cadherin CCTGTCTTCAACCCAAGCAC CAACAACGAACTGCTGGTCA HDAC1 TGGGGCTGGCAAAGGCAAGT GACCACTGCACTAGGCTGGAACA HDAC4 AGCTCTGGCAACGTCAGCACT AAGTGGGGCGACTGAGCCTTCT HDAC7 GCTCAGCATGTGCATGTGGAACAC TGAGAGCCTGGTGTGTCTGGCT HDAC9 TGCACCTTTGCCTCAGAGCACG TGGCTGCCTGGTTGCTTCAGT HDAC10 TAGCAGCCAAACATGCCAAGCAGA ATGCTCATAGCGGTGCCAAGAGAAA GADPH Forward SEQ ID NO: 18 GADPH Reverse SEQ ID NO: 19 SLC5A8 Forward SEQ ID NO: 20 SLC5A8 Reverse SEQ ID NO: 21 GPR43 Forward SEQ ID NO: 22 GPR43 Reverse SEQ ID NO: 23 p300 Forward SEQ ID NO: 24 p300 Reverse SEQ ID NO: 25 TIP60 Forward SEQ ID NO: 26 TIP60 Reverse SEQ ID NO: 27 BAK Forward SEQ ID NO: 28 BAK Reverse SEQ ID NO: 29 BAX Forward SEQ ID NO: 30 BAX Reverse SEQ ID NO: 31 BCL-B (Bcl2110) Forward SEQ ID NO: 32 BCL-B (Bc12110) Reverse SEQ ID NO: 33 JAM Forward SEQ ID NO: 34 JAM Reverse SEQ ID NO: 35 Occludin Forward SEQ ID NO: 36 Occludin Reverse SEQ ID NO: 37 E-Cadherin Forward SEQ ID NO: 38 E-Cadherin Reverse SEQ ID NO: 39 HDAC1 Forward SEQ ID NO: 40 HDAC1 Reverse SEQ ID NO: 41 HDAC4 Forward SEQ ID NO: 42 HDAC4 Reverse SEQ ID NO: 43 HDAC7 Forward SEQ ID NO: 44 HDAC7 Reverse SEQ ID NO: 45 HDAC9 Forward SEQ ID NO: 46 HDAC9 Reverse SEQ ID NO: 47 HDAC10 Forward SEQ ID NO: 48 HDAC10 Reverse SEQ ID NO: 49

(148) Chromatin Immunoprecipitation:

(149) Primary CD326+ IECs were seeded on gelatin (Cell Biologics; Chicago, Ill.) coated cell culture dishes (100 mm) overnight followed by treatment with butyrate 1 mM for 24 hours. Cells were harvested and used for ChIP analysis using EZ-Magna ChIP kit from EMD Millipore (Billerica, Mass.) following the manufacturers instructions. Briefly, cells were cross-linked with 1% formaldehyde and extracted chromatin was sonicated using a Bioruptor Pico by Diagenode (Denville, N.J.) to yield DNA fragments predominately in the range of 200-1000 bp. Sonicated lysates were immunoprecipitated (IP) utilizing ChIP grade specific antibodies purchased from EMD Millipore for acetylated histone-H4 and RNA Pol II or IgG control antibody. De-crosslinked DNA was next examined by qPCR using primers targeting the promoter region of the target gene BCL-B (Bcl2110) (Forward: CCTACTCTGCCTGGCTCTTT (SEQ ID NO:50); Reverse: ACCCTTCTGAGTCCCTGAGA (SEQ ID NO:51)), Slc5a8 (Forward: CACAGCACAGCCTTCTTTGT (SEQ ID NO:52); Reverse: TCCAGTTCACAGTCCAGGTC (SEQ ID NO:53), and JAM (F11r) (Forward: TGCCGGGATTAAAAGCATGG (SEQ ID NO:54; Reverse: ACAGGGACAGCAGGATTAGG (SEQ ID NO:55)). IP efficiency of all samples was verified by qPCR analysis of the promoter region of Gapdh (Forward: CTGCAGTACTGTGGGGAGGT (SEQ ID NO:56); Reverse: CAAAGGCGGAGTTACCAGAG (SEQ ID NO:57)). Data analysis was determined as percent of input utilizing the equations: ΔCt[normalized ChIP]=(Ct[ChIP]−(Ct[Input]−Log 2 (6.644))) and % Input=2(−ΔCt [normalized ChIP]).

(150) Flow Cytometry:

(151) To analyze immunophenotype surface markers, lymphocytes contained in the IEC fraction or spleen were harvested, stained using recommended dilutions indicated by manufacturer product sheets and gated on CD4-conjugated PerCP/Cy5.5 (Clone: GK1.5) or CD8-conjugated APC (Clone: 53-6.7) and configurations of the following per mouse in duplicate: CD69-PE (Clone: H1.2F3), CD62L-PE (Clone: MEL-14), CD25-PE (Clone: 3C7), CD44-PerCP/Cy5.5 (Clone: IM7), CD44-APC (Clone: IM7), FoxP3-APC (Clone: FJK-16s). Stained cells were then analyzed with an Accuri C6 Flow Cytometer (BD Biosciences). IECs were stained with CD326-conjugated APC (Clone: G8.8) and DAPI and sorted to >98% purity using a FACSAria III (BD Biosciences) gating on live cells.

(152) All antibodies have been validated for this species and application as found in respective 1 DegreeBio validation profile. CD4, CD8, CD69, CD62L, CD25, CD44, CD326 antibodies were purchased from Biolegend, FoxP3 from eBioscience, and DAPI from Life Technologies.

(153) CTL Assay:

(154) CD8+ T cells were isolated from Balb/c (H-2d) mice using anti-CD8 microbeads and LS columns (Miltenyi Biotec) following the manufacturer's instructions. CD8+ T cells were primed in the presence of irradiated (30 Gy) C57BL/6J (H-2b) splenocytes for 6 days prior to culture with primary IECs for 6 h and 16 h. Primary C57BL/6J IECs were harvested and incubated overnight in the presence or absence of butyrate 1 mM in gelatin coated (Cell Biologics Inc.; Chicago, Ill.) 100 mm-culture dishes (Fisher Scientific).

(155) Reproducibility:

(156) Experiments were repeated at least 2 times with 3 sample replicates, bringing the n to at least 6; sample size is indicated in figure legends. To analyze one variable in one BMT experiment, at least two groups of 3 recipients are required.

(157) Statistics:

(158) Bars and error bars represent the means and standard errors of the mean, respectively. Non-survival analysis was performed using students unpaired t test between two groups. ANOVA was used for comparisons with more than two groups. Survival data analysis was performed using a Mantel-Cox log-rank test.

(159) Results

(160) Targeted Microbial Metabolite Profiling:

(161) It was hypothesized that alterations in the composition of the microbiota in the GI lumen would result in an altered microbial metabolome after GVHD (Jenq, R. R. et al. Regulation of intestinal inflammation by microbiota following allogeneic bone marrow transplantation. Journal of Experimental Medicine 209, 903-911 (2012); Hill, G. R. & Ferrara, J. L. The primacy of the gastrointestinal tract as a target organ of acute graft-versus-host disease: rationale for the use of cytokine shields in allogeneic bone marrow transplantation. Blood 95, 2754-2759 (2000)). The concentration of microbial FA metabolites, both short-chain FAs and long-chain FAs up to 18 carbons in length, was determined from several sites seven days (day +7) after BMT. The serum, spleen, liver, intestines, and luminal contents (stool) of the intestines were analyzed with gas chromatography mass spectrometry (GC/MS). A well-established, clinically relevant model of MHC-mismatched BMT with C57BL/6J (H-2b) cells transferred to lethally irradiated Balb/c (H-2d) mice was used and results were compared to syngeneic transplant and naive animals. The animal cages were exchanged on day 3 to take any alterations in the microbial environment into account, and analysis following GC/MS was performed in a blinded manner. The concentrations of the FAs were not significantly different in the luminal contents of the intestines between any of the groups (FIG. 1a). They were also not significantly different in the serum or the tissues such as the spleen and liver of allogeneic animals compared with syngeneic animals and naive controls.

(162) However, the greatest and the only statistically significant difference was observed in just one SCFA, butyrate, which was significantly decreased only in the intestinal tissue at day 7 (FIG. 1b). Similar results were observed on day 21 as on day 7. Collectively these data demonstrate that butyrate levels are consistently reduced only in the intestinal tissue after allo-BMT.

(163) Functional Impact of Altered Levels of SCFA in the IECs:

(164) In light of the reduction of butyrate in allogeneic animals only in the intestinal tissue, the functional impact of reduced butyrate in IECs was analyzed. Because butyrate is an HDACi (Ganapathy, V., Thangaraju, M., Prasad, P. D., Martin, P. M. & Singh, N. Transporters and receptors for short-chain fatty acids as the molecular link between colonic bacteria and the host. Curr Opin Pharmacol 13, 869-874 (2013); Sealy, L. & Chalkley, R. The effect of sodium butyrate on histone modification. Cell 14, 115-121 (1978); Gao, S.-M. et al. Histone deacetylases inhibitor sodium butyrate inhibits JAK2/STAT signaling through upregulation of SOCS1 and SOCS3 mediated by HDAC8 inhibition in myeloproliferative neoplasms. Exp. Hematol. 41, 261-70.e4 (2013)), the degree of histone acetylation was analyzed by immunoblotting purified CD326+ IECs after BMT. The degree of acetylation of histone H4 was significantly decreased on day 7 and day 21 (FIG. 2a) following allo-BMT demonstrating that reduced butyrate resulted in decreased histone acetylation. Therefore to confirm if the decreased acetylation is secondary to decreased HDAC inhibition from reduction in butyrate and not due to potential alterations in HDAC and HAT enzyme levels20 following transplant, the expression of HDACs and HATs in IECs after BMT was analyzed. Similar levels of several HDACs (Hdac 1,4,7,9, and 10) (FIG. 2b) and HATs (p300 and TIP60) (FIG. 2c) were observed by qPCR in the IECs (CD326+) of both syngeneic and allogeneic BMT recipients. Furthermore both HDAC (FIG. 2d) and HAT (FIG. 2e) enzyme activity were not different in these animals. These data show that reduction in histone acetylation in the IECs after allo-BMT is from reduced levels of butyrate.

(165) Reduced Uptake of Butyrate by the IECs:

(166) It was next explored whether the diminished concentration of butyrate observed in the intestinal tissue was from impaired uptake of butyrate following allo-BMT. To this end, the expression of the known butyrate monocarboxylate transporter (SLC5A8) and the receptor of butyrate (GPR43) was analyzed in IECs following allo-BMT (Ganapathy, V., Thangaraju, M., Prasad, P. D., Martin, P. M. & Singh, N. Transporters and receptors for short-chain fatty acids as the molecular link between colonic bacteria and the host. Curr Opin Pharmacol 13, 869-874 (2013); Furusawa, Y. et al. Commensal microbe-derived butyrate induces the differentiation of colonic regulatory T cells. Nature (2013)). Decreased gene expression (FIG. 2f) and protein (FIG. 2g) of both SLC5A8 and GPR43 were observed in IECs from allogeneic animals following transplant on day +21 and also on day +7 showing that reduction in butyrate concentration in the IECs is due to reduced uptake of the microbiota-derived luminal butyrate. Primary IECs were cultured with proinflammatory mediators (IFN-γ and/or TNF) and expression of the butyrate transporter SLC5A8 was analyzed. Exposure of IECs to inflammatory cytokines significantly decreased the expression of Slc5a8. These data indicate that the intense inflammatory milieu following allo-BMT causes reduced expression of butyrate transporters and receptors leading to reduction in butyrate and histone acetylation in IECs.

(167) Rescuing the Cellular Effects of Reduced Butyrate:

(168) It was next determined if the reduced amount of butyrate in IECs could be restored in vivo and further, whether this would have a functional impact on histone acetylation. In addition to utilizing transporters, butyrate can also diffuse across the mucosal barrier into IECs when present in high concentrations (Ganapathy, V., Thangaraju, M., Prasad, P. D., Martin, P. M. & Singh, N. Transporters and receptors for short-chain fatty acids as the molecular link between colonic bacteria and the host. Curr Opin Pharmacol 13, 869-874 (2013); Charney, A. N., Micic, L. & Egnor, R. W. Nonionic diffusion of short-chain fatty acids across rat colon. Am. J Physiol. 274, G518-24 (1998)). Therefore, it was hypothesized that administration of high amounts of butyrate locally would restore histone acetylation of IECs, in vivo. To test this, C57BL/6J cells were transferred to Balb/c mice and administered vehicle or butyrate via daily intragastric gavage. Daily butyrate administration for 21 days significantly restored acetylation of histone H4 compared with untreated allo-BMT recipients (FIG. 3a).

(169) It was next determined whether there was a difference in the uptake and metabolism of the exogenously administered butyrate between the syngeneic and allogeneic recipients. To this end, metabolic flux analysis (MFA) assessing label incorporation of heavy 13C labeled butyrate into luminal and intestinal tissue butyrate pools was performed by utilizing GC/MS as above. Recipients of syngeneic and allogeneic transplant were treated 7 days after BMT with a bolus of either.sup.13C-butyrate or regular .sup.12C-butyrate, which served as the control. The IECs and luminal contents were harvested 6 hours later and analyzed for incorporation of .sup.13C. Similar amounts of heavy .sup.13C butyrate was observed in the lumen of the large intestine; however, significantly decreased .sup.13C heavy butyrate was observed in the intestinal tissue of recipients of allo-BMT, indicating reduced uptake (FIG. 3b). To determine whether there were any differences in the metabolism of butyrate, the presence of .sup.13C-butyrate in different stages of the tricarboxylic acid (TCA) cycle was analyzed. Specifically, the incorporation of .sup.13C-butyrate into citrate, succinate and further downstream, into malate was analyzed. There was a significant difference in the amount of heavy carbon in citrate and malate (FIG. 3c) and a trend towards greater incorporation into succinate within the IECs from the large intestine. Similarly, examination of IECs from both small and large intestines combined also revealed an overall increased level of .sup.13C incorporation in the downstream metabolite of the TCA cycle, malate, in allo-BMT recipients compared with syngeneic animals, showing an increased rate of metabolism in the IECs of these animals. Furthermore, daily intragastric gavage of butyrate resulted in an increase in butyrate transporter SLC5A8 (FIG. 3d), indicating that butyrate has a positive feedback mechanism resulting in an increase of its own transporter. To determine whether butyrate was directly responsible for induction of its own transporter, the degree of histone acetylation at the promoter of SLC5A8 was analyzed with chromatin immunoprecipitation (ChIP). An increased association of acetylated histone H4 in the promoter region of Slc5a8 was found in IECs (CD326+) treated with butyrate (FIG. 3e). These data demonstrate that reduced butyrate following allo-BMT has functional effects on IECs.

(170) Increase in Intestinal Butyrate Mitigated GVHD:

(171) Systemic administration of HDACi decreases acute GVHD (Reddy, P. et al. Histone deacetylase inhibitor suberoylanilide hydroxamic acid reduces acute graft-versus-host disease and preserves graft-versus-leukemia effect. Proc Natl Acad Sci USA 101, 3921-3926 (2004); Reddy, P. et al. Histone deacetylase inhibition modulates indoleamine 2,3-dioxygenasedependent DC functions and regulates experimental graft-versus-host disease in mice. J. Clin. Invest. 118, 2562-2573 (2008); Sun, Y. et al. Cutting edge: Negative regulation of dendritic cells through acetylation of the nonhistone protein STAT-3. J Immunol 182, 5899-5903 (2009)). It was therefore determined if increasing local levels of endogenous HDACi, butyrate, would impact GVHD severity. Again using the C57BL/6J into Balb/c model, vehicle control or butyrate was administered via daily intragastric gavage for one week, followed by administration every other day for the remainder of the experiment. Administration of butyrate resulted in decreased weight loss (FIG. 3b), GVHD clinical scores (FIG. 3c), and increased survival (FIG. 3d). Similar improved survival was found using a second clinical model of BMT, a MHC-matched, minor antigen mismatched model. C3H.SW (H-2b) cells were transferred to C57BL/6J (H-2b) mice, thus demonstrating strain-independent results. Furthermore, histopathological analysis 21 days following BMT exhibited decreased histological scores in the intestines of the major MHC mismatch model (FIG. 3e) and decreased histological scores in both the intestines and liver in the model of minor antigen mismatch. To determine whether irradiation related inflammation was critical for butyrate induced protection, the butyrate induced protective effects were observed in a non-irradiated model of parent (C57BL/6J, H-2b) into F1 (B6D2F1, H-2b/d) BMT. Significantly less weight loss and improved survival was observed in allogeneic recipients that were treated with intragastric butyrate. Next, to further evaluate the magnitude of the butyrate-induced protective effect, GVHD mortality was determined utilizing the MHC disparate B6 into BALB/c model. Intragastric gavage of butyrate induced significant GVHD survival benefit in allogeneic animals that received higher doses of T cells. These data collectively show that butyrate induced GVHD protective effects regardless of strain combinations, conditioning, or higher alloreactive T cell doses.

(172) Increase in Intracellular Butyrate Protects GI Epithelium:

(173) It was next determined if the decreased GI GVHD resulted in reduced translocation of luminal contents and improved epithelial integrity (Noth, R. et al. Increased intestinal permeability and tight junction disruption by altered expression and localization of occludin in a murine graft versus host disease model. BMC Gastroenterol 11, 109 (2011); Soler, A. P. et al. Increased tight junctional permeability is associated with the development of colon cancer. Carcinogenesis 20, 1425-1431 (1999); Suzuki, T. Regulation of intestinal epithelial permeability by tight junctions. Cell. Mol. Life Sci. 70, 631-659 (2013)) using transmission electron microscopy (TEM) to examine the ability of butyrate to preserve cellular junctions following allo-BMT. Significantly, intense leakage of the electron dense stain ruthenium red25 was found in allo-BMT recipients treated with vehicle alone (FIG. 4a, middle panel). However, TEM studies demonstrate that the integrity of the IEC junction was preserved at both day 7 (FIG. 4a, right panel) and day 21 in allo-BMT recipients that received local intragastric administration of butyrate. Intestinal permeability after allo-BMT was assessed by intragastric administration of FITC-dextran, a non-metabolized carbohydrate (Hanash, A. M. et al. Interleukin-22 protects intestinal stem cells from immune-mediated tissue damage and regulates sensitivity to graft versus host disease. Immunity 37, 339-350 (2012)). Butyrate-treated allo-BMT recipients exhibited significantly less detectable FITC-dextran in the serum at 21 days following transplant (FIG. 4b).

(174) Reduction in GVHD is Independent of Donor Treg Cells:

(175) Treg cells mitigate GVHD and butyrate has been shown to increase intestinal Treg cells (Atarashi, K. et al. Treg induction by a rationally selected mixture of Clostridia strains from the human microbiota. Nature (2013); Arpaia, N. et al. Metabolites produced by commensal bacteria promote peripheral regulatory T-cell generation. Nature 504, 451-455 (2013)). The cellular contents of the intestine were analyzed 21 days after allo-BMT to determine whether butyrate had an impact on local Treg cells. The total numbers of CD45.1+ cells recovered from the intestinal lamina propria were not different between vehicle- and butyrate-treated allo-BMT recipients. By contrast, intestinal infiltration of donor CD4+ and CD8+ T cells and activated T cells (CD69+ or CD44hi) was decreased in animals that received local intragastric butyrate administration (FIG. 4a). However, the ratio of donor Treg cells to effector T cells was not different in the intestines of these animals (FIG. 4b). Microbiota-derived butyrate has been shown to increase immune-regulatory macrophages in the GI tract which increased Treg cells (Chang, P. V., Hao, L., Offermanns, S. & Medzhitov, R. The microbial metabolite butyrate regulates intestinal macrophage function via histone deacetylase inhibition. Proc Natl Acad Sci USA 111, 2247-2252 (2014)). However, no difference in the total number of donor macrophages in the intestine of allogenenic recipients that were treated with either vehicle or butyrate was observed (FIG. 4c).

(176) To further determine whether the salutary effects of local treatment with butyrate on GI GVHD were dependent on donor Treg cells, a BMT was performed utilizing the same HC mismatched BMT model in which C57BL/6J (H-2b) cells are transferred to Balb/c (H-2d) mice. T cell-depleted (TCD) bone marrow was transplanted and purified CD4+CD25− T cells from donors. Vehicle or butyrate was administered to the recipients daily for 1 week, then every other day thereafter as above. Decreased GVHD was observed (FIG. 4d-e), indicating that donor Treg cells may be dispensable for the reduction of GVHD. To further confirm the donor Treg cell-independent protective effects of butyrate on GVHD, donor C57BL/6J mice with a knock-in of human diphtheria toxin receptor (DTR) expressed only on Treg cells (DREG) was utilized (Lahl, K. et al. Selective depletion of Foxp3+ regulatory T cells induces a scurfy-like disease. J. Exp. Med. 204, 57-63 (2007); Lahl, K. & Sparwasser, T. In vivo depletion of FoxP3+ Tregs using the DEREG mouse model. Methods Mol. Biol. 707, 157-172 (2011), DREG donor mice were injected with diphtheria toxin (DT) (10 μg/kg) on day −2 and day −1 and loss of Foxp3-Treg expression was confirmed. The Treg depleted T cells were then used as donor cells in the major MHC mismatch model used above. Significantly improved clinical GVHD, less weight loss, and improved survival was observed. To further examine whether the local administration of butyrate impacted donor T cells directly, the HDAC and HAT enzymatic activity was determined in donor T cells harvested from the recipient animals. Both the HDAC activity or HAT activity in the donor T cells harvested from the recipient spleen were similar between butyrate and vehicle treated allogeneic animals. These collectively demonstrate that the reduction in GI GVHD upon intragastric administration of butyrate is independent of its potential effects from donor Treg cells.

(177) Butyrate Protects IECs from Allo-T Cell Mediated Damage:

(178) The potential mechanisms that contribute to butyrate-induced protection from severe GVHD were explored. Because (a) butyrate is decreased in IECs, (b) administration of butyrate mitigated GI GVHD independent of Treg cells, but (c) improved junction integrity, it was explored whether butyrate had direct effects on protecting IECs from allo-T cell mediated damage and conditioning. IECs were treated ex vivo with vehicle or butyrate for 24 hours irradiation (6 Gy) or no-irradition, followed by 24 hours of additional incubation with butyrate was performed. It was observed that butyrate was not toxic to IECs (FIG. 5a, left) and more importantly conferred protection from irradiation-induced apoptosis (FIG. 5a, right). The ability of butyrate-treated IECs to withstand damage mediated by alloreactive T cells was determined by isolating and culturing primary IECs with butyrate or vehicle control, overnight. The pre-treated IECs were next co-cultured with primed allogeneic CD8+ T cells, in the absence of butyrate. Fewer butyrate pre-treated IECs succumbed to CD8+ T cell killing within 6 hours (FIG. 5b, left) and 16 hours (FIG. 5b, right) following co-culture, compared with control. Because butyrate is a primary energy source for IECs 1-13, it was next determined whether butyrate enhances survival and growth of IECs in vitro. To this end, intestinal organoids were cultured in the presence or absence of butyrate. It was observed that culture in the presence of butyrate significantly increased organoid size (FIG. 5c). Next, the impact of butyrate on IEC junctional function in the organoid cultures was confirmed by determining the mRNA expression of claudins (FIG. 5E). It was observed that culture of organoids with butyrate significantly increased the mRNA expression of claudins (Cldn1, Cldn5, Cldn6, Cldn10, Cldn11, Cldn13, Cldn14, Cldn17, and Cldn18).

(179) Molecular Mechanisms of IEC Protection:

(180) It was hypothesized that butyrate would increase anti-apoptotic genes by modulation of histone acetylation. Pro- and anti-apoptotic mRNA expression levels (Topham, C. H. & Taylor, S. S. Mitosis and apoptosis: how is the balance set? Curr. Opin. Cell Biol. 25, 780-785 (2013)) were analyzed and it was found that Bakl and Bax were significantly decreased, whereas transcripts of the antiapoptotic protein BCL-B (Bcl2110) were significantly increased (FIG. 5d) in butyrate treated IECs. mRNA expression of junctional proteins such as occludin (Ocln) and JAM (F11r) was examined (FIG. 5e) in IECs following butyrate treatment, which significantly increased their expression. It was also determined if the restored acetylation of histone H4 observed in butyrate-treated allo-BMT recipients was responsible for increased BCL-B (Bcl2110) and JAM (F11r) expression via ChIP. Acetylation of histone H4 was associated with the promoter region of Bcl2110 (FIG. 5f) and F11r (FIG. 5g) in butyrate treated IECs (CD326+).

(181) These data thus collectively indicate butyrate has several salutary effects on IECs that may or may not be mutually exclusive, such as regulating the expression of genes involved in decreased IEC apoptosis and increased junctional proteins in IECs. To determine if these are involved in in vivo protection from GVHD, the expression of pro- and anti-apoptotic proteins as well as junctional proteins in IECs isolated 21 days following allo-BMT was determined. Pro-apoptotic transcripts of Bak1 and Bax were significantly decreased in allo-BMT recipients that received intragastric butyrate treatment (FIG. 5h) while the anti-apoptotic BCL-B (Bcl2110) expression was increased (FIG. 5g). Further, gene expression of junctional proteins were, again, similarly increased in butyrate treated animals (FIG. 5h). To determine if these results have biological consequences on protein expression, the protein amounts of Occludin, JAM, and Claudin 5 were assayed. Indeed, immunoblot analysis revealed increased junctional proteins in recipients of allo-BMT treated with intragastric butyrate. Overall, the results identify several ways in which butyrate can directly enhance epithelial cell function ranging from protection from irradiation and allo-T cell mediated apoptosis to proliferation and junctional protein expression, both in vitro and in vivo.

(182) High Butyrate Producing Microbiota Mitigate GVHD:

(183) The endogenous HDACi butyrate is a by-product of microbial fermentation (Wong, J. M. W., de Souza, R., Kendall, C. W. C., Emam, A. & Jenkins, D. J. A. Colonic health: fermentation and short chain fatty acids. J. Clin. Gastroenterol. 40, 235-243 (2006). Therefore, the hypothesis that altering the composition of indigenous GI microbiota in hosts to those that can produce high levels of butyrate will mitigate GVHD was tested. Seventeen rationally selected strains of Clostridia that have been shown to increase butyrate both in vitro and in vivo (Atarashi, K. et al. Treg induction by a rationally selected mixture of Clostridia strains from the human microbiota. Nature (2013); Narushima, S. et al. Characterization of the 17 strains of regulatory T cell-inducing human-derived Clostridia. Gut Microbes 5, 333-339 (2014) were administered these strains via intragastric gavage every other day to naive mice starting 14 days prior to allo-BMT and continued administration of the 17-strain cocktail for 21 days post-BMT. The microbiota in feces collected from animals that received vehicle and 17-strain administration was analyzed by 16S rRNA-encoding gene sequencing. In animals that received the 17 Clostridial strains, 16S analysis (Schloss, P. D. et al. Introducing mothur: open-source, platform-independent, community supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 75, 7537-7541 (2009); Schloss, P. D., Gevers, D. & Westcott, S. L. Reducing the effects of PCR amplification and sequencing artifacts on 16S rRNA-based studies. PLoS ONE 6, e27310 (2011); DeSantis, T. Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl. Environ. Microbiol. 72, 5069-5072 (2006)) revealed an important biologically significant shift in the microbiota indicating that these organisms could be detected (FIG. 6a). Furthermore, GC/MS analysis 21 days following allo-BMT revealed a significant increase of butyrate in the luminal contents (FIG. 6b) and significantly increased butyrate in the intestinal tissues (FIG. 6c) of animals that received intragastric gavage of the 17 Clostridial strains. The recipients of intragastric gavage of the 17 strains and allo-BMT exhibited significantly decreased GVHD (FIG. 6d-e). Detectable levels of the 17 Clostridial strains were diminished within 2 weeks (day +35) of ceasing intragastric administration (FIG. 6a).

(184) Because microbiota variations are known to occur in different colonies of mice, it was also determined whether mice housed at another institution (Memorial Sloan Kettering Cancer Center, USA) and treated with the same 17 Clostridial strains would also mitigate GVHD. Additionally, because clinical BMT patients are often treated with antibiotics and as an alternative approach to colonizing the indigenous microbiota, C57BL/6J mice were treated with an antibiotic cocktail (ampicillin 5 mg, metronidazole 4 mg, clindamycin 5 mg, vancomycin 5 mg) daily by intragastric gavage for 6 days to target obligate anaerobes. The mice were then colonized 4 and 6 days later with either human Enterococcus faecium or the same cocktail of 17 strains of human Clostridia17 by intragastric gavage. Once again, the fecal microbiota was characterized by 16S gene sequence analysis on day −1, relative to BMT. Upon analysis, increased presence of Clostridia species in recipients that received the cocktail of 17 Clostridial strains was observed, compared to recipients ofE. faecium. The animals were next used as recipients of a MHC-mismatched B10.BR (H-2k) BMT and followed for survival. Animals that were treated with antibiotics, but were not recolonized with bacteria, died significantly faster (P<0.0001) than mice not treated with the antibiotic mixture. These data demonstrate that antibiotic treatment eliminated beneficial microbiota similar to previous Reports (Jenq, R. R. & van den Brink, M. R. M. Allogeneic haematopoietic stem cell transplantation: individualized stem cell and immune therapy of cancer. Nature Reviews Cancer 10, 213-221 (2010). Sinificantly increased survival was observed in the animals treated with the cocktail of 17 Clostridial strains (FIG. 6g). These results show that altering the indigenous microbiota with 17 rationally selected strains of Clostridia, known to produce high amounts of butyrate (Atarashi, K. et al. Treg induction by a rationally selected mixture of Clostridia strains from the human microbiota. Nature (2013); Narushima, S. et al. Characterization of the 17 strains of regulatory T cell-inducing human-derived Clostridia. Gut Microbes 5, 333-339 (2014)), can decrease the severity of GVHD and improve survival across multiple institutions with strain independent results.

(185) In summary, the present example describes unbiased profiling of the microbial metabolome with a specific focus on targeted FAs after experimental allo-BMT. Only one SCFA, namely butyrate was significantly reduced only in the intestinal tissue of allo-BMT recipients resulting in decreased acetylation of histone H4 within IECs. Increasing intestinal butyrate restored acetylation of histone H4, protected IECs, and decreased the severity of GVHD. Furthermore, rationally altering host GI microbiota to high butyrate producers 17 mitigated GVHD.

(186) The community structure of the microbiota is altered following allo-BMT (Jenq, R. R. et al. Regulation of intestinal inflammation by microbiota following allogeneic bone marrow transplantation. Journal of Experimental Medicine 209, 903-911 (2012); Eriguchi, Y. et al. Graft-versus-host disease disrupts intestinal microbial ecology by inhibiting Paneth cell production of α-defensins. Blood 120, 223-231 (2012)). The results described herein now provide a novel perspective on microbial metabolites and their impact on GVHD. The study revealed that the only significantly decreased SCFA, butyrate, is diminished in the intestinal tissue after allo-BMT. Reduction of butyrate in allo-BMT IECs decreased acetylation of histones while increasing butyrate via intragastric gavage restored acetylation of histone H4 and GVHD.

(187) An important observation was the lack of changes in luminal (stool) butyrate, despite a documented shift in the microbiome species that produce less butyrate after allo-BMT (Jenq, R. R. et al. Regulation of intestinal inflammation by microbiota following allogeneic bone marrow transplantation. Journal of Experimental Medicine 209, 903-911 (2012)). It is contemplated that this may be because of reduced uptake into IECs due to decreased butyrate transporter, thus leaving overall butyrate levels not significantly reduced in the lumen because less is being taken into the IECs despite a decreased production by the shift in the microbiota after allo-BMT.

(188) The reasons for decreased transporter proteins after allo-BMT are intriguing. Previous reports observed a decrease in SLC5A8 following alterations in the microbiota (Cresci, G. A., Thangaraju, M., Mellinger, J. D., Liu, K. & Ganapathy, V. Colonic gene expression in conventional and germ-free mice with a focus on the butyrate receptor GPR109A and the butyrate transporter SLC5A8. J Gastrointest. Surg. 14, 449-461 (2010).). Thus, the findings that SLC5A8 and GPR43 are decreased in IECs following allo-BMT are consistent with previous Reports (Jenq, R. R. et al. Regulation of intestinal inflammation by microbiota following allogeneic bone marrow transplantation. Journal of Experimental Medicine 209, 903-911 (2012); Eriguchi, Y. et al. Graft-versus-host disease disrupts intestinal microbial ecology by inhibiting Paneth cell production of α-defensins. Blood 120, 223-231 (2012)). Furthermore, it was demonstrated that exposure of IECs to inflammatory cytokines leads to reduction in the expression of butyrate transporters. These data show that the inflammatory milieu early after allo-BMT reduces the butyrate transporter SLC5A8 leading to its reduction in the IECs and further reducing transporter expression and butyrate intake in a feedback mechanism.

(189) Administered butyrate is more rapidly metabolized as shown by the greater incorporation of carbon from butyrate into the TCA cycle. These data point to a novel observation on the role of energy requirements of IECs in the context of inflammation and GVHD. The data collectively provide new insights into the role and interactions of the microbiome-derived metabolite, butyrate after allo-BMT. These data indicate that butyrate has direct salutary effects on IECs. Butyrate altered the ratio of the expression of anti-apoptotic to pro-apoptotic molecules and increased the expression of proteins relevant for junctional integrity.

(190) The foregoing description of illustrative embodiments of the disclosure has been presented for purposes of illustration and of description. It is not intended to be exhaustive or to limit the disclosure to the precise form disclosed, and modifications and variations are possible in light of the above teachings or may be acquired from practice of the disclosure. The embodiments were chosen and described in order to explain the principles of the disclosure and as practical applications of the disclosure to enable one skilled in the art to utilize the disclosure in various embodiments and with various modifications as suited to the particular use contemplated. It is intended that the scope of the disclosure be defined by the claims appended hereto and their equivalents.