MICROBUBBLE-CHEMOTHERAPEUTIC AGENT COMPLEX FOR SONODYNAMIC THERAPY

20220347314 · 2022-11-03

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to methods of sonodynamic therapy comprising the co-administration of a microbubble-chemotherapeutic agent complex together with a microbubble-sonosensitiser complex. It further relates to pharmaceutical compositions comprising these complexes and their use in methods of sonodynamic therapy and/or sonodynamic diagnosis. Such methods find particular use in the treatment of cancer, e.g. pancreatic cancer.

Claims

1. A method of treating cancer via sonodynamic therapy, comprising simultaneous or sequential administration to cells or tissues of a patient in need thereof a microbubble-sonosensitiser complex and a microbubble-chemotherapeutic agent complex, and subjecting said cells or tissues to ultrasound irradiation to rupture the microbubbles and activate the sonosensitiser.

2. A method of treating cancer via sonodynamic therapy, said method comprising administration to cells or tissues of a patient in need thereof a microbubble-chemotherapeutic agent complex, wherein said complex is additionally attached to or associated with at least one sonosensitiser, and wherein said method comprises subjecting said cells or tissues to ultrasound irradiation to rupture the microbubble and activate the sonosensitizer.

3. The method as claimed in claim 1, wherein the microbubble-chemotherapeutic agent complex comprises a microbubble attached to or associated with the chemotherapeutic agent, via a non-covalent linkage.

4. The method as claimed in claim 1, wherein the microbubble-chemotherapeutic agent complex comprises a microbubble having a shell which retains a gas.

5. The method as claimed in claim 1, wherein the microbubble-sonosensitiser complex comprises a microbubble having a shell which retains a gas.

6. The method as claimed in claim 1, wherein said microbubble-chemotherapeutic agent complex and/or said microbubble-sonosensitiser complex comprises a microbubble having a diameter of less than 200 μm.

7. The method as claimed in claim 1, wherein said microbubble-chemotherapeutic agent complex and/or said microbubble-sonosensitiser complex comprises a phospholipid monolayer shell having linked thereto one or more polymers.

8. The method as claimed in claim 1, wherein the sonosensitiser is selected from phenothiazine dyes such as methylene blue, toluidine blue, Rose Bengal, porphyrins such as Photofrin®, chlorins, benzochlorins, phthalocyanines, napthalocyanines, porphycenes, cyanines and cyanine analogues such as Merocyanine 540 and indocyanine green, azodipyromethines such as BODIPY and halogenated derivatives thereof, acridine dyes, purpurins, pheophorbides, verdins, psoralens, hematoporphyrins, protoporphyrins and curcumins.

9. A pharmaceutical composition comprising the microbubble-chemotherapeutic agent complex as defined in claim 2, together with at least one pharmaceutical carrier or excipient.

10. A pharmaceutical composition comprising the microbubble-chemotherapeutic agent complex, and the microbubble-sonosensitiser complex as defined in claim 1, together with at least one pharmaceutical carrier or excipient.

11. A method of treating cancer via sonodynamic therapy, said method comprising administration to cells or tissues of a patient in need thereof a pharmaceutical composition as claimed in claim 9, and subjecting said cells or tissues to ultrasound irradiation to rupture the microbubbles and activate the sonosensitiser.

12-13. (canceled)

14. The method as claimed in claim 1, wherein said cancer is selected from the group consisting of sarcomas, including osteogenic and soft tissue sarcomas, carcinomas, lymphomas, including Hodgkin and non-Hodgkin lymphomas, neuroblastoma, melanoma, myeloma, Wilm's tumour, and leukemias, including acute lymphoblastic leukaemia and acute myeloblastic leukaemia, astrocytomas, gliomas and retinoblastomas.

15. The method as claimed in claim 14, wherein said cancer is pancreatic cancer.

16-22. (canceled)

23. A microbubble having linked thereto at least one chemotherapeutic agent and at least one sonosensitiser.

24-34. (canceled)

35. The method as claimed in claim 2, wherein said complex is additionally attached to or associated with the at least one sonosensitiser via a non-covalent linkage.

36. The method as claimed in claim 35, wherein said non-covalent linkage is a biotin-avidin interaction.

37. The method as claimed in claim 3, wherein the non-covalent linkage is a biotin-avidin interaction.

38. The method as claimed in claim 4, wherein said gas is oxygen.

39. The method as claimed in claim 5, wherein said gas is oxygen.

40. The method as claimed in claim 8, wherein the sonosensitiser is Rose Bengal, methylene blue, indocyanine green or an analogue of indocyanine green.

41. The pharmaceutical composition as claimed in claim 9, wherein said microbubble-chemotherapeutic agent complex comprises a microbubble having non-covalently bound thereto at least one chemotherapeutic agent and at least one sonosensitiser.

42. A method of treating cancer via sonodynamic therapy, said method comprising administration to cells or tissues of a patient in need thereof a pharmaceutical composition as claimed in claim 10, and subjecting said cells or tissues to ultrasound irradiation to rupture the microbubble and activate the sonosensitiser.

43. The method as claimed in claim 14, wherein said cancer is selected from breast, lung, cerebral, bladder, thyroid, prostate, colon, rectum, pancreas, stomach, liver, uterine, hepatic, renal, prostate, cervical and ovarian carcinoma.

44. The method as claimed in claim 1, wherein said chemotherapeutic agent is selected from the group consisting of antifolates; 5-fluoropyrimidines; cytidine analogues; purine antimetabolites; alkylating agents; non-classical alkylating agents; platinum analogues; antitumour antibiotics; bioreductive drugs; anthracyclines; topoisomerase I inhibitors; topoisomease II inhibitors; antimicrotubule agents such as vinca alkaloids, taxols, and epothilones; antioestrogens; antiandrogens; aromatase inhibitors; antiangiogenic or hypoxia targeting drugs; antivascular agents; tyrosine kinase inhibitors; oncogene or signalling pathway targeting agents; agents targeting stress proteins; autophagy targeting agents; proteasome targeting agents; telomerase inhibitors; histone deacetylase inhibitors; DNA methyl transferase inhibitors; alkyl sulfonates; aziridines; ethylenimines and methylamelamines; nitrogen mustards; nitrosureas; purine analogues; pyrimidine analogues; androgens; and anti-adrenals and the pharmaceutically acceptable salts, derivatives, and analogues thereof.

45. The method as claimed in claim 44, wherein the chemotherapeutic agent is a taxane.

46. The method as claimed in claim 45, where the taxane is paclitaxel or docetaxel, or an analogue thereof.

Description

[0108] The invention will now be described further with reference to the following non-limiting Examples and the accompanying drawings in which:

[0109] FIG. 1 is a schematic representation of ultrasound-activated sonosensitisation of a microbubble-sonosensitiser complex.

[0110] FIG. 2 shows (a) a schematic illustration of the preparation of a Rose Bengal derivative (denoted “RB1”) and (b) a schematic representation of covalent coupling of RB1 to a microbubble.

[0111] FIG. 3 shows photomicrographs taken with a 40×objective lens of the O.sub.2MB after dilution (1:10) in PBS. Scale bar is 20 μm; (b) size distribution of O.sub.2MB after centrifugation obtained from analysis of 30 optical microscope images (the unfilled boxes at the left hand side of the graph represent MB that were detected by the image analysis software but smaller than 450 nm, the optical resolution of the system).

[0112] FIG. 4 is a plot of % MB remaining after incubation of PBS dispersions of MBs prepared from either DBPC or DSPC at 37° C. Error bars represent±the standard error where n=4. *p<0.05 and **p<0.01

[0113] FIG. 5 is a plot of % increase in dissolved oxygen for degassed PBS solutions containing either O.sub.2MB or PFBMB. Arrow indicates time of ultrasound application.

[0114] FIG. 6 is a plot of cell viability for (a) BxPc-3, (b) MIA PaCa-2 and (c) PANC-1 cells treated with (from left to right) (i) no treatment (ii) gemcitabine (iii) 5-FU (iv) O.sub.2MB-5FU+US (v) O.sub.2MB-RB+US (vi) O.sub.2MB-RB/O.sub.2MB-5FU mix−US and (vii) O.sub.2MB-RB/O.sub.2MB-5FU mix+US. [RB], [5-FU] and [gemcitabine] were kept constant at 5 μM, 100 μM and 100 μM respectively. Ultrasound treatment was delivered for 30 sec at frequency of 1 MHz, an ultrasound power density of 3.0 Wcm.sup.−2 and a duty cycle of 50%, pulse frequency=100 Hz. Error bars represent±the standard error where n=4. *p<0.05, **p<0.01 and ***p<0.001.

[0115] FIG. 7 is a plot of cell viability for BxPc-3 (black), MIA PaCa-2 (grey) and PANC-1 (white) cells treated with PFBMB-RB/PFBMB-5FU mix+US (left) or (ii) O.sub.2MB-RB/O.sub.2MB-5FU mix+US (right). Concentrations and US parameters as in FIG. 6. Error bars represent±the standard error where n=4 **p<0.01

[0116] FIG. 8 is a plot of (a) % change in tumour volume and (b) average body weight for mice treated with (i) no treatment (open diamonds) (ii) ultrasound only (filled diamonds) (iii) gemcitabine (open triangles) (iv) O.sub.2MB-RB/O.sub.2MB-5FU mix−US (open circles) (v) O.sub.2MB-RB+US (filled squares) (vi) O.sub.2MB-RB/O.sub.2MB-5FU mix+US (filled circles). Not shown for ease of illustration are treatments with 5-FU alone, O.sub.2MB-RB−US, O.sub.2MB-5FU+US, O.sub.2MB-5FU−US. The RB, 5-FU and gemcitabine concentrations were kept constant in each case at 0.184 mg/kg (90.8 μM), 0.115 mg/kg (440 μM) and 0.264 mg/kg (440 μM) respectively. Ultrasound treatment was delivered for 30 sec at frequency of 1 MHz, an ultrasound power density of 3.0 Wcm.sup.−2 and a duty cycle of 50%, pulse frequency=100 Hz. Error bars represent±the standard error where n=4. *p<0.05, **p<0.01 and ***p<0.001 for (vi) compared to (i) and .sup.Δp<0.05, .sup.ΔΔp<0.01 and .sup.ΔΔΔp<0.001 for (vi) compared to (v).

[0117] FIG. 9 is a plot of % change in tumour volume for mice treated with IP gemcitabine (120 mg/kg on days 0, 3 and 8) (filled squares) or vehicle only (filled diamonds). Error bars represent±the standard error where n=4.

[0118] FIG. 10 shows (a) Bcl3 and Bcl2 protein expression using immunohistochemistry. The inner image is the whole section and the main image is a selected area with ×20 magnification. (b) Histology scoring for Bcl3 and Bcl2 expression.

[0119] FIG. 11 shows (a) Quantitative RT-PCR mRNA expression of Bcl3. (b) Plot of Bcl3 gene expression profiles for (i) no treatment (black), (ii) O.sub.2MB-5FU+US (grey) and (iii) O.sub.2MB-RB/O.sub.2MB-5FU mix+US (white). Error bars represent±the standard deviation where n=3. ***p<0.001.

[0120] FIG. 12 shows (a) Representative fluorescence images of nude mice bearing ectopic BxPC-3 tumours before (t=0), 5 min after (t=5) and 30 min after (t=30) intravenous administration of the MB-9 conjugate with (+US) or without (−US) ultrasound applied to the tumour during IV injection. (b) Plot of % increase in tumour fluorescence recorded 5 and 30 min after intravenous administration of MB-9 conjugates with (US) or without (control) ultrasound applied to the tumour during IV injection. Increase in intensity measured relative to tumours before treatment. Error bars represent±SEM where n=3. (c) Densitometry data (compared to loading control GAPDH) showing tumour Hif1α protein expression for mice treated with an IV suspension of O.sub.2MB or PFBMB. Inset shows a representative Western Blot image of HIF1α protein expression in tumours treated with an IV suspension of O.sub.2MB or PFBMB. Error bars represent±SEM where n=3. *p<0.05, **p<0.01 and ***p<0.001.

[0121] FIG. 13 shows a plot of % tumour growth versus time for mice bearing ectopic human pancreatic BxPC3 tumours treated with (i) vehicle only (open circles) or (ii) an intra-tumoural injection of I.sub.2-IR783 (100 μL, 1 mg/kg) in a PBS:DMSO (98:2) vehicle with 780 nm light irradiation for 3×3 min with a 1 minute lag in between treatments (open squares). Mice in treatment group received a second treatment at day 8 that included 100 μL of O.sub.2MBs (1×10.sup.8 MB/mL).

[0122] FIG. 14 shows (a) UV-Vis spectra and (b) Fluorescence spectra of ICG ( . . . ), I2-IRCYDYE (solid line) and I4-IRCYDYE ( - - - ).

[0123] FIG. 15 shows a plot of increase in SOSG intensity at 410 nm for ICG, I2-IRCYDYE and I4-IRCYDYE. Increased SOSG intensity is indicative of singlet oxygen production.

[0124] FIG. 16 shows a plot of cell viability for Mia Paca cells (upper graphs) and for BxPC3 cells (lower graphs) treated with (a) ICG, (b) I2-IRCYDYE and (c) I4-IRCYDYE with (white bars) and without (black bars) 780 nm (200 mW) light for 1 min.

[0125] FIG. 17 shows the treatment of MiaPaCa2 cells using Rose Bengal (RB), 5-fluorouracil (5FU) and combined RB/5FU treatment±ultrasound to determine if any synergy is evident when combining SDT and 5-FU treatment. The cells were incubated with either 3 μM RB and 50 μM 5FU (or both) for 3 h as these represent sub-lethal doses and enabled synergy to be identified if evident. Ultrasound exposure was 30 sec, 3 W/cm.sup.2, 1 MHz, 50% duty cycle; pulse repetition frequency of 100 MHz. Cell viability was determined 24 h following treatment using a MTT assay.

[0126] FIG. 18 shows a schematic representation of oxygen loaded microbubbles with Doxorubicin (Dox-O.sub.2MB) and Rose Bengal (RBO.sub.2MB) attached to the surface.

[0127] FIG. 19 shows a plot of % change in tumour volume against time for human xenograft MDA-MB-231 breast tumours treated with (i) vehicle only (ii) DoxO.sub.2MB+US (iii) RBO.sub.2MB+US or (iv) combined DoxO.sub.2MB/RBO.sub.2MB+US. A 100 μL intratumoural injection was administered on days 0 and 14 reflecting a dose of MB containing 300 μM and 475 μM of RB and DOX respectively for groups (ii) and (iii) and 150 μM and 237.5 μM of RB and DOX respectively for group (iv). Ultrasound exposure was 3.5 min, 3 W/cm.sup.2, 1 MHz, 50% duty cycle; pulse repetition 100 MHz.

[0128] FIG. 20 shows a schematic representation for the structure of the O.sub.2MB-RB and O.sub.2MB-5FU conjugates.

[0129] FIG. 21 shows a schematic representation of the MB-9 conjugate used in the imaging experiments.

EXAMPLES

Reagents and Equipment

[0130] Rose bengal sodium salt, 2-bromoethylamine, NHS-biotin, MTT, avidin, FITC avidin, chloroacetic acid, 4-dimethylaminopyridine (DMAP), hydroxybenzotriazole (HOBt), N,N′-dicyclohexylcarbodiimide (DCC), anhydrous dimethylformamide (DMF) and ethanol were purchased from Sigma Aldrich (UK) at the highest grade possible. Biotin, 5-Flurouracil, di(N-succinimidyl)carbonate and 2-aminoethanol were purchased from Tokyo Chemical Industry UK Ltd. 1,2-dibehenoyl-sn-glycero-3-phosphocholine (DSPC), dibehenoylphosphatidylcholine (DBPC), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)-2000 (DSPE-PEG (2000)) and DSPE-PEG(2000)-biotin were purchased from Avanti Polar Lipids (Alabaster, Ala., USA). Doxorubicin was purchased from XABC (China). Oxygen gas was purchased from BOC Industrial Gases UK, while perfluorobutane (PFB) gas was purchased from Apollo Scientific Ltd. Phosphate Buffered Saline (PBS) was purchased from Gibco, Life Technologies, UK.

[0131] NMR spectra were recorded on a Varian 500 MHz spectrometer. ESI-MS characterisation was achieved using a LCQTM quadrupole ion-trap mass spectrometer (Finnigan MAT, San Jose, Calif., USA) utilising electrospray ionisation (ESI). Optical microscope images were taken with an optical microscope (Leica DM500 optical microscope). Dissolved oxygen was measured using a Thermo Scientific Orion Star A216 bench top dissolved oxygen meter. Error was expressed as ±SEM (standard error of the mean) while statistical comparisons were made using an un-paired student's t-test.

Example 1—Preparation of O.SUB.2 .Loaded Microbubbles (O.SUB.2.MBs)

[0132] DSPC MBs were prepared as described in McEwan et al. (J Control Release. 2015; 203, 51-6). However, to improve both the physical stability of the MBs and also their stability with respect to O.sub.2 retention, we utilised the longer chain lipid dibehenoylphosphatidylcholine (DBPC) in place of distearoylphosphatidylcholine (DSPC) as this has been shown in previous work to reduce the diffusivity of the MB surface and hence improve stability.

[0133] For the preparation of DBPC MBs, DBPC (4.0 mg, 4.43 μmol), DSPE-PEG (2000) (1.35 mg, 0.481 μmol) and DSPE-PEG (2000)-biotin (1.45 mg, 0.481 μmol) in a molar ratio of 82:9:9 were dissolved in chloroform and placed in a glass vial. The solution was heated at 40° C. until all the chloroform had evaporated. PBS (pH 7.4±0.1) (5 ml) was added to the dried lipid film and the contents heated above the lipid phase transition temperature (>70° C.) under constant magnetic stirring for 30 minutes. The suspension was then sonicated with a Microson ultrasonic cell disruptor for 1.5 min (100 Watts, 22.5 kHz at power setting 4), the headspace filled with perfluorobutane (PFB) gas and the gas/liquid interface sonicated (power 19) for 20 sec producing PFBMBs. The MB suspension was cooled in an ice bath for approximately 10 minutes. An aqueous solution of avidin (50 μL, 10 mg/mL) was then added to the cooled MB suspension and stirred for a further 10 minutes. The suspension was then centrifuged (300 RPM, 10 min) and the resulting MB “cake” concentrated into 1 mL of PBS (pH 7.4±0.1). This was divided into two freeze drying vials. For the PFBMBs the vials were then crimped (sealed with a metal cap). To create oxygen filled MBs the headspace of the vial and the MB suspension was sparged under a positive pressure of oxygen gas for 2 min and the vial was then crimped. Following preparation as described above, MB samples were imaged under conventional optical microscopy to determine their size distribution and concentration. 10 μL samples were removed from each suspension and diluted in 90 μL of PBS (pH 7.4±0.1) followed by examination on a haemocytometer (Bright-Line, Hausser Scientific, Horsham, Pa., USA). Images were obtained with a 40×objective lens with a Leica DM500 optical microscope. The MB size distribution and concentration were then obtained using purpose written image analysis software in Matlab (2010B, The MathWorks, Natick, Mass., USA).

[0134] These MBs had an average diameter of 1-2 μm with a concentration of approximately 1×109 MB/mL as determined by analysis of optical microscopy images (FIG. 3). To determine the effect that inclusion of DBPC had on MB stability, we incubated PBS dispersions of the MBs prepared with DBPC or DSPC at 37° C. and counted the number of viable MBs remaining at various time intervals. The results are shown in FIG. 4 and reveal a significant improvement in stability for MBs prepared from DBPC compared with those prepared using DSPC. Indeed, after three hours incubation, 80% of DBPC MBs remained while the number of DSPC MBs reduced to 54%. These results are consistent with those from previous studies which showed that increasing the acyl chain length of the lipid reduced both the mechanical flexibility of the microbubbles and surface diffusivity.

Example 2—Preparation of Biotinylated Rose Bengal and Biotinylated 5-FU

[0135] ##STR00007##

[0136] Scheme 1 provides a synthetic scheme for the preparation of biotin-5-FU (5). A schematic representation for the structure of the O.sub.2MB-RB and O.sub.2MB-5FU conjugates is provided in FIG. 20.

[0137] Biotin functionalised Rose Bengal (6) was prepared as described in McEwan et al. (J Control Release. 2015; 203, 51-6). Biotin functionalised 5-FU (5) was synthesized according to scheme 1a following the procedures outlined below.

Preparation N-(2-Hydroxyethyl)-5-(2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)pentanamide (2)

[0138] To an ice-cooled solution of biotin-N-hydroxysuccinimide ester (1) (prepared by the reaction between biotin and Di(N-succinimidyl)carbonate) described in Kang et al., Jr. Rapid Commun Mass Spectrom. 2009, 23(11), 1719-1726) (3.75 g, 11 mmol) in anhydrous DMF (40 mL), was added 2-aminoethanol (1.0 ml, 16.4 mmol) and the mixture stirred at 25° C. for 30 min. The reaction was monitored by thin layer chromatography (TLC) (Merck Silica 60, HF 254, 20:80 methanol-dichloromethane v/v). The biotin-N-hydroxysuccinimide ester (R.sub.f=0.76) was consumed within 15 min with the concomitant formation of the alcohol product (R.sub.f=0.47). The reaction mixture was concentrated under reduced pressure and the residue co-evaporated with DMF to remove excess amounts of 2-aminoethanol. The white residue was recrystallized from water to yield 2 as a light yellow solid (1.7 g, 38%). An analytical sample was obtained from a second recrystallization, m.p. 192-195° C.

[0139] .sup.1HNMR (500 MHz, D.sub.2O) 4.49-4.47 (m, 1H, —CH), 4.31-4.30 (m, 1H, —CH), 3.53-3.51 (m, 2H, CH.sub.2), 3.23-3.18 (m, 3H, CH and CH.sub.2), 2.85-2.64 (m, 2H, CH.sub.2), 2.15 (t, 2H, —CH.sub.2), 1.62-1.46 (m, 4H, CH.sub.2 X 2), 1.32-1.26 (m, 2H, CH.sub.2).

[0140] .sup.13CNMR (125 MHz, D.sub.2O) 177.09 (C═O), 61.98 (CH.sub.2), 60.19 (CH), 59.91 (CH), 55.24 (CH), 41.29 (CH.sub.2), 39.61 (CH.sub.2), 35.42 (CH.sub.2), 27.77 (CH.sub.2), 27.56 (CH.sub.2), 25.02 (CH.sub.2).

[0141] ESMS (M+H.sup.+): found 288.70, calculated for C.sub.12H.sub.21N.sub.3O.sub.3S=287.13.

Preparation of 5-Fluorouracil-1-carboxylic acid (4)

[0142] A mixture of 5-Fluorouracil (3) (5 g, 38.4 mmol), potassium hydroxide (9.07 g, 161.6 mmol) and chloroacetic acid (3.63 g, 38.4 mmol) in 100 mL of water was refluxed for 2 h at 70° C. After cooling to room temperature, the pH of the solution was adjusted to 5.5 by the addition of concentrated hydrochloric acid. The reaction mixture was then kept in a refrigerator (5° C.) for 18 h and the resulting white crystals isolated by filtration and washed with cold water to produce 4 in 52.5% yield. mp>200° C.

[0143] .sup.1HNMR (500 MHz, D.sub.2O) 7.76 (d, 1H, J=6 Hz, CH), 4.29 (s, 2H, CH.sub.2).

[0144] .sup.13C NMR (D.sub.2O): 173.58 (C═O), 159.97 (C═O), 150.80 (C═O), 141.20 (C), 131.74 (CH), 51.48 (CH.sub.2).

[0145] ESMS (M-H+): found 187.10, calculated for C.sub.6H.sub.5O.sub.4N.sub.2F=188.11.

Preparation of 2-(5-(2-oxohexahydro-1H-thieno[3,4-d]imidazol-4yl)pentanamido) ethyl 2-(5-fluoro-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)acetate (5)

[0146] N-(2-Hydroxyethyl)-5-(2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)pentanamide (2) (0.5 g, 1.7 mmol), 5-Fluorouracil-1-carboxylic acid (4) (0.4 g, 2.1 mmol), DMAP (0.023 g, 0.17 mmol) and HOBT (0.023 g, 0.17 mmol) were added to 20 mL of anhydrous DMF in a 100 mL 2-neck round bottom flask under a N.sub.2 atmosphere. The mixture was heated at 40° C. and stirred until a homogeneous solution was obtained. DCC (0.4 g, 1.9 mmol) was then added to the reaction mixture and allowed to stir at room temperature for 12 hrs. The DMF was removed under reduced pressure, diethyl ether (50 mL) added and the contents stirred for 20 min. The resulting white semi-solid product was removed by filtration and after removing excess diethyl ether under reduced pressure, the crude product was purified by preparative HPLC (C-18 column) using acetonitrile/water (80:20 v/v) as mobile phase. The product 5 was obtained after lyophilisation of the desired fractions as a white semi-solid (0.24 g, 30% Yield).

[0147] .sup.1HNMR (500 MHz, D.sub.2O): 7.67 (d, 1H, J=6.0 Hz, CH), 4.50-4.47 (m, 1H, CH), 4.31-4.29 (m, 1H, CH), 4.19 (s, 2H, CH.sub.2), 3.54 (t, 2H, CH.sub.2), 3.22-3.19 (m, 2H, CH.sub.2), 2.89-2.86 (m, 1H, CH), 2.67-2.64 (m, 2H, CH.sub.2), 2.17-2.14 (m, 2H, CH.sub.2), 1.61-1.47 (m, 4H, CH.sub.2X 2), 1.47-1.28 (m, 2H, CH.sub.2).

[0148] .sup.13CNMR 125 MHz, D.sub.2O): 177.12 (C═O), 173.74 (C═O), 165.33 (C═O), 160.01 (C═O), 159.81 (C═O), 141.14 (C), 131.71 (CH), 62.00 (CH.sub.2), 60.22 (CH), 59.94 (CH), 55.26 (CH), 51.53 (CH.sub.2), 41.31 (CH.sub.2), 39.64 (CH.sub.2), 35.45 (CH.sub.2), 27.79 (CH.sub.2), 27.58 (CH.sub.2), 25.14 (CH.sub.2).

[0149] ESMS (M-H.sup.+) found 456.20, calculated for C.sub.18H.sub.24FN.sub.5O.sub.6S=457.48.

Example 3—Preparation of O.SUB.2.MB-Rose Bengal and O.SUB.2.MB-5FU Conjugates

[0150] Saturated solutions of 5 (91.2 mM) and 6 (0.61 mM) were prepared in a 0.5% DMSO solution in PBS (pH 7.4±0.1). A 0.3 mL aliquot of these stock solutions were then added separately to two 1 mL suspensions of avidin functionalised PFBMBs (1×10.sup.9 MB/mL) and the contents vortex mixed for 15 minutes. The suspensions were then centrifuged (900 rpm) for 5 min and the MB conjugates isolated as a milky suspension floating on top of the solution. The solution was removed and replaced with a further 0.3 mL of stock solution containing either 5 or 6 and the mixing/centrifugation steps repeated. The MB suspensions were then washed with PBS (5mL), centrifuged (900 rpm) for 5 minutes and the MBs transferred to a clean centrifuge tube. This washing procedure was repeated again and the isolated PFBMB-RB and PFBMB-5FU conjugates placed in glass vial. The PFBMB-RB and PFBMB-5FU conjugates were then sparged with oxygen gas for 2 min and the resulting O.sub.2MB-RB and O.sub.2MB-5FU conjugates were mixed together at a ratio of 1:3.25 to produce a final suspension containing 6.8×10.sup.7 MB/mL with 90.8 μM RB and 440 μM 5-FU.

[0151] This O.sub.2MB-RB/O.sub.2MB-5FU mix was used directly in the in vitro and in vivo experiments described herein.

Example 4—Preparation of O.SUB.2.MB-IR820 Conjugates

[0152] ##STR00008##

[0153] Scheme 2 shows the synthesis of biotin functionalised NIR absorbing dye (9). A schematic representation of the MB-9 conjugate used in the imaging experiments is provided in FIG. 21.

Synthesis of 2-((E)-2-((E)-2-((4-aminophenyl)thio)-3-((E)-2-(1,1-dimethyl-3-(4-sulfobutyl)-1H-benzo[e]indol-2(3H)-ylidene)ethylidene)cyclohex-1-en-1-yl)vinyl)-1,1-dimethyl-3-(4-sulfobutyl)-1H-benzo[e]indol-3-ium (8)

[0154] Compound 7 was prepared following a literature procedure (James et al., Evaluation of Polymethine Dyes as Potential Probes for Near Infrared Fluorescence Imaging of Tumors: Part-1. Theranostics. 2013, 3(9), 692-702). 4-Aminothiophenol (0.63 g, 5 mmol) was dissolved in anhydrous DMF (50 ml) under N.sub.2 atmosphere. 7 (0.6 g, 0.7 mmol) was added to this solution and the mixture stirred for 18 h at room temperature. The reaction was monitored by TLC (Merck Silica 60, HF 254, using 25% MeOH/DCM as mobile phase). The DMF was removed under reduced pressure and the residue re-dissolved in DMF (5 mL) and precipitated with Et.sub.2O (15 mL). The solid product was filtered, washed with Et.sub.2O (30 mL) and purified by column chromatography (silicagel, 60-120 mesh) using MeOH-DCM (1:3) as an eluting agent. The product (230 mg, 4.8%) was isolated as reddish brown semi-solid. This compound was not stable and was used immediately in the next step.

[0155] .sup.1H NMR (500 MHz, MeOH-d.sub.4): 8.96-8.93 (m, 2H, Ar—CH), 8.81-8.78 (m, 2H, Ar—CH), 8.09-8.07 (m, 2H, Ar—CH), 7.90-7.89 (m, 6H, Ar—CH), 7.57-7.51 (m, 4H, Ar—CH), 7.38 (brs, 2H, NH.sub.2), 7.38-7.28 (m, 2H, Ar—CH), 6.34-6.31 (m, 2H, CH X 2), 4.23 (brs, 4H, CH X 2, CH.sub.2), 2.87-2.80 (m, 8H, CH.sub.2 X 4), 1.98-1.91 (m, 10H, CH.sub.2 X 5), 1.70 (s, 12H, CH.sub.3 X 4).

[0156] .sup.13C NMR (125 MHz, dmso-d.sub.6): 173.4, 170.2, 150.1, 148.4, 143.7, 144.6, 142.7, 134.3, 133.9, 132.4, 128.0, 126.1, 126.2, 125.5, 125.7, 117.5, 115.4, 104.7, 61.8, 59.3, 49.4, 48.9, 46.8, 30.2, 28.6, 26.8, 26.9, 25.2, 21.0.

[0157] ESMS calculated for C.sub.52H.sub.58N.sub.3O.sub.6S.sub.3Na.sub.2.sup.+=961.1, found 960.3.

Synthesis of 2-((E)-2-((E)-3-((E)-2-(1,1-dimethyl-3-(4-sulfobutyl)-1H-benzo[e]indol-2(3H)-ylidene)ethylidene)-2-((4-(5-(2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)penta namido)phenyl)thio)cyclohex-1-en-1-yl)vinyl)-1,1-dimethyl-3-(4-sulfobutyl)-1H-benzo[e]indol-3-ium (9)

[0158] Compound 8 (100 mg, 0.1 mmol) was added to a stirring solution of 1 (40.9 mg, 0.12 mmol) in anhydrous DMF (50 mL) to which a catalytic amount of triethylamine was added. The solution was stirred at room temperature for 5 h. The reaction mixture was added to ether (100 ml) and the contents stirred for 30 min. The precipitate was collected by filtration and purified by preparative TLC using MeOH:DCM (1:4) as eluting agent and the product isolated as a green powder.

[0159] Yield=21 mg, 18.4%.

[0160] .sup.1H NMR (500 MHz, MeOH-d.sub.4): 8.77 (d, J=7.8 Hz, 2H, Ar—CH), 8.21 (d, J=7.5 Hz, 2H, Ar—CH), 8.03-7.99 (m, 2H, Ar—CH), 7.73 (d, J=7.5 Hz, 2H, Ar—CH), 7.60-7.57 (m, 2H, Ar—CH), 7.47-7.44 (m, 2H, Ar—CH), 7.20-7.17 (m, 2H, Ar—CH), 7.16 (d, J=12 Hz, 1H, CH), 6.89-6.83 (m, 2H, Ar—CH), 6.58 (d, J=12 Hz, 1H, CH), 6.42 (brs, 1H, NH), 6.36 (brs, 2H, NH X 2), 4.29-4.27 (m, 6H, CH X 2, NCH.sub.2), 4.10 (brs, 2H, —CH.sub.2), 3.14-3.06 (m, 3H, CH, CH.sub.2), 2.80-2.74 (m, 4H, CH.sub.2 X 2), 2.57-2.48 (m, 4H, CH.sub.2 X 2), 2.19-2.16 (m, 2H, CH.sub.2), 1.88-1.59 (m, 2H, CH.sub.2), 1.76 (s, 12H, CH.sub.3 X 4), 1.59-1.57 (m, 2H, CH.sub.2), 1.48-1.28 (m, 12H, CH.sub.2 X 6).

[0161] .sup.13C NMR (125 MHz, dmso-d.sub.6): 177.5, 174.3, 169.9, 166.2, 152.5, 150.2, 148.0, 145.3, 144.8, 140.7, 134.8, 132.6, 131.3, 130.0, 128.5, 126.3, 124.7, 120.1, 116.8, 114.8, 102.5, 64.0, 62.3, 60.1, 54.9, 50.1, 48.6, 48.1, 42.2, 36.7, 32.8, 30.2, 28.4, 28.3, 26.9, 26.0, 24.5, 22.8.

[0162] ESMS calculated for C.sub.62H.sub.72N.sub.5O.sub.8S.sub.4.sup.+=1142.4 (protonated form, M.sup.+), found 1143.4.

Preparation of O.SUB.2.MB-IR820 Conjugates

[0163] Biotin functionalised IR-820 (9) was attached to the surface of O.sub.2MBs following the procedure as described above for 5-FU and Rose Bengal. [MB]=2.6×10.sup.8; [9]=280 μM.

Example 5—Ultrasound Mediated O.SUB.2 .Release from O.SUB.2.MBs

[0164] A 0.5 mL suspension of O.sub.2MBs (1×10.sup.8) prepared in Example 1 was added to degassed PBS (pH 7.4±0.1) (4.5 mL). The dissolved oxygen level of this solution was measured over a 20 min period at 2 min intervals using a dissolved oxygen meter. Ultrasound was applied after 4.5 min for 1 min, using a frequency of 1 MHz, an ultrasound power density of 3.0 Wcm.sup.−2 and a duty cycle of 50% (pulse frequency=100 Hz). Control experiments using PFBMBs were also performed following the same procedure.

[0165] If O.sub.2MBs are to be successful as carrier for oxygen delivery in vivo, it is important that gas exchange between the core of the MB and blood is minimised until the MB is exposed to ultrasound at the target site. The half-life of commercial MBs ranges from 0.97 min in men to 1.23 min in women. Therefore, it is important that O.sub.2MBs can retain their oxygen for at least this time period in situations where an oxygen diffusion gradient may exist. In an attempt to simulate such a scenario, O.sub.2MBs (0.5 mL, 1×10.sup.8) were added to 4.5 mL of degassed PBS (pH 7.4±0.1) in a glass vial and the contents agitated periodically at 37° C. As the O.sub.2MBs float at the top of the PBS solution they were in direct contact with air in the headspace of the open vial. The amount of dissolved O.sub.2 in the PBS solution was determined using a dissolved oxygen meter and was measured for 4.5 min before and 14.5 min after ultrasound treatment. As a control, experiments using PFBMBs were also conducted. The results are shown in FIG. 5 and illustrate that the O.sub.2MBs effectively retain their O.sub.2 until destruction by the externally applied ultrasound at which point the dissolved oxygen increases by more than 40% five minutes after irradiation. In contrast, the dissolved oxygen in the PFBMB control experiment increased by about 20% 1 min after exposure to ultrasound and then decreased to only 5% at five minutes after exposure to ultrasound. We believe this initial increase in dissolved O.sub.2 in the control preparation was due to ultrasound-mediated agitation of the fluid in the measurement chamber. Nevertheless, the results suggest that the O.sub.2MBs effectively retain oxygen and exposure to ultrasound results in an increase in dissolved oxygen that is sustained for a relatively prolonged period of time in this system. We believe this time frame of both retention and ultrasound-mediated release would facilitate sufficient time to enable targeting of microbubbles and their gas payload to a specific anatomical site and provide an increase in dissolved oxygen in a tissue microenvironment that would be sufficient to support enhanced ROS generation during SDT.

Example 6—In Vitro Cytotoxicity Experiments

[0166] Human primary pancreatic adenocarcinoma cell lines MIA PaCa-2 and PANC-1 were maintained in Dulbecco's Modified Eagle's Medium while BxPC-3 cells were maintained in RPMI-1640 medium, all of which were supplemented with 10% (v/v) foetal bovine serum in a humidified 5% CO.sub.2 atmosphere at 37° C. These cell lines were plated into the wells of a 96-well plate at a concentration of 5×10.sup.3 cells per well and incubated for 21 h at 37° C. in a humidified 5% CO.sub.2 atmosphere before being transferred to a hypoxic chamber at 37° C. (O.sub.2/CO.sub.2/N.sub.2, 0.1:5:94.9 v/v/v) for 3 h (this is intended to mimic the hypoxic conditions found at a tumor site). The medium was then removed from each well and replaced with O.sub.2MB-RB (50 μL, 5 μM RB) and O.sub.2MB-5FU (50 μL, 100 μM 5FU) conjugates. Individual wells were then treated with ultrasound delivered using a Sonidel SP100 sonoporator (30 sec, frequency=1 MHz, ultrasound power density=3.0 Wcm.sup.−2, duty cycle=50% with pulse repetition frequency=100 Hz). Cells were kept in the hypoxic environment for a further 3 hours before the treatment solution was removed, the cells washed with PBS and fresh media added (200 uL per well). Plates were then incubated in normoxic conditions (i.e. humidified 5% CO.sub.2 atmosphere at 37° C.) for a further 21 hours before cell viability was determined using a MTT assay (McHale et al., Cancer Lett 1988; 41, 315-21). A similar procedure was repeated for the vehicle only, gemcitabine (drug approved for use in pancreatic cancer treatment), 5-FU, O.sub.2MB-5FU+US, O.sub.2MB-RB+US and the O.sub.2MB-RB/O.sub.2MB-5FU mix−US. In all experiments the amount of RB, 5-FU and gemcitabine used was 5 μM, 100 μM and 100 μM respectively. All groups were also repeated using PFBMB conjugates with the same amount of RB or 5-FU attached.

[0167] The results, shown in FIG. 6, reveal that a statistically significant reduction in viability was observed in all three cell lines for cells treated with the combined SDT/antimetabolite therapy (i.e. O.sub.2MB-RB/O.sub.2MB-5FU mix+US) compared to that of cells treated with either antimetabolite therapy alone (i.e. 5-FU or gemcitabine). Indeed, a statistically significant reduction in viability was also observed for cells treated with the combined therapy relative to that of cells treated with SDT treatment alone (i.e. O.sub.2MB-RB+US). That the SDT effect observed in such hypoxic conditions is greatly enhanced through the use of O.sub.2MBs was confirmed by comparing the difference in the cytotoxicity between the O.sub.2MB-RB/O.sub.2MB-5FU mix with ultrasound treatment and an otherwise identical mix of PFBMB conjugates with ultrasound treatment (FIG. 7). Indeed, statistically significant (p<0.01) reductions in cell viability of over 20% were observed for all three cell lines treated with the O.sub.2MB conjugates compared to the PFBMB conjugates. Collectively, the results shown in FIGS. 6 and 7 clearly highlight the benefit gained when SDT is combined with antimetabolite therapy, particularly in hypoxic environments where O.sub.2MBs can provide additional O.sub.2 to improve the SDT effect.

Example 7—In Vivo Cytotoxicity Experiments

[0168] BxPc-3 cells were maintained in RPMI-1640 medium supplemented with 10% foetal calf serum as described above. Cells (1×10.sup.6) were re-suspended in 100 μL of Matrigel® and implanted into the rear dorsum of female Balb/c SCID (C.B-17/IcrHan®Hsd-Prkdcscid) mice. Tumour formation occurred approximately 2 weeks after implantation and tumour measurements were taken every other day using calipers. Once the tumours had reached an average volume of 218 mm.sup.3, calculated from the geometric mean diameter using the equation tumour volume=4πR.sup.3/3, animals were randomly distributed into 10 groups (n=4). Following induction of anaesthesia (intraperitoneal injection of Hypnorm/Hypnovel), a 100 μL mixture of PBS containing O.sub.2MB-RB (MB=1.6×10.sup.7, [RB]=90.8 μM) and O.sub.2MB-5FU (MB=5.2×10.sup.7, [5FU]=440 μM) was injected directly into each tumour. Intratumoural injection was chosen as the route of administration to preclude experimental variation resulting from pharmacokinetic behaviour of the platform. Where appropriate, tumours were then treated with ultrasound for 3.5 min at an ultrasound frequency of 1 MHz, an ultrasound power density of 3.5 Wcm.sup.−2 (I.sub.SATP; spatial average temporal peak) and using a duty cycle of 30% at a pulse repetition frequency of 100 Hz. Additional treatment groups included (i) no drug; (ii) O.sub.2MB-RB conjugate alone±ultrasound treatment; and (iii) O.sub.2MB-5FU conjugate alone±ultrasound treatment. Gemcitabine (440 μM) and 5-FU (440 μM) only treatments were also performed. After treatment, animals were allowed to recover from anaesthesia and tumour volume and body weight were recorded daily for nine days. The % increase in tumour volume was calculated employing the pre-treatment measurements for each group.

[0169] The tumour volume was measured daily for 9 days and the % change in tumour volume for each group plotted as a function of time. For ease of interpretation, only results from six of the ten groups are shown in FIG. 8a. These results reveal a dramatic reduction in tumour volume for mice treated with the combined SDT/antimetabolite therapy compared to either gemcitabine or 5-FU treatment alone. Indeed, 9 days after treatment, tumours in mice treated with gemcitabine or 5-FU alone grew by 125.1 and 123.3% respectively, while tumours treated with the O.sub.2MB-RB/O.sub.2MB-5FU mix+US grew by only 29.1% over their original starting volume within the same time period. In addition, there was also a statistically significant reduction in tumour volume for tumours treated with the combined SDT/5-FU therapy (i.e. O.sub.2MB-RB/O.sub.2MB-5FU mix+US) relative to SDT treatment alone (i.e. O.sub.2MB-RB+US) with tumours being on average 30.2% smaller 9 days after treatment. Analysis of the average body weight (FIG. 8b) for animals in each of the groups showed no noticeable reductions over the course of the experiment suggesting the treatments did not produce any acute adverse effects.

[0170] In these experiments, gemcitabine was administered as an intra-tumoral injection at a concentration of 0.264 mg/kg in order to provide a direct molar comparison with the amount of 5-FU used (440 μM). Even though this amount was delivered directly to the tumour it is significantly less than the normal systemic dose of gemcitabine (120 mg/kg) used in mice.

[0171] In order to compare the effectiveness of the combined SDT/5-FU therapy against systemic gemcitabine therapy, we treated mice bearing ectopic BxPC-3 tumours with gemcitabine (120 mg/kg) administered by intraperitoneal (IP) injection on days 0, 3 and 8. Tumour volume was measured daily as before and compared to untreated animal controls. These results (FIG. 9) demonstrate that while the tumour volume in the control group increased by about 100%, tumour volume increased by 38% in the gemcitabine treated group and at no point in the therapy did the tumour volume decrease below the starting tumour volume. In contrast, with a single treatment, for the combined SDT/5FU therapy (FIG. 8) the tumour volume decreased below the initial treatment volume and remained so up to 6 days post treatment while tumours in the gemcitabine group exhibited a 20% increase in tumour volume at day 6. That such dramatic response can be achieved using relatively low amounts of sensitiser/5-FU and following a single treatment is extremely promising and suggests the targeted delivery of such agents could provide enhanced therapeutic benefit with reduced side effects.

Example 8—In Vivo NIR Fluorescence Imaging of O.SUB.2.MB-9 Conjugates Following IV Administration to Tumour Bearing Mice

[0172] Athymic nude mice were anaesthetised (intraperitoneal injection of Hypnorm/Hypnovel) and the O.sub.2MB-9 conjugate (100 uL) was administered via tail vein injection. In the treatment group, ultrasound (conditions as in 2.10 above) was applied to the tumours during and for 3 minutes after IV injection while no ultrasound was applied to the tumours in the control group (n=3 in each group). Following administration (at t=5 min and t=10 min), animals were placed in the chamber of a Xenogen IVIS® Lumina imaging system on fluorescence mode using the ICG filter set (excitation: 705-780 nm; emission: 810-885 nm). Data were captured and analyzed using the Living Image® software package version 2.60. Quantitative data were obtained by drawing a region of interest around the tumour and comparing the fluorescent signal (photons/second) at t=5 and t=10 min post O.sub.2MB-9 administration with the fluorescent signal obtained prior to administration.

Example 9—Immunohistochemistry and qRT-PCR Analysis

[0173] We were also interested in probing the effects of combined SDT/5-FU treatment at the molecular level when compared to 5-FU treatment alone. In order to do this, tumours in the control group (i.e. no treatment), the O.sub.2MB-5FU+US group (i.e. 5-FU), and O.sub.2MB-RB/O.sub.2MB-5FU mix+US group (i.e. combined treatment) were harvested at the end of the monitoring period and subjected to immunohistochemistry and qRT-PCR analysis.

HIF1α Expression in the Tumour Post IV Administration of O.SUB.2.MB

[0174] Athymic nude mice were anaesthetised (intraperitoneal injection of Hypnorm/Hypnovel) and either PFBMBs or O.sub.2MBs (100 uL) were administered via tail vein injection (n=3 in each group). Ultrasound (conditions as in 2.10 above) was applied to the tumour during and for 3 minutes after IV injection and the tumours were excised 30 minutes later. For Western blotting analysis of HIF-1α protein expression, total protein was extracted using urea buffer. Primary murine antibodies employed in these studies were anti-HIF1α (Millipore, 1:500), and anti-GAPDH (Sigma, 1:1000). Protein samples were electrophoresed on a 4-12% TruPAGE® gel and transferred to nitrocellulose membranes. Blocking of non-specific binding was carried out in 5% (w/v) bovine serum albumin diluted in 1×tris buffered saline containing 0.05% (v/v) Tween 20. Membranes were then incubated in the appropriate secondary antibody, goat anti-mouse IgG-HRP (1:10000 of the stock solution). Secondary antibodies were purchased from Santa Cruz Biotechnology, Heidelberg, Germany. Densitometry was carried out to quantify HIF1α protein expression using GAPDH as a housekeeping reference.

Immune Response Characterisation

[0175] To characterise the immune response in tissues subjected to therapy, Bcl3 and Bcl2 protein expression was examined using immunohistochemistry in tissue samples harvested at the end of the monitoring period. Immunohistochemical (IHC) evaluation for Bcl2 and Bcl3 proteins was performed on paraffin-embedded sections. The paraffin-embedded tissue samples were cut to a 4 μm thickness using a Leica RM2235 microtome (Leica Biosystems Ltd., Newcastle) and examined on a coated glass slide. IHC analysis for Bcl2 (clone: BCL-2/100/D5) and Bcl3 (clone: 1E8) were diluted 1:200 and 1:150 respectively. Both antibodies were mouse anti-human obtained from Leica Biosystems. Immunostaining was carried out using the automated Bond-Max system (Leica Biosystems Ltd., Newcastle) using on board heat-induced antigen retrieval with Bond Epitope Retrieval Solution 2 (EDTA based on pH 9.0) for 30 min. Endogenous peroxidase activity was blocked using 0.3% hydrogen peroxide for 5 min. The histological specimens were incubated with the primary antibody for 15 min at room temperature and the slides were incubated with rabbit anti-mouse for 8 min at room temperature. The slides were then incubated with goat anti-rabbit polymer reagent for 8 min at room temperature. The reactions were developed using a bond polymer refine detection kit and followed by colour development with 3,3′-diaminobenzidine tetrahydrochloride as a chromogen for 10 min. The immunohistochemistry intensity and proportion scores were carried out according to Allred et al. (Prognostic and predictive factors in breast cancer by immunohistochemical analysis. 1998, 11(2):155-68). In order to confirm immunohistochemical studies Bcl3 expression was also examined at the transcriptional level. mRNA expression of Bcl3 was measured with gene specific qRT-PCR using the primers listed in Table 1:

TABLE-US-00001 TABLE 1 Primers used in qRT-PCR. Primer Sequence Bcl3 Forward CCTTTGATGCCCATTTACTCTA [Seq ID No 1] Bcl3_Reverse AGCGGCTATGTTATTCTGGAC [Seq ID No 2] β-Actin Forward CGTGGGCCGCCCTAGGCACCA [Seq ID No 3] β-Actin Reverse TTGGCCTTAGGGTTCAGGGGGG [Seq ID No 4] 18SrRNA_Forward TGACTCAACACGGGAAACC [Seq ID No 5] 18SrRNA_Reverse TCGCTCCACCAACTAAGAAC [Seq ID No 6]
qRT-PCR and analysis were performed following previously published protocols (Hamoudi et al., Leukemia, 2010, vol. 24, no. 8, pp. 1487-1497; and Bi et al., Haematologica, 2012, 97, 926-930). Briefly, RNA was extracted from microdissected slides using the RecoverAll Kit (Life Technologies, Paisley, UK). cDNA synthesis was carried out using the Superscript III First Strand cDNA synthesis kit (Life Technologies, Paisley, UK) using the reverse primer of each of the genes including the two housekeeping genes; 18S rRNA and 62 -actin. qRT-PCR was carried out using the SYBR Green kit on the CFX96 instrument (BioRad, UK). The qRT-PCR cycle was as follows: 95° C. for 3 minutes, 95° C. for 10 seconds, 60° C. for 45 seconds for 40 cycles. For analysis, the geometric mean of 18S rRNA and β-actin was taken as the single housekeeping value. Statistical comparison between the groups was carried out using two-way ANOVA with Bonferroni post-hoc analysis.

Results

[0176] The immunohistochemistry results revealed that at the protein level, there was Bcl3 and Bcl2 deregulation between both treatment groups and the control group. At this level of analysis, Bcl3 intensity and proportion were higher in the control and 5FU groups but decreased in the combined treatment group. Similarly, Bcl2 protein expression was highest in the control group, decreased in the 5FU group and was undetectable in the combined treatment group (FIG. 10). At the mRNA level, a similar pattern was observed for Bcl3 (FIGS. 11a and 11b) with the ΔΔCt showing significant decreases of approximately 5- and 7-fold for the 5FU and combined treatment groups respectively relative to the control group (p<0.001). Bcl3 is a key member of the NF-κB pathway and is involved in regulating many cellular pathways including survival, proliferation, inflammation and immune response. Bcl3 expression and activation has been associated with increased cellular proliferation or survival, dependent on the tissue and the type of stimuli. Its transcriptional repressor function has been shown to be involved in regulating immune responses as well as the development and activation of immune cells (Wessells et al., J Biol Chem 2004; 279: 49995-50003, and Kuwata et al., Blood 2003; 102: 4123-4129). The fact that Bcl3 expression was deregulated suggests an alteration in the immune response as well as survival and proliferation cell signalling. This was confirmed by the fact that Bcl2, which is an important anti-apoptotic gene, was higher in the control but its expression decreased remarkably after the combined treatment. Indeed Bcl2 expression is known to be up-regulated in the majority of primary pancreatic tumours (Campani et al., Pathol. 2001, 194(4), 444-450) and it has been demonstrated that using Bcl2-spectific siRNA to down-regulate its expression has anti-proliferative and pro-apoptotic effects on pancreatic tumour growth in vitro and in vivo (Ocker et al., Gut, 2005, 54(9), 1298-1308). More recently, it has been shown that a G-quadruplex-binding compound (MM41) that exhibits anti-tumour activity using the MIA PaCa-2 pancreatic cancer xenograft model, reduced Bcl2 levels by 40% following analysis at the protein level (Ohnmacht et al., Sci Rep. 2015, 16(5):11385). Taken together, these results indicate a marked effect on cellular signalling pathways as a result of the combined SDT/5-FU treatment and suggest that SDT could provide significant therapeutic benefit for pancreatic cancer patients when employed together with conventional chemotherapy-based regimes.

Example 10—NIR Imaging

[0177] To be suitable for clinical translation, the MB suspension will need to be administered intravenously and the MBs disrupted at the tumour site using appropriate ultrasound conditions. Such a strategy should enhance localisation of the sensitiser/chemotherapeutic and increase tumour pO.sub.2 at the tumour site. To test the feasibility of such an approach the biotin functionalised near infrared absorbing cyanine dye (9) was employed as a surrogate for RB and 5-FU (Scheme 2)—see Example 4. The UV-Vis and fluorescence spectra of 9 reveal absorbance (750 nm) and emission maxima (818 nm) in the NIR region making this compound ideal for in vivo imaging.

[0178] As described in Example 4, dye (9) was loaded onto the MB surface following the same procedure used for RB and 5-FU. The O.sub.2MB-9 conjugate was then administered intravenously via the tail vein of athymic nude mice bearing ectopic Bx-PC3 tumours. Ultrasound was applied directly to the tumour during and for 3 minutes after IV administration. Control experiments in the absence of ultrasound were used for comparative purposes. The mice were imaged before, 5 and 30 minutes after administration using an IVIS whole body imaging system. Representative images (FIG. 12a) reveal strong tumour fluorescence 30 min after treatment for mice in the ultrasound treated group while mice in the control group showed negligible tumour fluorescence, with most of the emission observed from the liver region. When the intensity of tumour fluorescence was measured relative to the pre-treatment value (FIG. 12b), a statistically significant 7-fold enhancement was observed for the ultrasound treated group relative to the control group, 30 min following treatment (p<0.01). Furthermore, when either O.sub.2MB or PFBMB were administered to tumour-bearing animals by tail vein injection and subsequently treated with ultrasound, protein extracts from surgically-excised tumours revealed a significant decrease in Hif-1α in tumours treated with the O.sub.2MB (FIG. 12c). These results suggest that the application of ultrasound to the tumour, during and immediately after administration of the O.sub.2MB-9 conjugate, facilitates stimulus-dependant destruction of the MBs in the tumour vasculature which in turn facilitates release of both O.sub.2 and the attached payload in a targeted manner. The end result is an increase in tumour pO.sub.2 as evidenced by reduced expression of Hif1α a protein and a greater concentration of drug in the tumour as evidenced by the enhanced fluorescence of (9).

Example 11—Monoiodo ICG Synthesis (I.SUB.2.-IR783 or “I2-IRCYDYE”)

[0179] ##STR00009##

Synthesis of (4-iodophenyl)hydrazine (1)

[0180] 20 g (91.3 mmol) of 4-iodoaniline was stirred with a solution of 15 ml concentrated hydrochloric acid and 15 ml of water. The mixture was cooled to about −10° C. and 12.6 g (182.6 mmol) of NaNO.sub.2 in 45 ml of water was added drop wise with continuous stirring. The suspension was allowed to stir for another 30 minutes and then an ice cold solution of SnCl.sub.2.2H.sub.2O (67.99 g, 301.3 mmol in 40 ml of concentrated HCl) was added drop wise keeping the temperature at −10° C. The reaction mixture was stirred at that temperature for 1.5 hr and at 5° C. overnight. The light brown precipitate obtained was filtered and washed three times with water. This solid mass thus obtained was then stirred with saturated solution of NaOH in water (100 ml) and extracted with ether (200 ml). The ether layer was washed with aqueous solution of NaOH, Na.sub.2S.sub.2O.sub.3 and water. After drying with MgSO.sub.4 (anhydrous), the ether layer was evaporated to dryness to afford 17.94 g of (4-iodophenyl)hydrazine as brown powder. m.p=104-106° C.

[0181] .sup.1H NMR (CDCl.sub.3): 7.48 (d, J=8.0 Hz, 2H, Ar—CH), 6.62 (d, J=8.0 Hz, 2H, Ar—CH), 5.18 (brs, 1H, NH), 3.55 (brs, 2H, NH.sub.2).

[0182] ESMS (M+H) found=235.00, calculated for C.sub.6H.sub.7IN.sub.2=234.04.

Synthesis of 5-iodo-2,3,3-trimethyl-3H-indole (2)

[0183] 12.68 g (54.1 mmol) of (4-iodophenyl)hydrazine (1) and 8 g (92.8 mmol) of 3-methyl-2-butanone were refluxed in 100 ml of glacial acetic acid for 20 hrs. The acetic was evaporated and the residue was dissolved in ether. Insoluble precipitate was filtered off, and the etheric solution was washed with aqueous solution of NaOH followed by Na.sub.2S.sub.2O.sub.3 and water. The organic layer was dried with anhydrous Na.sub.2SO.sub.4 and the ether was removed under reduced pressure to afford 10.5 g of 5-iodo-2,3,3-trimethyl-3H-indole (2) as red gummy liquid.

[0184] .sup.1H NMR (CDCl.sub.3): 7.60 (dd, J=4.5, 8.0 Hz, 2H, Ar—CH), 7.28 (d, J=8.0 Hz, 1H, Ar—CH), 2.25 (s, 3H, CH.sub.3), 1.20 (s, 6H, CH.sub.3 X 2).

[0185] .sup.13C NMR (CDCl.sub.3): 153.4 (C), 148.1 (C), 139.3 (C), 136.6 (CH), 130.6 (CH), 121.8 (CH), 89.9 (C), 54.0 (C), 23.0 (CH.sub.3), 22.9 (CH.sub.3), 15.3 (CH.sub.3).

[0186] ESMS (M+H) found=286.1, calculated for C.sub.11H.sub.12IN=285.12.

Synthesis of 5-iodo-2,3,3-trimethyl-1-(4-sulfobutyl)-3H-indol-1-ium (3)

[0187] Toluene (70 ml), 5-iodo-2,3,3-trimethyl-3H-indole (2) (12 g, 42.1 mmol) and 1,4-butane sultone (8.6 g, 63.1 mmol) were heated under reflux for 18 hrs. The reaction mixture was allowed to cool to room temperature. The resulting brown crystals were filtered and washed with acetone (3×10 ml). The filtered product was recrystallized from a solution of MeOH and diethyl ether. The crystals were collected and dried in vacuo to yield 8 g of 5-iodo-2,3,3-trimethyl-1-(4-sulfobutyl)-3H-indol-1-ium (3).

[0188] .sup.1H NMR (dmso-d.sub.6): 8.27 (s, 1H, Ar—CH), 7.95 (s, 1H, Ar—CH), 7.82 (s, 1H, Ar—CH), 4.42 (brs, 2H, CH.sub.2), 2.79 (s, 3H, CH.sub.3), 2.47 (brs, 2H, CH.sub.2), 1.90 (brs, 2H, CH.sub.2), 1.69 (brs, 2H, CH.sub.2), 1.49 (s, 6H, CH.sub.3 X 2).

[0189] .sup.13C NMR (DMSO-d.sub.6):176.2, 148.4, 139.9, 136.7, 132.5, 126.8, 96.8, 49.8, 46.8, 42.6, 26.8, 25.6, 10.5.

[0190] ESMS (M+H) found=422.10, calculated for C.sub.15H.sub.21INO.sub.3S.sup.+=422.30.

Synthesis of 2-((E)-2-((E)-2-chloro-3-((E)-2-(5-iodo-3,3-dimethyl-1-(4-sulfobutyl)indolin-2-ylidene)ethylidene)cyclohex-1-en-1-yl)vinyl)-5-iodo-3,3-dimethyl-1-(4-sulfobutyl)-3H-indol-1-ium (5)

[0191] A solution of 3 (0.2 g, 0.47 mmol), 4 (prepared according to the method described in Flanagan et al., Bioconjugate Chem, 1997, 8, 751-756) (0.153 g, 0.47 mmol) and anhydrous sodium acetate (0.077 g, 0.93 mmol) in absolute EtOH (10 ml) under N.sub.2 atmosphere was heated under reflux for 4 hr. The EtOH was removed under reduced pressure and the residue was purified by column chromatography (silica 60-120 mesh) using 25% MeOH-CHCl.sub.3 mixture as eluting agent. The product (0.152 g, 33% yield) was isolated as greenish powder.

[0192] .sup.1H NMR (MeOH-d.sub.4): 8.26 (d, J=7.8 Hz, 1H, Ar—CH), 8.03-7.98 (m, 2H, Ar—CH), 7.68-7.63 (m, 2H, Ar—CH), 7.63-7.49 (m, 1H, Ar—CH), 6.39-6.36 (m, 2H, CH X 2), 4.34-4.33 (m, 2H, CH X 2), 3.33-3.34 (m, 4H, CH.sub.2 X 2), 2.92-2.90 (m, 2H, CH.sub.2), 2.89-2.80 (m, 2H, CH.sub.2), 2.08-1.96 (m, 26H, CH.sub.2 X 7, CH.sub.3 X 4).

[0193] .sup.13C NMR (DMSO-d.sub.6): 174.7, 173.9, 150.1, 149.6, 148.0, 146.7, 145.9, 130.8, 134.8, 132.6, 130.1, 129.8, 128.3, 126.4, 124.7, 120.7, 116.1, 114.9, 104.6, 102.8, 98.6, 62.1, 60.1, 50.4, 29.1, 48.7, 30.5, 28.4, 28.5, 26.3, 26.2, 24.6.

[0194] ESMS (M-H.sup.+) found=977.2, calculated for C.sub.38H.sub.46ClI.sub.2N.sub.2O.sub.6S.sub.2.sup.+=979.06.

Example 12—Diiodo-IR-820 Synthesis (I.SUB.4.-IR783 or “I4-IRCYDYE”)

[0195] ##STR00010##

Synthesis of 3,5-diiodonitrobenzene (2)

[0196] To concentrated H.sub.2SO.sub.4 (96%, 15 mL) solution cooled at 0° C. was added 2,6-diiodo 4-nitroaniline 1 (3.9 g, 10 mmol) in small portions. This solution was stirred 20 minutes at this temperature and NaNO.sub.2 (1.5 g, 22 mmol) was added. Stirring was continued at 0° C. for 2 h. Then, the viscous solution was poured into ice (100 g) and any solid material was filtered off. The yellow filtrate was carefully poured into a refluxed solution of CuSO.sub.4.5H.sub.2O (160 mg, 1 mmol) in EtOH (200 mL) and stirred for 2 h to reduce the diazonium salt. After cooling to room temperature, solid 3,5-diiodonitrobenzene (2) was separated. The product was filtered off and washed with water until neutral. The product was recrystallized from EtOH to give 2.48 g (66% yield) of fine brown needles.

[0197] .sup.1H NMR (CDCl3) δ=8.43 (t, J=1.4 Hz, 2H, Ar—CH X2), 8.29 (s, 1H, Ar—CH);

[0198] .sup.13C NMR (CDCl3)δ=94.1, 131.7, 148.4, 151.0.

[0199] ESMS [M+H.sup.+]: calculated for C.sub.6H.sub.3I.sub.2NO.sub.2Na 397.8, found 398.9 m/z.

Synthesis of 3,5-diiodoaniline (3)

[0200] To a suspension of 2 (7.15 g, 19 mmol) in anhydrous EtOH (75 mL) under argon atmosphere was added SnCl.sub.2.2H.sub.2O (21.6 g, 96 mmol). This mixture was brought to boil and a solution of NaBH.sub.4 (361 mg, 9.5 mmol) in EtOH (40 mL) was added dropwise. The reaction mixture was stirred at reflux for 45 min. After the reaction was cooled down to 0° C., water (60 mL) was added and the mixture was neutralized with NaOH (2.5 M in H.sub.2O). The aniline derivative was extracted with diethyl ether, dried over Na.sub.2SO4 and evaporated under reduced pressure to afford aniline 3 (5.86 g, 89% crude yield).

[0201] .sup.1H NMR (CDCl3) δ=7.39 (s, 1H, Ar—CH), 6.97 (s, 2H, Ar—CH X 2), 3.66 (brs, 2H, NH.sub.2).

[0202] .sup.13C NMR (CDCl3)δ=148.5, 134.8, 122.9, 95.1.

[0203] ESMS [M+H.sup.+]: calculated for C.sub.6H.sub.5I.sub.2N 344.8, found 345.5 m/z.

Synthesis of 3,5-diiodophenylhydrazine (4)

[0204] This compound was synthesised according to the procedure described in US 2013/0231604.

Synthesis of 4,6-diiodo-2,3,3-trimethyl-3H-indole (5)

[0205] This compound was synthesised according to the procedure described in US 2013/0231604.

Synthesis of 4,6-diiodo-2,3,3-trimethyl-1-(4-sulfobutyl)-3H-indol-1-ium (6)

[0206] Toluene (10 ml), 4,6-diiodo-2,3,3-trimethyl-3H-indole (5) (2.1 g, 5.1 mmol) and 1,4-butane sultone (3.5 g, 25.7 mmol) were heated under reflux for 18 hrs. The reaction mixture was allowed to cool to room temperature. The resulting brown crystals were filtered and washed with acetone (3×10 ml). The filtered product was recrystallized from a solution of MeOH and diethyl ether. The crystals were collected and dried in vacuo to yield 1.9 g of 4,6-diiodo-2,3,3-trimethyl-1-(4-sulfobutyl)-3H-indol-1-ium (6).

[0207] .sup.1H NMR (MeOH-d.sub.4): 8.42 (s, 1H, Ar—CH), 8.36 (s, 1H, Ar—CH), 4.51-4.48 (m, 2H, CH.sub.2), 2.88-2.85 (m, 2H, CH.sub.2), 2.09-2.00 (m, 2H, CH.sub.2), 1.99-1.82 (m, 2H, CH.sub.2), 1.73 (s, 6H, CH.sub.3 X 2), 1.16 (s, 3H, CH.sub.3).

[0208] ESMS [M-H.sup.+]: calculated for C.sub.15H.sub.20I.sub.2NO.sub.3S.sup.+ 547.9, found 546.1 m/z.

Synthesis of 2-((E)-2-((E)-2-chloro-3-((E)-2-(4,6-diiodo-3,3-dimethyl-1-(4-sulfobutyl)indolin-2-ylidene)ethylidene)cyclohex-1-en-1-yl)vinyl)-4,6- diiodo-3,3-dimethyl-1-(4-sulfobutyl)-3H-indol-1-ium (8)

[0209] A solution of 8 (0.84 g, 1.5 mmol), 7 (prepared according to the method described in Flanagan et al., Bioconjugate Chem, 1997, 8, 751-756) (0.25 g, 0.7 mmol) and anhydrous sodium acetate (0.13 g, 1.5 mmol) in absolute EtOH (10 ml) under N.sub.2 atmosphere was heated under reflux for 4 hr. The EtOH was removed under reduced pressure and the residue was purified by column chromatography (silica 60-120 mesh) using 25% MeOH—CHCl.sub.3 mixture as eluting agent. The product (0.153 g, 8% yield) was isolated as brown powder.

[0210] .sup.1H NMR (MeOH-d.sub.4): 8.59 (s, 2H, Ar—CH X 2), 8.29 (s, 2H, Ar—CH X 2), 6.77-6.75 (m, 2H, CH X 2), 5.30 (brs, 2H, CH X 2), 4.82-4.72 (m, 4H, CH.sub.2 X 2), 3.39 (brs, 4H, CH.sub.2 X 2), 2.60-2.47 (m, 14H, CH.sub.2 X 7), 2.23 (s, 12H, CH.sub.3 X 4).

[0211] .sup.13C NMR (DMSO-d.sub.6): 170.2, 169.9, 158.9, 150.1, 149.7, 148.6, 146.8, 144.9, 140.8, 139.3, 134.2, 132.1, 126.7, 124.3, 104.0, 100.4, 96.7, 96.2, 94.5, 64.1, 59.5, 50.5, 48.7, 48.1, 30.3, 28.7, 28.2, 26.3, 26.1, 24.3.

[0212] ESMS [M-H.sup.+]: calculated for C.sub.38H.sub.44CI.sub.4N.sub.2O.sub.6S.sub.2Na.sup.+ 1253.85, found 1252.81 m/z.

Example 13—In Vivo PDT Effect of I.SUB.2.-IR783 in Mice Bearing Human Xenograft Ectopic BxPc-3 Pancreatic Cancer Tumours

[0213] BxPc-3 cells were maintained in RPMI-160 medium supplemented with 10% foetal calf serum. Cells were cultured at 37° C. under 5% CO2 in air. BxPc-3 cells (1×10.sup.6) were re-suspended in 100 μl of matrigel and implanted into the rear dorsal of male SCID mice. Tumour formation occurred approximately 2 weeks after implantation and tumour measurements were taken every day using callipers. Once the tumours had reached an average volume of 267 mm.sup.3 calculated from the geometric mean diameter using the equation tumour volume=4πR.sup.3/3, animals were randomly distributed into 2 groups (n=2). Following induction of anaesthesia (intraperitoneal injection of Hypnorm/Hypnovel), the treatment group received a 100 μl aliquot of I.sub.2-IR783 (1 mg/kg) in a PBS:DMSO (98:2) vehicle injected directly into each tumour and treated with 780 nm light irradiation (100 mW) for 3×3 min with a 1 minute lag in between treatments. The second group (control) received vehicle only. After treatment animals were allowed to recover from anaesthesia and tumour volume was monitored at the indicated times. The % increase in tumour volume was calculated employing the pre-treatment measurements for each group. At day 8 the treatment group received a second treatment as described above but also received an intra-humoral injection of 100 μl of O.sub.2MBs (1×10.sup.8 MB/mL) before light irradiation. Results are shown in FIG. 13.

Example 14—Fluorescence of I2 and I4 Analogues of IR783 (“I2-IRCYDYE” and “I4-IRCYDYE”)

[0214] FIG. 14 shows (a) the UV-Vis and (b) fluorescence emission spectra of I2-IRCYDYE and I4-IRCYDYE in comparison to cardio green. The new compounds clearly show similar absorption profiles to Cardio Green. However, while the fluorescence emission of I2-IRCYDYE remains similar to cardiogreen the emission from I4-IRCYDYE is considerably quenched. This is attributed to increased ISC due to the additional iodine atoms.

Example 15—Singlet Oxygen Production and In Vitro Cytotoxicity of I2 and I4 Analogues of IR783 (“I2-IRCYDYE” and “I4-IRCYDYE”)

[0215] FIG. 15 shows that both I2-IRCYDYE and I4-IRCYDYE produce more singlet oxygen than Cardio Green when excited at 780 nm.

[0216] FIG. 16 shows that both I2-IRCYDYE and I4-IRCYDYE are significantly more cytotoxic to two different pancreatic cancer cell lines (Mia Paca and BxPC-3) than cardio green when exposed to 780 nm irradiation. The compounds also proved more toxic to a cervical cancer cell line (HeLa) than Cardio Green when excited at 780 nm. In vivo experiments in mice using ectopic BxPC-3 pancreatic tumors have also shown that I2-IRCYDYE localises in tumor 18 hours following tail vein administration.

[0217] These results evidence that both I2-IRCYDYE and I4-IRCYDYE are effective NIR activated sensitisers and that I2-IRCYDYE also has potential as an imaging agent given its high NIR fluorescence. This provides the potential for image guided PDT and/or SDT of solid tumors, e.g. pancreatic tumors.

Example 16—Combined Antimetabolite/Sonodynamic Therapy of Human Pancreatic Cancer MiaPaCa-2 Cells Using Rose Bengal and 5-FU

Procedure

[0218] Human primary pancreatic adenocarcinoma cell lines MIA PaCa-2 were maintained in Dulbecco's Modified Eagle's Medium and supplemented with 10% (v/v) foetal bovine serum in a humidified 5% CO.sub.2 atmosphere at 37° C. The cells were plated into the wells of a 96-well plate at a concentration of 4×10.sup.3 cells per well and incubated for 21 h at 37° C. in a humidified 5% CO.sub.2 atmosphere. The medium was then removed and wells treated with either Rose Bengal, (3 μM), 5-Fluorouracil (50 μM) or a combination of both RB (3 μM) and 5-FU (50 μM) for 3 h. The drug solutions were then removed, fresh media added and selected wells treated with ultrasound delivered using a Sonidel SP100 sonoporator (30 sec, frequency=1 MHz, ultrasound power density=3.0 Wcm.sup.−2, duty cycle=50% with pulse repetition frequency=100 Hz). The cells were then incubated for 24 h before cell viability was determined using a MTT assay.

Results

[0219] The results are shown in FIG. 17. The results demonstrate that SDT treatment (i.e. RB+US) reduced cell viability by 11.1% relative to RB alone (RB−US). 5FU treatment+ultrasound reduced cell viability by 5.9% more than 5FU treatment alone. Treatment with combined SDT/5FU+ultrasound (combo+US) resulted in a 21.9% reduction relative to treatment with RB/5FU-ultrasound. Surprisingly, this difference is greater than would be expected by adding the effects caused by both treatments (17%) and indicates there is synergy by combining both techniques. (n=6).

[0220] This experiment involved just the active agents. However, these are effectively the liberated species upon microbubble destruction. The results are thus expected to extend to the situation in which the active agents are delivered using the microbubble technology herein described.

Example 17—Combined Anthracycline/Sonodynamic Therapy of Human Breast Cancer MDA-MB-231 Tumours Using Oxygen Loaded Microbubble Rose Bengal and Doxorubicin Conjugates

Synthesis of Biotin-Rose Bengal and Biotin-Doxorubicin

[0221] Synthesis of Biotin-Rose Bengal has been detailed above in Example 2. Biotin-Doxorubicin (Biotin-Dox) was prepared according to Scheme 3:

##STR00011##

[0222] To an ice cold solution of biotin-N-hydroxysuccinimide ester (0.14 g, 0.41 mmol) in DMF (10 ml) was added doxorubicin (0.3 g, 0.41 mmol) under a nitrogen atmosphere. After stirring for 30 min, triethylamine (0.5 ml, 2 mmol) was added to this reaction mixture and was allowed to stir for another 12 hrs at room temperature. The reaction was monitored by TLC (Merck Silica 60, HF 254, 20:80 methanol-dichloromethane v/v). After completion of the reaction, excess diethyl ether (100 ml) was added to the reaction mixture. The red solid thus obtained was filtered and washed three times with diethyl ether (50 ml X 3). This red solid was then subjected to PTLC purification using methanol-dichloromethane (20:80, v/v) as an eluent to obtain 0.25 g (Yield=78%) of biotinylated doxorubin. An analytical sample was obtained from a recrystallization of this product from ethanol.

[0223] .sup.1H NMR (MeOH-d.sub.4)δ: 8.54 (brs, 1H, NH), 7.82-7.76 (m, 2H, aromatic), 7.47 (d, J=7.5 Hz, 1H, aromatic), 5.39 (brs, 1H, NH), 5.05 (brs, 2H, NH, OH), 4.71 (s, 2H, —CH.sub.2—OH), 4.67 (brs, 2H, OH X 2), 4.36-4.33 (m, 1H, CH), 4.25-4.22 (m, 1H, CH), 4.16-4.13 (m, 1H, CH), 3.99 (s, 3H, OCH.sub.3), 3.60-3.58 (m, 1H, CH), 3.55 (brs, 2H, OH X2), 3.30-2.5 (m, 4H, CH.sub.2 X1, CH X 2), 2.18-2.14 (m, 3H, CH.sub.2 X 1, CH), 2.00-1.96 (m, 1H, CH), 1.63-1.50 (m, 4H, CH.sub.2 X 2), 1.42-1.26 (m, 11H, CH.sub.3 X 1, CH.sub.2 X 4).

[0224] ESMS [M-H]: calculated for C.sub.37H.sub.43I.sub.2N.sub.3O.sub.13S=769.25, found=767.9 m/z.

Preparation of Oxygen Loaded Microbubble Rose Bengal (RBO.SUB.2.MB) and Doxorubicin (DoxO.SUB.2.MB) Conjugates

[0225] Solutions containing Biotin-RB (2.5 mg/mL) and Biotin-Dox (2.5 mg/mL) were prepared in a 0.5% DMSO solution in PBS (pH 7.4±0.1). A 2 mL aliquot of these stock solutions was then added separately to two 2 mL suspensions of avidin functionalised PFBMBs (1×10.sup.9 MB/mL) and the contents vortex mixed for 15 minutes. The suspensions were then centrifuged (900 rpm) for 5 min and the MB conjugates isolated as a milky suspension floating on top of the solution. The solution was removed and replaced with a further 2 mL of stock solution containing either Biotin-RB or Biotin-Dox and the mixing/centrifugation steps repeated. The MB suspensions were then washed with PBS (5 mL), centrifuged (900 rpm) for 5 minutes and the MBs transferred to a clean centrifuge tube. This washing procedure was repeated again and the isolated PFBMB-RB and PFBMB-Dox conjugates placed in a glass vial. The PFBMB-RB and PFBMB-Dox conjugates were then sparged with oxygen gas for 2 min and the resulting RBO.sub.2MB and DoxO.sub.2MB (see FIG. 18) used directly in the animal experiments.

Treatment of Human Xenograft MDA-MB-231 Using Breast Cancer Tumors in SCID Mice

[0226] All animals employed in this study were treated humanely and in accordance with licenced procedures under the UK Animals (Scientific Procedures) Act 1986. MDA-MB-231 cells were maintained in RPMI-1640 medium supplemented with 10% foetal calf serum as described above. Cells (1×10.sup.6) were re-suspended in 100 μL of Matrigel® and implanted into the rear dorsum of female Balb/c SCID (C.B-17/IcrHan®Hsd-Prkdcscid) mice. Tumour formation occurred approximately 2 weeks after implantation and tumour measurements were taken every other day using calipers. Once the tumours had reached an average volume of 100 mm.sup.3, calculated from the geometric mean diameter using the equation tumour volume=4πR.sup.3/3, animals were randomly distributed into 3 groups (n=3). Following induction of anaesthesia (intraperitoneal injection of Hypnorm/Hypnovel), group 1 received 100 μL of RBO.sub.2MB (300 μM RB); group 2 received 100 μL of DoxO.sub.2MB (475 μM) and group 3 received 100 μL containing RBO.sub.2MB (150 μM RB) and of DoxO.sub.2MB (237.5 μM). Intratumoural injection was chosen as the route of administration to preclude experimental variation resulting from pharmacokinetic behaviour of the platform. The tumours were then treated with ultrasound for 3.5 min at an ultrasound frequency of 1 MHz, an ultrasound power density of 3.5 Wcm.sup.−2 (I.sub.SATP; spatial average temporal peak) and using a duty cycle of 30% at a pulse repetition frequency of 100 Hz. Treatments were repeated on Day 14. After treatments, animals were allowed to recover from anaesthesia and tumour volume and body weight were recorded daily for nine days. The % increase in tumour volume was calculated employing the pre-treatment measurements for each group.

Results

[0227] The results are shown in FIG. 19. The results show that the combined DoxO.sub.2MB/RBO.sub.2MB+US treatment was more effective than RBO.sub.2MB+US and as effective as DoxO.sub.2MB+US using half the concentration of Doxorubicin and Rose Bengal. The results demonstrate that the platform may be employed to treat breast cancer.