Infiltrating immune cell proportions predict anti-TNF response in colon biopsies

11262358 · 2022-03-01

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are methods of predicting responsiveness of a subject having an inflammatory bowel disease (IBD) to a tumor necrosis factor (TNF)-alpha inhibitor, by analyzing a frequency of at least one subpopulation of immune cells in a tissue biopsy of the subject. Also provided are methods of selecting a treatment for a subject and kits for determining responsiveness of the subject to treatment with a TNF-alpha inhibitor.

Claims

1. A method of treating inflammatory bowel disease (IBD) in a subject in need thereof, the method comprising: (a) determining responsiveness to a TNF-alpha inhibitor by: analyzing a frequency of at least one subpopulation of immune cells in a tissue biopsy of the subject, wherein a frequency above a predetermined threshold of immune cells of a subpopulation selected from the group consisting of memory B cells, and neutrophils is indicative of the subject being non-responder to the TNF-alpha inhibitor, and/or wherein a frequency below a predetermined threshold of immune cells of a subpopulation of CD8+ T cells is indicative of the subject being non-responder to the TNF-alpha inhibitor, wherein said memory B cells are plasma cells, and wherein said plasma cells are characterized by positive expression of CD138; or wherein said memory B cells are non-plasma cells, and wherein said non-plasma cells are characterized by CD20+, CD19+ and CD45RA+ expression signature; wherein said neutrophils are characterized by CD45+, CD66b+ and CD16+ expression signature; and wherein said CD8+ T cells are characterized by CD8+ and CD69+ expression signature, thereby predicting the responsiveness of the subject having the inflammatory bowel disease (IBD) to the TNF-alpha inhibitor; and (b) treating said subject with the TNF-alpha inhibitor when the subject is a responder to the TNF-alpha inhibitor based on said responsiveness or with a steroid, 5-ASA, thiopurines and/or methotrexate,when the subject is a non-responder to the TNF-alpha inhibitor based on said responsiveness.

2. The method of claim 1, wherein said subject is a naive subject who hasn't been treated with said TNF-alpha inhibitor.

3. The method of claim 1, wherein said cells of said tissue biopsy are intact cells.

4. The method of claim 1, wherein said analyzing said frequency of said at least one subpopulation of immune cells is performed by a morphometric analysis.

5. The method of claim 1, wherein said analyzing said frequency of said at least one subpopulation of immune cells is performed using at least one histological stain.

6. The method of claim 1, wherein said analyzing said frequency of said at least one subpopulation of immune cells is performed using at least one antibody.

7. The method of claim 1, wherein said analyzing said frequency of said at least one subpopulation of immune cells is performed by an RNA in-situ hybridization assay.

8. The method of claim 1, wherein said analyzing said frequency of said at least one subpopulation of immune cells is performed by a single cell RNA sequencing (RNA SEQ) analysis.

9. The method of claim 1, wherein said analyzing said frequency of said at least one subpopulation of immune cells is performed by exome sequencing.

10. The method of claim 1, wherein said analyzing said frequency of said at least one subpopulation of immune cells is performed by RNA SEQ followed by deconvolution.

11. The method of claim 1, wherein said analyzing said frequency of said at least one subpopulation of immune cells is performed by reverse-transcriptase polymerase chain reaction (RT-PCR) followed by deconvolution.

12. The method of claim 1, wherein said analyzing said frequency of said at least one subpopulation of immune cells is performed by micro array followed by deconvolution.

Description

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

(2) Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.

(3) In the drawings:

(4) FIGS. 1A-B schematically illustrate the cell centered meta-analysis pipeline. Schematic view of the meta-analysis pipeline used to identify baseline cellular signature of response to anti-TNF. FIG. 1A—in-silico training. FIG. 1B—clinical validation assay.

(5) FIGS. 2A-B depict the cell type expression analysis of previously reported gene signature. FIG. 2A—Expression of gene signatures in immune cell subsets and colon tissue. Each row was standardized (z-score) separately to highlight gene expression cell type-specificity. Color scale range from blue/low to red/high, with white/zero representing average expression across all samples. Rows and columns were clustered using euclidean distance with average linkage. Row annotations indicates the absolute maximum log 2 expression of each gene (shades of green), and the membership(s) of each gene to a signature. Row dendrogram clades (8) are coloured to highlight genes that the present inventors associated with specific—group of—cell types. Column annotation indicates the GEO dataset from which each sample was obtained. Column dendrogram clades (7) are coloured to highlight cell types that belong to a common lineage. (B) Scores and p-values from single sample enrichment analysis using GSVA.

(6) FIGS. 3A-C depict computational deconvolution of gene expression data. FIG. 3A—Boxplot of estimated proportions in cohort GSE16789 (baseline CD colon samples). Only cell types with non-zero proportions in more than 75% of the samples are shown. Group differences are highlighted by separate boxplots for responders (blue) and non-responders (red). Significant differences are indicated with circled stars (nominal p-value<=0.05, Wilcoxon rank sum test). The y-axis represents the estimated proportion of each cell type in each sample. “mono act”=M1 Macrophage. FIGS. 3B-C—Expression of the top 20-genes signature previously identified in UC patients, and shown to be able to predict response in CD patients (4) (FIG. 3B). After correction for estimated proportions of activated monocytes and plasma cells, the predictive power of this signature drops (FIG. 3C). The heatmap shows the log 2 expression of each gene. For better comparison, rows in the top panel were clustered using the same metric and linkage method as the columns (dendrogram not shown), and the resulting ordering was applied to the rows in the bottom panel.

(7) FIG. 4 depicts meta-analysis of cell subset proportion identified consistent immune cell subset different between responders and non-responder to infliximab. Each panel shows estimated group proportion differences (pseudo median) and 95% confidence interval for a given cell subset, across all discovery cohorts. Missing data comes from cell type/cohort pairs not included in the meta-analysis because of too many zero estimated proportions. The x-axis represents the log 2 proportion fold change (i.e. log 2(Responders/Non-Responders)). The y-axis indicates the discovery cohorts. Statistical significance was calculated using Wilcoxon rank sum test (nominal p-value<=0.05), and is shown in red (significant) and blue (non-significant). “mono act”=M1 Macrophage.

(8) FIGS. 5A-B depict validation by staining of plasma cells in independent IBD biopsies. FIG. 5A—ROC curve showing the predictive power of plasma cell proportions from staining as quantified by two scoring methods: a clinician categorical score (blue) and automated pixel quantitation (red). The respective Area Under the Curve (AUC) achieved by each scoring method are indicated in the legend. FIG. 5B—Staining slides showing visual differences between responders and non-responders. CD138+ plasma cells are colored in brown, showing an increased staining in non-responsive patients. The blue staining indicates the brown regions detected by automated quantitation with ImagePro Plus software.

(9) FIG. 6 depicts estimated cell type proportions in all discovery cohorts. Proportions were estimated in each sample separately and compared within each cohort between responders and non-responders. Only cell types with non-zero proportions in more than 75% of the samples are shown. Group differences are highlighted by separate boxplots for responders (blue) and non-responders (red). Significant differences are indicated with circled stars (nominal p-value<=0.05, wilcoxon rank sum test). “mono act”=M1 Macrophage.

(10) FIGS. 7A-B the predictive power of a 20-genes signatures after correction for cell type proportions. Expression of the 20-UC genes predictive signature in CDc samples, after correction for estimated proportions of activated monocytes (FIG. 7A) and plasma cells (FIG. 7B). After correction, the predictive power of this signature drops. The heatmap shows the log 2 expression of each gene. For better comparison, rows in both panels were ordered according to the clustering order in the original data (unadjusted for proportions) shown in FIG. 3B.

(11) FIG. 8 depicts ROC curve analysis for the cell types selected in each of the discovery cohorts. Each panel shows the ROC curve computed from the estimated proportions of a given cell type [plasma cells (left) and activated monocytes (right)] in each discovery cohort: GSE12251 (red), GSE14580 (green) and GSE16879 (blue). The x and y axis represent the false positive rate (1-specificity) and true positive rate (sensitivity) respectively. “mono act”=M1 Macrophage.

(12) FIGS. 9A-B depict results from staining of plasma cells in the validation IBD biopsy samples. FIG. 9A—Automated quantitation. FIG. 9B—Pathologist blind score. The Y-axis gives the proportion of assessed biopsies achieving a given score (x-axis).

(13) FIG. 10 depicts ROC curve analysis of pathologist validation of cell-types signatures highlights plasma cell differences between anti-TNF responders versus non-responders.

(14) FIG. 11A-C depict cell type specific differential expression in all discovery cohorts. csSAM runs on the 3 discovery cohorts including plasma cells, activated monocytes and neutrophils identifies differentially expressed genes in plasma cells. “mono act”=M1 Macrophage.

(15) FIG. 12 is a histogram demonstrating that plasma cell proportions in inflamed colon tissue can predict response to infliximab (IFX) prior to treatment initiation. Formalin-fixed slides of paraffin-embedded colon tissues were immunostained with H&E to show the basic tissue morphology. All biopsies were collected prior to IFX therapy initiation. Slides were then coded and interpreted by a specialist pathologist. A specific cell abundance categorical index between 0 and 3 was determined by the pathologist for plasma cells proportion and for inflammation level. Chronic inflammation score was defined as a combined score that reflects tissue distortion and plasmacytosis. Minimal amount of cells or inflammation was scored as “0”, whereas the highest cell abundance or inflammation stage detected across all slides was scored as “3”. The tissues were scored one by one in a blinded manner. Nine non-responders and twenty responders were included in this 2nd cohort. Inflamed tissue sites (inflammation score>1.5) were scored from 7 responders and 5 non-responders.

DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION

(16) The present invention, in some embodiments thereof, relates to methods and kits for predicting responsiveness of a subject having an inflammatory bowel disease (IBD) to treatment with a tumor necrosis factor (TNF)-alpha inhibitor, more particularly, but not exclusively, to methods of selecting a treatment for a subject diagnosed with the IBD.

(17) Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

(18) IBD conditions can be treated with a TNF-alpha inhibitor to treat inflammation and achieve mucosal healing. However, response to such treatments is very heterogeneous, with overall only 60% of the patients showing clear primary phenotypic improvement. The remainder of patients do not respond at all, or lose response after a short period. Because of the high cost of the anti-TNF biologics combined with their systemic side effects and the uncertainty of response, these drugs are generally not used as a first line treatment.

(19) The present inventors have hypothesized that the relative proportions of the various immune cell subsets infiltrating the affected tissue does not only reflect disease state, but may also be predictive of a patient's potential to respond to anti-TNF treatment. Thus, as shown in the Examples section which follows, the present inventors analyzed public gene expression data using recent bioinformatics methodology developments that enable the computational deconvolution of mixture data such as blood or bulk tissue, i.e. the estimation of the proportions of constituting cell types directly from heterogeneous samples (18). By means of a meta-analysis framework, the present inventors integrated estimated immune cell subset proportions from multiple IBD cohorts, and identified consistent proportion differences between responders and non-responders in immune cells such as macrophages and plasma cells. The implication of plasma cells was further supported by a cell type-specific differential analysis. The present inventors validated these results on an independent set of samples, where plasma cells proportions assessed in immunostained biopsies could predict response to anti-TNF with high accuracy [Area Under the Curve (AUC) 80%]. Overall, these results propose a novel clinically feasible and efficient mean of predicting response to anti-TNF treatment in naive patients, which can be used to improve patient care through maximizing response rate. These results also provide novel insights on the immune target of TNF blockade in IBD.

(20) Thus, according to an aspect of some embodiments of the invention there is provided a method of predicting responsiveness of a subject having an inflammatory bowel disease (IBD) to treatment with a tumor necrosis factor (TNF)-alpha inhibitor, the method comprising:

(21) analyzing a frequency of at least one subpopulation of immune cells in a tissue biopsy of the subject,

(22) wherein a frequency above a predetermined threshold of immune cells of a subpopulation selected from the group consisting of activated monocytes M1 macrophages, memory B cells, and neutrophils is indicative of the subject being non-responder to the TNF-alpha inhibitor, and/or

(23) wherein a frequency below a predetermined threshold of immune cells of a subpopulation selected from the group consisting of activated monocytes M2 macrophages and CD8+ T cells is indicative of the subject being non-responder to the TNF-alpha inhibitor,

(24) thereby predicting the responsiveness of the subject having the inflammatory bowel disease (IBD) to the treatment with the TNF-alpha inhibitor.

(25) According to some embodiments of the invention, the tissue biopsy of the subject comprises an inflamed tissue.

(26) As used herein the term “inflammatory bowel disease (IBD)” refers to a pathology characterized by an inflammatory condition of the colon and the small intestine. Crohn's disease (CD) and ulcerative colitis (UC) are the principal types of inflammatory bowel disease.

(27) According to some embodiments of the invention, the IBD comprises ulcerative colitis (UC).

(28) Ulcerative colitis (UC) is a long-term condition that results in inflammation and ulcers of the colon and rectum. The primary symptom of active disease is abdominal pain and diarrhea mixed with blood. Other common symptoms include, weight loss, fever, anemia, which can be ranged from mild to severe. Symptoms typically occur intermittently with periods of no symptoms between flares; and complications may include megacolon, inflammation of the eye, joints, or liver, and colon cancer.

(29) According to some embodiments of the invention, the IBD comprises Crohn's disease (CD).

(30) Crohn's disease (CD) is a type of inflammatory bowel disease (IBD) that may affect any part of the gastrointestinal tract from mouth to anus. Signs and symptoms often include abdominal pain, diarrhea (which may be bloody if inflammation is severe), fever, and weight loss. Other complications may include anemia, skin rashes, arthritis, inflammation of the eye, and feeling tired.

(31) As used herein, the term “subject” includes mammals, preferably human beings at any age which suffer from the pathology.

(32) According to some embodiments of the invention, the subject is a naive subject who hasn't been treated with the TNF-alpha inhibitor.

(33) According to some embodiments of the invention, the subject is refractory to corticosteroids and/or immunosuppression treatment. For example, the subject has been subjected to corticosteroids and/or immunosuppression treatment, yet without sufficient, or any therapeutic effect.

(34) As used herein the phrase “TNF-alpha” or “tumor necrosis factor alpha”, which is interchangeably used herein, refers to a multifunctional pro-inflammatory cytokine [also known as DIF; TNFA; TNFSF2; TNLG1F;] that belongs to the tumor necrosis factor (TNF) superfamily. TNF-alpha is mainly secreted by macrophages. It can bind to, and thus functions through its receptors TNFRSF1A/TNFR1 and TNFRSF1B/TNFBR. This cytokine is involved in the regulation of a wide spectrum of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation, and is being implicated in a variety of diseases, including autoimmune diseases, insulin resistance, and cancer.

(35) It should be noted that the “responsiveness” of a subject to a TNF-alpha inhibitor refers to the success or failure of treatment of the subject with the TNF-alpha inhibitor.

(36) A positive response to TNF-alpha inhibitor refers to an improvement following treatment with the TNF-alpha inhibitor in at least one relevant clinical parameter as compared to an untreated subject diagnosed with the same pathology (e.g., the same type, stage, degree and/or classification of the pathology), or as compared to the clinical parameters of the same subject prior to treatment with the TNF-alpha inhibitor. Hence, improvement of clinical symptom(s) following treatment implicates that the subject is a “responder” to the treatment.

(37) On the other hand, a negative response to the treatment with the TNF-alpha inhibitor means that the subject has no sufficient improvement in clinical symptoms, or has a complete lack of improvement of clinical symptoms, or has a worsening of clinical symptoms characterizing the pathology (the IBD condition), with or without appearance of antibodies (e.g., antibody against infliximab) which neutralize the TNF-alpha inhibitor. Such a subject is a “non-responder” to the treatment.

(38) According to some embodiments of the invention, a subject diagnosed with and/or suffering from Crohn's disease or ulcerative colitis is considered to be a responder to the treatment with the TNF-alpha inhibitor if his follow-up clinical data (a year after biopsy) point to remission by Physicians Global Assessment (PGA), laboratory parameters [haemoglobin (Hb), erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), albumin] and used medicines (e.g., steroids, 5-ASA, thiopurines, methotrexate, biologics).

(39) According to some embodiments of the invention, a subject diagnosed with and/or suffering from Crohn's disease or ulcerative colitis is considered to be a non-responder to the treatment with the TNF-alpha inhibitor if his follow-up clinical data (a year after biopsy) point to continuous flare/chronic disease by Physicians Global Assessment (PGA), laboratory parameters (Hb, ESR, CRP, albumin) and 25 used medicines (e.g., steroids, 5-ASA, thiopurines, methotrexate, biologics).

(40) For example, a positive response to treatment with TNF-alpha inhibitor in a subject having an IBD such as ulcerative colitis (UC) or Crohn's disease (CD) disease is a mucosal healing.

(41) Additional and/or alternative parameters which indicate a positive response to the treatment with the TNF-alpha inhibitor (thus indicating that the subject is responder to treatment) include, for example, reduction in the number of liquid or very soft stools; reduction in the abdominal pain; reduction in symptoms or findings presumed related to Crohn's disease: arthritis or arthralgia, iritis or uveitis, erythema nodosum, pyoderma gangrenosum, aphthous stomatitis, anal fissure, fistula or perirectal abscess, other bowel-related fistula, febrile (fever), episode over 100 degrees during past week; and/or reduction in abdominal mass.

(42) The response (i.e., positive or negative) for treatment with the TNF-alpha inhibitor of some embodiments of the invention can be evaluated using known and accepted medical indexes and/or calculators.

(43) For example, the Crohn's Disease Activity Index (CDAI) calculator gauges the progress or lack of progress for people with Crohn's disease. It is accepted that CDAI scores below 150 indicate a better prognosis than higher scores.

(44) The CDAI calculator takes into consideration the following parameters:

(45) (1). Number of liquid or very soft stools in one week;

(46) (2). Sum of seven daily abdominal pain ratings: (0=none, 1=mild, 2=moderate, 3=severe);

(47) (3). Sum of seven daily ratings of general well-being: (0=well, 1=slightly below par, 2=poor, 3=very poor, 4-=terrible);

(48) (4). Symptoms or findings presumed related to Crohn's disease: arthritis or arthralgia, iritis or uveitis, erythema nodosum, pyoderma gangrenosum, aphthous stomatitis, anal fissure, fistula or perirectal abscess, other bowel-related fistula, febrile (fever) episode over 100 degrees during past week;
(5). Taking Lomotil or opiates for diarrhea;
(6). Abnormal mass: 0=none; 0.4=questionable; 1=present
(7). Hematocrit [(Typical−Current)×6] Normal average: For Male=47 For Female=42;
(8). 100× [(standard weight-actual body weight)/standard weight]

(49) Additionally or alternatively, the clinical status of patients with CD following treatment with the TNF-alpha inhibitor can be evaluated using the Harvey-Bradshaw index (HBI) which was devised in 1980 as a simpler version of the Crohn's disease activity index (CDAI) for data collection purposes. It consists of only clinical parameters.

(50) Following is a non-limiting an exemplary calculator for score using the HBI index.

(51) TABLE-US-00001 TABLE 1 Table 1: Harvey-Bradshaw index (HBI). Parameter Scoring General well-being very well +0 slightly below par +1 poor +2 very poor +3 terrible +4 Abdominal pain none +0 mild +1 moderate +2 severe +3 Number of liquid stools per day Abdominal mass none +0 dubious +1 definite +2 definite and tender +3 Complications none +0 arthralgia +1 uveitis +1 erythema nodosum +1 aphthous ulcers +1 pyoderma gangrenosum +1 anal fissure +1 new fistula +1 abscess +1

(52) Patients with Crohn's disease who scored 3 or less on the HBI are very likely to be in remission according to the CDAI. Patients with a score of 8 to 9 or higher are considered to have severe disease.

(53) According to some embodiments of the invention, a subject diagnosed with and/or suffering from Crohn's disease is considered to be a responder to treatment with the TNF-alpha inhibitor if the Crohn's Disease Activity Index (CDAI) score is 150 or less.

(54) According to some embodiments of the invention, a subject diagnosed with and/or suffering from Crohn's disease is considered to be a responder to treatment if following treatment with the TNF-alpha inhibitor the Crohn's Disease Activity Index (CDAI) score is reduced in at least 70 points as compared to the CDAI score prior to the treatment.

(55) According to some embodiments of the invention, a subject diagnosed with and/or suffering from Crohn's disease is considered to be a responder to treatment if following treatment with the TNF-alpha inhibitor the Crohn's Disease Activity Index (CDAI) score is reduced in at least 70 points, e.g., by at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 points as compared to the CDAI score prior to the treatment.

(56) According to some embodiments of the invention, a subject diagnosed with and/or suffering from Crohn's disease is considered to be a non-responder to the treatment with the TNF-alpha inhibitor if the Crohn's Disease Activity Index (CDAI) score is higher than 220.

(57) According to some embodiments of the invention, a subject diagnosed with and/or suffering from Crohn's disease is considered to be a non-responder to the treatment if following treatment with the TNF-alpha inhibitor the Crohn's Disease Activity Index (CDAI) score remains the same or even increased as compared to the CDAI score prior to the treatment.

(58) According to some embodiments of the invention, a subject diagnosed with and/or suffering from Crohn's disease is considered to be a non-responder to the treatment if following treatment with the TNF-alpha inhibitor the Crohn's Disease Activity Index (CDAI) score was reduced in a value lower than 69 as compared to the CDAI score prior to the treatment.

(59) According to some embodiments of the invention, a subject diagnosed with and/or suffering from Crohn's disease is considered to be a non-responder to the treatment if following treatment with the TNF-alpha inhibitor the Crohn's Disease Activity Index (CDAI) score was reduced in a value lower than 69 points, e.g., the CDAI is lower than 68, 67, 66, 65, 64, 63, 62, 61, 60, 59, 58, 57, 56, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 point(s) as compared to the CDAI score prior to the treatment.

(60) For patients having ulcerative colitis (UC) the Mayo Clinic scoring system (Rutgeerts P, Sandborn W J, Feagan B G, Reinisch W, et al. Infliximab for induction and maintenance therapy for ulcerative colitis. N Engl J Med. 2005 Dec. 8; 353(23):2462-76) can be used for assessments of UC activity before or following treatment with the TNF-alpha inhibitor. The Mayo score ranges from 0 to 12, with higher scores indicating more severe disease. This score can be used for both initial evaluation and monitoring treatment response.

(61) Table 2 provides an exemplary calculator according to the Mayo Clinic scoring system.

(62) TABLE-US-00002 TABLE 2 Table 2. Stool Frequency Normal number of stools for patient 1 to 2 stools per day more than normal 3 to 4 stools more than normal >=5 stools more than normal Rectal Bleeding No blood seen. Streaks of blood with stool less than half the time. Obvious blood with stool most of the time. Blood alone passes. Endoscopic findings Normal or inactive disease. Mild Disease. Moderate Disease. Severe Disease. Physician's Global Assessment Normal Mild disease Moderate disease Severe disease

(63) According to some embodiments of the invention, a subject diagnosed with and/or suffering from ulcerative colitis is considered to be a responder to treatment with the TNF-alpha inhibitor if the Mayo Clinic score is 2 or less.

(64) According to some embodiments of the invention, a subject diagnosed with and/or suffering from ulcerative colitis is considered to be a responder to treatment if following treatment with the TNF-alpha inhibitor the Mayo Clinic score is reduced in at least 2 points as compared to the Mayo Clinic score prior to the treatment.

(65) According to some embodiments of the invention, a subject diagnosed with and/or suffering from ulcerative colitis is considered to be a non-responder to the treatment if following treatment with the TNF-alpha inhibitor the Mayo Clinic score remains the same or even increased as compared to the Mayo Clinic score prior to the treatment.

(66) Following is a non-limiting description of determining responsiveness of a subject to the anti-TNF treatment.

(67) Clinical Evaluation of Patients:

(68) The clinical state of the patients can be evaluated using the Harvey Bradshaw Index (HBI) at each visit in the Doctor's clinic. Clinical state was defined as either remission, mild disease, moderate disease, or severe disease based on the HBI score definition. Subjects can be defined as clinical responders if clinical state improved or remained at remission during all visits.

(69) Biomarker response—evaluated biomarkers include, but are not limited to serum C-reactive protein (CRP) and fecal calprotectin. The determination of responders or non-responders can be performed using the following guidelines:

(70) (1) Subjects having at least 2 fecal calprotectin samples taken at least 1 week apart are considered responders when at least a 50% reduction in levels is demonstrated in the second sample retrieved from the feces of the subject.

(71) (2) Subjects who stably remain at normal levels of fecal calprotectin (≤50 mg/gram of feces) at all visits, regardless of serum CRP are considered responders.

(72) (3) Subjects with less than 2 samples of fecal calprotectin are considered responders when demonstrated at least a 50% reduction in serum CRP levels in a second blood sample taken at least a week after the first blood sample.

(73) (4) Subjects who exhibit normal levels of CRP (≤5 mg/dl) at all visits are considered responders.

(74) Steroid dependence—The persistent need of concurrent steroid therapy is a valuable marker of disease state and of response to therapy. Subjects, who are receiving steroid therapy at the clinic visit at the 14.sup.th week of treatment (“14-week”) are considered non-responders.

(75) Immunogenic status—Subjects having measurable serum antibodies to Infliximab at their week 14-week visit are considered non-responders.

(76) Study response algorithm—The present inventors have formulated a decision algorithm to conclude whether a subject is responsive or not to therapy. The algorithm is mainly based on the primary gastroenterologist following the subject. For each subject on the 14-week visit the physician, after reviewing the subjects' records, decides whether the subject responded to therapy, failed or if it is still indeterminate. For the latter (indeterminate), a decision tree is performed with the following steps: a definition of failure is set when steroid treatment is given at 14-week visit. If no steroids are given the next step is to test the biomarker dynamics. A substantial reduction in fecal calprotectin is defined as response. If fecal calprotectin is not available, a reduction in serum CRP (as defined previously) is considered a response to treatment. For subjects who are not steroid-dependent and show no substantial biomarker dynamics, a physician decision on week 26 is made to determine the response status.

(77) As used herein the phrase a “TNF-alpha inhibitor” refers to an agent capable of inhibiting (e.g., downregulating) the expression level and/or activity of tumor necrosis factor alpha (TNFα) and/or capable of competing and/or antagonizing the TNFα activity.

(78) For example, the anti TNFα inhibitor can inhibit the binding to TNFα to its TNFRSF1A/TNFR1 and/or TNFRSF1B/TNFBR receptors.

(79) According to some embodiments of the invention, the TNF-alpha inhibitor is an antibody.

(80) Non-limiting examples of anti-TNFα antibodies include, Infliximab, adalimumab, and certolizumab pegol.

(81) Infliximab (e.g., marketed as REMICADE™, REMSIMA™, INFLECTRA™) is a chimeric IgG1κ monoclonal antibody (composed of human constant and murine variable regions) used as a biologic drug against tumor necrosis factor alpha (TNF-α) that is a key part of the autoimmune reaction. Infliximab neutralizes the biological activity of TNFα by binding with high affinity to the soluble and transmembrane forms of TNFα and inhibits binding of RNFα with its receptors. Infliximab has a molecular weight of approximately 149.1 kilodaltons, and is produced by a recombinant cell line cultured by continuous perfusion and is purified by a series of steps that includes measures to inactivate and remove viruses. Infliximab is used to treat autoimmune diseases such as Crohn's disease, ulcerative colitis, psoriasis, psoriatic arthritis, ankylosing spondylitis, and rheumatoid arthritis.

(82) For example, treatment with Infliximab (IFX) can include, for example, intravenous infusion of 5 mg IFX per kg body weight. If additional treatment is needed, subsequent doses of IFX can be administered, e.g., after 2 and 6 weeks of the first dose of administration of IFX.

(83) Adalimumab (e.g., marketed as HUMIRA™ and EXEMPTIA) is a medication used for rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, Crohn's disease, ulcerative colitis, moderate to severe chronic psoriasis, moderate to severe hidradenitis suppurativa, and juvenile idiopathic arthritis. In rheumatoid arthritis, adalimumab has a response rate similar to methotrexate, and in combination nearly doubles the response rate of methotrexate alone. Like Infliximab, Adalimumab binds to TNFα and prevents it from activating TNF receptors.

(84) Certolizumab pegol (e.g., CDP870, marketed as CIMZIA™) is a therapeutic monoclonal antibody to tumor necrosis factor alpha (TNF-α), for the treatment of Crohn's disease and rheumatoid arthritis.

(85) Antibodies and methods of generating, isolating and/or using same are further described hereinunder.

(86) According to some embodiments of the invention, the TNF-alpha inhibitor is an antagonist of TNFα such as a soluble TNF receptor.

(87) Non-limiting examples of soluble TNF receptors which can be used according to some embodiments of the invention include ENBREL™ (Etanercept). Like Infliximab, Etanercept binds to TNFα, preventing it from activating TNF receptors.

(88) Etanercept is a fusion protein produced by recombinant DNA. It fuses the TNF receptor to the constant end of the IgG1 antibody.

(89) As described hereinabove, the method of some embodiments of the invention comprises analyzing a frequency of at least one subpopulation of immune cells in a tissue biopsy of the subject.

(90) The tissue biopsy used by the method of some embodiments comprises a colon tissue.

(91) The tissue biopsy used by the method of some embodiments comprises an ileum.

(92) According to some embodiments of the invention, the cells of the tissue biopsy are intact cells.

(93) According to some embodiments of the invention, a frequency above a predetermined threshold of immune cells of a subpopulation selected from the group consisting of activated monocytes M1 macrophages, memory B cells, and neutrophils is indicative of the subject being non-responder to the TNF-alpha inhibitor.

(94) As used herein the phrase “frequency above a predetermined threshold” refers to a frequency of the subpopulation of immune cells which is at least 0.01%, 0.02%, 0.03%. 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 1%, 2%0, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 390/%, 40% or higher than a predetermined threshold.

(95) The predetermined threshold can be determined by the frequency of the subpopulation of immune cells in the same tissue biopsy of a subject with a known outcome of TNF-alpha inhibitor treatment (i.e., responder or non-responder), yet, wherein the tissue biopsy of the subject is obtained prior to the first administration of the TNF-alpha inhibitor to the subject (i.e., when the subject is naive to the TNF-alpha treatment). Such a subject can be considered a reference subject. The reference subject can be a TNF-alpha responder or a TNF-alpha non-responder.

(96) Non-limiting exemplary ranges of the subpopulations of immune cells in responders and non-responders patients can be found in Table 11 of the Examples section which follows.

(97) According to some embodiments of the invention, a frequency of activated monocytes M1 macrophages which is above 10% (e.g., above 11%) indicates that the subject is predicted to be a non-responder to the treatment with the TNF-alpha inhibitor.

(98) According to some embodiments of the invention, a frequency of plasma cells which is above 14% indicates that the subject is predicted to be a non-responder to the treatment with the TNF-alpha inhibitor.

(99) According to some embodiments of the invention, a frequency of neutrophils which is above 13% (e.g., above 14%) indicates that the subject is predicted to be a non-responder to the treatment with the TNF-alpha inhibitor.

(100) According to some embodiments of the invention, a ratio of M1/M2 macrophages which is higher than 1, e.g., higher than 1.1 is indicative of the subject being non-responder to treatment with the TNF-alpha inhibitor.

(101) According to some embodiments of the invention, the method of predicting responsiveness of a subject having an inflammatory bowel disease (IBD) to a TNF-alpha inhibitor can be performed by:

(102) (a) analyzing a frequency of at least one subpopulation of immune cells in a tissue biopsy of the subject, and;

(103) (b) comparing the frequency of the at least one subpopulation of immune cells in the tissue biopsy of the subject to an expression data of the at least one subpopulation of immune cells in a corresponding tissue biopsy obtained from at least one TNF-alpha inhibitor responder subject and/or at least one TNF-alpha inhibitor non-responder subject, thereby predicting the responsiveness of the subject to the TNF-alpha inhibitor treatment.

(104) As mentioned, the tissue biopsy can be from an inflamed region as determined by tissue distortion and plasmacytosis.

(105) According to some embodiments of the invention, when the tissue biopsy comprises both an inflamed tissue and a non-inflamed tissue the method can sufficiently determine the responsiveness of the subject to (TNF)-alpha inhibitor therapy based on frequencies of macrophages or plasma cells.

(106) According to some embodiments of the invention, when the tissue biopsy comprises mainly an inflamed tissue the method can sufficiently determine the responsiveness of the subject to (TNF)-alpha inhibitor therapy based on frequencies of plasma cells or macrophages

(107) According to some embodiments of the invention, the activated monocytes M1 macrophages are characterized by CD68+ and one of CCR7+, CD86+ or CD80+ or a combination of CCR7+, CD86+ and CD80+ as core expression signature.

(108) It should be noted that the sign “+” as used herein refers to a positive expression (i.e., the cell expresses the indicated marker); and the sign “−” as used herein refers to a negative expression (i.e., the cell does not express the indicated marker).

(109) According to some embodiments of the invention, the activated monocytes M1 macrophages are characterized by CD68+/CCR7+ expression signature.

(110) According to some embodiments of the invention, the activated monocytes M1 macrophages are characterized by CD68+/CD86+ expression signature.

(111) According to some embodiments of the invention, the activated monocytes M1 macrophages are characterized by CD68+/CD80+ expression signature.

(112) According to some embodiments of the invention, the activated monocytes M1 macrophages are characterized by CD68+/CCR7+/CD86+ expression signature.

(113) According to some embodiments of the invention, the activated monocytes M1 macrophages are characterized by CD68+/CCR7+/CD80+ expression signature.

(114) According to some embodiments of the invention, the activated monocytes M1 macrophages are characterized by CD68+/CD86+/CD80+ expression signature.

(115) According to some embodiments of the invention, the activated monocytes M1 macrophages are characterized by CD68+/CCR7+/CD86+/CD80+ expression signature.

(116) Additionally or alternatively, the activated monocytes M1 macrophages are further characterized by CD11b+ and/or CCR2+ expression markers.

(117) According to some embodiments of the invention, the activated monocytes M1 macrophages are characterized by CD68+/CCR7+/CD11b+/CCR2+ expression signature.

(118) According to some embodiments of the invention, the activated monocytes M1 macrophages are characterized by CD68+/CCR7+/CD86+/CD80+/CD11b+ expression signature.

(119) According to some embodiments of the invention, the activated monocytes M1 macrophages are characterized by CD68+/CCR7+/CD86+/CD80+/CCR2+ expression signature.

(120) According to some embodiments of the invention, the activated monocytes M1 macrophages are characterized by CD68+/CCR7+/CD86+/CD80+/CD11b+/CCR2+ expression signature.

(121) According to some embodiments of the invention, the memory B cells are plasma cells, and wherein the plasma cells are characterized by positive expression of a marker selected from the group consisting of: CD138 as a core signature, and optionally one or more of the markers selected from the group consisting of: CD45, BCMA, CD38, IgM, IgG, IgA and/or IgE.

(122) According to some embodiments of the invention, the plasma cells are characterized by CD138+ expression signature.

(123) According to some embodiments of the invention, the plasma cells are further characterized by a positive expression of one or more markers of the CD45, BCMA, CD38, IgM, IgG, IgA and/or IgE markers.

(124) According to some embodiments of the invention, the plasma cells are characterized by CD138+/CD45+ expression signature.

(125) According to some embodiments of the invention, the plasma cells are characterized by CD138+/BCMA+ expression signature.

(126) According to some embodiments of the invention, the plasma cells are characterized by CD138+/CD38+ expression signature.

(127) According to some embodiments of the invention, the plasma cells are characterized by CD138+/IgM+ expression signature.

(128) According to some embodiments of the invention, the plasma cells are characterized by CD138+/IgG+ expression signature.

(129) According to some embodiments of the invention, the plasma cells are characterized by CD138+/IgE+ expression signature.

(130) According to some embodiments of the invention, the plasma cells are characterized by CD138+/CD45+/BCMA+/CD38+/IgM+/IgG+/IgA+/IgE+ expression signature.

(131) According to some embodiments of the invention, the memory B cells are non-plasma cells, and wherein the non-plasma cells are characterized by positive expression of CD20, CD19, and CD45RA as a core signature.

(132) According to some embodiments of the invention, the non-plasma cells are further characterized by an expression of at least one marker or a combination of markers selected from the group of CD45, MHC-Class II, IgG, IgA, IgE and/or IgD markers.

(133) According to some embodiments of the invention, the neutrophils are characterized by CD45+, CD66b+ and/or CD16+ expression signature.

(134) According to some embodiments of the invention, a frequency below a predetermined threshold of immune cells of a subpopulation selected from the group consisting of activated monocytes M2 macrophages and CD8+ T cells is indicative of the subject being non-responder to the TNF-alpha inhibitor,

(135) As used herein the phrase “frequency below a predetermined threshold” refers to a frequency of the subpopulation of immune cells which is lower than 50%, 45%, 44%, 43%, 42%, 41%, 40%, 39%, 38%, 37%, 36%, 35%, 34%, 33%, 32%, 31%, 30%, 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.9%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, 0.01% of a predetermined threshold.

(136) According to some embodiments of the invention, a frequency of CD8+ T cells which is lower than 2% indicates that the subject is predicted to be a non-responder to the treatment with the TNF-alpha inhibitor.

(137) According to some embodiments of the invention, the activated monocytes M2 macrophages are characterized by CD68+ expression signature.

(138) According to some embodiments of the invention, the activated monocytes M2 macrophages are further characterized by expression of one or more markers selected from the group consisting of CD163+ and CD206+.

(139) According to some embodiments of the invention, the activated monocytes M2 macrophages are characterized by CD68+/CD163+ expression signature.

(140) According to some embodiments of the invention, the activated monocytes M2 macrophages are characterized by CD68+/CD206+ expression signature.

(141) According to some embodiments of the invention, the activated monocytes M2 macrophages are characterized by CD68+/CD163+/CD206+ expression signature.

(142) According to some embodiments of the invention, the CD8+ T cells are characterized by CD8+ expression signature.

(143) According to some embodiments of the invention, the CD8+ T cells are characterized by CD8+ and CD69+ expression signature.

(144) According to some embodiments of the invention, the CD8+ T cells are characterized by CD8+/CD3+ expression signature.

(145) According to some embodiments of the invention, the CD8+ T cells are characterized by CD8+/CD45+ expression signature.

(146) According to some embodiments of the invention, the CD8+ T cells are characterized by CD8+/CD45RA+ expression signature.

(147) According to some embodiments of the invention, the CD8+ T cells are characterized by CD8+/CD69+/CD3+ expression signature.

(148) According to some embodiments of the invention, the CD8+ T cells are characterized by CD8+/CD69+/CD45+ expression signature.

(149) According to some embodiments of the invention, the CD8+ T cells are characterized by CD8+/CD69+/CD45RA+ expression signature.

(150) According to some embodiments of the invention, the CD8+ T cells are characterized by CD8+/CD69+/CD3+/CD45+/CD45RA+ expression signature.

(151) Analysis of the frequency of at least one subpopulation of immune cells can be performed by determining the presence of the subpopulation of immune cells in the sample and calculating the frequencies thereof out of the total immune cells present in the sample. Methods of determining which subpopulations of immune cells are present in a sample include, for example, identification of cell types from the cells in the sample and calculating the frequencies of each subpopulation of immune cells.

(152) According to some embodiments of the invention, the analyzing the frequency of the at least one subpopulation of immune cells is performed by a morphometric analysis.

(153) According to some embodiments of the invention, the analyzing the frequency of the at least one subpopulation of immune cells is performed by using at least one histological stain.

(154) According to some embodiments of the invention, the analyzing the frequency of the at least one subpopulation of immune cells is performed by using at least one antibody.

(155) According to some embodiments of the invention, the antibody is used in an immuno-histochemistry (IHC) or immuno-fluorescence method.

(156) According to some embodiments of the invention, the antibody is used in a flow cytometry or Fluorescence-activated cell sorting (FACS) analysis.

(157) According to some embodiments of the invention, the analyzing the frequency of the at least one subpopulation of immune cells is performed by mass-cytometry.

(158) According to some embodiments of the invention, the mass-cytometry is CyTOF (e.g., FLUIDIGM®).

(159) According to some embodiments of the invention, the analyzing the frequency of the at least one subpopulation of immune cells is performed by an RNA in-situ hybridization assay.

(160) According to some embodiments of the invention, the analyzing the frequency of the at least one subpopulation of immune cells is performed by a single cell RNA sequencing (RNA SEQ) analysis.

(161) According to some embodiments of the invention, the analyzing the frequency of the at least one subpopulation of immune cells is performed by exome sequencing followed by computational deconvolution.

(162) According to some embodiments of the invention, the analyzing the frequency of the at least one subpopulation of immune cells is performed by RNA SEQ followed by computational deconvolution.

(163) According to some embodiments of the invention, the analyzing the frequency of the at least one subpopulation of immune cells is performed by reverse-transcriptase polymerase chain reaction (RT-PCR) followed by computational deconvolution.

(164) According to some embodiments of the invention, the analyzing the frequency of the at least one subpopulation of immune cells is performed by microarray followed by computational deconvolution.

(165) According to an aspect of some embodiments of the invention, there is provided a method of selecting treatment to inflammatory bowel disease (IBD) in a subject in need thereof, the method comprising:

(166) (a) determining responsiveness to a treatment with a TNF-alpha inhibitor according to the method of some embodiments of the invention (e.g., any of the embodiments described hereinabove); and

(167) (b) selecting treatment based on the responsiveness.

(168) According to an aspect of some embodiments of the invention, there is provided a method of treating to inflammatory bowel disease (IBD) in a subject in need thereof, the method comprising:

(169) (a) determining responsiveness to a TNF-alpha inhibitor according to the method of some embodiments of the invention; and

(170) (b) treating the subject based on the responsiveness.

(171) The term “treating” refers to inhibiting, preventing or arresting the development of a pathology (disease, disorder or condition) and/or causing the reduction, remission, or regression of a pathology. Those of skill in the art will understand that various methodologies and assays can be used to assess the development of a pathology, and similarly, various methodologies and assays may be used to assess the reduction, remission or regression of a pathology.

(172) The treatment of the subject, e.g., the treatment plan or regimen, depends on the predicted responsiveness of the subject to the TNF-alpha inhibitor. For example, if the subject is predicted to response to the TNF-alpha inhibitor (a TNF-alpha inhibitor responder subject), then the treatment selected for treating such a responder subject can include administration of the TNF-alpha inhibitor. On the other hand, if the subject is predicted to not respond to the TNF-alpha inhibitor (a TNF-alpha non-responder subject), then the treatment selected for treating such as non-responder subject will not include the TNF-alpha inhibitor.

(173) The agents of some embodiments of the invention which are described herein for predicting responsiveness of a subject to treatments with a tumor necrosis factor (TNF)-alpha inhibitor may be included in a diagnostic kit/article of manufacture preferably along with appropriate instructions for use and labels indicating FDA approval for use in diagnosing and/or assessing the prediction of responsiveness of a subject to treatment with a tumor necrosis factor (TNF)-alpha inhibitor.

(174) Such a kit can include, for example, at least one container including at least one of the herein described diagnostic agents (e.g., an antibody which can specifically bind to a cell marker characteristic of the immune cell subpopulation; or a probe which can specifically hybridize to and/or elongate a nucleic acid sequence, e.g., an RNA sequence, characteristic of the immune cell subpopulation) and an imaging reagent packed in another container (e.g., enzymes, secondary antibodies, buffers, chromogenic substrates, fluorogenic material). The kit may also include appropriate buffers and preservatives for improving the shelf-life of the kit.

(175) According to an aspect of some embodiments of the invention, there is provided a kit for predicting responsiveness of a subject to treatment with a tumor necrosis factor (TNF)-alpha inhibitor comprising an agent capable of analyzing a frequency of at least one subpopulation of immune cells in a tissue biopsy of the subject, and a reference expression data of the frequency of at least one subpopulation of immune cells of a tissue biopsy obtained from at least one TNF-alpha inhibitor responder subject and/or at least one TNF-alpha inhibitor non-responder subject, wherein the immune cells are of a subpopulation selected from the group consisting of: activated monocytes M1 macrophages, memory B cells, neutrophils, activated monocytes M2 macrophages and CD8+ T cells.

(176) Table 3 hereinbelow, provides a non-limiting description of suitable agents (e.g., antibodies) for identifying subpopulations of immune cells from the tissue biopsy. It should be noted that the antibodies can be directly (e.g., by conjugation to a label) or indirectly labeled (e.g., by conjugation to an identifiable moiety) for visualization and further detection.

(177) TABLE-US-00003 TABLE 3 Table 3. Population Antibody Catalogue number Company Plasma cells Mouse anti MCA2459GA AbD Serotec human CD138 Activated Mouse anti MCA5709 AbD Serotec monocytes Human CD68 (M1) Mouse anti 305202 BioLegend human CD80 Goat anti AF-141-NA R&D Systems Human CD86 Mouse anti MAB197 R&D Systems human CCR7 Activated Mouse anti MCA5709 AbD Serotec monocytes Human CD68 (M2) Mouse anti MCA1853 AbD Serotec human CD163 Mouse anti MCA5552Z AbD Serotec human CD206 CD8+ T cells mouse anti MCA1817T AbD Serotec human CD8 mouse anti NBP2-25236 Novus human CD69 Neutrophils rabbit anti BS-6028R-A488 BioSS human CD16 mouse anti NB100-77808 Novus human C66b Memory B mouse anti MCA1915T AbD Serotec cells human CD20 mouse anti MCA2454 AbD Serotec human CD19 mouse anti MCA88 AbD Serotee human CD45RA

(178) Table 4 provides a non-limiting sequence information for the antigens (markers) which can be used to identify the various immune cells (e.g., subpopulation of cells) according to some embodiments of the invention. The Table provides the GenBank Accession numbers (and the respective sequence identifiers) for the polypeptides of the antigens (cell markers) and the polynucleotide encoding same. It should be noted that the polypeptides can be identified using various protein detection methods such as those described hereinunder; and that the polynucleotides can be identified using various RNA detection methods such as those described hereinunder.

(179) TABLE-US-00004 TABLE 4 Table 4. Marker (presence Poly- Poly- “+”; Polypeptide peptide Polynucleotide nucleotide absence GenBank SEQ ID GenBank SEQ ID “−“ Accession No. NO: Accession No. NO: CD68+ NP_001035148 5 NM_001040059.1 37 CD68+ NP_001242.2 6 NM_001251.2 38 CD86+ NP_001193853.1 7 NM_001206924.1 39 CD86+ NP_001193854.1 8 NM_001206925.1 40 CD86+ NP_008820.3 9 NM_006889.4 41 CD86+ NP_787058.4 10 NM_175862.4 42 CD86+ NP_795711.1 11 NM_176892.1 43 CD64+ NP_000557.1 12 NM_000566.3 44 CD20+ NP_061883.1 13 NM_019010.2 45 CD19+ NP_001761.3 14 NM_001770.5 46 CD19+ NP_001171569.1 15 NM_001178098.1 47 IgD+ — NG_001019.5 (977531 . . . 984804) 48 IgA+ NP_067612.1 17 NM_021601.3 49 IgA+ NP_001774.1 18 NM_001783.3 50 CD138+ NP_001006947.1 19 NM_001006946.1 51 CD138+ NP_002988.3 20 NM_002997.4 52 CD45+ NP_001254727.1 21 NM_001267798.1 53 CD45+ NP_002829.3 22 NM_002838.4 54 CD45+ NP_563578.2 23 NM_080921.3 55 CD66b+ NP_001807.2 24 NM_001816.3 56 CD16+ NP_000560.5 25 NM_000569.6 57 CD16+ NP_001121064.1 26 NM_001127592.1 58 CD16+ NP_001121065.1 27 NM_001127593.1 59 CD16+ NP_001121067.1 28 NM_001127595.1 60 CD16+ NP_001121068.1 29 NM_001127596.1 61 CD163+ NP_004235.4 30 NM_004244.5 62 CD163+ NP_981961.2 31 NM_203416.3 63 CD206+ NP_002429.1 32 NM_002438.3 64 CD8+ NP_001139345.1 33 NM_001145873.1 65 CD8+ NP_001759.3 34 NM_001768.6 66 CD8+ NP_741969.1 35 NM_171827.3 67 CD69+ NP_001772.1 36 NM_001781.2 68

(180) Following is a non-limiting description of methods of detecting RNA and/or protein sequences within cells of the tissue biopsy of some embodiments of the invention.

(181) Methods of Detecting the Expression Level of RNA

(182) The expression level of the RNA in the cells of some embodiments of the invention can be determined using methods known in the arts.

(183) RT-PCR Analysis:

(184) This method uses PCR amplification of relatively rare RNAs molecules. First, RNA molecules are purified from the cells and converted into complementary DNA (cDNA) using a reverse transcriptase enzyme (such as an MMLV-RT) and primers such as, oligo dT, random hexamers or gene specific primers. Then by applying gene specific primers and Taq DNA polymerase, a PCR amplification reaction is carried out in a PCR machine. Those of skills in the art are capable of selecting the length and sequence of the gene specific primers and the PCR conditions (i.e., annealing temperatures, number of cycles and the like) which are suitable for detecting specific RNA molecules. It will be appreciated that a semi-quantitative RT-PCR reaction can be employed by adjusting the number of PCR cycles and comparing the amplification product to known controls.

(185) RNA In Situ Hybridization Stain:

(186) In this method DNA or RNA probes are attached to the RNA molecules present in the cells. Generally, the cells are first fixed to microscopic slides to preserve the cellular structure and to prevent the RNA molecules from being degraded and then are subjected to hybridization buffer containing the labeled probe. The hybridization buffer includes reagents such as formamide and salts (e.g., sodium chloride and sodium citrate) which enable specific hybridization of the DNA or RNA probes with their target mRNA molecules in situ while avoiding non-specific binding of probe. Those of skills in the art are capable of adjusting the hybridization conditions (i.e., temperature, concentration of salts and formamide and the like) to specific probes and types of cells. Following hybridization, any unbound probe is washed off and the bound probe is detected using known methods.

(187) For example, if a radio-labeled probe is used, then the slide is subjected to a photographic emulsion which reveals signals generated using radio-labeled probes; if the probe was labeled with an enzyme then the enzyme-specific substrate is added for the formation of a colorimetric reaction; if the probe is labeled using a fluorescent label, then the bound probe is revealed using a fluorescent microscope; if the probe is labeled using a tag (e.g., digoxigenin, biotin, and the like) then the bound probe can be detected following interaction with a tag-specific antibody which can be detected using known methods.

(188) In Situ RT-PCR Stain:

(189) This method is described in Nuovo G J, et al. [Intracellular localization of polymerase chain reaction (PCR)-amplified hepatitis C cDNA. Am J Surg Pathol. 1993, 17: 683-90] and Komminoth P, et al. [Evaluation of methods for hepatitis C virus detection in archival liver biopsies. Comparison of histology, immunohistochemistry, in situ hybridization, reverse transcriptase polymerase chain reaction (RT-PCR) and in situ RT-PCR. Pathol Res Pract. 1994, 190: 1017-25]. Briefly, the RT-PCR reaction is performed on fixed cells by incorporating labeled nucleotides to the PCR reaction. The reaction is carried on using a specific in situ RT-PCR apparatus such as the laser-capture microdissection PixCell I LCM system available from Arcturus Engineering (Mountainview, Calif.).

(190) Oligonucleotide Microarray—

(191) In this method oligonucleotide probes capable of specifically hybridizing with the polynucleotides of some embodiments of the invention are attached to a solid surface (e.g., a glass wafer). Each oligonucleotide probe is of approximately 20-25 nucleic acids in length. To detect the expression pattern of the polynucleotides of some embodiments of the invention in a specific cell sample (e.g., blood cells), RNA is extracted from the cell sample using methods known in the art (using e.g., a TRIZOL solution, Gibco BRL, USA). Hybridization can take place using either labeled oligonucleotide probes (e.g., 5′-biotinylated probes) or labeled fragments of complementary DNA (cDNA) or RNA (cRNA).

(192) Briefly, double stranded cDNA is prepared from the RNA using reverse transcriptase (RT) (e.g., Superscript II RT), DNA ligase and DNA polymerase I, all according to manufacturer's instructions (Invitrogen Life Technologies, Frederick, Md., USA). To prepare labeled cRNA, the double stranded cDNA is subjected to an in vitro transcription reaction in the presence of biotinylated nucleotides using e.g., the BioArray High Yield RNA Transcript Labeling Kit (Enzo, Diagnostics, Affymetix Santa Clara Calif.). For efficient hybridization the labeled cRNA can be fragmented by incubating the RNA in 40 mM Tris Acetate (pH 8.1), 100 mM potassium acetate and 30 mM magnesium acetate for 35 minutes at 94° C. Following hybridization, the microarray is washed and the hybridization signal is scanned using a confocal laser fluorescence scanner which measures fluorescence intensity emitted by the labeled cRNA bound to the probe arrays.

(193) For example, in the Affymetrix microarray (Affymetrix®, Santa Clara, Calif.) each gene on the array is represented by a series of different oligonucleotide probes, of which, each probe pair consists of a perfect match oligonucleotide and a mismatch oligonucleotide. While the perfect match probe has a sequence exactly complimentary to the particular gene, thus enabling the measurement of the level of expression of the particular gene, the mismatch probe differs from the perfect match probe by a single base substitution at the center base position. The hybridization signal is scanned using the Agilent scanner, and the Microarray Suite software subtracts the non-specific signal resulting from the mismatch probe from the signal resulting from the perfect match probe.

(194) Exome sequencing (also known as Whole Exome Sequencing, WES or WXS) is a targeted sequencing approach that is restricted to the protein-coding regions of genomes (exome).

(195) The exome is estimated to encompass approximately 1% of the genome, yet contains approximately 85% of disease-causing mutations. In the initial step, the subset of DNA encoding proteins (exons) are selected, followed by sequencing of the exons using a high throughput DNA sequencing technology. The exome sequencing enables a rapid, cost-effective identification of common single nucleotide variants (SNVs), copy number variations (CNVs), and small insertions or deletions (indels), as well as rare de novo mutations that may explain the heritability of Mendelian and complex disorders. Exome sequencing can be performed using, e.g., the Ion Torrent™ Next-Generation Sequencing (Available from ThermoFisher Scientific).

(196) Strand Specific RNA-Sequencing Library Construction—

(197) The following is a representative protocol for the preparation of sequencing libraries from purified RNAs. This protocol is optimized for very low amounts of input RNA, and uses an adapter-ligation strategy in order to map locations of crosslinks (e.g., for the AMT protocol). This RNA-sequencing protocol also includes several steps that remove contaminating ssDNA probes.

(198) RNA can be extracted using the miRNeasy kit (Qiagen, 217004) and poly(A) RNA is further isolated using, for example, Oligo d (T25) beads (NEB, E7490L). The Poly(A) fraction is then fragmented (Invitrogen, AM8740), and fragments smaller than 200 bps are preferably eliminated (Zymo, R1016) and the remaining fraction is treated with FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific, EF0652) and T4 Polynucleotide Kinase (NEB, M0201L). RNA is then ligated to a RNA adaptor essentially as described in Engreitz, J. M. et al. Science 341: 1237973, (2013), which is fully incorporated herein by reference, using T4 RNA Ligase 1 (NEB, M0204L), which is then used to facilitate cDNA synthesis using Affinity Script Multiple Temperature Reverse Transcriptase (Agilent, 600105). More specifically, the following adaptors reported in Engreitz, J. M. et al. 2013 can be used:

(199) TABLE-US-00005 RNA sequencing-RiL-19 3′ RNA adaptor: (SEQ ID NO: 1) Thosphate/rArGrArUrCrGrGrArArGrArGrCrGrUrCrGr UrG/ddC; RNA sequencing-AR17 RT primer: (SEQ ID NO: 2) ACACGACGCTCTTCCGA; RNA sequencing-3Tr3 5′ DNA adaptor: (SEQ ID NO: 3) /Phosphate/AGATCGGAAGAGCACACGTCTG/ddC; RNA sequencing-PCR enrichment: (SEQ ID NO: 4) AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC GCTCTTCCGATCTCAAGCAGAAGACGGCATACGAGATNNNNNNNN GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT.

(200) RNA is then degraded and the cDNA is ligated to a DNA adaptor using T4 RNA Ligase 1 as described in Engreitz, J. M. et al. 2013. Final library amplification is completed using NEB Next High Fidelity 2×PCT Master Mix (M054L). To clean up the final PCR and removed adapter dimers, two subsequent 1× and 8×SPRI reactions ire completed to prepare the final library for sequencing.

(201) Methods of Detecting the Expression Level of Protein

(202) Non-limiting examples of protein detection methods include, flow cytometry (e.g., intra or extra-cellular flow cytometry), FACS, ELISA, Western Blot, RIA, immunohistochemistry, protein activity assays and Mass cytometry (e.g., CyTOF (FLUIDIGM®)).

(203) Mass Cytometry:

(204) Mass-cytometry uniquely combines time-of-flight mass spectrometry with Maxpar metal-labeling technology to enable breakthrough discovery and comprehensive functional profiling applications. Cellular targets are labeled with metal-tagged antibodies and detected and quantified by time-of-flight mass spectrometry. The high purity and choice of metal isotopes ensure minimal background noise from signal overlap or endogenous cellular components. For example, CyTOF (Fludigm) is a recently introduced mass-cytometer capable of detecting up to 40 markers conjugated to heavy metals simultaneously on single cells.

(205) Enzyme Linked Immunosorbent Assay (ELISA):

(206) This method involves fixation of a sample (e.g., fixed cells or a proteinaceous solution) containing a protein substrate to a surface such as a well of a microtiter plate. A substrate specific antibody coupled to an enzyme is applied and allowed to bind to the substrate. Presence of the antibody is then detected and quantitated by a colorimetric reaction employing the enzyme coupled to the antibody. Enzymes commonly employed in this method include horseradish peroxidase and alkaline phosphatase. If well calibrated and within the linear range of response, the amount of substrate present in the sample is proportional to the amount of color produced. A substrate standard is generally employed to improve quantitative accuracy.

(207) Western Blot:

(208) This method involves separation of a substrate from other protein by means of an acrylamide gel followed by transfer of the substrate to a membrane (e.g., nylon or PVDF). Presence of the substrate is then detected by antibodies specific to the substrate, which are in turn detected by antibody binding reagents. Antibody binding reagents may be, for example, protein A, or other antibodies. Antibody binding reagents may be radiolabeled or enzyme linked as described hereinabove. Detection may be by autoradiography, colorimetric reaction or chemiluminescence. This method allows both quantitation of an amount of substrate and determination of its identity by a relative position on the membrane which is indicative of a migration distance in the acrylamide gel during electrophoresis.

(209) Radio-Immunoassay (RIA):

(210) In one version, this method involves precipitation of the desired protein (i.e., the substrate) with a specific antibody and radiolabeled antibody binding protein (e.g., protein A labeled with I.sup.125) immobilized on a precipitable carrier such as agarose beads. The number of counts in the precipitated pellet is proportional to the amount of substrate.

(211) In an alternate version of the RIA, a labeled substrate and an unlabeled antibody binding protein are employed. A sample containing an unknown amount of substrate is added in varying amounts. The decrease in precipitated counts from the labeled substrate is proportional to the amount of substrate in the added sample.

(212) Fluorescence Activated Cell Sorting (FACS):

(213) This method involves detection of a substrate in situ in cells by substrate specific antibodies. The substrate specific antibodies are linked to fluorophores. Detection is by means of a cell sorting machine which reads the wavelength of light emitted from each cell as it passes through a light beam. This method may employ two or more antibodies simultaneously.

(214) Immunohistochemical Analysis:

(215) This method involves detection of a substrate in situ in fixed cells by substrate specific antibodies. The substrate specific antibodies may be enzyme linked or linked to fluorophores. Detection is by microscopy and subjective or automatic evaluation. If enzyme linked antibodies are employed, a colorimetric reaction may be required. It will be appreciated that immunohistochemistry is often followed by counterstaining of the cell nuclei using for example Hematoxyline or Giemsa stain.

(216) In Situ Activity Assay:

(217) According to this method, a chromogenic substrate is applied on the cells containing an active enzyme and the enzyme catalyzes a reaction in which the substrate is decomposed to produce a chromogenic product visible by a light or a fluorescent microscope.

(218) In Vitro Activity Assays:

(219) In these methods the activity of a particular enzyme is measured in a protein mixture extracted from the cells. The activity can be measured in a spectrophotometer well using colorimetric methods or can be measured in a non-denaturing acrylamide gel (i.e., activity gel). Following electrophoresis, the gel is soaked in a solution containing a substrate and colorimetric reagents. The resulting stained band corresponds to the enzymatic activity of the protein of interest. If well calibrated and within the linear range of response, the amount of enzyme present in the sample is proportional to the amount of color produced. An enzyme standard is generally employed to improve quantitative accuracy.

(220) As mentioned above, the analysis of the subpopulations of immune cells can employ a method of detecting total RNA (e.g., RT-PCR, microarray, RNA SEQ, exome sequencing) or protein (e.g., ELISA, immunofluorescence, immuno-histochemistry) or DNA methylation (e.g., Methylation microarray) in a biological sample, followed by a computational deconvolution.

(221) Computational Deconvolution:

(222) This method involves using computational algorithms to estimate the composition/proportion of constituting cell subpopulation in bulk samples assayed on a given technology. Often, but not necessarily, this makes use of prior knowledge in the form of cell subset markers or profiles from the same assay.

(223) Deconvolution algorithms have been proposed for a variety of assays, including but not only, gene expression measured by microarray or RNA-seq, and methylation arrays essentially as described elsewhere (18), which is fully incorporated herein by reference.

(224) As used herein, the term “antibody” refers to a substantially intact antibody molecule.

(225) As used herein, the phrase “antibody fragment” refers to a functional fragment of an antibody (such as Fab, F(ab′)2, Fv or single domain molecules such as VH and VL) that is capable of binding to an epitope of an antigen.

(226) Suitable Antibody fragments for practicing some embodiments of the invention include a complementarity-determining region (CDR) of an immunoglobulin light chain (referred to herein as “light chain”), a complementarity-determining region of an immunoglobulin heavy chain (referred to herein as “heavy chain”), a variable region of a light chain, a variable region of a heavy chain, a light chain, a heavy chain, an Fd fragment, and antibody fragments comprising essentially whole variable regions of both light and heavy chains such as an Fv, a single chain Fv, an Fab, an Fab′, and an F(ab′)2.

(227) Functional antibody fragments comprising whole or essentially whole variable regions of both light and heavy chains are defined as follows:

(228) (i) Fv, defined as a genetically engineered fragment consisting of the variable region of the light chain and the variable region of the heavy chain expressed as two chains;

(229) (ii) single chain Fv (“scFv”), a genetically engineered single chain molecule including the variable region of the light chain and the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule.

(230) (iii) Fab, a fragment of an antibody molecule containing a monovalent antigen-binding portion of an antibody molecule which can be obtained by treating whole to antibody with the enzyme papain to yield the intact light chain and the Fd fragment of the heavy chain which consists of the variable and CH1 domains thereof;

(231) (iv) Fab′, a fragment of an antibody molecule containing a monovalent antigen-binding portion of an antibody molecule which can be obtained by treating whole antibody with the enzyme pepsin, followed by reduction (two Fab′ fragments are obtained per antibody molecule);

(232) (v) F(ab′)2, a fragment of an antibody molecule containing a monovalent antigen-binding portion of an antibody molecule which can be obtained by treating whole antibody with the enzyme pepsin (i.e., a dimer of Fab′ fragments held together by two disulfide bonds); and

(233) (vi) Single domain antibodies are composed of a single VH or VL domains which exhibit sufficient affinity to the antigen.

(234) Methods of generating antibodies (i.e., monoclonal and polyclonal) are well known in the art. Antibodies may be generated via any one of several methods known in the art, which methods can employ induction of in-vivo production of antibody molecules, screening of immunoglobulin libraries (Orlandi D. R. et al., 1989. Proc. Natl. Acad. Sci. U.S.A 86:3833-3837; Winter G. et al., 1991. Nature 349:293-299) or generation of monoclonal antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the Epstein-Barr virus (EBV)-hybridoma technique (Kohler G. et al., 1975. Nature 256:495-497; Kozbor D. et al., 1985. J. Immunol. Methods 81:31-42; Cote R I. et al., 1983. Proc. Natl. Acad. Sci. U.S.A. 80:2026-2030; Cole S P. et al., 1984. Mol. Cell. Biol. 62:109-120).

(235) In cases where target antigens are too small to elicit an adequate immunogenic response when generating antibodies in-vivo, such antigens (haptens) can be coupled to antigenically neutral carriers such as keyhole limpet hemocyanin (KLH) or serum albumin [e.g., bovine serum albumine (BSA)] carriers (see, for example, U.S. Pat. Nos. 5,189,178 and 5,239,078]. Coupling a hapten to a carrier can be effected using methods well known in the art. For example, direct coupling to amino groups can be effected and optionally followed by reduction of the imino linkage formed.

(236) Alternatively, the carrier can be coupled using condensing agents such as dicyclohexyl carbodiimide or other carbodiimide dehydrating agents. Linker compounds can also be used to effect the coupling; both homobifunctional and heterobifunctional linkers are available from Pierce Chemical Company, Rockford, Ill.

(237) The resulting immunogenic complex can then be injected into suitable mammalian subjects such as mice, rabbits, and the like. Suitable protocols involve repeated injection of the immunogen in the presence of adjuvants according to a schedule which boosts production of antibodies in the serum. The titers of the immune serum can readily be measured using immunoassay procedures which are well known in the art.

(238) The antisera obtained can be used directly or monoclonal antibodies may be obtained as described hereinabove.

(239) Antibody fragments can be obtained using methods well known in the art. [(see, for example, Harlow and Lane, “Antibodies: A Laboratory Manual”, Cold Spring Harbor Laboratory, New York, (1988)]. For example, antibody fragments according to some embodiments of the invention can be prepared by proteolytic hydrolysis of the antibody or by expression in E. coli or mammalian cells (e.g., Chinese hamster ovary cell culture or other protein expression systems) of DNA encoding the fragment.

(240) Alternatively, antibody fragments can be obtained by pepsin or papain digestion of whole antibodies by conventional methods. As described hereinabove, an (Fab′)2 antibody fragments can be produced by enzymatic cleavage of antibodies with pepsin to provide a 5S fragment. This fragment can be further cleaved using a thiol reducing agent, and optionally a blocking group for the sulfhydryl groups resulting from cleavage of disulfide linkages to produce 3.5S Fab′ monovalent fragments. Alternatively, enzymatic cleavage using pepsin produces two monovalent Fab′ fragments and an Fc fragment directly. Ample guidance for practicing such methods is provided in the literature of the art (for example, refer to: Goldenberg, U.S. Pat. Nos. 4,036,945 and 4,331,647; Porter, R R., 1959. Biochem. J. 73:119-126). Other methods of cleaving antibodies, such as separation of heavy chains to form monovalent light-heavy chain fragments, further cleavage of fragments, or other enzymatic, chemical, or genetic techniques may also be used, so long as the fragments bind to the antigen that is recognized by the intact antibody.

(241) As described hereinabove, an Fv is composed of paired heavy chain variable and light chain variable domains. This association may be noncovalent (see, for example, Inbar et al., 1972. Proc. Natl. Acad. Sci. USA. 69:2659-62). Alternatively, as described hereinabove the variable domains can be linked to generate a single chain Fv by an intermolecular disulfide bond, or alternately, such chains may be cross-linked by chemicals such as glutaraldehyde.

(242) Preferably, the Fv is a single chain Fv.

(243) Single chain Fv's are prepared by constructing a structural gene comprising DNA sequences encoding the heavy chain variable and light chain variable domains connected by an oligonucleotide encoding a peptide linker. The structural gene is inserted into an expression vector, which is subsequently introduced into a host cell such as E. coli. The recombinant host cells synthesize a single polypeptide chain with a linker peptide bridging the two variable domains. Ample guidance for producing single chain Fv's is provided in the literature of the art (for example, refer to: Whitlow and Filpula, 1991. Methods 2:97-105; Bird et al., 1988. Science 242:423-426; Pack et al., 1993. Bio/Technology 11:1271-77; and Ladner et al., U.S. Pat. No. 4,946,778).

(244) Isolated complementarity determining region peptides can be obtained by constructing genes encoding the complementarity determining region of an antibody of interest. Such genes may be prepared, for example, by RT-PCR of mRNA of an antibody-producing cell. Ample guidance for practicing such methods is provided in the literature of the art (for example, refer to Larrick and Fry, 1991. Methods 2:106-10).

(245) It will be appreciated that for human therapy or diagnostics, humanized antibodies are preferably used. Humanized forms of non human (e.g., murine) antibodies are genetically engineered chimeric antibodies or antibody fragments having-preferably minimal-portions derived from non human antibodies. Humanized antibodies include antibodies in which complementary determining regions of a human antibody (recipient antibody) are replaced by residues from a complementarity determining region of a non human species (donor antibody) such as mouse, rat or rabbit having the desired functionality. In some instances, Fv framework residues of the human antibody are replaced by corresponding non human residues.

(246) Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported complementarity determining region or framework sequences.

(247) In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the complementarity determining regions correspond to those of a non human antibody and all, or substantially all, of the framework regions correspond to those of a relevant human consensus sequence.

(248) Humanized antibodies optimally also include at least a portion of an antibody constant region, such as an Fc region, typically derived from a human antibody (see, for example, Jones et al., 1986. Nature 321:522-525; Riechmann et al., 1988. Nature 332:323-329; and Presta, 1992. Curr. Op. Struct. Biol. 2:593-596).

(249) Methods for humanizing non human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non human. These non human amino acid residues are often referred to as imported residues which are typically taken from an imported variable domain. Humanization can be essentially performed as described (see, for example: Jones et al., 1986. Nature 321:522-525; Riechmann et al., 1988. Nature 332:323-327; Verhoeyen et al., 1988. Science 239:1534-1536; U.S. Pat. No. 4,816,567) by substituting human complementarity determining regions with corresponding rodent complementarity determining regions.

(250) Accordingly, such humanized antibodies are chimeric antibodies, wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non human species. In practice, humanized antibodies may be typically human antibodies in which some complementarity determining region residues and possibly some framework residues are substituted by residues from analogous sites in rodent antibodies.

(251) Human antibodies can also be produced using various techniques known in the art, including phage display libraries [see, for example, Hoogenboom and Winter, 1991. J. Mol. Biol. 227:381; Marks et al., 1991. J. Mol. Biol. 222:581; Cole et al., “Monoclonal Antibodies and Cancer Therapy”, Alan R. Liss, pp. 77 (1985); Boerner et al., 1991. J. Immunol. 147:86-95). Humanized antibodies can also be made by introducing sequences encoding human immunoglobulin loci into transgenic animals, e.g., into mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon antigenic challenge, human antibody production is observed in such animals which closely resembles that seen in humans in all respects, including gene rearrangement, chain assembly, and antibody repertoire. Ample guidance for practicing such an approach is provided in the literature of the art (for example, refer to: U.S. Pat. Nos. 5,545,807, 5,545,806, 5,569,825, 5,625,126, 5,633,425, and 5,661,016; Marks et al., 1992. Bio/Technology 10:779-783; Lonberg et al., 1994. Nature 368:856-859; Morrison, 1994. Nature 368:812-13; Fishwild et al., 1996. Nature Biotechnology 14:845-51; Neuberger, 1996. Nature Biotechnology 14:826; Lonberg and Huszar, 1995. Intern. Rev. Immunol. 13:65-93).

(252) It will be appreciated that targeting of particular compartment within the cell can be achieved using intracellular antibodies (also known as “intrabodies”). These are essentially SCA to which intracellular localization signals have been added (e.g., ER, mitochondrial, nuclear, cytoplasmic). This technology has been successfully applied in the art (for review, see Richardson and Marasco, 1995, TIBTECH vol. 13). Intrabodies have been shown to virtually eliminate the expression of otherwise abundant cell surface receptors and to inhibit a protein function within a cell (See, for example, Richardson et al., 1995, Proc. Natl. Acad. Sci. USA 92: 3137-3141; Deshane et al., 1994, Gene Ther. 1: 332-337; Marasco et al., 1998 Human Gene Ther 9: 1627-42; Shaheen et al., 1996 J. Virol. 70: 3392-400; Werge, T. M. et al., 1990, FEBS Letters 274:193-198; Carlson, J. R. 1993 Proc. Natl. Acad. Sci. USA 90:7427-7428; Biocca, S. et al., 1994, Bio/Technology 12: 396-399; Chen, S-Y. et al., 1994, Human Gene Therapy 5:595-601; Duan, L et al., 1994, Proc. Natl. Acad. Sci. USA 91:5075-5079; Chen, S-Y. et al., 1994, Proc. Natl. Acad. Sci. USA 91:5932-5936; Beerli, R. R. et al., 1994, J. Biol. Chem. 269:23931-23936; Mhashilkar, A. M. et al., 1995, EMBO J. 14:1542-1551; PCT Publication No. WO 94/02610 by Marasco et al.; and PCT Publication No. WO 95/03832 by Duan et al.).

(253) To prepare an intracellular antibody expression vector, the cDNA encoding the antibody light and heavy chains specific for the target protein of interest are isolated, typically from a hybridoma that secretes a monoclonal antibody specific for the marker. Hybridomas secreting anti-marker monoclonal antibodies, or recombinant monoclonal antibodies, can be prepared using methods known in the art. Once a monoclonal antibody specific for the marker protein is identified (e.g., either a hybridoma-derived monoclonal antibody or a recombinant antibody from a combinatorial library), DNAs encoding the light and heavy chains of the monoclonal antibody are isolated by standard molecular biology techniques. For hybridoma derived antibodies, light and heavy chain cDNAs can be obtained, for example, by PCR amplification or cDNA library screening. For recombinant antibodies, such as from a phage display library, cDNA encoding the light and heavy chains can be recovered from the display package (e.g., phage) isolated during the library screening process and the nucleotide sequences of antibody light and heavy chain genes are determined. For example, many such sequences are disclosed in Kabat, E. A., et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242 and in the “Vbase” human germline sequence database. Once obtained, the antibody light and heavy chain sequences are cloned into a recombinant expression vector using standard methods.

(254) For cytoplasmic expression of the light and heavy chains, the nucleotide sequences encoding the hydrophobic leaders of the light and heavy chains are removed. An intracellular antibody expression vector can encode an intracellular antibody in one of several different forms. For example, in one embodiment, the vector encodes full-length antibody light and heavy chains such that a full-length antibody is expressed intracellularly. In another embodiment, the vector encodes a full-length light chain but only the VH/CH1 region of the heavy chain such that a Fab fragment is expressed intracellularly. In another embodiment, the vector encodes a single chain antibody (scFv) wherein the variable regions of the light and heavy chains are linked by a flexible peptide linker [e.g., (Gly.sub.4Ser).sub.3 and expressed as a single chain molecule. To inhibit marker activity in a cell, the expression vector encoding the intracellular antibody is introduced into the cell by standard transfection methods, as discussed hereinbefore.

(255) Once antibodies are obtained, they may be tested for activity, for example via ELISA.

(256) The antibody of some embodiments of the invention is used for therapeutic purposes, e.g., the antibody which is used as a TNF-alpha inhibitor.

(257) Additionally or alternatively, several detection methods (e.g., protein detection methods) which are encompassed by some embodiments of the invention employ the use of antibodies (e.g., antibodies for diagnostic, identification and/or classification purposes).

(258) According some embodiments of the invention, the antibody is conjugated to a functional moiety (also referred to as an “immunoconjugate”) such as a detectable or a therapeutic moiety. The immunoconjugate molecule can be an isolated molecule such as a soluble and/or a synthetic molecule.

(259) Various types of detectable or reporter moieties may be conjugated to the antibody of the invention. These include, but not are limited to, a radioactive isotope (such as .sup.[125]iodine), a phosphorescent chemical, a chemiluminescent chemical, a fluorescent chemical (fluorophore), an enzyme, a fluorescent polypeptide, an affinity tag, and molecules (contrast agents) detectable by Positron Emission Tomography (PET) or Magnetic Resonance Imaging (MRI).

(260) Examples of suitable fluorophores include, but are not limited to, phycoerythrin (PE), fluorescein isothiocyanate (FITC), Cy-chrome, rhodamine, green fluorescent protein (GFP), blue fluorescent protein (BFP), Texas red, PE-Cy5, and the like. For additional guidance regarding fluorophore selection, methods of linking fluorophores to various types of molecules see Richard P. Haugland, “Molecular Probes: Handbook of Fluorescent Probes and Research Chemicals 1992-1994”, 5th ed., Molecular Probes, Inc. (1994); U.S. Pat. No. 6,037,137 to Oncoimmunin Inc.; Hermanson, “Bioconjugate Techniques”, Academic Press New York, N.Y. (1995); Kay M. et al., 1995. Biochemistry 34:293; Stubbs et al., 1996. Biochemistry 35:937; Gakamsky D. el al., “Evaluating Receptor Stoichiometry by Fluorescence Resonance Energy Transfer,” in “Receptors: A Practical Approach,” 2nd ed., Stanford C. and Horton R. (eds.), Oxford University Press, U K. (2001); U.S. Pat. No. 6,350,466 to Targesome, Inc.]. Fluorescence detection methods which can be used to detect the antibody when conjugated to a fluorescent detectable moiety include, for example, fluorescence activated flow cytometry (FACS), immunofluorescence confocal microscopy, fluorescence in-situ hybridization (FISH) and fluorescence resonance energy transfer (FRET).

(261) Numerous types of enzymes may be attached to the antibody of the invention [e.g., horseradish peroxidase (HPR), beta-galactosidase, and alkaline phosphatase (AP)] and detection of enzyme-conjugated antibodies can be performed using ELISA (e.g., in solution), enzyme-linked immunohistochemical assay (e.g., in a fixed tissue), enzyme-linked chemiluminescence assay (e.g., in an electrophoretically separated protein mixture) or other methods known in the art [see e.g., Khatkhatay M I. and Desai M., 1999. J Immunoassay 20:151-83; Wisdom G B., 1994. Methods Mol Biol. 32:433-40; Ishikawa E. et al., 1983. J Immunoassay 4:209-327; Oellerich M., 1980. J Clin Chem Clin Biochem. 18:197-208; Schuurs A H. and van Weemen B K., 1980. J Immunoassay 1:229-49).

(262) The affinity tag (or a member of a binding pair) can be an antigen identifiable by a corresponding antibody [e.g., digoxigenin (DIG) which is identified by an anti-DIG antibody) or a molecule having a high affinity towards the tag [e.g., streptavidin and biotin]. The antibody or the molecule which binds the affinity tag can be fluorescently labeled or conjugated to enzyme as described above.

(263) Various methods, widely practiced in the art, may be employed to attach a streptavidin or biotin molecule to the antibody of the invention. For example, a biotin molecule may be attached to the antibody of the invention via the recognition sequence of a biotin protein ligase (e.g., BirA) as described in the Examples section which follows and in Denkberg, G. et al., 2000. Eur. J. Immunol. 30:3522-3532.

(264) Alternatively, a streptavidin molecule may be attached to an antibody fragment, such as a single chain Fv, essentially as described in Cloutier S M. et al., 2000. Molecular Immunology 37:1067-1077; Dubel S. et al., 1995. J Immunol Methods 178:201; Huston J S. et al., 1991. Methods in Enzymology 203:46; Kipriyanov S M. et al., 1995. Hum Antibodies Hybridomas 6:93; Kipriyanov S M. et al., 1996. Protein Engineering 9:203; Pearce L A. el al., 1997. Biochem Molec Biol Intl 42:1179-1188).

(265) Functional moieties, such as fluorophores, conjugated to streptavidin are commercially available from essentially all major suppliers of immunofluorescence flow cytometry reagents (for example, Pharmingen or Becton-Dickinson).

(266) According to some embodiments of the invention, biotin conjugated antibodies are bound to a streptavidin molecule to form a multivalent composition (e.g., a dimmer or tetramer form of the antibody).

(267) Table 5 provides non-limiting examples of identifiable moieties which can be conjugated to the antibody of the invention.

(268) TABLE-US-00006 TABLE 5 Table 5. Amino Acid Nucleic Acid sequence sequence Identifiable (GenBank SEQ ID (GenBank SEQ ID Moiety Accession No.) NO: Accession No.) NO: Green AAL33912 69 AF435427 78 Fluorescent protein Alkaline AAK73766 70 AY042185 79 phosphatase Peroxidase CAA00083 71 A00740 80 Histidine tag Amino acids 72 Nucleotides 81 264-269 of 790-807 of GenBank GenBank Accession No. Accession No. AAK09208 AF329457 Myc tag Amino acids 73 Nucleotides 82 273-283 of 817-849 of GenBank GenBank Accession No. Accession No. AAK09208 AF329457 Biotin lygase LHHILDAQKM 74 — — tag VWNHR/ orange AAL33917 75 AF435432 83 fluorescent protein Beta ACH42114 76 EU626139 84 galactosidase Streptavidin AAM49066 77 AF283893 16

(269) As used herein the term “about” refers to ±10%.

(270) The terms “comprises”, “comprising”, “includes”, “including”, “having” and their conjugates mean “including but not limited to”.

(271) The term “consisting of” means “including and limited to”.

(272) The term “consisting essentially of” means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.

(273) As used herein, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a compound” or “at least one compound” may include a plurality of compounds, including mixtures thereof.

(274) Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

(275) Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging/ranges between” a first indicate number and a second indicate number and “ranging/ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.

(276) As used herein the term “method” refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.

(277) When reference is made to particular sequence listings, such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.

(278) It is understood that any Sequence Identification Number (SEQ ID NO) disclosed in the instant application can refer to either a DNA sequence or a RNA sequence, depending on the context where that SEQ ID NO is mentioned, even if that SEQ ID NO is expressed only in a DNA sequence format or a RNA sequence format. For example, SEQ ID NO: 37 is expressed in a DNA sequence format (e.g., reciting T for thymine), but it can refer to either a DNA sequence that corresponds to a CD68 nucleic acid sequence, or the RNA sequence of an RNA molecule nucleic acid sequence. Similarly, though some sequences are expressed in a RNA sequence format (e.g., reciting U for uracil), depending on the actual type of molecule being described, it can refer to either the sequence of a RNA molecule comprising a dsRNA, or the sequence of a DNA molecule that corresponds to the RNA sequence shown. In any event, both DNA and RNA molecules having the sequences disclosed with any substitutes are envisioned.

(279) It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

(280) Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.

EXAMPLES

(281) Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion.

(282) Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, “Molecular Cloning: A laboratory Manual” Sambrook et al., (1989); “Current Protocols in Molecular Biology” Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., “Current Protocols in Molecular Biology”, John Wiley and Sons, Baltimore, Md. (1989); Perbal, “A Practical Guide to Molecular Cloning”, John Wiley & Sons, New York (1988); Watson et al., “Recombinant DNA”, Scientific American Books, New York; Birren et al. (eds) “Genome Analysis: A Laboratory Manual Series”, Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; “Cell Biology: A Laboratory Handbook”, Volumes I-III Cellis, J. E., ed. (1994); “Current Protocols in Immunology” Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), “Basic and Clinical Immunology” (8th Edition), Appleton & Lange, Norwalk, Conn. (1994); Mishell and Shiigi (eds), “Selected Methods in Cellular Immunology”, W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; “Oligonucleotide Synthesis” Gait, M. J., ed. (1984); “Nucleic Acid Hybridization” Hames, B. D., and Higgins S. J., eds. (1985); “Transcription and Translation” Hames, B. D., and Higgins S. J., Eds. (1984); “Animal Cell Culture” Freshney, R. I., ed. (1986); “Immobilized Cells and Enzymes” IRL Press, (1986); “A Practical Guide to Molecular Cloning” Perbal, B., (1984) and “Methods in Enzymology” Vol. 1-317, Academic Press; “PCR Protocols: A Guide To Methods And Applications”, Academic Press, San Diego, Calif. (1990); Marshak et al., “Strategies for Protein Purification and Characterization—A Laboratory Course Manual” CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.

General Materials and Experimental Methods

(283) All analyses were performed in the R statistical software (www(dot)r-project(dot)org), using additional packages available from the Bioconductor project (www(dot)bioconductor(dot)org).

(284) Cell Type Expression Pattern of Predictive Gene Signatures—

(285) CEL files of sorted cell type samples from IRIS (GSE22886, (34)) and the Human body index (GSE7307) were downloaded from GEO, and normalized separately using frma. In GSE7307, the present inventors then extracted the profiles from all immune cells (10 profiles from monocyte, T cell and B cell lineages) and colon tissues (2 profiles). The present inventors then created a combined gene expression matrix, correcting for batch (dataset) effect using Combat. Previously reported gene signatures were collected as lists of gene symbols from their associated original publications or patent application as detailed in Table 6. Symbols were mapped to the genes assayed on platform HGU133A using Bioconductor symbol and alias mappings available in the hgu133plus2.db annotation package.

(286) Gene Expression Datasets—

(287) Normalized gene expression data for datasets GSE12251, GSE14580 and GSE16879 were downloaded from GEO using the GEOquery package. In each dataset the present inventors selected the relevant subset of baseline samples as described in Table 7, each forming a separate discovery cohort.

(288) Deconvolution Analysis—

(289) Given the total gene expression profile of a sample, gene expression deconvolution methods use prior knowledge obtained from sorted cells, e.g., as basis expression profiles or marker gene lists, to estimate the respective contribution of distinct cell types (18). In this work the present inventors used the basis signature and method developed in (26), which returns estimates for 17 immune cell types. The present inventors used the implementation available from the CellMix package (35).

(290) Meta-Analysis of Cell Type Proportions—

(291) Cell type proportion differences estimated in multiple cohorts were integrated in a meta-analysis. First cell type proportions were log 2-transformed and compared between responders and non-responders within each cohort using Wilcoxon rank sum test. Then nominal p-values were combined using Fisher combined probability test, which was corrected using Benjamini and Hochberg FDR correction. Cell types having nominal p-values<=0.05 in at least 2 cohorts and a combined FDR<=0.01 were selected for further analysis.

(292) Patients in the Validation Cohort—

(293) Archival slides from 23 patients with an established diagnosis of IBD (13 Crohn's Disease, 7 Ulcerative Colitis, 3 IBDU) from the gastroenterology department of Rambam Health Care Campus were included in this analysis. Responsiveness to anti-TNF treatment was assessed based on parameters such as: abdominal pain, bowel consistency and frequency, blood in stool, nausea/vomiting, constitutional symptoms, extracolonic manifestations, presence of abdominal mass, blood inflammatory markers, and colonic biopsy results. Patients were classified retrospectively as anti-TNF responders when they experienced clinical and/or mucosal improvement within 8 weeks after treatment initiation. Other data collected includes age, gender, disease state when biopsy was taken, disease-related surgery, co-morbidities and medications. A summary of these data is shown in Table 6.

(294) Biopsy Collection in the Validation Cohort—

(295) Colonic biopsies were collected from the patients during flexible sigmoidoscopy or full colonoscopy before their first anti-TNF treatment. Biopsies were taken from inflamed and/or uninflamed areas of the intestine ascending/transverse/descending colon and placed into formalin.

(296) Immuno-Histochemistry Quantification—

(297) Formalin-fixed slides of paraffin-embedded colon tissues, sectioned at 4 μm, were immunostained for the expression of plasma cells (CD138+). The slides were deparaffinized in Xylene (twice, 3 minutes each time) and rehydrated in gradually decreasing concentrations of EtOH (100% EtOH×2, 95%, 85%, 70% and running water). 0.01 M sodium citrate buffer pH 6.0 was used to heat-induced epitope retrieval before incubation with antibody. Slides were immersed in the buffer and heated in a microwave for 20 minutes. The slides were rinsed in cool running water, washed in PBS with 0.1% Tween solution, and blocked in 10% goat serum. Then, they were incubated with CD138 primary monoclonal antibody in 4° C. overnight (obtained from Serotec, clone B-A38, dilution 1:250). For detection, the Polink-1 HRP Broad Spectrum DAB Detection Kit (GBI labs) was used.

(298) Staining Data Analysis—

(299) Two scoring methods were used for the analysis of stain biopsies: Slides were coded and interpreted blindly by a specialist pathologist. A “plasma cell abundance” subjective score between 0-3 was determined by the pathologist (minimal amount of plasma cells was scored as “0”, the highest abundance which have seen within all slides was scored as “3”), and the tissues were scored one by one.

(300) Slides were scanned in automatic digital slide scanner, and evaluated in Image-Pro Plus 6.0 software. 4 high stained fields were chosen randomly in each patient slide, and Brown color of DAB CD138+ cells was tested. Each field CD138+ staining value was divided by the same field whole tissue staining. Average of those 4 fields is presented.

(301) Clinical Evaluation of Patients:

(302) The clinical state of the patients was evaluated using the Harvey Bradshaw Index (HBI) at each visit. Clinical state was defined as either remission, mild disease, moderate disease, or severe disease based on the HBI score definition. Subjects were defined as clinical responders if clinical state improved or remained at remission during all visits.

(303) Biomarker Response—

(304) Evaluated biomarkers were serum C-reactive protein (CRP) and fecal calprotectin. Previous studies have shown that fecal calprotectin levels are highly correlated with disease severity. Due to low subject compliance with handling fecal material, the fecal calprotectin could not be obtained on all visits from all subjects. The determination of responders or non-responders was performed using the following guidelines:

(305) (1) Subjects who had at least 2 fecal calprotectin samples taken at least 1 week apart were considered responders when at least a 50% reduction in levels was demonstrated in the second sample retrieved from the feces of the subject.

(306) (2) Subjects who stably remained at normal levels of fecal calprotectin (≤50 mg/gram of feces) at all visits, regardless of serum CRP were considered responders.

(307) (3) Subjects with less than 2 samples of fecal calprotectin were considered responders when demonstrated at least a 50% reduction in serum CRP levels in a second blood sample taken at least a week after the first blood sample.

(308) (4) Subjects who exhibited normal levels of CRP (≤5 mg/dl) at all visits were considered responders.

(309) Steroid Dependence—

(310) The persistent need of concurrent steroid therapy is a valuable marker of disease state and of response to therapy. Subjects, who were receiving steroid therapy at the clinic visit at the 14.sup.th week of treatment (“14-week”) were considered non-responders.

(311) Immunogenic Status—

(312) Subjects who had measurable serum antibodies to Infliximab at their week 14-week visit were considered non-responders.

(313) Study Response Algorithm—

(314) The present inventors have formulated a decision algorithm to conclude whether a subject is responsive or not to therapy. The algorithm is mainly based on the primary gastroenterologist following the subject. For each subject on the 14-week visit the physician, after reviewing the subjects' records, decides whether the subject responded to therapy, failed or if it is still indeterminate. For the latter (indeterminate), a decision tree is performed with the following steps: a definition of failure is set when steroid treatment is given at 14-week visit. If no steroids are given the next step is to test the biomarker dynamics. A substantial reduction in fecal calprotectin is defined as response. If fecal calprotectin is not available, a reduction in serum CRP (as defined previously) is considered a response to treatment. For subjects who are not steroid-dependent and show no substantial biomarker dynamics, a physician decision on week 26 is made to determine the response status.

Example 1

Previously Reported Gene Signatures Indicate Immune-Driven Signal

(315) The present inventors have hypothesized that there is a baseline immune cellular signature of response to anti-TNF therapy, and accordingly, expected that at least part of previously predictive gene signatures detected by previous studies was indeed capturing an immune-driven signal, through genes that are more highly expressed by some immune cell subsets. To test this hypothesis, genes belonging to 7 gene signatures (i.e. gene sets) that were identified in studies of baseline response to anti-TNF in biopsies (6) or blood (1) (Table 6 below) have been considered. Most biopsy signatures (UC_A, UC_B, UC_AB, CDc and UC_B_knn) were originally defined based on the comparison of gene expression profiles between responders and non-responders to Infliximab treatment in UC and CD cohorts generated by two studies (4, 5). Signatures UC_A and UC_B were on two independent cohorts of UC patients (cohort A and B) from the top 20 differentially expressed genes; UC_AB was defined as the overlap between all differentially expressed genes in these two studies (53 genes) (4); Signature UC_B_knn was derived from UC cohort B using a different methodology based on k-nearest-neighbor classifier (20); The IRRAT signature (Injury-Repair Response Associated Transcripts) was defined in a kidney transplant study (21), but was subsequently found to correlate well with anti-TNF response at baseline in one of the above UC cohort (22); Signatures CDc and CD_blood were identified in CD patients from colon biopsies (5) and blood samples (PBMCs) respectively, the later using an iterative multivariate classification algorithm (13).

(316) TABLE-US-00007 TABLE 6 Table 6: Previously proposed gene signatures of baseline response to anti-TNF. N Datasets Disease/Tissue Reference UC_A 20 GSE14580 UC/Colon Arijs et al. (2009) Gut. 2009; 58(12): 1612-9. Pubmed: 19700435 UC_B 20 GSE12251 UC/Colon Arijs et al. (2009) Gut. 2009; 58(12): 1612-9. Pubmed: 19700435 UC_B_knn 19 GSE12251 UC/Colon www(dot)faqs(dot)org/patents/app/ 20100069256 UC_AB 53 GSE12251, UC/Colon Arijs et al. (2009) Gut. GSE14580 2009; 58(12): 1612-9. Pubmed: 19700435 CDc 20 GSE16879 CD/Colon Arijs et al. Inflamm Bowel Dis. 2010; 16(12): 2090-8. Pubmed: 20848504 IRRAT 29 GSE14580 UC/Colon Halloran et al. Inflamm Bowel Dis. 2014; 20(12): 2353-63 Pubmed: 25397893 CD_Blood 23 IBD Blood Mesko et al. Genome Med. 2013; 5(6): 59 Pubmed: 23809696 N: number of genes in each signature.

(317) The present inventors looked at the expression of all signature genes across a variety of sorted immune cell subsets and bulk colon tissue samples obtained from two public datasets of sorted cell expression profiles (FIG. 2A, see Methods). Cell types from common hematopoietic lineage clustered together, mainly within B cells, T cells and Monocytes, while genes clustered in distinct blocks according to these lineages.

(318) The association between each signature and each cell type was analyzed using a single sample enrichment analysis with GSVA (23) (FIG. 2B). Genes in the IRRAT signature were associated to subsets from the B cell lineage and neutrophils, while genes from CD_blood were associated to T cells. All other signatures were associated with monocytes. Hence overall most genes were more highly expressed by some immune cell subsets, rather than by colon tissues.

(319) Very few genes were more highly expressed in colon tissues, and of those, most were also highly expressed in some other immune cell subset, mainly from the B cell lineage and neutrophils. This could indicate the presence of resident or infiltrating leukocyte populations within these tissues.

Example 2

Meta-Analysis Identifies Consistent Cell Type Proportion Differences

(320) Meta-analysis of gene expression datasets has shown its ability to extract robust disease gene-based signatures by leveraging the biological and technical heterogeneity in data obtained from multiple sources to select genes that consistent and reproducible differences between two conditions (19, 24). This approach essentially consists of two steps: (1) a discovery phase that identifies features that are consistently different between two conditions in a set of discovery cohorts; and (2) a validation phase that assesses the ability of the selected features in classifying samples from an independent dataset. Here this methodology was applied in a novel way, by combining it with computational deconvolution techniques, to find robust cellular signatures that are predictive of anti-TNF response pre-treatment.

(321) First the present inventors looked in the GEO database (25) for datasets of biopsies from IBD patients that were naive to anti-TNF therapy, and selected those for which both pre-treatment expression profiles and response status were available (GSE12251, GSE14580 and GSE16879).

(322) Table 7 summarizes each dataset experimental design and relevant associated clinical data.

(323) TABLE-US-00008 TABLE 7 Table 7. Summary of the datasets and biopsy samples used in the meta-analysis. Discovery cohorts Dataset Cohort Samples* GSE14580 UC cohort A, colon biopsies,  8 R /16 NR pre-treatment GSE12251 UC cohort B, colon biopsies, 12 R/10 NR pre-treatment GSE16879 CD colon biopsies, 12 R/7 NR  pre-treatment Validation Rambam Hospital UC/CD/IBDU colon and  9 R/11 NR ileum biopsies *Responders (R)/Non-responders (NR).

(324) These datasets contain biopsy gene expression profiles generated from 2 cohorts of UC patients (Cohort UC-A and UC-B in GSE14580 and GSE12251 respectively), and 1 cohort of CD (CD-C) patients (GSE16879). They were designed for the discovery of genes that can predict, at baseline, if a patient is likely to respond to an anti-TNF treatment (Infliximab), and, indeed, resulted in most of the previously proposed gene signatures analyzed hereinabove (4, 5). As a matter of fact, dataset GSE16879 contains profiles from other samples such as ileum CD biopsies, for which the response criterion was not as stringent as for the other samples, and consequently did not lead to any signature of response in the original study (5); it also includes pre-treatment UC samples that are part of dataset GSE14580, which were used therein, as well as post-treatment profiles from the same CD and UC patients (8 weeks after therapy initiation). In the baseline analysis, however, only the pre-treatment CD colon samples were used, all other samples were not used. Hence in the following, each cohort is referred using its corresponding GEO id.

(325) Computational gene expression deconvolution methods can estimate the proportions of constituting cell types directly from heterogeneous samples (18). This is typically achieved using either sets of marker genes that are known to be expressed in a cell type-specific manner, or within a linear regression framework that jointly estimates all cell subset proportions—on each sample separately—from a reference compendium of sorted cell gene expression profiles (18). Using such a regression-based method (26), the present inventors estimated the proportion of 17 immune cell types in each sample, including most major cell subsets such as neutrophils, monocytes, B cell or T cell subpopulations in resting or activated state. Then, the estimated proportions of each cell type was compared between responders and non-responders, to identify candidate immune driver(s) of response. For robustness, the non-parametric Wilcoxon rank sum test was used, which is free of distributional assumption, and only cell types for which at least 75% of the samples had non-zero estimated proportions were considered. This analysis was performed initially in the CDc cohort (GSE16879), which revealed significant differences in activated monocytes and plasma cells, both showing higher proportions in non-responders (FIG. 2A). This same cohort was previously used to show that a predictive signature of 20 genes derived from UC patients was also able to perfectly discriminate responders and non-responders CD patients (5) (FIG. 3B). Having the estimated proportions of the two cell types that are the most associated with response enabled the present inventors to perform a second analysis to support the hypothesis of an immune based biomarkers of response. The total gene expression data was corrected for variation in activated monocytes and plasma cells, and the effect on the predictive power of the 20-genes signature was monitored. After correction, the classification accuracy dropped, suggesting that the gene signature indeed reflected, at least partially, a predictive variation in the proportions of these cell types (FIG. 3C). Notably, correcting for each cell type individually also lowered the signature's predictive power but not as much as when correcting for both (FIGS. 7A and 7B). Next, to strengthen the cell—based biomarker prediction, the present inventors repeated the analysis within each discovery cohort (FIG. 6). Significant differences were detected in activated monocytes which were lower in responders in all cohorts; plasma cells were lower in responders in 2 out 3 cohorts, including both UC and CD samples; finally, in either one of the cohorts, proportions of monocytes, activated dendritic cells, activated NK cells and CD8 T cells were higher in responders, while proportions of memory IgM B cells and neutrophils were higher in non-responders. Then, these differences were integrated across all cohorts in a meta-analysis, by combining p-values and selecting cell types that showed significant differences in at least 2 out of the 3 discovery cohorts (nominal p-value<=0.05) and a combined FDR≤0.01. This resulted in the selection of two cell subsets, activated monocytes and plasma cells, with responders having in both cases significantly lower proportions than non-responders (FIG. 4). In term of training set prediction power, separate ROC analysis within each cohort resulted in high mean accuracies of 90.3% and 77.8% Area Under the Curve (AUC) for activated monocytes and plasma cell proportions respectively (FIG. 8).

Validation of Cell Signatures by Staining in an Independent Set of Biopsies

(326) In order to validate these findings, the present inventors looked at an independent set of 20 IBD patients (11 responders, 9 non-responders to anti-TNF) for which paraffin embedded biopsies had been stored prior anti-TNF treatment initiation, as part of common standard patient monitoring protocol in IBD. The present inventors defined cell type abundance scores from the examination of immunostained slides, and assessed how their proportion could predict response to treatment via ROC curve and Area Under the Curve (AUC). Since macrophages and plasma cells were the present inventors' top hits, the present inventors set out to define a macrophage and plasma cells morphological abundance score (low/medium/high) based on visual identification by a pathologist. For macrophages, this did not discriminate well responders from non-responders (FIG. 10), but plasma cells gave a clearly distinguishable differences. To test these findings, the present inventors stained for plasma cells (CD138+), and used two scoring strategies: first, a pathologist was asked to score the staining for low/medium/high abundance, while blind to the response status. Second, the present inventors used the proportions obtained by automated pixel quantitation averaged over multiple randomly chosen regions (see Methods). The pathologist and automated quantitation scores achieved 72.2% and 83.3% accuracy respectively (FIG. 5A). Visually, non-responsive patients showed very clear increased staining for plasma cells compared to non-responsive patients (FIG. 5B).

(327) Tables 8A-B hereinbelow (Deconvolution basis signature), discloses raw data of the deconvolution estimation basis matrix. Table 9 herein below summarizes the results from the meta-analysis of the raw data.

(328) TABLE-US-00009 TABLE 8A Table 8A Deconvolution basis signature 5654 Adaptive immune cell subsets ENTREZ ID Symbol T CD4 T CD4 activated T CD8 T CD8 activated B cells 5292.9 104.6 191.29 41.553 671.33 83481 EPPK1 605.1 57.129 19.282 23.457 19.076 678 ZFP36L2 5213.9 625.69 860.42 267.09 1040.9 1710.6 222.72 147.83 79.293 319.04 4929 NR4A2 1407.8 247.46 19.61 143.09 50.766 1079.4 104.49 189.22 154.5 57.445 26289 AK5 1379.6 330.29 203.27 52.567 50.005 3707 ITPKB 9321.4 1863.7 1799 613.54 1615.5 6951 389.67 369.9 408.86 1149.1 9241 NOG 1205.8 216.29 175.73 61.715 163.99 3337 DNAJB1 4361.3 980.92 842.13 919.73 580.86 2935 GSPT1 3343.6 1173.4 661.92 751.8 737.37 14624 2674.3 1387.4 3255.3 5202 4929 NR4A2 1142.3 259.03 75.925 204.75 125.36 90139 TSPAN18 1948.2 400.21 234 129.54 353.61 146330 FBXL16 3811.3 1576.5 1403.5 697.89 732.34 678 ZFP36L2 3793.8 620.67 771.55 219.34 1023.5 112744 IL17F 75.661 9648.6 96.514 126.73 146.75 3605 IL17A 7.194 809.34 3.396 10.259 7.24 1493 CTLA4 1152.6 5171.8 644.65 1132.7 400.95 1493 CTLA4 456.17 1826.6 170.64 539.95 77.447 940 CD28 484.12 1102.4 350.46 347.35 148.4 51339 DACT1 276.97 664.71 99.844 95.204 207.63 50616 IL22 195.27 1621.9 140.2 272.41 182.77 143686 SESN3 848.53 1665.6 388.3 162.9 305.6 128553 TSHZ2 669.63 1663.3 288.41 312.36 171.51 145864 HAPLN3 1946.6 8728.1 1101.6 2305.8 594.52 30812 SOX8 298.04 1025 19.781 21.533 30.567 940 CD28 424.1 927.04 284.99 249.87 32.017 1493 CTLA4 829.63 2074.9 360.49 772.02 172.99 10320 IKZF1 585.01 1251.5 289.46 343.31 289.61 29968 PSAT1 346.27 2214.3 394.62 805.9 320.85 3578 IL9 97.274 1343.5 49.426 410.4 83.163 128553 TSHZ2 305.87 591.41 112.12 137.34 154.73 926 CD8B 41.855 32.983 1489.1 122.68 37.742 54674 LRRN3 735.62 503.37 6792.8 1198.6 62.117 925 CD8A 310.06 405.99 9957.8 3315.8 611.63 926 CD8B 138.63 177.5 5811.1 2622.3 115.71 54674 LRRN3 706.71 581.81 8644.5 2115.9 159.72 51676 ASB2 79.337 112.51 2639.9 92.7.9 38.727 9666 DZIP3 63.449 15.003 194.1 12.941 59.71 10730 YME1L1 246.02 176.44 613.76 234.81 24.22 85315 PAQR8 786.88 1044.9 2261.4 883.48 460.26 9402 GRAP2 102.7 186.89 569.46 181.94 24.59 2833 CXCR3 232.2 123.87 1592.3 282.94 73.401 3820 KLRB1 237.41 181.43 750.95 276.46 270.68 4676 NAP1L4 1095.9 1054.6 1961.3 1146 851.07 1731 1-Sep 1853.2 1078 3456.8 1540.5 1236.1 814 CAMK4 1278.2 978.5 2274.6 1265.9 238.29 57124 CD248 366.65 216.83 1028.2 288.42 329.16 116.38 108.86 526.68 257.03 74.15 283869 NPW 5.177 5.275 4.551 539.25 6.061 199953 TMEM201 192.86 235.07 220.53 3249.7 173.54 399694 SHC4 59.433 60.769 40.265 570.24 33.133 3976 LIF 31.201 1084.5 36.214 5823.8 25.66 23176 8-Sep 11.013 20.212 16.933 126.6 10.758 990 CDC6 93.088 194.93 220.38 1223.1 107.62 51010 EXOSC13 118.67 789.6 738.75 2638.3 174.02 1021 CDK6 3018.2 4621.4 3289.6 19509 2481.6 51293 CD320 144.21 273.65 232.18 1229.6 68.268 1503 CTPS1 233.48 828.46 608.83 2722.2 268.05 84319 CMSS1 844.34 1873.3 1306.2 6709.1 935.86 10622 POLR3G 111.28 129.25 80.188 499.74 110.15 199953 TMEM201 169.99 261.11 249.09 1122.7 140.65 1021 CDK6 1750.7 2549.3 1791.3 9645 1502.4 1841 DTYMK 108.09 195.01 278.64 1007.2 163.8 23464 GCAT 220.973 14.22 28.833 191.85 16.681 3336 HSPE1 844.06 2476.6 1665.5 7532.5 669.89 59.386 43.757 62.947 48.205 1755 971 CD72 58.037 36.506 120.52 81.1 2131.4 933 CD22 15.819 9.314 10.67 9.456 4220.4 163.92 86.114 48.873 16.798 1334.1 6328 SCN3A 9.889 14.549 3.845 5.263 722.63 84518 CNFN 17.525 20.474 15.638 15.914 223.47 8115 TCL1A 413.37 244.87 53.831 83.168 11712 29802 VPREB3 155.11 68.624 42.995 57.886 2850.9 79856 SNX22 47.638 48.233 40.53 35.855 607.56 115123 3-Mar 81.96 51.288 73.467 72.773 345.25 8115 TCL1A 641.02 399.85 114.45 76.966 13310 915.56 281.78 499.02 263.74 3325 221.07 128.11 19.172 32.89 1833 283663 LINC00926 726.74 166.83 123 126.47 23022 283663 LINC00926 692.64 453.05 520.19 392.15 13389 933 CD22 390.89 254.78 175.49 153.74 5953.5 55278 QRSL1 387.5 465.19 526.61 783.83 2643 94235 GNG8 53.579 611.56 23.299 184.36 51.681 23089 PEG10 46.498 31.167 66.482 18.336 253.9 7782 SLC30A4 743.61 680.67 534.2 492.15 1318.3 72.247 269.15 243.03 479.83 451.44 121.46 90.123 93.263 76.315 493.97 148932 MOB3C 879.19 2018.4 1343.5 1029.6 825.81 80237 ELL3 156.69 158.02 95.262 104.13 503.88 1184 CLCN5 757.15 676.29 495.2 584.13 623.52 653121 ZBTB8A 163.85 107.16 57.552 97.531 219.78 53.024 126.27 68.75 269.56 451.93 1184 CLCN5 155.94 162.89 109.18 181.57 159.9 94274 PPP1R14A 30.346 9.07 9.096 9.518 392.81 80237 ELL3 159.7 130.7 92.114 118.93 420.44 1490 CTGF 22.249 22.905 6.739 3.515 43.341 148932 MOB3C 588.25 1078.3 640.07 622.65 514.18 140733 MACROD2 210.22 110.16 58.043 68.735 3510.6 116449 CLNK 177.14 95.259 75.054 51.036 183.49 51237 MZB1 768.21 1072 205.82 123.61 2046.6 3514 IGKC 17.024 12.551 9.378 10.146 26.928 3537 IGLC1 27.368 28.913 16.45 26.404 135.1 476.89 528.5 108.54 42.032 957.48 81618 ITM2C 585.42 318.44 534.58 194.83 1031.8 51237 MZB1 506.82 307.29 21.088 21.828 1374.2 608 TNFRSF17 481.56 79.328 7.069 4.69 1187.8 669.73 445.68 99.639 82.5 1858 96610 BMS1P20 1159.5 1240.9 243.81 144.13 4950.9 132.76 183.85 15.044 25.193 757.95 51303 FKBP11 1010.8 1771.9 1287 1715.5 833.49 107.22 119.57 35.991 31.263 429.37 18.285 15.852 9.172 7.818 47.27 589.65 458.26 148.22 85.462 3392.6 79694 MANEA 87.389 192.19 113.36 190.16 109.12 28823 IGLV1-44 316.7 249.63 21.981 8.441 1613 857 CAV1 45.356 22.639 15.996 72.569 96.76 10316 NMUR1 16.485 10.581 10.655 9.429 23.474 2043 EPHA4 232.57 88.394 232.39 42.03 171.22 10079 ATP9A 11.562 14.731 6.817 9.387 12.617 9289 ADGRG1 450.23 46.85 680.21 378.36 273.85 2043 EPHA4 304.21 44.721 162.55 12.343 158.35 79901 CYBRD1 7.287 5.64 5.593 5.551 9.848 56.285 18.537 102.77 15.889 50.579 151742 PPM1L 264.55 96.483 257.25 150.53 209.8 81563 C1orf21 150.22 48.558 482.41 176.14 151.32 2619 GAS1 12.055 10.149 9.647 9.038 20.012 59338 PLEKHA1 2609.8 1355.1 1304.4 665.37 1768.9 2043 EPHA4 900.99 422.48 455.53 254.47 417.9 4068 SH2D1A 390.85 464.3 737.65 455.64 77.492 2043 EPHA4 634.35 162.79 615.75 128.7 195.17 2774 GNAL 85.932 63.9 41.075 28.466 74.428 5243 ABCB1 281.26 147.7 424.32 150.74 410.31 11098 PRSS23 337.78 158.02 147.29 189.44 245.58 127254 ERICH3 53.192 88.232 19.387 54.307 43.526 57489 ODF2L 402.52 524.06 396.31 137.76 355.88 57489 ODF2L 361.13 401.41 336.7 142.21 219.51 257019 FRMD3 304.9 315.32 121.07 156.3 292.62 10974 ADIRF 13.1 8.346 7.777 5.934 22.182 6672 SP100 301.3 711.82 491.39 248.45 889.83 64108 RTP4 156.03 1646.5 521.18 124.92 92.382 55603 FAM46A 209.46 254.63 56.082 30.957 262.27 54809 SAMD9 878.92 5053.9 3029.7 540.35 1463 257019 FRMD3 290.98 504.45 214.86 121.57 355.76 91624 NEXN 67.656 627 67.589 118.05 87.618 34.715 451.51 34.551 44.167 32.135 85363 TRIM5 177.65 345.55 336.22 108.71 330.94 50650 ARHGEF3 1839.8 2785.7 3143.2 928.31 802.1 100131733 USP30-AS1 321.04 662.29 499.97 368.98 350.57 190.68 1376.2 626.48 604.37 248.31 2635 GBP3 704.07 2327.8 2251.5 1177 507.74 5654 HTRA1 298.66 211.29 129.67 158.13 244.18 2048 EPHB2 18.128 14.747 13.441 10.721 22.435 10461 MERTK 170.5 109.41 114.19 123.07 217.36 4048 LTA4H 2762.8 3065.3 1893.5 2088.7 5716.5 2048 EPHB2 30.863 44.763 17.499 32.405 59.756 10461 MERTK 190.69 107.8 58.619 53.798 117.56 340526 RGAG4 78.208 111.4 61.529 63.163 103.33 284013 VMO1 34.258 39.726 11.115 11.268 16.153 120939 TMEM52B 47.859 43.294 34.943 30.558 36.092 408 ARRB1 34.25 29.224 38.111 72.62 31.272 2048 EPHB2 197.37 142.57 136.13 141.82 204.37 2517 FUCA1 242.55 302.08 495.6 216.27 440.56 170.59 108.76 126.74 100.47 271.42 2335 FN1 26.448 27.259 17.197 26.945 30.48 11326 VSIG4 233 137.81 120.47 81.189 213.86 2335 FN1 70.789 23.169 29.882 44.304 59.421 51063 CALHM2 314.56 124.06 776.91 70.875 230.96 55244 SLC47A1 18.184 27.079 14.001 17.424 21.488 2162 F13A1 289.19 154.99 124.88 105.2 313.25 10462 CLEC10A 117.66 77.553 54.795 58.318 113.97 246 ALOX15 10.612 25.339 6.831 6.378 13.36 23475 QPRT 22.06 16.746 54.589 25.22 24.631 154092 LINC01010 40.498 30.122 31.198 25.411 32.529 23017 FAIM2 53.577 29.106 14.683 16.222 41.65 79839 CCDC102B 13.112 8.355 4.523 5.864 5.023 5445 PON2 153.68 113.96 189.29 208.72 203.37 30835 CD209 220.38 169.13 83.777 91.853 207.13 51477 ISYNA1 285.49 212.26 179.91 183.44 292.53 30835 CD209 106.67 65.52 19.824 18.065 59.958 2878 GPX3 207.97 169.7 117.12 135.49 237.29 2878 GPX3 202.77 174.29 157.95 111.93 261.65 5445 PON2 142.99 90.515 112.25 122 90.488 56670 SUCNR1 181.08 728.19 164.8 113.29 340.37 30850 CDR2L 14.937 10.283 11.864 17.984 14.459 11067 C10orf10 37.582 61.905 18.124 17.372 28.084 6624 FSCN1 21.011 314.03 33.576 161.6 16.286 54662 TBC1D13 76.209 49.734 69.905 50.81 70.849 101930114 LOC101930114 333.43 340.39 283.22 277.53 237.07 5157 PDGFRL 36.427 9.53 14.258 12.599 34.964 3429 IFI27 162.25 912.04 119.25 65.958 75.112 78.773 668.53 20.265 24.835 25.86 80045 GPR157 1127.6 936.33 442.99 373.89 792.28 80380 PDCD1LG2 37.157 39.408 26.364 31.244 35.784 11067 C10orf10 86.486 66.895 25.297 43.289 87.619 8820 HESX1 15.962 20.309 9.002 16.894 20.791 6624 FSCN1 20.332 566.4 33.336 168.56 71.603 11167 FSTL1 192.12 120.83 113.92 109.45 195.78 54662 TBC1D13 624.15 537.35 501.78 399.81 665.39 9175 MAP3K13 6.504 4.804 3.886 3.113 5.906 3357 HTR2B 34.96 28.74 11.051 3.945 26.466 94015 TTYH2 607.39 287.84 245.13 104.92 237.65 56300 IL36G 91.241 91.419 44.993 41.394 72.339 3036 HAS1 83.836 49.02 39.758 51.693 82.304 7980 TFPI2 15.299 25.449 6.514 7.562 15.212 11009 IL24 85.352 83.076 38.318 38.162 251.23 4312 MMP1 9.388 26.327 2.994 3.6 8.573 7980 TFPI2 25.095 20.044 10.747 5.447 35.849 1440 CSF3 18.01 24.088 13.039 11.862 29.41 3569 IL6 207.34 440.66 94.669 75.292 320.72 4233 MET 11.918 12.065 5.665 56.352 11.912 169792 GLIS3 51.725 42.231 9.847 76.931 13.202 51334 PRR16 11.96 4.882 2.492 0.985 3.236 6374 CXCL5 31.673 28.613 23.431 24.093 36.395 6660 SOX5 9.836 7.861 7.661 6.475 29.154 79931 TNIP3 30.483 496.06 87 200.55 28.186 8710 SERPINB7 31.11 25.351 15.255 11.639 31.797 3690 ITGB3 77.937 52.599 25.61 12.752 87.344 5743 PTGS2 75.522 58.612 20.681 22.695 16.161 8794 TNFRSF10C 24.745 17.582 11.933 10.705 16.047 53829 P2RY13 20.207 15.818 7.568 6.407 29.631 4311 MME 52.68 35.537 27.734 32.273 47.653 146225 CMTM2 404.54 263.4 375.27 305.18 320.72 8794 TNFRSF10C 176.1 142.03 83.535 142.24 49.475 8794 TNFRSF10C 122.04 82.36 80.849 72.071 101.24 6286 S100P 341.03 96.34 29.987 26.748 230.68 3577 CXCR1 55.571 34.928 30.255 30.118 51.796 60675 PROK2 25.175 26.004 158.35 155.29 82.893 54682 MANSC1 75.87 57.915 31.179 33.702 98.717 144423 GLT1D1 48.013 28.57 27.015 34.934 109.92 3579 CXCR2 48.606 7.934 13.365 4.607 34.921 25984 KRT23 21.721 25.964 13.516 29.433 77.001 2215 FCGR3B 420.69 197.38 238.39 130.46 284.33 4311 MME 21.906 20.104 7.349 5.374 33.004 79908 BTNL8 18.42 11.019 9.26 19.771 28.565 86.434 63.098 71.649 52.289 87.488 1854.5 61.454 48.362 44.29 999.91 80201 HKDC1 442.35 35.677 47.464 21.902 45.899 297.62 19.749 6.99 17.411 66.318 3572 IL6ST 500.94 54.356 55.673 34.638 18.455 6711 SPTBN1 1419.8 51.589 46.397 44.595 332.99 6920 TCEA3 1084.5 225.21 238.7 62.339 68.575 1279.9 295.26 403.78 149.61 92.396 26119 LDLRAP1 2504.4 344.2 835.09 62.217 197.35 2596.8 466.59 585.78 390.5 474.34 3562 IL3 11.796 382.21 7.019 134.51 10.679 50616 IL22 51.201 3661.6 26.909 880.39 42.27 64788 LMF1 1219.7 1270.8 138.68 191.49 111.82 1125 2341.9 195.23 381.74 356.46 959 CD40LG 492.38 838.31 67.853 167.51 104.76 50943 FOXP3 322.53 1418.7 167.46 635.89 89.541 54602 NDFIP2 562.06 2564.1 486.91 2284.5 335.08 1493 CTLA4 1240.2 4434.9 489.94 1618.8 53.729 55423 SIRPG 1279.7 344.58 1870.4 377.07 176.03 917 CD3G 2246.6 916.04 3622.2 876.21 201.71 10663 CXCR6 147.04 969.58 1662.6 350.63 135.37 3090 HIC1 37.26 320.67 1359.6 1251.4 43.644 27240 SIT1 823.62 686.41 2063 786.65 1305.4 51676 ASB2 380.33 402.91 2482.4 1135.9 242.59 91978 TPGS1 147.3 83.667 652.05 427.54 76.829 28755 TRAC 9535.5 4889.7 11371 4324.1 989.81 3932 LCK 4328.6 1960.6 5769.7 2096.1 582.59 79413 ZBED2 153.9 3485.5 158.99 5721.5 244.85 993 CDC25A 13.246 24.781 88.757 868.1 16.454 151230 KLHL23 60.364 94.954 220.96 1774.3 72.694 29128 UHRF1 236.33 1119.1 3816.9 11233 321.11 233.92 290.59 813.35 3551 308.18 29089 UBE2T 174.69 798.98 1705.3 6581 117.92 3070 HELLS 47.141 87.792 454.04 1303.1 93.846 8438 RAD54L 37.236 27.188 174 529.88 29.891 3070 HELLS 284.84 423.31 1327.9 3798.5 346.27 10563 CXCL13 19.513 1354.7 29.476 1874.5 18.396 79075 DSCC1 41.096 98.875 266.43 1054.4 34.983 4049 LTA 36.869 2186 19.704 2896.6 23.214 10328 EMC8 27.346 73.761 32.207 695.77 25.677 84824 FCRLA 130.31 41.849 42.774 32.087 3782.4 668.07 294.22 50.476 56.156 21387 3899 AFF3 533.25 92.106 343.14 118.34 9753.7 55024 BANK1 131.67 62.309 17.332 13.043 5063.1 931 MS4A1 756 462.64 129.79 55.3 13482 743.39 815.94 246.9 284.77 15139 931 MS4A1 909.27 610.61 159.55 92.926 15292 199786 FAM129C 1149.9 781.16 583.52 548.37 15403 115350 FCRL1 416.95 132.19 110.29 114.67 10113 415.85 176.56 284.27 153.54 7089.1 931 MS4A1 291.55 183.21 166.4 186.99 8517.3 931 MS4A1 1316.4 1018.6 104.4 58.217 33100 53335 BCL11A 338.58 370.66 69.794 59.023 13141 26040 SETBP1 164.27 180.62 200.7 219.58 1157 53335 BCL11A 138.73 133.94 25.675 41.093 2742.6 41.785 67.193 9.726 5.421 163.95 13.19 15.156 7.21 7.64 141.74 968.69 815.12 23.298 23.718 5042.3 3514 IGKC 443.22 466.97 17.373 12.526 4208.7 857 CAV1 78.802 62.756 35.597 78.088 88.197 677.66 476.06 157.64 134.86 2782.3 100379345 M1R181A2HG 21.964 34.023 28.871 23.483 28.206 53637 S1PR5 15.586 12.486 8.636 8.962 16.528 53637 S1PR5 67.846 44.061 34.084 28.856 38.968 53637 S1PR5 717.93 282.15 666.48 162.36 414.42 9231 DLG5 48.54 24.378 25.433 19.693 44.627 90102 PHLDB2 357.59 187.77 433.56 256.29 505.27 79899 PRR5L 180.15 197.03 170.88 145.01 166.91 7049 TGFBR3 533.63 343.64 541.31 190.35 192.1 1524 CX3CR1 1329.3 195.08 634.97 42.747 441.76 51348 KLRF1 728.3 114.8 131.7 24.566 751.36 5775 PTPN4 960.31 792.99 1209.5 415.43 695.24 5775 PTPN4 424.84 365.3 571.27 223.34 289.89 7049 TGFBR3 2940.3 2267.2 2912 1216.9 588.96 83888 FGFBP2 2087.8 79.084 8123.5 2358.6 435.28 114879 OSBPL5 301 127.76 248.21 171.33 202.29 219285 SAMD9L 768.39 9098.1 1581.8 440.99 1694.1 54877 ZCCHC2 2470.2 5750.5 1562.2 2493.9 1912.9 356 FASLG 272.33 789.32 739.24 912.05 263.67 5920 RARRES3 2719.8 2664.6 3060.1 235.33 849.11 388228 SBK1 913.96 523.96 775.1 283.02 343.93 219285 SAMD9L 1329.8 9480.5 1860.7 712.66 1880.3 2219 FCN1 467.99 60.392 78.933 58.575 284.26 9332 CD163 101.82 119.76 79.024 61.356 118.4 23601 CLEC5A 119.11 95.737 92.389 84.429 228.91 9332 CD163 71.858 85.886 38.251 24.845 68.466 51313 FAM198B 156.34 93.035 118.44 123.52 130.26 23166 STAB1 128.66 107.3 93.651 72.915 83.267 10501 SEMA6B 33.318 21.347 24.505 33.317 76.208 7045 TGFBI 314.89 110.94 91.258 36.355 79.571 8536 CAMK1 231.77 200.59 264.45 485.72 194.55 23166 STAB1 161.92 111.78 150.14 170.8 190.98 206358 SLC36A1 69.352 112.18 167.49 162.58 136.7 913 CD1E 23.446 31.112 24.51 19.626 10.493 713 C1QB 57.155 68.223 38.545 24.608 93.249 712 C1QA 62.558 24.101 23.867 20.628 32.379 910 CD1B 116.44 64.685 43.037 23.273 75.038 913 CD1E 76.574 73.689 34.628 34.141 101.33 714 C1QC 110.65 140.74 27.702 61.741 34.068 5480 PPIC 47.172 48.238 37.09 16.31 46.384 945 CD33 23.86 26.068 11.41 9.258 25.716 909 CD1A 334.06 215.3 239.04 192.86 595.37 2 A2M 56.154 90.243 91.964 68.09 88.213 6357 CCL13 103.8 102.11 70.412 68.673 165.5 1193 CLIC2 19.734 13.509 4.991 7.239 27.693 5577 PRKAR2B 109.78 78.126 61.402 92.489 117.09 6614 SIGLEC1 23.821 16.503 13.074 11.874 18.704 80380 PDCD1LG2 16.213 14.334 24.966 7.891 14.958 942 CD86 183.62 162.09 106.74 90.275 293.85 629 CFB 136.58 132.94 46.834 56.07 131.35 5055 SERPINB2 104.82 108.06 56.517 32.963 71.147 55022 PID1 68.932 25.883 27.311 36.14 27.062 2921 CXCL3 24.788 25.074 21.049 26.677 53.966 6374 CXCL5 32.322 5.255 14.219 3.561 33.529 2919 CXCL1 102.29 72.235 49.323 38.146 109.13 3552 IL1A 88.623 145.24 90.422 35.318 155.24 718 C3 59.883 26.757 34.401 17.188 28.973 6369 CCL24 44.054 21.628 24.646 14.316 57.382 3624 INHBA 16.237 135.48 7.304 7.813 26.306 8875 VNN2 269.9 77.17 513.82 12.6 355.24 1441 CSF3R 106.53 44.825 45.942 38.679 176.05 64407 RGS18 348.74 282.09 132.72 112.99 257.38 ENTREZ ID B activated B aIgM B Mem IgG B Mem IgM Plasma cells 125.9 78.485 1355.6 2167.6 575.7 83481 22.296 18.152 51.534 45.244 24.699 678 563.83 248.18 422.51 430.73 170.09 236.36 156.19 134.89 262.19 128.64 4929 112.38 322.4 202.34 365.71 42.58 81.581 162.01 48.368 116.49 31.034 26289 48.406 38.379 69.45 65.663 55.256 3707 2073.6 2786.8 231.11 151.04 294.67 388.4 630.63 1875.9 3071.5 448.05 9241 62.575 71.163 153.18 210.55 226.19 3337 779.84 629.17 342.02 318.99 888.9 2935 768.24 920.58 513.34 503.68 565.05 1429.3 2599.7 3060.4 3890.8 1513.1 4929 209.68 312.83 502.61 820.81 97.28 90139 210.34 149.64 323.63 239.4 712.5 146330 672.19 494.3 833.77 550.58 1161 678 486.97 268.09 366.91 415.21 172.63 112744 99.437 125.95 181.58 145.47 169.89 3605 8.1 3.219 24.895 36.767 5.585 1493 331.91 319.33 599.21 486.96 540.88 1493 57.268 68.635 58.954 76.762 89.278 940 101.36 39.628 175.46 291.21 134.16 51339 228.89 116.55 212.18 274.44 115.61 50616 177 131.76 305.89 259.44 170.05 143686 519.98 590.79 135.39 151.2 120.16 128553 286.96 117.25 355.25 272.75 201.94 145864 1180.4 388.18 558.27 536.28 992.28 30812 26.109 23.557 28.412 27.116 41.972 940 33.209 17.453 61.339 66.092 45.075 1493 225.83 82.15 277.45 353.17 308.49 10320 355.95 186.75 251.73 257.34 202.66 29968 337.81 736.12 429.65 309.66 102.5.6 3578 57.007 22.289 145.32 101.28 54.427 128553 110.94 63.719 214.32 219.95 234.12 926 27.152 8.683 93.873 74.936 50.758 54674 40.136 28.776 157.23 118.26 33.943 925 460.91 106.98 363.04 243.73 125.54 926 130.58 54.383 281.08 335.21 118.48 54674 143.34 90.669 332.35 344.48 173.99 51676 46.681 31.775 53.498 43.509 219.16 9666 26.541 25.563 37.349 36.696 17.2 10730 30.823 24.564 39.521 42.166 31.209 85315 520.17 258.38 424.19 344.92 557.11 9402 16.219 12.373 19.32 20.428 13.39 2833 52.68 25.821 101.19 79.587 242.77 3820 110.13 115.56 162.12 76.456 206.92 4676 858.5 642.55 569.35 587.16 796.58 1731 1119.3 944.65 371.66 442.15 1079.7 814 296.08 68.922 188 231.35 301.28 57124 282.39 195.08 324.75 255.77 252.92 61.25 39.666 104.62 117.43 122.23 283869 5.692 446.58 11.427 16.884 12.242 199953 170.17 95.56 141.98 147.22 290.42 399694 62.257 34.752 92.555 87.079 47.668 3976 21.031 19.177 49.072 46.371 25.724 23176 11.885 13.505 25.628 24.617 18.216 990 112.04 83.857 174.97 175.32 310.89 51010 567.47 822.37 48.067 79.427 299.82 1021 2276.6 1490.8 493.55 258.8 3295 51293 144.65 283.68 59.468 53.224 315.2 1503 532.91 994.27 373.66 397.97 386.96 84319 1139.8 3038.4 411.69 346.84 1622.2 10622 90.279 191.06 105.25 95.599 122.2 199953 160.81 171.54 123.62 129.9 114.47 1021 1408.9 897.3 752.27 632.6 2131.3 1841 160.07 273.64 133.27 153.84 292.14 23464 11.739 14.28 22.541 21.448 16.567 3336 1505.3 2903.3 846.93 783.39 1572.6 162.4 482.29 413.11 121.42 128.14 971 429.63 938.19 245.96 573.81 17.596 933 899.99 1028.4 411.99 546.56 11.084 244.78 244.54 171.12 212.56 22.94 6328 159.39 75.757 124.23 81.037 22.318 84518 42.35 25.314 47.823 161.18 31.814 8115 2673.8 2889.4 498.98 831.45 293.26 29802 755.75 264.61 1466.2 1287.6 178.78 79856 124.46 101.79 348.5 401.1 104.37 115123 86.994 110.34 75.808 75.208 61.51 8115 3401.9 2895.9 575.35 902.55 275.69 798.08 831.82 778 802.7 432.14 502.73 422.8 785.39 690.67 272.74 283663 6478.5 4462 6503.1 7265.8 226.35 283663 4016.6 2195.3 3613.9 4563.9 556.32 933 1829.8 1631.8 1793.3 2011 266.97 55278 875.1 727.76 1464.3 1714.3 621.96 94235 8705.2 681.42 43.5 64.063 57.214 23089 2036.6 121.93 81.024 103.77 73.413 7782 7943.9 326.7 1065.5 710.81 847.84 3818.5 2789.4 150.52 188.22 240.7 2956.6 774.48 232.44 167.55 182.61 148932 13894 717.4 604.51 685.16 895.23 80237 2672.8 627.44 196.76 187.92 102 1184 4105.2 524.36 1044.6 1151.2 764.8 653121 2444 154.17 222.47 278.34 440.52 3470.4 881.09 127.17 231.04 56.611 1184 1331.7 179.77 216.7 184.82 145.23 94274 2681.6 109.95 196.29 198.03 100.7 80237 1706 524.31 229.49 264.89 170.12 1490 265.32 34.172 29.803 13.406 12.285 148932 4626 496.97 611.27 530.52 453.65 140733 11697 5016.8 124.2 181.28 644.92 116449 657.76 44.223 102.93 129.5 188.89 51237 1716.7 785.93 740.4 838.1 37183 3514 11.946 14.494 23.924 21.578 677.99 3537 40.005 74.637 57.895 39.922 5202.1 592.6 712.36 296.25 472.3 32592 81618 738.28 247.2 577.24 779.46 11437 51237 1319.5 490.69 260.48 239.29 17479 608 365.71 263.56 626.98 442.39 14375 900.13 604.22 1247.4 2371.6 22774 96610 3547.4 1665.6 1460.3 1353.7 44647 436.2 527.22 512.07 467.82 6583.2 51303 736.14 618.66 596.84 431.99 13740 167.16 108.45 65.809 55.434 4308.9 47.245 16.959 37.188 22.782 555.37 2245 842.29 1265.4 1225.6 26624 79694 128.83 61.721 57.43 51.351 1510.6 28823 1120.6 591.59 697.15 670.13 13019 857 64.758 65.577 46.166 24.508 1889.2 10316 16.968 11.241 28.366 24.025 21.331 2043 92.377 36.349 140.79 81.496 54.073 10079 10.289 11.696 19.097 25.438 10.548 9289 146.6 17.949 47.686 42.818 31.702 2043 137.15 20.26 166.81 42.352 38.186 79901 8.445 7.804 19.536 17.719 8.519 25.757 25.26 112.58 61.378 25.283 151742 240.56 152.7 259.38 192.84 210.88 81563 97.005 29.468 93.735 57.454 63.917 2619 12.016 8.361 24.734 25.129 12.794 59338 1304.9 762.61 848.99 955.81 356.19 2043 429.13 273.55 717.74 602.07 596.28 4068 72.491 74.097 47.594 46.695 20.921 2043 190.16 66.138 395.22 109.34 155.65 2774 43.235 33.021 90.869 85.197 79.187 5243 274.03 186.01 228.02 225.67 224.27 11098 359.39 132.8 330.03 377.04 351.5 127254 75.933 42.083 112.26 106.76 33.029 57489 155.38 159.46 183.49 113.26 312.66 57489 187.77 125.38 240.69 116.48 274.85 257019 214.85 117.87 312.93 474.35 213.8 10974 27.798 11.084 22.65 20.283 15.804 6672 574.84 396.32 225.06 197.43 120.03 64108 560.78 58.119 59.991 60.383 224.17 55603 338.22 140.46 70.072 70.491 96.183 54809 1883.7 500 389.29 544.59 1078.5 257019 267.45 226.52 846.65 811.22 387.72 91624 101.62 150.77 82.89 38.41 30.593 29.07 32.918 52.246 56.176 76.157 85363 318.82 274.03 143.37 183.16 317.66 50650 999.06 266.06 374.46 472.91 440.33 100131733 250.69 163.87 200.3 148.86 637.26 303.43 158.5 49.547 60.247 882.36 2635 597.15 260.27 260.49 282.58 680.29 5654 325.94 217.11 254.78 217.39 378.02 2048 19.212 13.813 41.378 38.509 19.184 10461 151.04 110.88 131.29 147.68 167.79 4048 5135.1 4152 2095.9 2279.2 3178.3 2048 19.794 14.376 68.248 49.623 86.171 10461 104.65 56.653 236.55 207.85 107.1 340526 94.134 75.628 96.029 94.257 95.477 284013 14.451 19.847 23.683 20.328 23.967 120939 85.694 45.534 69.956 54.285 134.15 408 19.392 15.134 37.238 34.008 20.44 2048 159.93 109.4 240.71 226.39 202.71 2517 450.22 469.94 416.64 325.97 713.2.1 210.77 199.36 122.69 123.37 38.037 2335 25.495 42.183 81.327 103.35 16.885 11326 154.35 61.94 352.53 358.35 198.53 2335 56.337 17.899 52.106 56.731 16.433 51063 151.41 104.78 139.07 174.98 129.8 55244 30.656 13.634 24.757 22.461 30.17 2162 233.58 115.91 479.91 402.89 247.61 10462 116.72 20.433 119.71 111.38 104.15 246 11.346 9.715 19.972 58.372 10.044 23475 16.766 31.21 87.88 56.88 141.4 154092 28.516 36.734 69.953 64.71 44.851 23017 21.3 18.821 28.089 25.181 28.634 79839 8.302 1.015 37.086 9.202 8.124 5445 121.68 97.311 120.96 128.04 130.15 30835 163.27 99.57 313.17 251 187.27 51477 198.33 85.288 65.867 135.68 52.564 30835 52.787 21.539 35.029 47.617 24.918 2878 182.73 161.49 414.11 438.13 229.3 2878 236.72 154.17 295.06 301.73 234.74 5445 64.661 62.882 113.24 149.34 50.288 56670 277.13 142.74 423.79 260.43 305.45 30850 8.9 13.077 13.102 13.026 10.069 11067 23.813 25.516 43.537 39.406 29.808 6624 63.516 55.39 54.472 29.717 24.173 54662 141.92 114.81 54.299 51.949 51.197 101930114 137.2 75.169 147.68 206.61 305.57 5157 16.96 44.181 40.21 22.475 13.408 3429 112.25 46.373 50.78 94.163 119.78 39.337 23.056 114.36 60.898 40.013 80045 765.69 864.41 672.41 417.83 1021.2 80380 26.589 26.191 63.203 53.796 59.15 11067 102.61 23.724 58.954 61.644 63.256 8820 22.89 13.287 26.034 26.317 17.264 6624 102.41 67.491 10.366 6.506 7.758 11167 158.41 118.18 353.01 375.64 162.49 54662 730.1 446.29 528.19 571.03 405.15 9175 5.464 4.814 8.781 9.781 11.148 3357 10.004 15.287 25.989 17.253 29.89 94015 192.38 136.59 76.097 105.62 369.95 56300 78.498 53.339 171.73 175.77 85.443 3036 62.179 22.661 135.41 153.81 107.37 7980 135.04 88.061 22.203 21.938 12.314 11009 72.213 118.18 67.58 126.55 22.751 4312 16.557 7.346 33.165 45.886 6.634 7980 74.723 52.423 70.474 69.994 34.393 1440 19.209 19.475 26.511 26.774 20.875 3569 1588 284.03 341.25 435.91 145.62 4233 10.115 35.396 24.648 16.854 32.194 169792 16.12 14.462 83.659 111.02 64.578 51334 8.931 22.338 34.53 23.283 19.207 6374 9.425 17.418 54.262 77.543 38.061 6660 8.14 11.336 19.539 23.041 16.023 79931 19.561 27.081 64.546 62.118 37.863 8710 20.7 20.595 48.02 44.575 24.085 3690 100.16 79.679 27.204 28.815 13.054 5743 26.012 21.551 28.498 43.676 25.445 8794 12.525 12.11 37.874 17.543 9.775 53829 76.257 13.312 70.916 33.945 22.424 4311 44.56 32.565 106.81 102.32 68.168 146225 272.32 165.77 841.78 212.16 494.7 8794 43.257 26.589 45.615 59.935 125.79 8794 94.444 66.289 143.19 149.05 94.772 6286 299.56 120.18 69.519 41.807 30.985 3577 46.036 23.438 66.93 68.085 27.242 60675 49.74 28.545 24.378 16.613 53.691 54682 103.16 34.426 291.74 249.55 97.194 144423 33.965 25.369 54.365 48.216 45.415 3579 15.821 19.504 13.723 15.532 19.566 25984 62.235 52.891 151.99 138.74 106.63 2215 180.1 91.841 248.53 239.36 162.95 4311 64.683 12.237 32.656 30.344 18.396 79908 22.44 13.582 25.459 26.706 26.866 50.563 44.979 99.362 61.429 110.7 57.159 47.999 62.948 64.1 66.571 80201 34.716 31.414 65.151 73.108 71.596 13.655 10.1 11.711 9.278 13.786 3572 33.371 45.084 127.48 253.1 93.452 6711 37.121 54.203 108.92 253.63 122.46 6920 50.839 46.818 75.369 171.03 152.37 109.06 137.22 125.98 246.18 43.598 26119 98.984 173 135.23 159.29 284.72 448.8 270.5 136.42 258 408.3 3562 10.166 9.046 36.347 16.231 9.837 50616 53.862 16.571 102.85 70.52 146.28 64788 123.14 198.43 173.84 193.14 182.04 283.78 174.75 205.37 190.32 240.26 959 46.611 20.655 64.876 58.402 42.182 50943 65.338 48.38 220.77 206.11 146.06 54602 441.29 350.3 661.08 704.09 614.13 1493 52.941 16.366 134.12 85.046 151.54 55423 122.11 36.387 183.64 157.75 97.431 917 87.324 19.905 53.472 55.177 32.644 10663 191.12 73.848 262.77 265.17 136.31 3090 62.872 53.679 62.066 56.536 43.042 27240 447.22 556.99 658.06 732.74 394.33 51676 289.52 203.62 242.59 200.29 612.31 91978 56.022 175.17 42.183 46.635 136.02 28755 734 297.26 509.97 406.85 471.19 3932 401.34 265.26 313.1 297.33 85.982 79413 328.8 549.38 314.44 244.52 123.05 993 12.278 11.699 27.212 27.494 47.288 151230 58.921 60.413 79.842 48.502 36.977 29128 227.75 796.15 223.23 171.58 1438.7 279.31 439.72 282.41 256.85 363.93 29089 255.28 393.67 100.27 84.534 842.79 3070 106.47 136.72 41.992 43.732 61.13 8438 30.037 23.372 35.105 31.035 17.64 3070 421.1 591.66 309.23 325.53 424.17 10563 16.105 190.19 60.868 41.46 23.525 79075 45.943 45.53 38.164 54.297 115.2 4049 305.93 19.847 22.388 21.473 14.365 10328 34.441 63.591 60.775 60.12 98.738 84824 1105.1 2016.2 1131.8 1993.1 118.29 11410 6419.6 332.54 1278.4 329.1 3899 6992 4487.8 1347.4 2163 17.917 55024 3369.7 1609 4849.6 4389 269.4 931 12327 7914.7 12484 14351 330.25 11615 7550.3 4127.6 4829.9 1153.1 931 14082 8618.6 14009 16289 294.53 199786 7850.1 4753.7 3450 6123.6 822.34 115350 3156.3 1094.1 1986.9 2423.5 875.88 3593 3206.7 1259.2 1392.3 207.42 931 10792 5230.7 3721.6 4253.6 312.53 931 35052 20987 23579 26239 395.68 53335 14169 6339.9 3436.7 3985.5 528.8 26040 3083.3 786.02 716.76 599.74 526.88 53335 3364.6 1258.2 1038.8 1261.6 187.64 47.628 32.218 45.183 41.792 1278.4 45.987 36.33 21.507 51.597 827.93 2888.9 2118.1 2838.8 3291.2 34965 3514 2671.2 1577.3 1877 2561.6 34431 857 45.911 78.45 119.82 124.39 1721.2 1358.7 976.07 737.17 1560.2 21772 100379345 39.402 43.26 60.684 63.493 39.157 53637 11.045 13.645 18.64 16.741 10.684 53637 48.293 33.393 82.363 80.263 80.665 53637 319.18 33.136 75.413 64.085 83.253 9231 16.9 23.514 39.08 38.174 37.877 90102 522.21 174.05 345.23 277.7 248.14 79899 153.61 34.386 135.85 178.07 56.217 7049 131.58 96.953 183.11 213.56 161.31 1524 79.278 23.436 156.29 157.04 89.718 51348 240.92 38.515 203.31 195.7 100.14 5775 526.92 334.2 378.6 407.28 491.97 5775 221.9 158.53 250.08 392.4 343.3 7049 522.78 231.16 741.98 630.24 599.46 83888 230.64 175.08 88.643 54.91 54.863 114879 110.69 69.018 132.79 113.05 114.13 219285 2391.7 104.07 157.76 419.91 2176.5 54877 2185.9 1046.7 922.62 816.44 599.11 356 181.14 81.324 227.78 206.89 174.67 5920 278.5 127.62 432.41 367.02 1801.9 388228 279.65 196.79 279.46 191.22 270.74 219285 2386.9 353.87 846.09 942.06 2698.5 2219 339.72 113.46 134.87 123.98 180.89 9332 74.272 44.964 221.24 226.95 210.04 23601 150.82 73.627 226.83 219.5 159.9 9332 53.077 31.555 174.52 279.05 140.63 51313 140.87 68.801 294.18 302.38 218.98 23166 94.68 113.24 128.71 106.57 64 10501 44.16 22.369 63.408 40.779 118.86 7045 101.04 43.168 62.25 132.31 102.34 8536 167.43 176.85 157.92 185.87 191.37 23166 219.39 144.43 301.11 260.52 81.386 206358 242.86 134.87 81.805 73.633 100.04 913 18.039 17.494 38.018 79.575 21.279 713 62.42 33.698 50.778 36.277 18.398 712 49.396 11.998 83.199 44.593 74.948 910 76.53 60.891 184.23 121.28 202.85 913 67.955 48.996 74.338 72.827 86.424 714 71.675 33.642 118.86 56.562 125.48 5480 27.873 72.802 76.562 100.23 28.991 945 20.375 14.645 37.029 35.662 17.374 909 330.27 283.03 765.57 729.57 334.33 2 61.413 70.048 110.28 217.55 116.79 6357 111.1 53.946 134.15 164.72 100.83 1193 27.378 16.056 17.633 17.894 9.958 5577 64.795 78.53 96.114 111.03 96.123 6614 14.555 17.02 27.273 27.555 13.05 80380 12.758 13.968 20.981 22.152 13.788 942 267.82 183.33 618.49 400.78 281.29 629 83.048 43.087 129.28 79.264 59.938 5055 96.217 41.219 113.71 115.17 71.027 55022 43.915 33.14 85.735 108.6 45.643 2921 18.063 38.137 56.646 50.331 87.434 6374 12.421 21.868 49.028 37.239 15.912 2919 94.808 78.084 156.84 130.59 91.55 3552 63.8 81.281 287.8 220.03 111.54 718 26.25 17.639 27.042 25.763 39.066 6369 49.296 26.492 25.721 26.113 19.318 3624 14.216 20.578 20.333 18.133 8.488 8875 189.21 167.27 287.16 314.52 168.83 1441 82.909 41.943 74.399 38.012 29.283 64407 151.54 93.752 264.46 229.04 186.15

(329) TABLE-US-00010 TABLE 8B Table 8B Deconvolution basis signature Adaptive immune cell subsets NK Activated mDC ENTREZ ID Symbol NK activated Monocyte monocytes mDC activated Neutrophil 234.22 193.38 60.43 94.563 44.379 42.333 528.59 83481 EPPK1 22.594 25.374 15.907 23.304 17.794 14.671 49.81 678 ZFP36L2 944.54 829.88 947.23 303.25 768 224.49 685.29 118.91 74.872 49.12 36.745 26.144 19.642 24.981 4929 NR4A2 16.994 108.1 62.992 220.11 49.329 100.96 106.7 102.67 116.49 189.11 128.72 103 82.624 72.219 26289 AK5 199.32 175.49 27.348 33.242 26.782 42.736 114.44 3707 ITPKB 2300 12.48 134.46 135.6 290.04 94.781 610.74 192.38 340.33 209.66 263.31 151.63 182.99 1779.9 9241 NOG 108.3 65.022 67.638 107.4 66.928 68.087 245.57 3337 DNAJB1 913.3 898.93 1674.3 1546.3 1153.8 890.5 815.13 2935 GSPT1 460.41 371.28 148.31 138.81 121.14 117.47 234.13 773.73 774.08 460.05 327.9 234.19 363.43 1545.7 4929 NR4A2 167.22 211.2 153.38 325.82 153.57 127.94 217.77 90139 TSPAN18 93.089 110.13 83.97 121.68 134.12 124.52 230.54 146330 FBXL16 311.67 323.29 224.19 245.56 351.13 401.22 1170.8 678 ZFP36L2 893.78 701.58 1109.2 276.4 869.58 278.41 706.3 112744 IL17F 132.08 57.788 66.779 62.439 48.914 67.21 192.07 3605 IL17A 6.173 21.649 12.938 15.326 13.615 19.02 18.389 1493 CTLA4 280.2 272.35 127.25 202.8 219.86 213.03 546.89 1493 CTLA4 105.53 117.46 74.196 74.198 166.69 144.29 185.74 940 CD28 54.782 99.024 69.36 108.31 103.85 99.261 313.67 51339 DACT1 56.953 114.38 164.18 108.19 238.82 129.36 226.99 50616 IL22 130.08 140.77 160.41 208.94 195.76 176.95 458.47 143686 SESN3 479.75 251.81 70.653 94.283 209.79 790.54 79.465 128553 TSHZ2 169.31 130.05 81.735 121.52 97.362 109.71 253.85 145864 HAPLN3 563.5 2809.2 254.6 430.41 267.09 1769.6 644.6 30812 SOX8 39.268 45.119 15.518 25.178 50.898 22.052 25.256 940 CD28 65.611 35.191 29.141 49.231 19.951 27.802 37.221 1493 CTLA4 124.66 116.43 92.171 92.422 121.75 109.83 501.04 10320 IKZF1 571.49 213.94 254.88 233.08 271.55 439.89 210.19 29968 PSAT1 199.65 207.83 202.32 287.5 581.74 510.86 477.33 3578 IL9 95.923 63.72 52.85 60.811 68.764 52.046 88.46 128553 TSHZ2 102.72 72.86 28.29 63.443 42.089 40.373 163.89 926 CD8B 66.688 29.283 42.361 57.728 46.062 30.886 58.733 54674 LRRN3 46.41 34.332 99.24 152.85 121.16 87.014 107.64 925 CD8A 1747.3 1021.5 176.49 358.05 191.57 212.95 659.97 926 CD8B 239.29 169.83 138.51 232.77 128.76 116.27 422.64 54674 LRRN3 111.6 105.81 175.1 267.95 204.2.3 201.49 495.58 51676 ASB2 31.89 23.954 18.171 22.51 23.759 68.321 32.828 9666 DZIP3 35.794 21.865 21.678 28.811 39.256 44.789 30.134 10730 YME1L1 23.72 13.456 19.854 21.666 14.435 20.995 53.299 85315 PAQR8 945.21 671.94 472.6 224.57 882.61 233.68 556.69 9402 GRAP2 189.79 247.42 18.973 24.599 22.105 22.97 27.632 2833 CXCR3 602.71 345.71 49.709 78.357 64.907 28.424 62.056 3820 KLRB1 278.26 253.8 41.45 39.372 63.174 30.798 241.79 4676 NAP1L4 1028.9 774.41 1198.6 1045.5 896.23 1096.3 451.85 1731 1-Sep 1159.2 975.22 21.243 61.854 26.316 69.847 148.47 814 CAMK4 139.73 101.14 25.46 75.621 50.817 142.6 204.37 57124 CD248 213.8 213.93 317.03 255.8 371.85 289.84 453.31 49.748 27.014 31.759 55.044 32.022 36.939 217.53 283869 NPW 4.098 4.461 7.843 11.752 8.392 9.127 7.039 199953 TMEM201 134.75 135.83 100.88 112.42 107.51 102.01 213.66 399694 SHC4 21.764 31.468 18.077 29.599 26.114 25.334 60.573 3976 LIF 20.468 84.797 104.49 625.31 55.962 48.533 66.225 23176 8-Sep 13.231 10.118 20.444 23.372 23.637 21.66 24.944 990 CDC6 80.572 41.998 52.73 66.45 58.133 41.306 272.02 51010 EXOSC3 499.31 691.75 285.35 269.96 183.8 226.82 93.13 1021 CDK6 1248.6 830.99 475.77 235.09 1131.8 1444.6 318.97 51293 CD320 113.03 29.97 59.036 145.06 75.737 63.493 39.181 1503 CTPS1 223.21 303.98 430.55 239.9 573.47 332.52 293.59 84319 CMSS1 427.68 588.48 366.89 183.34 348.61 236.71 368.07 10622 POLR3G 65.923 66.872 62.421 96.927 95.214 73.507 98.346 199953 TMEM201 115.85 116.68 56.981 51.74 109.25 33.679 89.197 1021 CDK6 830.37 552.98 397.79 296.18 766.85 720.85 518.97 1841 DTYMK 178.37 112.05 210.83 157.39 223.51 179.2 45.123 23464 GCAT 17.535 9.065 24.936 33.227 23.741 24.881 37.288 3336 HSPE1 605.63 767.69 1753.7 1231 2327 1763.6 188.67 60.648 39.065 34.083 55.897 28.843 37.901 114.38 971 CD72 140.01 70.636 86.43 25.64 98.177 38.692 20.212 933 CD22 17.766 12.93 105.23 68.891 59.415 28.518 31.877 70.721 45.52 19.657 34.482 25.068 27.183 27.135 6328 SCN3A 9.035 16.917 20.771 16.759 15.008 14.52 30.192 84518 CNFN 13.975 11.258 14.451 23.411 16.705 19.943 27.996 8115 TCL1A 180.04 170.35 119.83 297.68 185.86 228.53 348.28 29802 VPREB3 61.713 94.775 90.293 96.477 78.715 97.26 123.4 79856 SNX22 44.03 51.925 27.59 49.441 36.764 35.319 111.72 115123 3-Mar 39.875 54.774 28.204 37.371 32.484 30.718 88.844 8115 TCL1A 286.46 251.84 247 312.07 191.15 185.85 392.58 407.7 331.35 113.97 184.05 84.152 122.42 456.53 31.909 47.045 11.475 22.142 16.219 13.423 120.6 283663 LINC00926 265.95 221.32 914.55 1401.3 239.32 423.65 219.41 283663 LINC00926 476.24 428.56 669.75 1095.6 309.15 406.34 897.64 933 CD22 243.9 251.42 697.13 618.3 649.58 454.74 714.06 55278 QRSL1 354.9 363.68 464.82 337.89 791.38 630.87 176.49 94235 GNG8 16.072 16.477 17.853 61.13 14.916 18.059 41.406 23089 PEG10 54.027 25.162 34.173 64.445 37.859 21.48 90.119 7782 SLC30A4 805.39 1089.5 85.611 279.09 740.4 422.82 497.14 122.51 111.59 513.67 723.39 598.57 235.17 29.861 91.025 91.24 45.43 58.428 42.262 45.095 185.27 148932 MOB3C 1533.5 3005.6 1422 1492.7 1051.1 937.14 980.55 80237 ELL3 132.33 109.34 241.61 198.86 252.73 569.53 256.98 1184 CLCN5 628.32 554.57 767.28 555.77 891.8 452.43 1058.2 653121 ZBTB8A 133.21 138.24 97.11 73.722 383.62 117.5 352.18 98.693 36.689 294.02 279.9 911.37 208.28 38.002 1184 CLCN5 123.85 106.44 244.96 215.04 243.33 146.17 260.36 94274 PPP1R14A 11.632 11.142 9.568 26.704 96.818 610.68 22.289 80237 ELL3 146.24 169.55 197.8 185.91 202.84 505.74 244.67 1490 CTGF 15.781 21.534 11.813 18.578 17.114 41.291 35.862 148932 MOB3C 829.5 1255.6 710.25 607.66 533.21 447.56 630.08 140733 MACROD2 79.989 66.195 42.426 76.844 58.566 40.426 140.71 116449 CLNK 144.92 97.92 42.783 47.617 43.627 37.469 164 51237 MZB1 52.632 104.09 19.182 52.139 32.979 18.784 67.427 3514 IGKC 15.836 17.732 23.55 32.221 33.423 26.31 32.073 3537 IGLC1 22.518 18.29 18.087 22.137 20.973 43.664 43.749 92.062 77.439 21.719 38.212 25.846 35.352 64.939 81618 ITM2C 542.99 323.12 33.527 83.342 50.067 43.392 129.57 51237 MZB1 16.949 17.981 29.661 37.977 33.723 31.289 40.291 608 TNFRSF17 25.957 9.114 21.037 21.426 26.508 35.455 32.888 146.08 117.63 154.76 164.45 135.49 142.59 353.57 96610 BMS1P20 76.908 111.4 74.646 119.1 83.672 98.779 225.79 44.886 41.648 29.585 73.693 31.832 47.005 75.732 51303 FKBP11 951.93 1748.7 153.69 225.52 152.68 102.36 170.24 28.589 30.469 25.767 36.928 23.977 25.044 43.659 14.155 11.369 21.694 31.114 22.223 19.143 23.746 43.581 136.18 116.63 117.3 107.23 160.4 243.01 79694 MANEA 85.751 124.28 111.99 82.277 196.15 182.86 5.879 28823 1GLV1-44 31.014 20.293 21.717 30.131 21.158 20.484 70.638 857 CAV1 14.734 23.886 23.042 136.13 51.28 156.41 46.812 10316 NMUR1 172.26 28.295 24.576 43.296 32.587 28.674 25.14 2043 EPHA4 2761.4 735.14 25.869 40.016 27.074 27.474 82.083 10079 ATP9A 948.85 203.48 40.959 55.259 160.09 41.003 27.762 9289 ADGRG1 5945.4 1929.6 50.639 140.34 46.329 72.247 180.88 2043 EPHA4 1388.8 396.3 25.82 30.08 30.872 25.258 53.499 79901 CYBRD1 121.89 7.789 21.734 21.921 33.831 21.927 19.441 535.44 147.87 18.017 23.31 13.838 26.439 28.242 151742 PPM1L 1220.4 304.67 157.85 96.387 413.32 116.43 274.48 81563 C1orf21 2150.6 903.11 84.932 390.11 31.397 23.844 159.08 2619 GAS1 178.7 35.304 17.643 34.257 42.159 26.652 44.204 59338 PLEKHA1 7208.2 2925.4 617.2 652.31 909.71 1482.1 442.03 2043 EPHA4 2364.5 967.61 145.92 239.82 138.98 172.69 440 4068 SH2D1A 1693 746.65 51.221 51.22 39.309 41.259 66.209 2043 EPHA4 3974.9 1121.7 19.352 28.697 24.173 24.334 157.95 2774 GNAL 193.61 90.085 39.564 54.834 62.992 63.343 84.722 5243 ABCB1 1488.5 773.91 78.088 55.655 48.71 46.583 298.63 11098 PRSS23 2740.9 775.99 92.684 108.22 107.02 101.46 407.85 127254 ERICH3 96.537 5221.1 20.035 16.235 31.973 19.899 76.112 57489 ODF2L 469.39 2852.3 29.954 88.016 51.95 64.323 111.68 57489 ODF2L 401.76 2054.4 33.763 61.725 39.819 107.49 86.458 257019 FRMD3 284.1 1797.8 111.72 76.125 133.01 202.21 294.68 10974 ADIRF 11.696 225.5 19.308 40.143 28.946 25.319 23.581 6672 SP100 990.02 3884 572.42 755.13 276.02 661.01 630.04 64108 RTP4 836.07 6115.6 346.26 438.55 577.13 1663.7 64.385 55603 FAM46A 750.31 2775.4 406.81 129.88 401.53 597.47 211.98 54809 SAMD9 4316.6 19829 471.56 584.64 274.6 2650.4 1593.1 257019 FRMD3 223.91 3689.8 94.875 77.308 140.16 266.24 748.24 91624 NEXN 115.11 2299.9 17.823 28.107 16.964 51.955 64.69 21.641 2082.2 39.556 27.231 22.498 96.451 70.775 85363 TRIM5 431.34 1212.8 328.47 236.23 326.44 417.5 213.38 50650 ARHGEF3 4649.5 10693 808.73 521.37 1982.5 1260 265.32 100131733 USP30-AS1 430.83 2257.5 109.55 72.205 85.077 413.35 267.85 259.52 4757.8 25.85 56.1 24.379 190.18 128.97 2635 GBP3 3614.4 9689.2 235.89 408.95 477.37 1973.1 442.26 5654 HTRA1 182.02 100.41 4524.5 721.17 344.37 393.46 408.27 2048 EPHB2 36.082 33.919 750 37.251 66.137 111.51 40.488 10461 MERTK 155.64 143.83 2057.5 444.14 347.38 196.23 221.36 4048 LTA4H 2278 832.7 21704 2697.1 4330.1 1290.8 1902.3 2048 EPHB2 54.592 51.961 1348.1 30.996 332.32 326.9 110.81 10461 MERTK 126.88 50.745 3131.1 768.85 422.35 132.67 247.23 340526 RGAG4 112.3 123.43 933.54 233.76 297.81 126.5 147.74 284013 VMO1 362.26 11.41 2665.1 396.29 97.002 261.12 21.038 120939 TMEM52B 72.249 101.61 821.29 191.39 106.19 115.88 143.71 408 ARRB1 144 87.986 591.46 169.9 179.32 77.117 79.13 2048 EPHB2 117.7 98.776 1139.8 190.47 393.61 362.3 378.24 2517 FUCA1 2269 1457.2 23621 1428.6 7804.2 2832.3 348.69 149.94 79.806 2508.8 1320.1 1363.3 601.22 135.64 2335 FN1 366.11 53.143 16242 58.443 2883.5 2906 165.13 11326 VSIG4 205.15 68.283 3604.2 370.12 157.55 209.64 455.5 2335 FN1 698.9 104.41 19697 64.194 4322.9 4511 73.793 51063 CALHM2 874.44 374.83 2336.4 451.57 899.63 218.93 379.34 55244 SLC47A1 18.268 31.408 34.706 31.818 1294.5 62.187 37.893 2162 F13A1 199.86 162.12 301.41 267.62 9213.4 463.63 663.21 10462 CLEC10A 242.18 51.339 666.23 247.07 10346 234.87 219.09 246 ALOX15 27.642 27.956 26.953 29.212 4539.9 72.346 182.96 23475 QPRT 27.911 18.443 39.471 38.229 3854.3 108.41 77.585 154092 LINC01010 23.433 33.679 57.564 49.195 1113.4 122.32 43.176 23017 FAIM2 18.124 15.246 38.708 44.951 1986 47.632 35.496 79839 CCDC102B 16.601 9.295 16.732 22.858 224.25 24.244 10.698 5445 PON2 434.92 340.34 276.18 103.43 5310.8 766.1 141.11 30835 CD209 118.57 188.32 365.69 835.46 7460.1 742.95 370.95 51477 ISYNA1 172.47 121.04 178.53 181.87 2664.7 426.65 120.38 30835 CD209 40.149 53.679 90.689 154.74 1321.4 166.3 140.49 2878 GPX3 289.86 166.4 2820.8 773.89 17689 2021.5 666.64 2878 GPX3 290.97 235.63 1813.8 724.23 10819 1542.4 612.69 5445 PON2 188.76 161.04 168.75 41.48 3833.2 579.46 69.345 56670 SUCNR1 166.02 133.08 158.29 517.6 4885.7 822.66 343.58 30850 CDR2L 15.938 20.626 54.75 40.053 904.74 77.118 39.601 11067 C10orf10 24.176 45.143 33.926 63.693 95.817 2692.8 36.858 6624 FSCN1 81.53 523.84 136.01 184.31 670.32 17366 98.237 54662 TBC1D13 98.944 262.08 96.11 188.52 289.66 5087.5 56.742 101930114 LOC101930114 150.12 378.01 86.24 121.02 294.11 15782 284.28 5157 PDGFRL 28.375 53.462 47.721 49.514 53.746 1387.7 20.595 3429 IFI27 134.04 1488.9 210.18 325.75 138.05 17765 151.87 74.727 153.21 53.552 33.817 95.649 8820.3 107.24 80045 GPR157 990.63 1117.5 941.2 500.12 390.29 9736.3 730.17 80380 PDCD1LG2 21.387 27.365 24.291 29.793 122.17 1974.3 53.788 11067 C10orf10 76.594 37.144 76.86 55.657 65.272 1186.5 89.081 8820 HESX1 13.973 59.359 33.421 25.657 40.231 1691.5 22.801 6624 FSCN1 126.4 620.29 171.77 344.98 1454.9 16899 52.809 11167 FSTL1 93.606 105.83 192.63 274.55 188.9 4875.7 381.91 54662 TBC1D13 582 689.43 770.72 899.75 1147.7 7639.7 681.05 9175 MAP3K13 9.844 6.678 11.997 17.73 14.728 173.95 11.757 3357 HTR2B 44.103 23.668 20.289 20.805 23.311 815.72 23.146 94015 TTYH2 403.48 548.11 194.02 123.57 283.43 7052.4 203.15 56300 IL36G 75.673 95.566 193.5 13364 96.662 140.58 158.08 3036 HAS1 52.122 23.743 85.531 6520.7 125.32 73.135 144.91 7980 TFPI2 14.302 264.75 228.32 10802 22.39 274.11 37.116 11009 IL24 89.089 27.311 98.807 7265 37.723 43.914 230.31 4312 MMP1 14.214 3.569 15.962 2464.7 22.158 26.477 38.896 7980 TFPI2 31.933 59.772 146.36 3886.6 28.623 142.85 22.053 1440 CSF3 47.925 24.496 27.293 2163.5 30.881 31.705 36.188 3569 IL6 97.655 1336.6 1632.4 34971 204.43 2510.5 240.88 4233 MET 15.715 16.009 360.15 4883.1 27.917 148.52 23.036 169792 GLIS3 13.486 37.029 185.27 1833 46.519 15.028 127.91 51334 PRR16 19.619 10.144 72.589 812.71 19.002 17.112 43.945 6374 CXCL5 9.621 15.056 175.25 1677.9 40.346 43.681 99.159 6660 SOX5 9.393 10.435 26.932 296.21 30.578 32.724 14.187 79931 TNIP3 13.75 34.176 660.08 8318.6 49.416 180.07 35.132 8710 SERPINB7 26.193 269.05 48.317 8770.5 32.96 803.26 45.827 3690 ITGB3 82.961 102.15 50.385 2003.3 53.605 172.65 112.65 5743 PTGS2 22.052 57.425 434.21 23846 79.633 293.33 2414 8794 TNFRSF10C 23.394 13.984 40.419 75.161 46.084 27.389 7494 53829 P2RY13 15.617 12.05 22.463 29.8 106.12 24.156 7096 4311 MME 45.207 25.599 56.171 108.62 66.398 51.768 5834.4 146225 CMTM2 260.95 291.93 161.55 189.59 204.06 184.9 41610 8794 TNFRSF10C 95.751 43.935 27.844 33.083 31.309 39.868 11321 8794 TNFRSF10C 69.516 66.842 124.52 98.004 132 127.39 7001.1 6286 S100P 35.679 40.597 196.07 287.74 71.192 50.918 21441 3577 CXCR1 150.19 36.452 38.777 47.861 34.59 34.741 6702.9 60675 PROK2 27.394 7.688 94.419 58.926 11.755 29.657 13698 54682 MANSC1 32.466 53.104 75.79 54.837 60.247 61.276 2613.4 144423 GLT1D1 97.688 90.763 406.39 290.12 29.735 19.451 12243 3579 CXCR2 392.19 100.84 111.39 20.749 453.51 83.791 12028 25984 KRT23 36.835 49.514 68.24 67.635 90.373 68.849 3796.8 2215 FCGR3B 901.02 693.72 1388 330.29 466.68 231.55 32749 4311 MME 18.525 13.907 21.308 93.096 27.296 25.716 2580 79908 BTNL8 19.269 15.886 38.278 55.531 50.442 42.432 1195.4 56.534 90.265 162.63 125.69 139.7 144.21 2915.3 43.711 36.304 28.181 36.962 26.687 31.636 101.33 80201 HKDC1 26.961 45.619 23.442 29.542 32.629 24.274 58.015 10.559 20.107 16.677 28.563 25.355 25.463 33.51 3572 IL6ST 18.648 75.83 17.295 19.91 12.723 20.567 66.204 6711 SPTBN1 40.456 30.066 29.822 33.681 25.029 28.475 88.178 6920 TCEA3 116.74 24.173 42.689 80.724 58.11 61.04 198.9 125.04 63.024 38.942 29.201 84.617 132.45 136.94 26119 LDLRAP1 512.32 232.72 316.47 283.63 570.71 174.09 140.7 1183.6 722.03 174.49 97.182 94.599 65.5 229.94 3562 IL3 9.531 7.443 16.465 22.998 20.151 21.977 18.31 50616 IL22 86.691 40.447 29.994 57.904 25.763 21.935 91.888 64788 LMF1 146.1 153.11 42.787 41.659 142.33 46.938 114.22 149.76 123.63 72.559 162.63 116.99 71.606 208.72 959 CD40LG 40.464 49.649 34.919 30.912 38.454 28.851 88.189 50943 FOXP3 127.15 81.559 32.344 77.866 46.594 46.038 122.99 54602 NDFIP2 370.94 370.3 183.16 259.95 348.39 267.85 711.33 1493 CTLA4 9.094 48.237 37.288 50.691 101.61 64.781 132.91 55423 SIRPG 105.48 80.092 107.77 138.53 127.52 151.82 220.38 917 CD3G 477.55 288.48 44.127 84.826 45.794 46.494 83.39 10663 CXCR6 406.47 375.57 152.71 177.96 163.36 154.32 292.65 3090 HIC1 190.21 119.43 47.963 42.613 46.522 177.53 73.215 27240 SIT1 199.48 132.05 101.21 123.34 407.85 119.45 174.4 51676 ASB2 274.66 272.28 135.17 143.8 94.268 172.17 376.9 91978 TPGS1 53.805 54.227 136.66 121.66 142.86 168.85 43.394 28755 TRAC 786.27 699.43 305.97 565.94 236.82 296.6 844.63 3932 LCK 2360.8 993.94 268.64 389.46 154.42 148.7 415.79 79413 ZBED2 130.91 87.84 77.241 139.93 117.45 87.879 257.46 993 CDC25A 12.808 8.661 21.27 35.54 28.316 18.804 23.371 151230 KLHL23 86.999 91.376 27.185 36.326 19.515 22.162 51.824 29128 UHRF1 184.73 95.148 68.223 51.556 36.754 33.832 223.99 137.58 95.521 32.602 48.19 34.163 57.902 99.755 29089 UBE2T 137.04 110.9 41.216 64.275 62.825 50.933 53.295 3070 HELLS 6.926 6.673 16.983 29.67 25.008 24.039 28.993 8438 RAD54L 55.063 35.177 56.263 47.656 48.391 46.296 57.866 3070 HELLS 176.76 154 34.591 65.708 34.752 50.621 298.73 10563 CXCL13 28.792 94.868 25.984 158.1 27.05 242.1 41.323 79075 DSCC1 61.206 23.793 101.91 136.67 98.441 95.428 61.939 4049 LTA 18.138 118.74 20.557 29.577 27.044 28.376 32.132 10328 EMC8 29.093 23.251 36.363 39.324 34.294 22.123 37.046 84824 FCRLA 45.306 35.399 33.046 52.991 28.414 16.273 85.514 45.323 42.148 14.306 59.328 16.55 23.564 65.166 3899 AFF3 278.65 183.3 30.892 227.31 28.426 22.836 36.823 55024 BANK1 87.887 93.53 35.155 98.414 81.002 42.046 96.465 931 MS4A1 161.02 229.51 115.45 406.1 130.5 190.71 468.78 188.29 83.886 44.602 109.46 38.954 42.475 172.67 931 MS4A1 225.68 328.16 265.38 525.55 198.48 283.11 571.83 199786 FAM129C 702.73 706.12 256.69 301.58 217.31 334.95 1098.2 115350 FCRL1 108.17 132.07 64.362 69.389 74.8 93.924 289.88 191.43 156.86 97.122 121.18 138.05 110.89 567.87 931 MS4A1 80.829 114.15 101.59 113.37 101.97 103.15 253.83 931 MS4A1 326.13 440.54 128.31 417.2 81.803 158.62 326.6 53335 BCL11A 278.77 344.03 188.3 1126.3 142.9 935.66 524.55 26040 SETBP1 182.44 205.55 75.283 105.32 347.1 146.98 127.52 53335 BCL11A 51.388 86.743 146.78 603.73 84.55 594.52 212.77 6.244 13.577 15.288 17.852 17.773 16.565 14.048 8.998 9.784 20.519 27.983 23.596 15.285 39.095 22.09 30.102 44.255 58.244 47.213 46.657 53.954 3514 IGKC 25.025 27.54 26.512 58.57 29.03 25.412 43.521 857 CAV1 32.745 47.461 43.329 83.562 51.181 114.21 120.86 156.03 222.68 145.78 228.12 167.6 153.98 378.45 100379345 MIR181A2HG 1357.6 1006 18.416 25.441 20.915 20.658 43.551 53637 S1PR5 636.77 472.14 16.048 20.789 17.434 18.811 19.978 53637 S1PR5 1050.1 856.24 18.334 27.73 21.672 26.124 41.053 53637 S1PR5 10394 9089.6 32.645 56.232 50.011 38.707 78.204 9231 DLG5 593.45 203.75 22.159 47.671 29.067 22.446 35.15 90102 PHLDB2 3883.5 2824.8 57.803 75.66 44.914 112.46 259.01 79899 PRR5L 1486.1 742.55 54.253 57.897 48.31 112.77 211.31 7049 TGFBR3 4462.7 3660.1 148.41 166.84 82.078 112.41 324.45 1524 CX3CR1 11626 7080.3 846.43 55.954 46.831 65.088 703.38 51348 KLRF1 7620.2 5981.3 75.985 74.24 100.25 97.755 204.09 5775 PTPN4 6757.7 6224.2 130.69 179.31 485.75 147.81 541.49 5775 PTPN4 3242.9 2902.9 90.022 88.882 109.14 78.403 328.46 7049 TGFBR3 14704 12273 167.22 280.79 134 140.35 1264.7 83888 FGFBP2 37240 11588 30.563 76.403 31.688 27.257 521.22 114879 OSBPL5 2031.1 2266.5 101.74 59.833 139.28 77.974 127.23 219285 SAMD9L 2468.3 25077 389.99 535.76 573.04 4217.1 849.73 54877 ZCCHC2 2777.4 13364 2181.8 2110.6 3070.1 2447.8 1979.3 356 FASLG 1767.8 4539.7 170.68 255.05 115.16 146.5 379.82 5920 RARRES3 7967.4 15536 142.96 272 114.99 681.38 388.82 388228 SBK1 1362.5 3717.5 45.33 75.229 66.294 84.376 443.53 219285 SAMD9L 2070.9 15246 608.57 541.2 934.09 3897.5 1137.3 2219 FCN1 671.24 314.21 12909 835.39 177.32 267.64 5507.7 9332 CD163 263.89 77.313 9682.4 8620.1 827.99 239.35 265.16 23601 CLEC5A 1117.4 316.18 19857 11344 2299.7 896.82 347.84 9332 CD163 241.85 36.597 8883.9 7051.5 908.66 212.78 175.95 51313 FAM198B 437.88 202.42 4948.7 822.28 4023.9 569.82 309.26 23166 STAB1 600.3 293.96 10839 1936.2 8595.5 1317.1 174.1 10501 SEMA6B 107.53 73.612 1094.7 910.27 52.127 143.82 30.585 7045 TGFBI 3343 793.16 31162 3217 25407 5132.9 103.22 8536 CAMK1 336.18 168.74 4099.8 349.29 3162 432.58 573.02 23166 STAB1 705.38 383.12 13007 3057.7 9961.8 2083.4 329.11 206358 SLC36A1 249.87 161.79 2534.6 715.27 1603.8 653.16 330.92 913 CD1E 40.886 10.775 97.286 121.26 16075 5709.7 69.112 713 C1QB 77.011 102.19 182.48 146.48 10592 7856.7 41.177 712 C1QA 50.142 86.203 184.27 108.09 7282.4 2928.5 76.151 910 CD1B 106.28 55.634 90.609 383.87 17114 4264.6 170.68 913 CD1E 115.69 80.099 81.505 94.16 6752.7 1417.6 118.17 714 C1QC 139.21 130.21 495.99 88.076 12507 11043 156.99 5480 PPIC 26.824 12.981 32.336 55.873 707.73 310.34 39.174 945 CD33 19.578 19.477 679.76 121.04 1593.4 133.38 60.619 909 CD1A 236.08 255.17 374.32 400.57 17758 3408.6 715.59 2 A2M 212.65 114.82 533.47 194.51 14937 15010 110.11 6357 CCL13 157.64 289.58 242.42 455.08 6434.5 11487 174.82 1193 CLIC2 115.54 209.36 190.72 234.49 3590.7 8375.9 22.283 5577 PRKAR2B 108.68 84.149 166.4 144.73 669.88 3171.9 167.26 6614 SIGLEC1 29.371 89.235 275.86 294.87 710.24 6005.1 49.332 80380 PDCD1LG2 33.651 23.536 50.538 60.569 174.05 1520.5 26.35 942 CD86 137.07 318.48 630.29 242.14 2070.3 8560 203.25 629 CFB 110.84 127.86 139.77 1128.5 252.42 4969.9 187.81 5055 SERPINB2 83.1 95.581 4287.5 24461 98.613 352.89 181.87 55022 PID1 154.69 54.538 7487.2 11205 34.221 105.68 78.269 2921 CXCL3 63.616 22.828 3914.7 27356 131.59 522.63 73.882 6374 CXCL5 20.307 12.939 4063.1 33167 20.269 445.88 102.86 2919 CXCL1 86.887 118.64 6214.2 35585 100.46 1191.3 1368.5 3552 IL1A 112.61 77.232 2599.8 22595 213.69 660.82 323.06 718 C3 62.908 45.944 5647.8 8096.8 246.51 282.92 49.628 6369 CCL24 235.72 198.21 9587.6 13839 113.99 365.61 68.75 3624 INHBA 20.287 104.69 536.09 11449 171.22 4927.5 19.921 8875 VNN2 499.61 320.66 223.25 4735.8 44.71 72.248 19069 1441 CSF3R 24.289 44.759 819.72 100.75 190.43 109.83 10132 64407 RGS18 315.04 200.03 374.78 94.765 1421.8 103.53 10444

(330) Tables 8A-B describe the data of the deconvolution basis signature matrix from (26) that was used by the present inventors to estimate immune cell subset proportions in all discovery cohorts. The present inventors used the version provided by the CellMix package (35). Rows are Affymetrix HG-U133plusV2 probesets, with the first 4 columns providing the probeset ID and the corresponding ENTREZ gene ID, gene symbol and description (if available), as mapped using Bioconductor annotation package hgu133plus2.db. The remaining 17 columns contain the reference expression profiles for each cell subset, which are detailed in Table 10 herein below.

(331) Table 9 herein below, describes the results of the meta-analysis performed on the 3 discovery cohorts. Each row contains the results of testing differences in the proportions of a given cell type in a given cohort between responders and non-responders to the treatment with the Infliximab TNF-alpha inhibitor. The quantity tested was the log 2 fold change log 2 (Responder/Non-responder). The columns provide the following information:

(332) Cohort: cohort ID; Cell type: cell type name; Cl. low: lower bound of the 95% confidence interval of the estimated proportion difference; Cl. up: upper bound of the 95% confidence interval of the estimated proportion difference; estimate: estimated (pseudo-)median proportion difference; p. value: nominal p-value for Wilcoxon rank sum test; Fstat: Fisher combined probability statistic; Fpvalue: nominal p-value for Fisher combined probability test; Ffdr: false discovery rate obtained by adjusting Fpvalue with Benjamini and Hochberg procedure; Significance: significance flag for the nominal Wilcoxon p-values as used in FIG. 4.

(333) TABLE-US-00011 TABLE 9 Table 9. Cohort Cell type CI. low CI. up estimate p. value Fstat Fpvalue Ffdr Significance GSE16879 PC −2.008935664 −0.334124253 −0.802445899 0.005239343 18.70073489 0.000899793 0.004349001 ≤0.05 GSE16879 mono act −1.921136072 −0.555524195 −1.138916477 0.005907491 25.07777803 4.85303E−05 0.000469126 ≤0.05 GSE12251 mono act −1.40090001 −0.146123505 −0.801394223 0.015871126 25.07777803 4.85303E−05 0.000469126 ≤0.05 GSE12251 mono 0.083431836 0.834009379 0.387433072 0.020580039 11.72217689 0.019541354 0.047224938 ≤0.05 GSE14580 PC −1.711129042 −0.110985781 −0.969678819 0.022970314 18.70073489 0.000899793 0.004349001 ≤0.05 GSE14580 DC act 0.070788646 0.848562982 0.428528154 0.022970314 13.38778995 0.009528501 0.030702949 ≤0.05 GSE14580 Mem IgM −4.410775103 −0.443741036 −1.876461659 0.024455936 8.217074503 0.083942424 0.115920491 ≤0.05 GSE14580 NK act 0.158764344 1.114754472 0.614506832 0.029177221 7.643379983 0.105550528 0.133085448 ≤0.05 GSE14580 Tc 0.022416538 2.518080552 0.891074973 0.036817534 9.070169168 0.059369317 0.114780679 ≤0.05 GSE14580 mono act −1.562598302 −0.071899857 −0.685699358 0.038231283 25.07777803 4.85303E−05 0.000469126 ≤0.05 GSE12251 neutro −1.006490965 −0.005595542 −0.409687906 0.042570433 8.368643695 0.078970351 0.115920491 ≤0.05 GSE14580 Tc act −0.049689147 2.400520526 1.304423587 0.079325765 6.093702195 0.192258968 0.223020403 NS GSE12251 DC act −0.150356751 0.693861677 0.242245285 0.140237472 13.38778995 0.009528501 0.030702949 NS GSE16879 mono −0.315416999 0.833763874 0.307548902 0.226839724 11.72217689 0.019541354 0.047224938 NS GSE12251 Tc −0.836041001 2.245527305 0.689010828 0.303696304 9.070169168 0.059369317 0.114780679 NS GSE16879 B aIgM −0.847957179 2.815656569 0.850008944 0.372727273 3.653317908 0.454951927 0.488652069 NS GSE16879 DC act −0.189549359 0.648479142 0.160272986 0.384456617 13.38778995 0.009528501 0.030702949 NS GSE14580 B aIgM −1.77844547 4.402900973 1.401951715 0.431818182 3.653317908 0.454951927 0.488652069 NS GSE16879 neutro −0.557117307 0.627022737 0.21094443 0.482416448 8.368643695 0.078970351 0.115920491 NS GSE12251 DC −1.099228501 0.972877023 0.273246793 0.548961874 1.199452572 0.87818874  0.891865528 NS GSE12251 NK −0.757662222 2.273034201 0.285909939 0.572603867 1.115122267 0.891865528 0.891865528 NS GSE16879 Tc act −0.959908605 1.106714795 0.239515529 0.598901099 6.093702195 0.192258968 0.223020403 NS GSE14580 mono −0.451452948 0.77132921 0.23122276 0.610093396 11.72217689 0.019541354 0.047224938 NS GSE12251 PC −0.767490557 0.396927657 0.044086237 0.722342673 18.70073489 0.000899793 0.004349001 NS GSE14580 neutro −0.351036164 0.636440896 0.094296973 0.741723331 8.368643695 0.078970351 0.115920491 NS GSE16879 NK act −0.980713316 0.729732326 −0.112269758 0.750269339 7.643379983 0.105550528 0.133085448 NS GSE16879 Mem IgM −2.998462888 1.445422883 −0.231855628 0.818181818 8.217074503 0.083942424 0.115920491 NS GSE12251 Mem IgM −1.08237294 0.875547513 −0.086327202 0.821203564 8.217074503 0.083942424 0.115920491 NS GSE16879 Tc −2.490998581 2.028537181 0.099652984 0.959276018 9.070169168 0.059369317 0.114780679 NS “mono act” = M1 Macrophage.

Example 3

(334) Immune Cell Types Analyzed

(335) Table 10 herein below provides the cell type of each subpopulation which can be analyzed (short name or symbol, and cell description), the cell separation method, and the characteristics markers.

(336) TABLE-US-00012 TABLE 10 Table 10. Symbol Cell Type Description Cell Separation Method Markers Th Resting helper T cells RosetteSep CD4+ T- CD45RA-high; CD4+; cell enrichment cocktail CD45RO− Th act Activated helper T cells Plate-bound anti-CD3 and anti-CD28 Tc Resting cytotoxic T cells RosetteSep CD8+ T- CD45RA+; CD8+; CD45RO− cell enrichment cocktail Tc act Activated cytotoxic T Plate-bound anti-CD3 cells and anti-CD28 B Resting B cells MACS CD138 CD19+; CD27-; IgG/A− microbeads and CD19 microbeads B act Activated B cells Anti-CD40 and IL4, 23 hours B aIgM BCR-ligated B cells Anti-IgM, 24 hours Mem IgG IgA/IgG memory B cells sorted CD19+; CD27+; IgM− C19+/CD27+/IgM− Mem IgM IgM memory B cells sorted CD19+; CD27+; IgG/A− C19+/CD27+/IgG/A− PC Plasma cells MACS CD138 CD20 FITC, CD138 PE and microbeads and FACS CD19 APC NK Resting NK cells RosetteSep NK-cell enrichment cocktail plus CD2 microbeads NK act Activated NK cells IL2, 16 hours mono Monocytes MACS CD14 microbeads mono act Activated LPS, 24 hours M1: CD68, CD86, CCR7; M1 Monocytes/Macrophages macrophages differentiated from monocytes M2 M2: CD68, CD 163, CD206 macrophages (MR); DC Resting dendritic cells Differentiated from monocytes with IL4 and GMCSF DC act Activated dendritic cells LPS, 24 hours neutro Neutrophils Ficoll gradient centrifugation of heparanized blood

(337) Table 11 describes the frequencies of the subpopulation of cells in TNF-alpha inhibitor responders versus non-responders.

(338) TABLE-US-00013 TABLE 11 Table 11. Confidence intervals (95% CI) and non-overlapping exemplary ranges [representative (Repr.) range] of proportions estimated by computational deconvolution for cell types that showed significant differences in at least one of the discovery cohorts, and optimal cutoff for the plasma cell clinician index (PC-index) and automated quantitation quantitative score (PC-score) from immunostaining in the validation cohort. Non-responders Responders Non-responders Responders Cohort Cell type 95% CI 95% CI Repr. range Repr. range GSE16879 PC 0.082-0.261 0.052-0.105 0.105-0.261 0.052-0.082 GSE16879 mono act 0.062-0.113 0.024-0.059 0.062-0.113 0.024-0.059 M1 GSE12251 mono act 0.089-0.171 0.052-0.094 0.094-0.171 0.052-0.089 M1 GSE12251 mono 0.057-0.079 0.073-0.129 0.057-0.073 0.079-0.129 GSE14580 PC 0.123-0.264 0.057-0.145 0.145-0.264 0.057-0.123 GSE14580 DC act 0.193-0.292 0.282-0.350 0.193-0.282 0.292-0.350 GSE14580 Mem IgM 0.059-0.165 0.002-0.091 0.091-0.165 0.002-0.059 GSE14580 NK act 0.052-0.095 0.073-0.139 0.052-0.073 0.095-0.139 GSE14580 Tc 0.011-0.031 0.017-0.050 0.011-0.017 0.031-0.050 GSE14580 mono act 0.088-0.130 0.026-0.101 0.101-0.130 0.026-0.088 M1 GSE12251 neutro 0.115-0.212 0.089-0.135 0.135-0.212 0.089-0.115 Validation PC-Index ≥2 ≤1 Validation PC-Score ≥0.056 <0.056

Example 4

(339) The present inventors have surprisingly uncovered that the predictive power of the gene signatures of some embodiments of the invention is much higher when the inflammation status of the tissue is accounted for. The present inventors have assessed the training set predictive power as single cellular biomarkers by ROC analysis in each GEO cohort separately. Activated monocyte proportions achieved high AUC values in all cohorts (AUC=77%, 82% and 890/% in the *UC-A*, *UC-B* and *CDc* cohorts respectively). Plasma cell proportions performed similarly well in cohorts *UC-A* and *CDc* (AUC=79% and 88% respectively), but gave a weaker signal in cohort *UC-B* (AUC=45%), which was expected since proportion differences were not found significant in this cohort in first place. In exploratory cohorts UC-A and CDc the collected tissues were all from inflamed mucosa sites, as opposed to cohort UC-B wherein the tissue samples included both normal and inflamed biopsies. Hence, the ROC curves for UC-A and CDc have a much higher % AUC than the UC-B cohort.

(340) The present inventors have carried out an additional validation, whereby the present inventors included a cohort of normal and inflamed biopsy samples from IBD patients. Plasma cell numbers from non inflamed biopsies of 9 non responders and 20 responders were collected, and from inflamed tissue sites of 7 responders and 5 non-responders prior to anti-TNF therapy initiation. Thus, as shown in FIG. 12, the plasma cell proportions in inflamed colon tissue can predict response to infliximab (IFX) prior to treatment initiation with high and unprecedented accuracy.

(341) It should be noted that a mixed tissue biopsy (i.e., having inflamed and non-inflamed cells) is sufficient for determining the responsiveness of the subject to anti-TNF therapy based on frequencies of macrophages and plasma cells in some cohorts.

(342) In addition, it should be noted that a tissue biopsy from an inflamed area, e.g., which includes mainly inflamed cells, is sufficient for determining the responsiveness of the subject to anti-TNF therapy based on frequencies of plasma cells and macrophages.

(343) Analysis and Discussion

(344) The treatment of IBDs using monoclonal antibodies against TNF-alpha has shown to be very effective in achieving complete mucosal remission, however only in 60% of patients (3). This high failure rate, together with the unavailability of a reliable test to predict response, the high cost of anti-TNF biologics and many major side effects on the patients' immune system greatly undermine the benefit/cost ratio of such an otherwise effective therapy. In this work, the present inventors used a cell-centered approach based on computational methods to elucidate cell subsets whose proportions can predict response to anti-TNF therapy in IBD patients, prior starting treatment. By validating the present inventors' findings in paraffin embedded stained biopsies the present inventors show that such prediction is easily possible in a clinical setting.

(345) Previous attempts to find predictive biomarkers used gene expression assays on bulk colon biopsies (4, 5). Traditional analysis of gene expression data look for genes that show differential expression patterns between conditions. However, due to both technical and biological variability, gene-based signatures are commonly difficult to reproduce. In this context, looking at functionally coordinated modules such as pathways or co-expression network is known to greatly improve robustness of findings. In a similar way, cells can be considered as the fundamental functional units whose coordinated gene expression programs are regulated according to conditions and stimuli. In disease conditions, in particular, immune cell subsets home to target tissues where they may turn to fight the cause of disease or in the worst scenario exacerbate the existing pathology if their actions are dis-regulated. This is all the more the case for inflammatory diseases such as IBD where immune activity has a role in pathogenesis. This inflammatory process involves interaction between different subsets of immune cells as well as cross talk with cells of the gut tissue through cytokine signaling, overall forming a complex dynamic system (17). The present inventors' approach identified immune cells as major contributors to gene signatures of colon tissue in IBD. Thus, the present inventors focused efforts on looking for biomarkers within the main actors of this system, i.e. the variety of immune cell subsets. For this reason, the present inventors expect these predictions to be more robust and reproducible than gene/pathway based biomarkers. An additional advantage of this cell-centered approach lays in the interpretability of the results, because they directly point to specific cell subsets, from which it is easier to derive immunological and mechanistic hypotheses. Last but not least, cell subset proportions are easily and accurately assayed in clinical settings, for example in the routinely stored biopsies in the case of IBD. In an in-silico discovery phase, the present inventors used computational deconvolution techniques to estimate the proportions of infiltrating immune cell subsets in colon tissues directly from public gene expression data of bulk tissue. While batch effects, tissue or disease heterogeneity makes proportion estimates from separate cohorts not directly comparable, group differences in proportions (fold change) within each cohort are comparable and indicative of differential immune compartment (27). By formally integrating these observed differences across multiple cohorts, the present inventors were able to capture the most consistent signal within a heterogeneous technical and biological background, in a similar way as gene-based meta-analysis are performed (19, 24). The present inventors' approach detected that non-responders have consistently greater proportions of activated monocytes and plasma cells than responders. When validating these finding, the present inventors found that macrophage proportions were not predictive of response, although showing the most consistent differences across all discovery cohorts. This may be due to a discrepancy between the resolution of their in-silico estimates and their assessment in the stained biopsies. Indeed, the reference gene expression profile used to estimate the proportion of activated monocytes was generated from monocytes 24 hours after in-vitro stimulation with LPS (26), which would qualify them as classically activated macrophages (M1). These are also known as inflammatory macrophages, due to their secretion of pro-inflammatory cytokines such as TNFα, IL-1β, IL-6 and IL-12 (36). The present inventors are currently investigating if M1 or M2 macrophages proportions could indeed provide accurate response prediction. However, these two cell subsets are thought to be the two extreme of a continuum phenotype, with their respective markers being rather quantitative than binary. This may prevent their distinction by staining, and require more advanced technology like flow-cytometry which are not directly implementable in routine clinical protocols. Nonetheless, the predictive power of plasma cells is remarkable. Moreover, immunostaining for CD138+ cells can be done using antibodies that are known to be very specific and efficient on this cell population, which presents the additional characteristics of being also distinguishable by morphology. Overall, this promises to provide a robust and accurate prediction clinical assay.

(346) Infliximab has been shown to induce monocyte apoptosis in patients with chronic active CD, which could explain its strong anti-inflammatory effect (28). Basal plasmacytosis, defined as a dense infiltration of plasma cells in the lower one third of the mucosa (29), is considered to be an early feature of IBD (30). The presence of basal plasmacytosis in colon biopsies of UC patients has notably been identified as an independent predictor of shorter time to clinical relapse (29).

(347) It is well known that dysregulation of various immune cell populations can be seen in the gut of patients with IBD. Their inflamed gut may become massively infiltrated with B cells alongside with IgA+ and IgG+ plasma cells, depending on the severity of inflammation, though the mechanisms of this recruitment are not fully clear (31-33). In this context, it is believed that the intestinal microbiota plays a key role in driving inflammatory responses during disease development and progression. Palm et al investigated the involvement of mucosal IgA (secreted by plasma cells) in IBD gut barrier function, and have shown that bacteria taxa-specific levels of IgA might distinguish between members of the microbiota that impact disease susceptibility and/or severity, and the remaining members of the microbiota (37) emphasizing the role of IgA+ mucosal plasma cells in gut homeostasis and disease. In UC, plasma cells also produce non-specific Antibodies, such as perinuclear anti-cytoplasmic neutrophil (pANCA) (38). Absence of this antibody was strongly associated with better response to Infliximab (39,40).

(348) IgG antibodies are the most abundant serum immunoglobulins, involved in the secondary immune response, and their numbers increase in response to infection, chronic inflammation, and autoimmune diseases (41,42). IgG-producing plasma cells heavily infiltrate the inflamed mucosa of patients with IBD. It was suggested that IgG plasma cells create immune complexes (IC) with their specific antigens. This IgG-IC activates intestinal macrophages via their FcγRs, and exacerbating intestinal inflammation, demonstrating plasma cell-macrophage cooperation as another potent inducer of intestinal inflammation besides commensal bacteria. Recently, FcγRIIA was also identified as a susceptible gene of UC in Japanese and European descent populations (43,44). In vitro IgG-IC stimulation caused increasing number of macrophages in the inflamed mucosa of UC patients, and induced the extensive production of pro-inflammatory cytokines such as TNF, IL-1β and IL-6. In addition, neutrophil expression of FcγRI is upregulated in adult patients with clinically active IBD (45). The high numbers of plasma cells together with activated monocytes in the present inventors' predictive signature can point to involvement of this signaling pathway by lamina propria mononuclear cells (LPMCs) (46).

(349) The present inventors validated these results for plasma cells in a completely independent set of 20 IBD samples (UC, CD, IBDU) by staining biopsy slides for CD138 positive cells. Proportions obtained by automated quantitation achieved very high accuracy (AUC 82.4%).

(350) Taken together, the present inventors' predictive assay is easily applicable in clinical settings and can dramatically improve the cost/benefit of anti-TNF therapy prescription for IBD patients. In future, a similar approach will be tested to achieve a higher resolution insight into the nature of macrophage subsetting in IBD biopsies, to derive an additional predictive value from biopsies obtained routinely prior to anti-TNF therapy initiation.

(351) Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

(352) All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.

REFERENCES

Additional References are Cited in Text

(353) 1. S. B. Hanauer, B. G. Feagan, G. R. Lichtenstein, L. F. Mayer, S. Schreiber, J. F. Colombel, D. Rachmilewitz, D. C. Wolf, A. Olson, W. Bao, P. Rutgeerts, Maintenance infliximab for Crohn's disease: The ACCENT I randomised trial, Lancet 359, 1541-1549 (2002). 2. G. R. Lichtenstein, S. Yan, M. Bala, M. Blank, B. E. Sands, Infliximab maintenance treatment reduces hospitalizations, surgeries, and procedures in fistulizing Crohn's disease, Gastroenterology 128, 862-869 (2005). 3. S. Ben-Horin, U. Kopylov, Y. Chowers, Optimizing anti-TNF treatments in inflammatory bowel disease, Autoimmunity Reviews 13, 24-30 (2014). 4. I. Arijs, K. Li, G. Toedter, R. Quintens, L. Van Lommel, K. Van Steen, P. Leemans, G. De Hertogh, K. Lemaire, M. Ferrante, F. Schnitzler, L. Thorrez, K. Ma, X-Y. R. Song, C. Marano, G. Van Assche, S. Vermeire, K. Geboes, F. Schuit, F. Baribaud, P. Rutgeerts, Mucosal gene signatures to predict response to infliximab in patients with ulcerative colitis., Gut 58, 1612-9 (2009). 5. I. Arijs, R. Quintens, L. Van Lommel, K. Van Steen, G. De Hertogh, K. Lemaire, A. Schraenen, C. Perrier, G. Van Assche, S. Vermeire, K. Geboes, F. Schuit, P. Rutgeerts, Predictive value of epithelial gene expression profiles for response to infliximab in Crohn's disease, Inflammatory bowel diseases 16, 2090-8 (2010). 6. Q. Chen, L. Rabach, P. Noble, T. Zheng, C. G. Lee, R. J. Homer, J. A. Elias, IL-11 receptor alpha in the pathogenesis of IL-13-induced inflammation and remodeling, Journal of immunology (Baltimore, Md.: 1950) 174, 2305-13 (2005). 7. A. J. Ashcroft, S. M. Cruickshank, P. I. Croucher, M. J. Perry, S. Rollinson, J. M. Lippitt, J. A. Child, C. Dunstan, P. J. Felsburg, G. J. Morgan, S. R. Carding, Colonic dendritic cells, intestinal inflammation, and T cell-mediated bone destruction are modulated by recombinant osteoprotegerin, Immunity 19, 849-61 (2003). 8. A. J. Ashcroft, S. R. Carding, RANK ligand and osteoprotegerin: emerging roles in mucosal inflammation, Gut 54, 1345-6 (2005). 9. P. Mannon, W. Reinisch, Interleukin 13 and its role in gut defence and inflammation, Gut 61, 1765-73 (2012). 10. H. Kefalakes, T. J. Stylianides, G. Amanakis, G. Kolios, Exacerbation of inflammatory bowel diseases associated with the use of nonsteroidal anti-inflammatory drugs: myth or reality?, European journal of clinical pharmacology 65, 963-70 (2009). 11. J. L. Wallace, Prostaglandin biology in inflammatory bowel disease, Gastroenterology clinics of North America 30, 971-80 (2001). 12. C. Chen, M. S. Jamaluddin, S. Yan, D. Sheikh-Hamad, Q. Yao, Human stanniocalcin-1 blocks TNF-alpha-induced monolayer permeability in human coronary artery endothelial cells, Arteriosclerosis, thrombosis, and vascular biology 28, 906-12 (2008). 13. B. Mesko, S. Poliska, A. Vnmcsa, Z. Szekanecz, K. Palatka, Z. Hollo, A. Horvath, L. Steiner, G. Zahuczky, J. Podani, A. Nagy, Peripheral blood derived gene panels predict response to infliximab in rheumatoid arthritis and Crohn's disease, Genome Medicine 5, 59 (2013). 14. B. Khor, A. Gardet, R. J. Xavier, Genetics and pathogenesis of inflammatory bowel disease, Nature 474, 307-317 (2011). 15. M. C. Dubinsky, L. Mei, M. Friedman, T. Dhere, T. Haritunians, H. Hakonarson, C. Kim, J. Glessner, S. R. Targan, D. P. McGovern, K. D. Taylor, J. I. Rotter, Genome wide association (GWA) predictors of anti-TNFalpha therapeutic responsiveness in pediatric inflammatory bowel disease, Inflammatory bowel diseases 16, 1357-66 (2010). 16. M. K. Magnusson, H. Strid, M. Sapnara, A. Lasson, A. Bajor, K.-A. Ung, L. Öhman, Anti-TNF therapy response in patients with ulcerative colitis is associated with colonic anti-microbial peptide expression and microbiota composition, Journal of Crohn's and Colitis, jjw051 (2016). 17. C. Abraham, R. Medzhitov, Interactions between the host innate immune system and microbes in inflammatory bowel disease, Gastroenterology 140, 1729-1737 (2011). 18. S. S. Shen-Orr, R. Gaujoux, Computational deconvolution: extracting cell type-specific information from heterogeneous samples, Current opinion in immunology 25, 571-8 (2013). 19. R. Chen, P. Khatri, P. K. Mazur, M. Polin, Y. Zheng, D. Vaka, C. D. Hoang, J. Shrager, Y. Xu, S. Vicent, A. J. Butte, E. A. Sweet-Cordero, A meta-Analysis of lung cancer gene expression identifies PTK7 as a survival gene in lung adenocarcinoma, Cancer Research 74, 2892-2902 (2014). 20. F. Baribaud, X. K. Li, Markers and Methods for Assessing and Treating Ulcerative Colitis and Related Disorders Using a 20 Gene Panel (available at www(dot)faqs(dot)org/patents/app/20100069256). 21. T. F. Mueller, G. Einecke, J. Reeve, B. Sis, M. Mengel, G. S. Jhangri, S. Bunnag, J. Cruz, D. Wishart, C. Meng, G. Broderick, B. Kaplan, P. F. Halloran, Microarray analysis of rejection in human kidney transplants using pathogenesis-based transcript sets, American Journal of Transplantation 7, 2712-2722 (2007). 22. B. Halloran, J. Chang, D. Q. Shih, D. McGovern, K. Famulski, C. Evaschesen, R. N. Fedorak, A. Thiesen, S. Targan, P. F. Halloran, Molecular patterns in human ulcerative colitis and correlation with response to infliximab. Inflammatory bowel diseases 20, 2353-63 (2014). 23. S. Hanzelmann, R. Castelo, J. Guinney, GSVA: gene set variation analysis for microarray and RNA-seq data. BMC bioinformatics 14, 7 (2013). 24. T. E. Sweeney, A. Shidham, H. R. Wong, P. Khatri, A comprehensive time-course—based multicohort analysis of sepsis and sterile inflammation reveals a robust diagnostic gene set, Science Translational Medicine 7, 1-16 (2015). 25. T. Barrett, D. B. Troup, S. E. Wilhite, P. Ledoux, C. Evangelista, I. F. Kim, M. Tomashevsky, K. a Marshall, K. H. Phillippy, P. M. Sherman, R. N. Muertter, M. Holko, O. Ayanbule, A. Yefanov, A. Soboleva, NCBI GEO: archive for functional genomics data sets-10 years on. Nucleic acids research 39, D1005-10 (2011). 26. A. R. Abbas, K. Wolslegel, D. Seshasayee, Z. Modrusan, H. F. Clark, Deconvolution of blood microarray data identifies cellular activation patterns in systemic lupus erythematosus. PloS one 4, e6098 (2009). 27. P. Karpiński, D. Frydecka, M. M. Sasiadek, B. Misiak, Reduced number of peripheral natural killer cells in schizophrenia but not in bipolar disorder, Brain, Behavior, and Immunity (2016), doi: 10.1016/j.bbi.2016.02.005. 28. A. Lügering, M. Schmidt, N. Luigering, H. G. Pauels, W. Domschke, T. Kucharzik, Infliximab induces apoptosis in monocytes from patients with chronic active Crohn's disease by using a caspase-dependent pathway. Gastroenterology 121, 1145-57 (2001). 29. a Bitton, M. a Peppercorn, D. a Antonioli, J. L. Niles, S. Shah, a Bousvaros, B. Ransil, G. Wild, a Cohen, M. D. Edwardes, a C. Stevens, Clinical, biological, and histologic parameters as predictors of relapse in ulcerative colitis. Gastroenterology 120, 13-20 (2001). 30. V. Villanacci, E. Antonelli, G. Reboldi, M. Salemme, G. Casella, G. Bassotti, Endoscopic biopsy samples of naïve “colitides” patients: role of basal plasmacytosis, Journal of Crohn's & colitis 8, 1438-43 (2014). 31. F. Schnitzler, H. Fidder, M. Ferrante, M. Noman, I. Arijs, G. Van Assche, I. Hoffman, K. Van Steen, S. Vermeire, P. Rutgeerts, Long-term outcome of treatment with infliximab in 614 patients with Crohn's disease: results from a single-centre cohort, Gut 58, 492-500 (2009). 32. D. Reijasse, C. Le Pendeven, J. Cosnes, A. Dehee, J.-P. Gendre, J.-C. Nicolas, L. Beaugerie, Epstein-Barr virus viral load in Crohn's disease: effect of immunosuppressive therapy, Inflammatory bowel diseases 10, 85-90 (2004). 33. R. S. Wallis, M. S. Broder, J. Y. Wong, M. E. Hanson, D. O. Beenhouwer, Granulomatous Infectious Diseases Associated with Tumor Necrosis Factor Antagonists, Clinical Infectious Diseases 38, 1261-1265 (2004). 34. A. R. Abbas, D. Baldwin, Y. Ma, W. Ouyang, A. Gurney, F. Martin, S. Fong, M. van Lookeren Campagne, P. Godowski, P. M. Williams, a C. Chan, H. F. Clark, Immune response in silico (IRIS): immune-specific genes identified from a compendium of microarray expression data. Genes and immunity 6, 319-31 (2005). 35. R. Gaujoux, C. Seoighe, CellMix: A Comprehensive Toolbox for Gene Expression Deconvolution. Bioinformatics (Oxford, England), 1-2 (2013). 36. F. O. Martinez, S. Gordon, M. Locati, A. Mantovani, Transcriptional profiling of the human monocyte-to-macrophage differentiation and polarization: new molecules and patterns of gene expression. Journal of immunology (Baltimore, Md.: 1950) 177, 7303-11 (2006). 37. N. W. Palm, M. R. De Zoete, T. W. Cullen, N. A. Barry, J. Stefanowski, L. Hao, P. H. Degnan, J. Hu, I. Peter, W. Zhang, E. Ruggiero, J. H. Cho, A. L. Goodman, R. A. Flavell, Immunoglobulin A coating identifies colitogenic bacteria in inflammatory bowel disease, Cell 158, 1000-1010 (2014). 38. J. A. Rump, J. Schölmerich, V. Gross, M. Roth, R. Helfesrieder, A. Rautmann, J. Lüdemann, W. L. Gross, H. H. Peter, A new type of perinuclear anti-neutrophil cytoplasmic antibody (p-ANCA) in active ulcerative colitis but not in Crohn's disease. Immunobiology 181, 406-13 (1990). 39. M. Ferrante, S. Vermeire, K. H. Katsanos, M. Noman, G. Van Assche, F. Schnitzler, I. Arijs, G. De Hertogh, I. Hoffman, J. K. Geboes, P. Rutgeerts, Predictors of early response to infliximab in patients with ulcerative colitis. Inflammatory bowel diseases 13, 123-8 (2007). 40. M. Jürgens, R. P. Laubender, F. Hartl, M. Weidinger, J. Seiderer, J. Wagner, M. Wetzke, F. Beigel, S. Pfennig, J. Stallhofer, F. Schnitzler, C. Tillack, P. Lohse, B. Göke, J. Glas, T. Ochsenkühn, S. Brand, Disease activity, ANCA, and IL23R genotype status determine early response to infliximab in patients with ulcerative colitis. The American journal of gastroenterology 105, 1811-9 (2010). 41. S. E. Plevy, C. J. Landers, J. Prehn, N. M. Carramanzana, R. L. Deem, D. Shealy, S. R. Targan, A role for TNF-alpha and mucosal T helper-1 cytokines in the pathogenesis of Crohn's disease. Journal of immunology (Baltimore, Md.: 1950) 159, 6276-82 (1997). 42. F. Hiepe, T. DOrner, A. E. Hauser, B. F. Hoyer, H. Mei, A. Radbruch, Long-lived autoreactive plasma cells drive persistent autoimmune inflammation, Nature reviews. Rheumatology 7, 170-8 (2011). 43. D. P. B. McGovern, A. Gardet, L. Torkvist, P. Goyette, J. Essers, K. D. Taylor, B. M. Neale, R. T. H. Ong, C. Lagace, C. Li, T. Green, C. R. Stevens, C. Beauchamp, P. R. Fleshner, M. Carlson, M. D'Amato, J. Halfvarson, M. L. Hibberd, M. Lordal, L. Padyukov, A. Andriulli, E. Colombo, A. Latiano, O. Palmieri, E.-J. Bernard, C. Deslandres, D. W. Hommes, D. J. de Jong, P. C. Stokkers, R. K. Weersma, Y. Sharma, M. S. Silverberg, J. H. Cho, J. Wu, K. Roeder, S. R. Brant, L. P. Schumm, R. H. Duerr, M. C. Dubinsky, N. L. Glazer, T. Haritunians, A. Ippoliti, G. Y. Melmed, D. S. Siscovick, E. A. Vasiliauskas, S. R. Targan, V. Annese, C. Wijmenga, S. Pettersson, J. I. Rotter, R. J. Xavier, M. J. Daly, J. D. Rioux, M. Seielstad, Genome-wide association identifies multiple ulcerative colitis susceptibility loci. Nature genetics 42, 332-7 (2010). 44. K. Asano, T. Matsushita, J. Umeno, N. Hosono, A. Takahashi, T. Kawaguchi, T. Matsumoto, T. Matsui, Y. Kakuta, Y. Kinouchi, T. Shimosegawa, M. Hosokawa, Y. Arimura, Y. Shinomura, Y. Kiyohara, T. Tsunoda, N. Kamatani, M. lida, Y. Nakamura, M. Kubo, A genome-wide association study identifies three new susceptibility loci for ulcerative colitis in the Japanese population. Nature genetics 41, 1325-9 (2009). 45. P. Minar, Y. Haberman, I. Jurickova, T. Wen, M. E. Rothenberg, M.-O. Kim, S. A. Saeed, R. N. Baldassano, M. Stephens, J. Markowitz, J. Rosh, W. V. Crandall, M. B. Heyman, D. R. Mack, A. M. Griffiths, S. S. Baker, J. S. Hyams, S. Kugathasan, L. A. Denson, Utility of neutrophil Fcγ receptor I (CD64) index as a biomarker for mucosal inflammation in pediatric Crohn's disease. Inflammatory bowel diseases 20, 1037-48 (2014). 46. M. Uo, T. Hisamatsu, J. Miyoshi, D. Kaito, K. Yoneno, M. T. Kitazume, M. Mori, A. Sugita, K. Koganei, K. Matsuoka, T. Kanai, T. Hibi, Mucosal CXCR4+ IgG plasma cells contribute to the pathogenesis of human ulcerative colitis through FcγR-mediated CD14 macrophage activation. Gut 62, 1734-44 (2013).