SPHEROIDS FOR SUPPRESSING IMMUNE REJECTION AND USES THEREOF
20230165903 · 2023-06-01
Assignee
Inventors
Cpc classification
A61K31/436
HUMAN NECESSITIES
A61K9/5031
HUMAN NECESSITIES
A61K9/1694
HUMAN NECESSITIES
C12N5/0667
CHEMISTRY; METALLURGY
A61P37/06
HUMAN NECESSITIES
A61K35/28
HUMAN NECESSITIES
International classification
A61K35/28
HUMAN NECESSITIES
A61K31/436
HUMAN NECESSITIES
A61K9/16
HUMAN NECESSITIES
A61P37/06
HUMAN NECESSITIES
Abstract
The present disclosure relates to spheroids for suppressing immune rejection including mesenchymal stem cells and rapamycin microparticles, uses thereof, and a preparation method thereof, wherein the spheroids includes the mesenchymal stem cells and rapamycin microparticles have increased PD-L1 expression of mesenchymal stem cells by the rapamycin microparticles such that the spheroids in which PD-L1 expression on the surface is increased suppress T cells and inflammatory responses that induce immune rejection to the pancreatic islet cells transplanted in vivo, thereby exhibiting the effect of maintaining a survival period and insulin secretion functions of transplanted pancreatic islet cells for a long time.
Claims
1. Spheroids which comprise mesenchymal stem cells and rapamycin microparticles and in which PD-L1 expression is increased.
2. The spheroids of claim 1, wherein the rapamycin microparticles comprise, with respect to 100 parts by weight of the microparticles, 0.1 to 50 parts by weight of rapamycin and 50 to 99.9 parts by weight of a polymer.
3. The spheroids of claim 2, wherein the polymer is selected from the group consisting of poly(lactic-co-glycolic acid) (PLGA), chitosan, hyaluronic acid, collagen, gelatin, and albumin.
4. The spheroids of claim 1, wherein the mesenchymal stem cells are included in an amount of 1×10.sup.4 to 3×10.sup.4 cells per spheroid.
5. The spheroids of claim 1, wherein the rapamycin is included in an amount of 10 to 200 ng per spheroid.
6. The spheroids of claim 1, wherein, in the spheroids, PD-L1 expression of the mesenchymal stem cells is increased by the rapamycin microparticles, and immune rejection of a transplant is suppressed by the increased PD-L1 expression.
7. The spheroids of claim 6, wherein the transplant is one or more cells selected from the group consisting of stem cells, pancreatic islet cells, epithelial cells, fibroblasts, osteoblasts, chondrocytes, cardiomyocytes, hepatocytes, human-derived cord blood cells, endothelial progenitor cells, and myoblasts.
8. A composition for suppressing immune rejection, comprising the spheroids of claim 1 as an active ingredient.
9. A method of preparing spheroids for suppressing immune rejection of a transplant, the method comprising: preparing rapamycin microparticles in which rapamycin is encapsulated with a polymer (first operation); preparing a suspension by mixing the rapamycin microparticles and mesenchymal stem cells in a growth medium (second operation); preparing cell-particle fusion spheroids by injecting the suspension into a polymer solution and then culturing the same (third operation); and collecting the spheroids (fourth operation).
10. The method of claim 9, wherein the suspension of the third operation comprises 1×10.sup.4 to 3×10.sup.4 mesenchymal stem cells in 2 μl of a growth medium and 10 to 200 ng of rapamycin.
11. The method of claim 9, wherein the third operation is to condense cell particles by injecting the suspension into a methyl cellulose solution and then culturing the same at 37° C. for 1 to 3 hours.
12. A method of preventing or treating diabetes, comprising: administering a cell therapy composition the spheroids of claim 1 and pancreatic islet cells as active ingredients to a subject in need thereof.
13. The method of claim 12, wherein the spheroids comprise 0.1×10.sup.6 to 5×10.sup.6 mesenchymal stem cells.
14. The method of claim 12, comprising 200 to 5000 islet equivalents (IEQs) of the pancreatic islet cells.
15. The method of claim 12, wherein the spheroids in which PD-L1 expression is increased and immune rejection for transplanted pancreatic islet cells is suppressed prolong a survival period and an insulin release period of pancreatic islet cells.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
DETAILED DESCRIPTION
[0021] Hereinafter, the present disclosure will be described in more detail.
[0022] The present disclosure relates to a technology for providing spheroids including mesenchymal stem cells and rapamycin microparticles, wherein the rapamycin microparticles increase PD-L1 expression of mesenchymal stem cells such that it was found that the spheroids with increased PD-L1 expression on the surface suppressed T cells and inflammatory responses that induce immune rejection to the transplanted pancreatic islet cells in vivo, thereby showing the effect of maintaining the survival period and insulin secretion function of the transplanted pancreatic islet cells for a long time. The inventors of the present disclosure have completed the present disclosure to provide the spheroid including the mesenchymal stem cells and rapamycin microparticles as a composition for suppressing immune rejection of a cell transplant.
[0023] The present disclosure may provide spheroids which include mesenchymal stem cells and rapamycin microparticles and in which PD-L1 expression is increased.
[0024] The rapamycin microparticles may include 0.1 to 50 parts by weight of rapamycin and 50 to 99.9 parts by weight of a polymer based on 100 parts by weight of the microparticles.
[0025] The polymer may be selected from the group consisting of poly(lactic-co-glycolic acid) (PLGA), chitosan, hyaluronic acid, collagen, gelatin, and albumin.
[0026] The mesenchymal stem cells may include 1×10.sup.4 to 3×10.sup.4 cells per spheroid.
[0027] The mesenchymal stem cells (MSCs) may be derived from adipose tissue, but is not limited thereto.
[0028] The rapamycin may be included in an amount of 10 to 200 ng per spheroid.
[0029] The spheroids may be one in which PD-L1 expression of mesenchymal stem cells is increased by rapamycin, and immune rejection of the transplant is suppressed by increased PD-L1 expression.
[0030] The transplant may be one or more endocrine cells selected from the group consisting of stem cells, pancreatic islet cells, epithelial cells, fibroblasts, osteoblasts, chondrocytes, cardiomyocytes, hepatocytes, human-derived cord blood cells, endothelial progenitor cells, and myoblasts.
[0031] The present disclosure may provide a composition for suppressing immune rejection, including the spheroids as an active ingredient.
[0032] The present disclosure may provide a method of preparing spheroids for suppressing immune rejection of a transplant, including preparing rapamycin microparticles in which rapamycin is encapsulated with a polymer (first operation); preparing a suspension by mixing the rapamycin microparticles and mesenchymal stem cells in a growth medium (second operation); preparing cell-particle fusion spheroids by injecting the suspension into a polymer solution and then culturing the same (third operation); and collecting the spheroids (fourth operation).
[0033] The suspension of the third operation may include 1×10.sup.4 to 3×10.sup.4 mesenchymal stem cells in 2 μl of a growth medium and 10 to 200 ng of rapamycin.
[0034] The third operation may be to condense the cell particles by injecting the suspension into the polymer solution and then culturing the same for 1 to 3 hours at 37° C.
[0035] The polymer solution may be a methyl cellulose solution.
[0036] In addition, the present disclosure may provide a cell therapy composition for preventing or treating diabetes, including the spheroids and pancreatic islet cells as active ingredients.
[0037] The transplant may include 0.1×10.sup.6 to 5×10.sup.6 mesenchymal stem cells and 200 to 5000 pancreatic islet equivalents (IEQs) of islet cells.
[0038] In the spheroid, PD-L1 expression is increased, and immune rejection for the transplanted pancreatic islet cells is suppressed to prolong the survival period and insulin release period of the pancreatic islet cells.
[0039] Hereinafter, to help the understanding of the present disclosure, example embodiments will be described in detail. However, the following example embodiments are merely illustrative of the content of the present disclosure, and the scope of the present disclosure is not limited to the following example embodiments. The example embodiments of the present disclosure are provided to more completely explain the present disclosure to those of ordinary skill in the art.
Experimental Example
[0040] The following experimental examples are intended to provide experimental examples commonly applied to each example embodiment according to the present disclosure.
[0041] 1. Preparation of RAP-MPs and Characteristic Analysis
[0042] Rapamycin (RAP) was encapsulated into PLGA microspheres (RAP-MP) using an oil-in-water emulsification (T. T. Nguyen, et al., Biomaterials 221, 119415, 2019). Briefly, poly(lactic-co-glycolic acid) (PLGA), Resomer RG504 H (76 mg; Sigma-Aldrich), and RAP (4 mg; LC Laboratories, Woburn, Mass.) were dissolved in dichloromethane (1 mL; Junsei Chemical, Japan). Next, the organic phase was homogenized in polyvinyl alcohol (PVA, 1%, 5 mL; Sigma-Aldrich) solution at 21,000 rpm for 4 minutes to prepare an emulsion. After stabilizing the emulsion in an excess of PVA solution for 4 hours, RAP-MP was collected from 5 cycles of centrifugal washing operation, and finally, RAP-MP was lyophilized to obtain dry powder for further experiments. The size of RAP-MP and chemical properties of RAP were checked using a scanning electron microscope (SEM, S-4100; Hitachi, Tokyo, Japan) and Fourier transform infrared spectroscopy (FT-IR; Nicolet Nexus 670 FTIR Spectrometer, Thermo Fisher Scientific), respectively.
[0043] In addition, the loading capacity of RAP-MP was determined by HPLC method. Briefly, RAP was extracted from RAP-MP using acetonitrile (ACN) and filtered through a 0.22 μm membrane.
[0044] Chromatographic parameters were as follows: Inertsil column (4.6×150 mm, 5 μm; GL Sciences, Tokyo, Japan), isocratic mobile phase in which ACN: H.sub.2O (85:15) is included per 1 ml/min, peak detection at 280 nm, and 60° C. for column temperature.
[0045] The in vitro release test for RAP-MP was performed in phosphate buffered saline (PBS, pH 7.4) in which 10% Tween 20 is contained. The microsphere suspension was incubated while keeping a shaking incubator (SI-64, 150; Hanyang Scientific Equipment Co., Ltd., South Korea) at 37° C. and 150 rpm.
[0046] At each determined time point, the supernatant was collected to quantify RAP levels.
[0047] 2. Isolation of Mouse Adipocyte-Derived Mesenchymal Stem Cells (MSCs) and Characteristic Analysis
[0048] All animal experiments were approved by the Institutional Review Board of Yeungnam University in Korea in accordance with national guidelines. Mesenchymal stem cells were isolated from C57BL6 mice (male, 8-10 week-old; Samtako, South Korea) by a method slightly modified from the previous protocol (P. Anderson, et al., Bio-protocol 5, e1642-e1642, 2015; G. Yu, et al., Methods Mol. Biol. 702, 29-36, 2011).
[0049] Briefly, mice were sacrificed by cervical dislocation, sterilized by immersing in 70% ethanol, and collected by exposing subcutaneous adipose tissue, cut into small pieces, and digested with 0.1% collagenase type P solution at 37° C. at 80 rpm for 30 minutes.
[0050] Thereafter, complete MEM-α medium was added to neutralize the enzyme activity, and then centrifuged at 400×g for 5 minutes to pelletize the cells. The cell pellets were re-dispersed in the complete MEM-α medium and residual fibers and large adipocytes were removed using a 40-μm cell strainer.
[0051] The cells collected after centrifugation were cultured at 37° C. overnight. The next day, the attached cells were carefully washed with PBS to remove residues and other suspending cells. The medium was frequently replaced every 2 to 3 days until MSCs meet 80-90% confluence. MSCs were used within 3-6 passages (p3-6) to ensure good results.
[0052] Characterization of the isolated MSCs was conducted on the specific cell surface markers (CD29, CD44, CD90, Sca-1, CD11b, CD34, and CD45) as well as differentiability into three lineages through assessment using previous protocols (M. C. Ciuffreda, et al., Mesenchymal Stem Cells, M. Gnecchi, Ed. (Springer New York, 2016), vol. 1416 of Methods in Molecular Biology, 149-158).
[0053] 3. Preparation of Hybrid Spheroids
[0054] Hybrid spheroids were prepared using a free water-absorbing polymer-based method (N. Kojima, et al., Biomaterials 33, 4508-4514, 2012). In this study, 2% methylcellulose (Sigma-Aldrich) was added to the polymer solution for a complete MEM-α growth medium.
[0055] In the case of a single hybrid spheroid, 25,000 MSCs and RAP-MP were thoroughly mixed in the growth medium to prepare 2 μl of particle suspension, and then the suspension was slowly injected into a high-viscosity methylcellulose solution. Incubation was carried out at 37° C. for 2 hours to facilitate spontaneous cell particle condensation.
[0056] Hybrid spheroids were collected after lowering the viscosity of the methylcellulose solution by adding the growth medium. The collected hybrid spheroids were washed twice with the growth medium to completely remove methylcellulose prior to the culture in a non-adhesive Petri dish. RAP-MP hybrid spheroids, in which 10 ng, 40 ng, 100 ng, and 200 ng of RAP were contained respectively, were prepared and named HS10, HS40, HS100, and HS200, respectively.
[0057] MSC spheroids in which RAP-MP is not mixed were used as a control (naïve spheroid). To visualize RAP-MPs in hybrid spheroids, they were labeled with coumarin-6.
[0058] 4. Shape and Size Distribution of Spheroids
[0059] Morphology of the naïve and hybrid spheroids was observed under a microscope system (Eclipse Ti; Nikon Instruments Inc., Melville, N.Y.). Size distribution was measured by randomly selecting at least 30 spheroids using Nis-Element software.
[0060] 5. Microsphere Distribution of Hybrid Spheroids
[0061] The distribution of microspheres in the hybrid spheroids was first observed under confocal laser scanning microscopy (CLSM; Nikon Alsi, Nikon Instruments Inc., Melville, N.Y.).
[0062] Briefly, hybrid spheroids were collected on day 3 of culture, washed twice with PBS, and immobilized with 4% paraformaldehyde (PFA) solution (Sigma-Aldrich). Next, cell nuclei were counterstained with Hoechst 33342 solution (1:1000; Thermo Fisher Scientific) at room temperature for 20 minutes. Next, the sample was scanned, a 3D image of the spheroid was reconstructed in Nis-Element software, and Cou6-MPs and cell nuclei were labeled in green and blue, respectively.
[0063] In addition, hybrid spheroids were observed according to the previous protocol (C. Heckman, et al., Protocol Exchange (2007), doi:10.1038/nprot.2007.504.) using SEM (S-4100; Hitachi, Tokyo, Japan). Briefly, samples were immobilized with 4% glutaraldehyde solution for 60 minutes and then continuously stained with 1% OsO4, 3% carbohydrazide, and 1% OsO4 for 15 minutes respectively. All materials were purchased from Tokyo Chemical Industry (Tokyo, Japan). To expose the central structure in SEM, the hybrid spheroids were cut in half using a sharp blade before spray-coating with a platinum layer.
[0064] 6. Identification of Cell Viability
[0065] Live/dead staining assay was performed to identify cell viability. Briefly, the naïve and hybrid spheroids were collected and incubated with a solution in which 0.67 μM acridine orange (AO) and 75 μM propidium iodine (PI) (both from Sigma-Aldrich) are contained at room temperature for 30 minutes, and then viable and dead cells were visualized with a fluorescence microscopy system (Eclipse Ti; Nikon Instruments Inc., Melville, N.Y.) after performing green staining with AO and red staining with PI, respectively.
[0066] In addition, the apoptotic state of the cells was observed via Western blot using the previous protocol (T. T. Nguyen, et al., J Control Release 321, 509-518, 2020). Briefly, the naïve and hybrid spheroids were collected, separated into single cells by washing twice with PBS and mincing, and lysed with MPER lysis buffer (Thermo Fisher Scientific) on ice. Next, 30-40 μg of the total protein identified by the Pierce Protein Assay 660 nm kit (Thermo Fisher Scientific) was separated on a 12% SDS-PAGE gel and transferred to a PVDF membrane (Immobilon-P, Merck Millipore).
[0067] Next, blocking was performed with Tris buffer (containing 0.05% Tween 20) in which 5% BSA is contained at room temperature for 1 hour, and then incubation was followed using rabbit anti-Bax antibody (1:1000; Cell Signaling) or rabbit anti-GAPDH antibody (1:1000; Cell Signaling) overnight at 4° C. After washing, the membrane was incubated with anti-rabbit IgG-HRP (1:5000, Santa Cruz) at room temperature for 1 hour. Finally, the membrane was incubated with SuperSignal West Pico Chemiluminescent Substrate solution (Thermo Fisher Scientific) and detected using a Fujifilm LAS-4000 mini system (Fujifilm, Tokyo, Japan).
[0068] 7. LC/MS/MS Analysis
[0069] RAP levels in hybrid spheroids were identified using LC/MS/MS.
[0070] Briefly, 1 to 3 hybrid spheroids were collected in microtubes at each determined time point and washed twice with PBS. RAP was extracted by probe sonication treatment in the presence of 0.1-1.0 ml of ACN. Samples were diluted appropriately for LC/MS/MS analysis and filtered through a 0.22-μm membrane.
[0071] FK506 was used as an internal control to compensate for the matrix effect of the sample. LC/MS/MS parameters were as follows: Agilent 1260 Infinity HPLC system (Agilent Technologies, Santa Clara, Calif.) equipped with HPLC Atlatis dC18 column (2.1×150 mm, 3 μm; Water Corporation, Milford, Mass.). Extraction by a solvent containing ACN and 2 mM ammonium acetate buffer in a gradient mode (0-2.5 min: 90% ACN, 2.5-10.5 min: 5% ACN, 10.5-16.0 min: 90% ACN); flow rate of 250 μl/min; 60° C. for column temperature. API-400 triple quadrupole (AB SCIEX, Framingham, Mass.) tandem mass system; ionization method: electrospray, positive ion mode; detection mode: multiple reaction monitoring (MRM); m/z 931.8 864.6 ion transition observation.
[0072] 8. Cytokine Treatment
[0073] To observe the status of MSC spheroids when exposed to inflammatory conditions, a cytokine cocktail in which TNF-α (10 ng/ml; Novus Biologicals, LLC, CO) and IFN-α (20 ng/ml; Biolegend) are contained was treated. Naïve and hybrid spheroids were collected at predetermined time points, washed twice with PBS, and subjected to flow cytometry or real-time PCR.
[0074] 9. Isolation of Rat Pancreatic Islets
[0075] Spague-Drague rats (male, 8-10 week-age; Samtako, South Korea) were used as pancreatic islet donors. Briefly, rats were sacrificed by cervical dislocation and the pancreas was exposed, followed by injection of a 0.08% collagenase type P solution (Sigma-Aldrich) through the hepatobiliary duct. The pancreas was degraded by incubation at 37° C. for 18 min. Pancreatic islets were isolated from exocrine cells by Histopaque-1077 solution (Sigma-Aldrich) gradient method. Finally, prior to transplantation, pancreatic islets were cultured in a complete RPMI medium for 3 days for functional recovery.
[0076] 10. Cell Transplantation into C57BL/6 Mice
[0077] For cell transplantation, streptozocin-induced diabetic C57BL/6 mice (male, 8-10 week-age; Samtako, South Korea) were used as recipients. Non-fasting blood glucose (NBG) levels were periodically measured using the blood in the tail vein to check diabetic status satisfying NBG>350 mg/dL for 2 consecutive days.
[0078] Thereafter, the kidney was exposed to create a hole under the capsule. 400 IEQ islet cells with or without 20 spheroids (0.5×10.sup.6 MSCs) were prepared in a transplantation tube to be injected into the renal capsule cavity.
[0079] For RAP-MP delivery (without spheroids), particle suspension in approximately 5 μl of PBS (˜5 μl) was loaded in transplantation tube and was separately injected to islet location. The transplants were considered to be rejected if NBG is greater than 200 mg/dL (NBG>200 mg/dL) for 2 consecutive days. In addition, intraperitoneal glucose tolerance test (IPGTT) was performed to check insulin secretion adaptation by transplanted islet cells to glucose tolerance (i.p, 2.0 g/kg).
[0080] 11. Real-Time PCR
[0081] Quantitative real-time PCR analysis was performed to detect the changes in mRNA expression.
[0082] Spheroid samples were collected via in vitro analysis, washed twice with PBS, and then lysed with a TRIzol reagent (Thermo Fisher Scientific). Total mRNA was isolated from the supernatant aqueous phase by adding chloroform and further purified using a continuous precipitation method with isopropanol and ethanol for additional purification. For in vivo studies, mRNA was extracted from the transplant using the ReliaPrep™ RNA Tissue Miniprep kit (Promega, Madison, Wis.). Next, according to the manufacturer's instructions, cDNA was synthesized with the isolated mRNA using the GoScript™ Reverse Transcription Kit (Promega, Madison, Wis.).
[0083] Then, PCR amplification was performed using a suitable primer pair (Table 1) and SYBR Green kit (Thermo Fisher Scientific). The relative expression level of the target mRNA was calculated by the comparative threshold (Ct) method, which is to normalize the target mRNA Ct value to a GAPDH or 18S rRNA value.
TABLE-US-00001 TABLE 1 Gene Forward primer sequence Reverse primer sequence COX-1 TCGGAGCCCCAGATATAGCA TTTCCGGCTAGAGGTGGGTA (SEQ ID NO: 1) (SEQ ID NO: 2) COX-2 GGGCTCAGCCAGGCAGCAAAT GCACTGTGTTTGGGGTGGGCT (SEQ ID NO: 3) (SEQ ID NO: 4) IL1RN TAGCAAATGAGCCACAGACG ACATGGCAAACAACACAGGA (SEQ ID NO: 5) (SEQ ID NO: 6) IL4 TCAACCCCCAGCTAGTTGTC TGTTCTTCGTTGCTGTGAGG (SEQ ID NO: 7) (SEQ ID NO: 8) IL6 ACAACCACGGCCTTCCCTACTT CACGATTTCCCAGAGAACATGTG (SEQ ID NO: 9) (SEQ ID NO: 10) IL10 CCAGGGAGATCCTTTGATGA CATTCCCAGAGGAATTGCAT (SEQ ID NO: 11) (SEQ ID NO: 12) TGFB1 TTGCTTCAGCTCCACAGAGA TGGTTGTAGAGGGCAAGGAC (SEQ ID NO: 13) (SEQ ID NO: 14) IDO1 GCTTTGCTCTACCACATCCAC CAGGCGCTGTAACCTGTGT (SEQ ID NO: 15) (SEQ ID NO: 16) INOS GCTCGCTTTGCCACGGACGA AAGGCAGCGGGCACATGCAA (SEQ ID NO: 17) (SEQ ID NO: 18) HO-1 GGTGATGGCTTCCTTGTACC AGTGAGGCCCATACCAGAAG (SEQ ID NO: 19) (SEQ ID NO: 20) MHC-I GGCAATGAGCAGAGTTTCCGAG CCACTTCACAGCCAGAGATCAC (SEQ ID NO: 21) (SEQ ID NO: 22) MHC-II GTGTGCAGACACAACTACGAGG CTGTCACTGAGCAGACCAGAGT (SEQ ID NO: 23) (SEQ ID NO: 24) CD86 GATTATCGGAGCGCCTTTCT CCACACTGACTCTTCCATTCTT (SEQ ID NO: 25) (SEQ ID NO: 26) PD-L1 TGCGGACTACAAGCGAATCACG CTCAGCTTCTGGATAACCCTCG (SEQ ID NO: 27) (SEQ ID NO: 28) PRF1 TCATCATCCCAGCCGTAGT ATTCATGCCAGTGTGAGTGC (SEQ ID NO: 29) (SEQ ID NO: 30) GRMB ACTCTTGACGCTGGGACCTA AGTGGGGCTTGACTTCATGT (SEQ ID NO: 31) (SEQ ID NO: 32) IFNG TTCTTCAGCAACAGCAAGGC TCAGCAGCGACTCCTTTTCC (SEQ ID NO: 33) (SEQ ID NO: 34) TNF TAGCCAGGAGGAGAACAGAAAC CCAGTGAGTGAAAGGGACAGAAC (SEQ ID NO: 35) (SEQ ID NO: 36) FOXP3 CCTGGTTGTGAGAAGGTCTTCG TGCTCCAGAGACTGCACCACTT (SEQ ID NO: 37) (SEQ ID NO: 38) GAPDH ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA (SEQ ID NO: 39) (SEQ ID NO: 40) 18S RNA TCAACACAGGGATCGGACAACACA GCCTTGGATCAAGTTCACAGGCAA (SEQ ID NO: 41) (SEQ ID NO: 42)
[0084] 12. Qualification of Mouse Serum Cytokine
[0085] Whole blood was collected from the heart of the recipient by cardiac puncture.
[0086] After the blood was left to clot at room temperature for 15 to 30 minutes, the serum was separated from the blood by centrifugation at 2000×g at 4° C. for 10 minutes, and the separated serum was stored at −80° C. until use. To quantify cytokine levels, the BD CBA Mouse Th1/Th2/Th17 Cytokine kit (Thermo Fisher Scientific) was used according to the manufacturer's instructions. Data were analyzed using Flowjo software version 7.6.2 (Becton, Dickinson & Company).
[0087] 13. Flow Cytometry
[0088] Surface markers of MSCs and immune cells were identified by fluorescence-activated cell sorting (FACS) analysis. In general, MSC spheroids or lymphoid organs (spleen, lymph nodes) were isolated into single cells and washed twice with PBS staining buffer in which 0.3% BSA is contained. Samples were incubated with specific fluorescence-bound antibody on ice for 30 minutes. After washing twice with staining buffer, cells were immobilized with 4% PFA solution (Sigma-Aldrich) and analyzed using FACSCalibur (BD Biosciences).
[0089] Intracellular antigen staining was performed according to the instructions provided by BD BioSciences. Each isotype control antibody was used to compensate for non-specific binding of IgG to the cell surface, and the results were processed using Flowjo software version 7.6.2 (Becton, Dickinson & Company).
[0090] 14. Histological Study
[0091] In order to observe histomorphology at day 12 post-transplantation, transplant-bearing kidneys were collected. Samples were collected from recipients with rejected transplants and organ functional transplants (125 days) from some experiments. Samples were immobilized in 4% PFA solution (Sigma-Aldrich) for 1 to 2 days and then immersed in 30% sucrose solution (Alfa Aesar, Ward Hill, Mass.) for 3 days.
[0092] Next, 10 μm sections were prepared with a deep freezing microtome system (HM450; Thermo Fisher Scientific) and placed on a gelatin-coated glass slide. The sample was subjected to epitope recovery with citric acid buffer (pH 6.0, with 0.05% Tween-20) in a water bath at 98° C. for 30 minutes, and the activity of endogenous peroxidase was inhibited with 3% hydroxyperoxide for 15 minutes. A circle was made therearound using a hydrophobic pen to limit the stained area. In addition, triple immunohistochemical staining was performed according to the instructions provided by Vector Laboratories to co-stain the islets and T-cells of the transplants.
[0093] For each antigen staining, the non-specific binding was first blocked in the sections with a PBS solution in which 2% BSA, 10% normal serum (Vector Laboratories), and 0.3% Triton X-100 were contained and then with avidin solution and biotin solution (Vector Laboratories) at room temperature for 15 minutes, respectively. The sections were then incubated with anti-insulin (1:300; ProteinTech, Suite 300 Rosemont, Ill.), anti-CD3 (1:300; Novus Biologicals, LLC, CO 80112), anti-Foxp3 (1:200; Biolegend), or anti-PDL1 (1:300; Cell Signaling) primary antibodies overnight at 4° C. After washing with PBS, the sections were incubated with a biotin-conjugated secondary antibody at room temperature for 1 hour, and then incubated with HRP-labeled ABC kit working solution at room temperature for 30 minutes. Signals were detected by incubation with ImmPACT-DAB (brown) substrate solution, ImmPACT-VIP (purple) substrate solution, or ImmPACT-SG (gray blue) substrate solution at room temperature for 2 to 15 minutes. After washing with PBS and drying, the sections were fixed with VectorMount-Permanent Mounting Medium (Vector Laboratories) before imaging using a microscope system.
<Example 1> Preparation of Rapamycin-Microparticle (RAP-MP) and Identification of Characteristics
[0094] RAP-MP was successfully prepared by oil-in-water emulsification. As a result of identifying the characteristics of RAP-MP, it was found in the scanning electron microscope (SEM) image as shown in
<Example 2> Identification of Characteristics of Mouse Adipose Tissue-Derived Mesenchymal Stem Cells (MSCs)
[0095] MSCs were isolated from subcutaneous adipose tissues of C57BL/6 mice according to standard protocols. The isolated MSCs exhibited a typical fibroblast morphology and were positive by 95% or higher (>95%) for a set of markers including CD29, CD44, CD90, and Sca-1, while being negative (<2%) for CD11b, CD34, and CD45. In addition, it was found that these MSCs have the ability to differentiate into the osteogenic lineage by deposition of calcium crystals stained with Alizarin red S, the adipogenic lineage by accumulation of Oil red O-stained lipid droplets, and the cartilage lineage by accumulation of glycosaminoglycans stained with Alcian blue.
<Example 3> Formation of Spheroids that are Uniform in Methylcellulose Solution
[0096] Referring to
[0097] Next, in an attempt to identify the MP distribution of hybrid spheroids on day 3 of the culture, confocal laser scanning microscopy (CLSM) and SEM image analysis for each of the hybrid HS100 were performed. As a result, as shown in CLSM in
[0098] In addition, liquid chromatography tandem mass spectrometry (LC-MS/MS) analysis was used to determine the actual content of RAP in the hybrid spheroids. Referring to
[0099] Next, the release pattern of RAP in hybrid spheroids was observed. Interestingly, similar RAP release profiles were observed in all groups regardless of the initial loading amount of RAP-MP. Referring to
[0100] Preparation of large spheroids often causes problems concerning the cell viability due to limitations in nutrient and oxygen infiltration. However, as shown in
<Example 4> Identification of Enhancement of Immunomodulatory Gene Expression by MSC after Hybrid Spheroid Formation
[0101] 3D cultured MSCs are known to exhibit enhanced immunomodulatory effects compared to 2D cultured MSCs. First, reverse transcription polymerase chain reaction (qRT-PCR) analysis was applied to observe dynamic changes in immunomodulatory gene expression of naïve spheroids in accordance with the culture time. To this end, naïve spheroids were prepared and cultured in MEM-α medium for 1-3 days. As a result, it was found that the expression of CD86, MHC-I, MHC-II, TGFB1, IL1RN, and IL4 significantly increased in accordance with the culture time as shown in
[0102] On day 1 of culture, a transient increase was observed in expression of INOS and HO-1 genes, but expression of PD-L1, IL6, and COX2 genes by naïve spheroids was significantly decreased after 3 days of culture. A cytokine cocktail containing 10 ng/ml TNF-α and 20 ng/ml IFN-γ was treated to the spheroids during the culture to mimic the inflammatory environment. Interestingly, as shown in
[0103] Next, the effect of RAP-MP incorporation in hybrid spheroids was identified. Naïve spheroids and hybrid HS100 were cultured in the MEM-α growth medium with or without the cytokine cocktail as shown in
<Example 5> Identification of Improvement in Survival of Xenogeneic Pancreatic Islet Cells by Localized Hybrid Spheroids in a Mouse Model
[0104] To identify the prevention of strong immune response by hybrid spheroids, a pancreatic rat-to-mouse islet xenotransplant model was established. As shown in
[0105] In addition, the total dose of RAP treated per transplant in the RAP-MP, hybrid HS10, HS40, HS100 and HS200 groups was determined to be 1534.0±499.8, 139.4±24.2, 538.3 24.6, 1378.2±87.0, and 2882.2±41.0 ng (p=0.6225 in RAP-MP vs. HS100).
[0106] Non-fasting blood glucose (NBG) levels and Kaplan-Meier transplant survival curves of pancreatic islet cell recipients were identified as shown in
[0107] From the above results, it was found that RAP-MP alone exhibited only temporary immunosuppression. However, local hybrid spheroids showed an effective protection for the pancreatic islet cell xenotransplants from strong immune rejection, and the effect was RAP dose-dependent. As shown in
[0108] In addition, of pancreatic islet cell recipients transplanted with hybrid spheroids, 79% (19 of 24), 17% (4 of 24), and 8% (2 of 24) maintained functions for more than 50 days, 100 days, and 125 days, respectively. Organ transplant acceptance (>125 days) was identified in two recipients of hybrid HS10 (n=1) and HS100 (n=1) (black circles;
[0109] On the other hand, to evaluate the sustained release requirement of RAP for immune protection, naïve spheroids pretreated with 100 nM RAP solution for 3 days and pancreatic islet cells were co-transplanted.
[0110] As a result, the naïve spheroid group showed early pancreatic islet cell transplant rejection (MST=10 days), similar as the control group. In addition, since individual transplantation of pancreatic islet cells and hybrid HS100 in the contralateral renal capsule caused the initial rejection (MST=10 days, p=0.1842 vs control), it was found that local delivery of hybrid spheroids to the pancreatic islet cell region was essential to exhibit immune protection. (Also identified was whether hybrid spheroids formed of human MSCs may exhibit a protective effect for pancreatic islet cell xenotransplant survival. Consequently, co-transplantation of human MSCs-derived hybrid HS100 with pancreatic islet cells did not prevent initial rejection (MST=9 days, p=0.7319 vs control).) At day 12 post-transplantation, an intraperitoneal glucose tolerance test (IPGTT) was performed to evaluate the reactivity of pancreatic islet cell transplant upon glucose overload.
[0111] As a result, as shown in
<Example 6> Identification of Immunomodulatory Effect of Local Hybrid Spheroids
[0112] To investigate immune responses, blood, spleen (SPL), draining lymph nodes (DLN), and transplants were collected on day 12 post-transplantation. Serum isolated from whole blood was used to measure cytokine levels with a cytometric bead array (CBA) mouse Th1/Th2/Th17 cytokine kit.
[0113] As a result, as shown in
[0114] To evaluate the progression of immunoactivation, the IFN-γ/IL-10 ratio that reflects the balance in the Th1/Th2 population in the blood was calculated. As a result, as shown in
[0115] Next, to perform flow cytometry, immune cells from DLN and SPL were harvested, and the percentage of each immune cell population was calculated based on the total cell counts. As a result of performing flow cytometry, it was determined that there was no significant change in the total CD4.sup.+ and CD8.sup.+ T cell percentage between the transplanted groups in the two lymphoid organs as shown in
[0116] Nevertheless, the ratio of CD4+:CD8.sup.+ T cell population in DLN showed a tendency to decrease in the control and naïve spheroid groups. Notably, compared to the control, the local delivery of hybrid HS100 drastically decreased production of effector memory CD8.sup.+CD44.sup.highCD62.sup.low W T cell (CD8.sup.+ TEM) (DLNs: 3.44±0.73% versus 5.01±1.24%, p=0.2127; SPL: 0.23±0.06% vs 0.35±0.08%, p=0.0144) and central memory CD8.sup.+CD44.sup.highCD62.sup.high T cell (CD8.sup.+ TCM) (DLNs: 1.29±0.30% vs 2.35±0.43%, p=0.0235; SPL: 1.32±0.31% vs 1.77±0.22%, p=0.1786). Moreover, it was found that hybrid HS100 promoted the production of CD4.sup.+ FoxP3.sup.+ T cells (CD4.sup.+ T.sub.reg) in DLN (2.67±0.81% vs 1.68±0.26% of the naïve spheroid group, p=0.0355).
[0117] Next, the transplant-bearing kidney was collected to observe the local immune response. Immune-related gene expression in the transplant was analyzed by qRT-PCR.
[0118] As a result, as shown in
[0119] In addition, histomorphological characteristics of the pancreatic islet cell xenotransplants were identified by performing hematoxylin & eosin (H&E) and multi-immunohistochemical staining.
[0120] As a result, a number of host cells infiltrating T cells (blue staining) were observed in the control group and the naïve spheroid group as shown in
[0121] In addition, in order to quantitatively detect immune cell populations, pancreatic islet cell transplants of hybrid HS100 and RAP-MP groups were collected on day 12, separated into single cells, and subjected to flow cytometry.
[0122] As a result, as shown in
[0123] From the above results, it was found that locally delivered hybrid spheroids diminished systemic immunoactivation and promoted formation of T.sub.reg cell populations to prevent initial rejection of pancreatic islet cell transplants.
<Example 7> Identification of Immunomodulation Through Enhanced PD-L1 Expression in Hybrid Spheroids
[0124] First, after transplantation of naïve spheroids or hybrid HS100 along with pancreatic islet cells, the survival of MSCs was tracked. To this end, green fluorescent protein (GFP)-expressing MSCs were used to fabricate spheroids. Then, the transplant-bearing kidney was collected and imaged by detecting the GFP signal. As a result, as shown in
[0125] Since PD-L1 plays an important role in immunomodulation, the gene expression of PD-L1 was identified in whole pancreatic islet cell xenotransplants 12 days after transplantation. Referring to
[0126] In addition, the role of PD-L1 on survival time of pancreatic islet cell xenotransplants was identified. Pancreatic islet cells were transplanted along with hybrid HS100 under the renal capsule of diabetes-induced mice. Then, on day 10 and 20, mice were intraperitoneally injected with double doses of anti-PD-L1 antibody solution or each isotype control antibody solution (2.5 mg/kg/dose each). As a result of observing NBG as shown in
[0127] From the above results, a hypothesis was formulated that PD-L1 expressed by MSCs transplanted from hybrid spheroids may be involved in the immunomodulatory effect in vivo. Therefore, the surface expression of PD-L1 by MSCs was observed by flow cytometry. Spheroids were cultured with or without treatment of a cytokine cocktail containing 20 ng/ml IFN-γ and 10 ng/ml TNF-α for 3 days prior to evaluation.
[0128] As a result, as shown in
[0129] In addition, the expression of PD-L1 by the transplanted spheroids in vivo was measured. To this end, MSCs were labeled with carboxyfluorescein diacetate succinimidyl ester (CFDA-SE) prior to fabrication of spheroids for pancreatic islet cell transplantation, and the transplants were collected on day 7 for flow cytometry. As a result, as shown in
[0130] As a result, as shown in
[0131] From the above results, it was found that enhanced PD-L1 expression by MSCs in hybrid HS100 improved MSC maintenance and survival rate of pancreatic islet cell xenotransplants.
[0132] As described above, a specific part of the content of the present disclosure was described in detail, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present disclosure is not limited thereby. Accordingly, the substantial scope of the present disclosure may be defined by the appended claims and equivalents thereof.