MICROBUBBLE-CHEMOTHERAPEUTIC AGENT COMPLEX FOR SONODYNAMIC THERAPY
20220347314 · 2022-11-03
Assignee
Inventors
Cpc classification
A61K47/6925
HUMAN NECESSITIES
A61K41/0033
HUMAN NECESSITIES
International classification
A61K47/69
HUMAN NECESSITIES
A61K41/00
HUMAN NECESSITIES
Abstract
The invention relates to methods of sonodynamic therapy comprising the co-administration of a microbubble-chemotherapeutic agent complex together with a microbubble-sonosensitiser complex. It further relates to pharmaceutical compositions comprising these complexes and their use in methods of sonodynamic therapy and/or sonodynamic diagnosis. Such methods find particular use in the treatment of cancer, e.g. pancreatic cancer.
Claims
1. A method of treating cancer via sonodynamic therapy, comprising simultaneous or sequential administration to cells or tissues of a patient in need thereof a microbubble-sonosensitiser complex and a microbubble-chemotherapeutic agent complex, and subjecting said cells or tissues to ultrasound irradiation to rupture the microbubbles and activate the sonosensitiser.
2. A method of treating cancer via sonodynamic therapy, said method comprising administration to cells or tissues of a patient in need thereof a microbubble-chemotherapeutic agent complex, wherein said complex is additionally attached to or associated with at least one sonosensitiser, and wherein said method comprises subjecting said cells or tissues to ultrasound irradiation to rupture the microbubble and activate the sonosensitizer.
3. The method as claimed in claim 1, wherein the microbubble-chemotherapeutic agent complex comprises a microbubble attached to or associated with the chemotherapeutic agent, via a non-covalent linkage.
4. The method as claimed in claim 1, wherein the microbubble-chemotherapeutic agent complex comprises a microbubble having a shell which retains a gas.
5. The method as claimed in claim 1, wherein the microbubble-sonosensitiser complex comprises a microbubble having a shell which retains a gas.
6. The method as claimed in claim 1, wherein said microbubble-chemotherapeutic agent complex and/or said microbubble-sonosensitiser complex comprises a microbubble having a diameter of less than 200 μm.
7. The method as claimed in claim 1, wherein said microbubble-chemotherapeutic agent complex and/or said microbubble-sonosensitiser complex comprises a phospholipid monolayer shell having linked thereto one or more polymers.
8. The method as claimed in claim 1, wherein the sonosensitiser is selected from phenothiazine dyes such as methylene blue, toluidine blue, Rose Bengal, porphyrins such as Photofrin®, chlorins, benzochlorins, phthalocyanines, napthalocyanines, porphycenes, cyanines and cyanine analogues such as Merocyanine 540 and indocyanine green, azodipyromethines such as BODIPY and halogenated derivatives thereof, acridine dyes, purpurins, pheophorbides, verdins, psoralens, hematoporphyrins, protoporphyrins and curcumins.
9. A pharmaceutical composition comprising the microbubble-chemotherapeutic agent complex as defined in claim 2, together with at least one pharmaceutical carrier or excipient.
10. A pharmaceutical composition comprising the microbubble-chemotherapeutic agent complex, and the microbubble-sonosensitiser complex as defined in claim 1, together with at least one pharmaceutical carrier or excipient.
11. A method of treating cancer via sonodynamic therapy, said method comprising administration to cells or tissues of a patient in need thereof a pharmaceutical composition as claimed in claim 9, and subjecting said cells or tissues to ultrasound irradiation to rupture the microbubbles and activate the sonosensitiser.
12-13. (canceled)
14. The method as claimed in claim 1, wherein said cancer is selected from the group consisting of sarcomas, including osteogenic and soft tissue sarcomas, carcinomas, lymphomas, including Hodgkin and non-Hodgkin lymphomas, neuroblastoma, melanoma, myeloma, Wilm's tumour, and leukemias, including acute lymphoblastic leukaemia and acute myeloblastic leukaemia, astrocytomas, gliomas and retinoblastomas.
15. The method as claimed in claim 14, wherein said cancer is pancreatic cancer.
16-22. (canceled)
23. A microbubble having linked thereto at least one chemotherapeutic agent and at least one sonosensitiser.
24-34. (canceled)
35. The method as claimed in claim 2, wherein said complex is additionally attached to or associated with the at least one sonosensitiser via a non-covalent linkage.
36. The method as claimed in claim 35, wherein said non-covalent linkage is a biotin-avidin interaction.
37. The method as claimed in claim 3, wherein the non-covalent linkage is a biotin-avidin interaction.
38. The method as claimed in claim 4, wherein said gas is oxygen.
39. The method as claimed in claim 5, wherein said gas is oxygen.
40. The method as claimed in claim 8, wherein the sonosensitiser is Rose Bengal, methylene blue, indocyanine green or an analogue of indocyanine green.
41. The pharmaceutical composition as claimed in claim 9, wherein said microbubble-chemotherapeutic agent complex comprises a microbubble having non-covalently bound thereto at least one chemotherapeutic agent and at least one sonosensitiser.
42. A method of treating cancer via sonodynamic therapy, said method comprising administration to cells or tissues of a patient in need thereof a pharmaceutical composition as claimed in claim 10, and subjecting said cells or tissues to ultrasound irradiation to rupture the microbubble and activate the sonosensitiser.
43. The method as claimed in claim 14, wherein said cancer is selected from breast, lung, cerebral, bladder, thyroid, prostate, colon, rectum, pancreas, stomach, liver, uterine, hepatic, renal, prostate, cervical and ovarian carcinoma.
44. The method as claimed in claim 1, wherein said chemotherapeutic agent is selected from the group consisting of antifolates; 5-fluoropyrimidines; cytidine analogues; purine antimetabolites; alkylating agents; non-classical alkylating agents; platinum analogues; antitumour antibiotics; bioreductive drugs; anthracyclines; topoisomerase I inhibitors; topoisomease II inhibitors; antimicrotubule agents such as vinca alkaloids, taxols, and epothilones; antioestrogens; antiandrogens; aromatase inhibitors; antiangiogenic or hypoxia targeting drugs; antivascular agents; tyrosine kinase inhibitors; oncogene or signalling pathway targeting agents; agents targeting stress proteins; autophagy targeting agents; proteasome targeting agents; telomerase inhibitors; histone deacetylase inhibitors; DNA methyl transferase inhibitors; alkyl sulfonates; aziridines; ethylenimines and methylamelamines; nitrogen mustards; nitrosureas; purine analogues; pyrimidine analogues; androgens; and anti-adrenals and the pharmaceutically acceptable salts, derivatives, and analogues thereof.
45. The method as claimed in claim 44, wherein the chemotherapeutic agent is a taxane.
46. The method as claimed in claim 45, where the taxane is paclitaxel or docetaxel, or an analogue thereof.
Description
[0108] The invention will now be described further with reference to the following non-limiting Examples and the accompanying drawings in which:
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
EXAMPLES
Reagents and Equipment
[0130] Rose bengal sodium salt, 2-bromoethylamine, NHS-biotin, MTT, avidin, FITC avidin, chloroacetic acid, 4-dimethylaminopyridine (DMAP), hydroxybenzotriazole (HOBt), N,N′-dicyclohexylcarbodiimide (DCC), anhydrous dimethylformamide (DMF) and ethanol were purchased from Sigma Aldrich (UK) at the highest grade possible. Biotin, 5-Flurouracil, di(N-succinimidyl)carbonate and 2-aminoethanol were purchased from Tokyo Chemical Industry UK Ltd. 1,2-dibehenoyl-sn-glycero-3-phosphocholine (DSPC), dibehenoylphosphatidylcholine (DBPC), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)-2000 (DSPE-PEG (2000)) and DSPE-PEG(2000)-biotin were purchased from Avanti Polar Lipids (Alabaster, Ala., USA). Doxorubicin was purchased from XABC (China). Oxygen gas was purchased from BOC Industrial Gases UK, while perfluorobutane (PFB) gas was purchased from Apollo Scientific Ltd. Phosphate Buffered Saline (PBS) was purchased from Gibco, Life Technologies, UK.
[0131] NMR spectra were recorded on a Varian 500 MHz spectrometer. ESI-MS characterisation was achieved using a LCQTM quadrupole ion-trap mass spectrometer (Finnigan MAT, San Jose, Calif., USA) utilising electrospray ionisation (ESI). Optical microscope images were taken with an optical microscope (Leica DM500 optical microscope). Dissolved oxygen was measured using a Thermo Scientific Orion Star A216 bench top dissolved oxygen meter. Error was expressed as ±SEM (standard error of the mean) while statistical comparisons were made using an un-paired student's t-test.
Example 1—Preparation of O.SUB.2 .Loaded Microbubbles (O.SUB.2.MBs)
[0132] DSPC MBs were prepared as described in McEwan et al. (J Control Release. 2015; 203, 51-6). However, to improve both the physical stability of the MBs and also their stability with respect to O.sub.2 retention, we utilised the longer chain lipid dibehenoylphosphatidylcholine (DBPC) in place of distearoylphosphatidylcholine (DSPC) as this has been shown in previous work to reduce the diffusivity of the MB surface and hence improve stability.
[0133] For the preparation of DBPC MBs, DBPC (4.0 mg, 4.43 μmol), DSPE-PEG (2000) (1.35 mg, 0.481 μmol) and DSPE-PEG (2000)-biotin (1.45 mg, 0.481 μmol) in a molar ratio of 82:9:9 were dissolved in chloroform and placed in a glass vial. The solution was heated at 40° C. until all the chloroform had evaporated. PBS (pH 7.4±0.1) (5 ml) was added to the dried lipid film and the contents heated above the lipid phase transition temperature (>70° C.) under constant magnetic stirring for 30 minutes. The suspension was then sonicated with a Microson ultrasonic cell disruptor for 1.5 min (100 Watts, 22.5 kHz at power setting 4), the headspace filled with perfluorobutane (PFB) gas and the gas/liquid interface sonicated (power 19) for 20 sec producing PFBMBs. The MB suspension was cooled in an ice bath for approximately 10 minutes. An aqueous solution of avidin (50 μL, 10 mg/mL) was then added to the cooled MB suspension and stirred for a further 10 minutes. The suspension was then centrifuged (300 RPM, 10 min) and the resulting MB “cake” concentrated into 1 mL of PBS (pH 7.4±0.1). This was divided into two freeze drying vials. For the PFBMBs the vials were then crimped (sealed with a metal cap). To create oxygen filled MBs the headspace of the vial and the MB suspension was sparged under a positive pressure of oxygen gas for 2 min and the vial was then crimped. Following preparation as described above, MB samples were imaged under conventional optical microscopy to determine their size distribution and concentration. 10 μL samples were removed from each suspension and diluted in 90 μL of PBS (pH 7.4±0.1) followed by examination on a haemocytometer (Bright-Line, Hausser Scientific, Horsham, Pa., USA). Images were obtained with a 40×objective lens with a Leica DM500 optical microscope. The MB size distribution and concentration were then obtained using purpose written image analysis software in Matlab (2010B, The MathWorks, Natick, Mass., USA).
[0134] These MBs had an average diameter of 1-2 μm with a concentration of approximately 1×109 MB/mL as determined by analysis of optical microscopy images (
Example 2—Preparation of Biotinylated Rose Bengal and Biotinylated 5-FU
[0135] ##STR00007##
[0136] Scheme 1 provides a synthetic scheme for the preparation of biotin-5-FU (5). A schematic representation for the structure of the O.sub.2MB-RB and O.sub.2MB-5FU conjugates is provided in
[0137] Biotin functionalised Rose Bengal (6) was prepared as described in McEwan et al. (J Control Release. 2015; 203, 51-6). Biotin functionalised 5-FU (5) was synthesized according to scheme 1a following the procedures outlined below.
Preparation N-(2-Hydroxyethyl)-5-(2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)pentanamide (2)
[0138] To an ice-cooled solution of biotin-N-hydroxysuccinimide ester (1) (prepared by the reaction between biotin and Di(N-succinimidyl)carbonate) described in Kang et al., Jr. Rapid Commun Mass Spectrom. 2009, 23(11), 1719-1726) (3.75 g, 11 mmol) in anhydrous DMF (40 mL), was added 2-aminoethanol (1.0 ml, 16.4 mmol) and the mixture stirred at 25° C. for 30 min. The reaction was monitored by thin layer chromatography (TLC) (Merck Silica 60, HF 254, 20:80 methanol-dichloromethane v/v). The biotin-N-hydroxysuccinimide ester (R.sub.f=0.76) was consumed within 15 min with the concomitant formation of the alcohol product (R.sub.f=0.47). The reaction mixture was concentrated under reduced pressure and the residue co-evaporated with DMF to remove excess amounts of 2-aminoethanol. The white residue was recrystallized from water to yield 2 as a light yellow solid (1.7 g, 38%). An analytical sample was obtained from a second recrystallization, m.p. 192-195° C.
[0139] .sup.1HNMR (500 MHz, D.sub.2O) 4.49-4.47 (m, 1H, —CH), 4.31-4.30 (m, 1H, —CH), 3.53-3.51 (m, 2H, CH.sub.2), 3.23-3.18 (m, 3H, CH and CH.sub.2), 2.85-2.64 (m, 2H, CH.sub.2), 2.15 (t, 2H, —CH.sub.2), 1.62-1.46 (m, 4H, CH.sub.2 X 2), 1.32-1.26 (m, 2H, CH.sub.2).
[0140] .sup.13CNMR (125 MHz, D.sub.2O) 177.09 (C═O), 61.98 (CH.sub.2), 60.19 (CH), 59.91 (CH), 55.24 (CH), 41.29 (CH.sub.2), 39.61 (CH.sub.2), 35.42 (CH.sub.2), 27.77 (CH.sub.2), 27.56 (CH.sub.2), 25.02 (CH.sub.2).
[0141] ESMS (M+H.sup.+): found 288.70, calculated for C.sub.12H.sub.21N.sub.3O.sub.3S=287.13.
Preparation of 5-Fluorouracil-1-carboxylic acid (4)
[0142] A mixture of 5-Fluorouracil (3) (5 g, 38.4 mmol), potassium hydroxide (9.07 g, 161.6 mmol) and chloroacetic acid (3.63 g, 38.4 mmol) in 100 mL of water was refluxed for 2 h at 70° C. After cooling to room temperature, the pH of the solution was adjusted to 5.5 by the addition of concentrated hydrochloric acid. The reaction mixture was then kept in a refrigerator (5° C.) for 18 h and the resulting white crystals isolated by filtration and washed with cold water to produce 4 in 52.5% yield. mp>200° C.
[0143] .sup.1HNMR (500 MHz, D.sub.2O) 7.76 (d, 1H, J=6 Hz, CH), 4.29 (s, 2H, CH.sub.2).
[0144] .sup.13C NMR (D.sub.2O): 173.58 (C═O), 159.97 (C═O), 150.80 (C═O), 141.20 (C), 131.74 (CH), 51.48 (CH.sub.2).
[0145] ESMS (M-H+): found 187.10, calculated for C.sub.6H.sub.5O.sub.4N.sub.2F=188.11.
Preparation of 2-(5-(2-oxohexahydro-1H-thieno[3,4-d]imidazol-4yl)pentanamido) ethyl 2-(5-fluoro-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)acetate (5)
[0146] N-(2-Hydroxyethyl)-5-(2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)pentanamide (2) (0.5 g, 1.7 mmol), 5-Fluorouracil-1-carboxylic acid (4) (0.4 g, 2.1 mmol), DMAP (0.023 g, 0.17 mmol) and HOBT (0.023 g, 0.17 mmol) were added to 20 mL of anhydrous DMF in a 100 mL 2-neck round bottom flask under a N.sub.2 atmosphere. The mixture was heated at 40° C. and stirred until a homogeneous solution was obtained. DCC (0.4 g, 1.9 mmol) was then added to the reaction mixture and allowed to stir at room temperature for 12 hrs. The DMF was removed under reduced pressure, diethyl ether (50 mL) added and the contents stirred for 20 min. The resulting white semi-solid product was removed by filtration and after removing excess diethyl ether under reduced pressure, the crude product was purified by preparative HPLC (C-18 column) using acetonitrile/water (80:20 v/v) as mobile phase. The product 5 was obtained after lyophilisation of the desired fractions as a white semi-solid (0.24 g, 30% Yield).
[0147] .sup.1HNMR (500 MHz, D.sub.2O): 7.67 (d, 1H, J=6.0 Hz, CH), 4.50-4.47 (m, 1H, CH), 4.31-4.29 (m, 1H, CH), 4.19 (s, 2H, CH.sub.2), 3.54 (t, 2H, CH.sub.2), 3.22-3.19 (m, 2H, CH.sub.2), 2.89-2.86 (m, 1H, CH), 2.67-2.64 (m, 2H, CH.sub.2), 2.17-2.14 (m, 2H, CH.sub.2), 1.61-1.47 (m, 4H, CH.sub.2X 2), 1.47-1.28 (m, 2H, CH.sub.2).
[0148] .sup.13CNMR 125 MHz, D.sub.2O): 177.12 (C═O), 173.74 (C═O), 165.33 (C═O), 160.01 (C═O), 159.81 (C═O), 141.14 (C), 131.71 (CH), 62.00 (CH.sub.2), 60.22 (CH), 59.94 (CH), 55.26 (CH), 51.53 (CH.sub.2), 41.31 (CH.sub.2), 39.64 (CH.sub.2), 35.45 (CH.sub.2), 27.79 (CH.sub.2), 27.58 (CH.sub.2), 25.14 (CH.sub.2).
[0149] ESMS (M-H.sup.+) found 456.20, calculated for C.sub.18H.sub.24FN.sub.5O.sub.6S=457.48.
Example 3—Preparation of O.SUB.2.MB-Rose Bengal and O.SUB.2.MB-5FU Conjugates
[0150] Saturated solutions of 5 (91.2 mM) and 6 (0.61 mM) were prepared in a 0.5% DMSO solution in PBS (pH 7.4±0.1). A 0.3 mL aliquot of these stock solutions were then added separately to two 1 mL suspensions of avidin functionalised PFBMBs (1×10.sup.9 MB/mL) and the contents vortex mixed for 15 minutes. The suspensions were then centrifuged (900 rpm) for 5 min and the MB conjugates isolated as a milky suspension floating on top of the solution. The solution was removed and replaced with a further 0.3 mL of stock solution containing either 5 or 6 and the mixing/centrifugation steps repeated. The MB suspensions were then washed with PBS (5mL), centrifuged (900 rpm) for 5 minutes and the MBs transferred to a clean centrifuge tube. This washing procedure was repeated again and the isolated PFBMB-RB and PFBMB-5FU conjugates placed in glass vial. The PFBMB-RB and PFBMB-5FU conjugates were then sparged with oxygen gas for 2 min and the resulting O.sub.2MB-RB and O.sub.2MB-5FU conjugates were mixed together at a ratio of 1:3.25 to produce a final suspension containing 6.8×10.sup.7 MB/mL with 90.8 μM RB and 440 μM 5-FU.
[0151] This O.sub.2MB-RB/O.sub.2MB-5FU mix was used directly in the in vitro and in vivo experiments described herein.
Example 4—Preparation of O.SUB.2.MB-IR820 Conjugates
[0152] ##STR00008##
[0153] Scheme 2 shows the synthesis of biotin functionalised NIR absorbing dye (9). A schematic representation of the MB-9 conjugate used in the imaging experiments is provided in
Synthesis of 2-((E)-2-((E)-2-((4-aminophenyl)thio)-3-((E)-2-(1,1-dimethyl-3-(4-sulfobutyl)-1H-benzo[e]indol-2(3H)-ylidene)ethylidene)cyclohex-1-en-1-yl)vinyl)-1,1-dimethyl-3-(4-sulfobutyl)-1H-benzo[e]indol-3-ium (8)
[0154] Compound 7 was prepared following a literature procedure (James et al., Evaluation of Polymethine Dyes as Potential Probes for Near Infrared Fluorescence Imaging of Tumors: Part-1. Theranostics. 2013, 3(9), 692-702). 4-Aminothiophenol (0.63 g, 5 mmol) was dissolved in anhydrous DMF (50 ml) under N.sub.2 atmosphere. 7 (0.6 g, 0.7 mmol) was added to this solution and the mixture stirred for 18 h at room temperature. The reaction was monitored by TLC (Merck Silica 60, HF 254, using 25% MeOH/DCM as mobile phase). The DMF was removed under reduced pressure and the residue re-dissolved in DMF (5 mL) and precipitated with Et.sub.2O (15 mL). The solid product was filtered, washed with Et.sub.2O (30 mL) and purified by column chromatography (silicagel, 60-120 mesh) using MeOH-DCM (1:3) as an eluting agent. The product (230 mg, 4.8%) was isolated as reddish brown semi-solid. This compound was not stable and was used immediately in the next step.
[0155] .sup.1H NMR (500 MHz, MeOH-d.sub.4): 8.96-8.93 (m, 2H, Ar—CH), 8.81-8.78 (m, 2H, Ar—CH), 8.09-8.07 (m, 2H, Ar—CH), 7.90-7.89 (m, 6H, Ar—CH), 7.57-7.51 (m, 4H, Ar—CH), 7.38 (brs, 2H, NH.sub.2), 7.38-7.28 (m, 2H, Ar—CH), 6.34-6.31 (m, 2H, CH X 2), 4.23 (brs, 4H, CH X 2, CH.sub.2), 2.87-2.80 (m, 8H, CH.sub.2 X 4), 1.98-1.91 (m, 10H, CH.sub.2 X 5), 1.70 (s, 12H, CH.sub.3 X 4).
[0156] .sup.13C NMR (125 MHz, dmso-d.sub.6): 173.4, 170.2, 150.1, 148.4, 143.7, 144.6, 142.7, 134.3, 133.9, 132.4, 128.0, 126.1, 126.2, 125.5, 125.7, 117.5, 115.4, 104.7, 61.8, 59.3, 49.4, 48.9, 46.8, 30.2, 28.6, 26.8, 26.9, 25.2, 21.0.
[0157] ESMS calculated for C.sub.52H.sub.58N.sub.3O.sub.6S.sub.3Na.sub.2.sup.+=961.1, found 960.3.
Synthesis of 2-((E)-2-((E)-3-((E)-2-(1,1-dimethyl-3-(4-sulfobutyl)-1H-benzo[e]indol-2(3H)-ylidene)ethylidene)-2-((4-(5-(2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)penta namido)phenyl)thio)cyclohex-1-en-1-yl)vinyl)-1,1-dimethyl-3-(4-sulfobutyl)-1H-benzo[e]indol-3-ium (9)
[0158] Compound 8 (100 mg, 0.1 mmol) was added to a stirring solution of 1 (40.9 mg, 0.12 mmol) in anhydrous DMF (50 mL) to which a catalytic amount of triethylamine was added. The solution was stirred at room temperature for 5 h. The reaction mixture was added to ether (100 ml) and the contents stirred for 30 min. The precipitate was collected by filtration and purified by preparative TLC using MeOH:DCM (1:4) as eluting agent and the product isolated as a green powder.
[0159] Yield=21 mg, 18.4%.
[0160] .sup.1H NMR (500 MHz, MeOH-d.sub.4): 8.77 (d, J=7.8 Hz, 2H, Ar—CH), 8.21 (d, J=7.5 Hz, 2H, Ar—CH), 8.03-7.99 (m, 2H, Ar—CH), 7.73 (d, J=7.5 Hz, 2H, Ar—CH), 7.60-7.57 (m, 2H, Ar—CH), 7.47-7.44 (m, 2H, Ar—CH), 7.20-7.17 (m, 2H, Ar—CH), 7.16 (d, J=12 Hz, 1H, CH), 6.89-6.83 (m, 2H, Ar—CH), 6.58 (d, J=12 Hz, 1H, CH), 6.42 (brs, 1H, NH), 6.36 (brs, 2H, NH X 2), 4.29-4.27 (m, 6H, CH X 2, NCH.sub.2), 4.10 (brs, 2H, —CH.sub.2), 3.14-3.06 (m, 3H, CH, CH.sub.2), 2.80-2.74 (m, 4H, CH.sub.2 X 2), 2.57-2.48 (m, 4H, CH.sub.2 X 2), 2.19-2.16 (m, 2H, CH.sub.2), 1.88-1.59 (m, 2H, CH.sub.2), 1.76 (s, 12H, CH.sub.3 X 4), 1.59-1.57 (m, 2H, CH.sub.2), 1.48-1.28 (m, 12H, CH.sub.2 X 6).
[0161] .sup.13C NMR (125 MHz, dmso-d.sub.6): 177.5, 174.3, 169.9, 166.2, 152.5, 150.2, 148.0, 145.3, 144.8, 140.7, 134.8, 132.6, 131.3, 130.0, 128.5, 126.3, 124.7, 120.1, 116.8, 114.8, 102.5, 64.0, 62.3, 60.1, 54.9, 50.1, 48.6, 48.1, 42.2, 36.7, 32.8, 30.2, 28.4, 28.3, 26.9, 26.0, 24.5, 22.8.
[0162] ESMS calculated for C.sub.62H.sub.72N.sub.5O.sub.8S.sub.4.sup.+=1142.4 (protonated form, M.sup.+), found 1143.4.
Preparation of O.SUB.2.MB-IR820 Conjugates
[0163] Biotin functionalised IR-820 (9) was attached to the surface of O.sub.2MBs following the procedure as described above for 5-FU and Rose Bengal. [MB]=2.6×10.sup.8; [9]=280 μM.
Example 5—Ultrasound Mediated O.SUB.2 .Release from O.SUB.2.MBs
[0164] A 0.5 mL suspension of O.sub.2MBs (1×10.sup.8) prepared in Example 1 was added to degassed PBS (pH 7.4±0.1) (4.5 mL). The dissolved oxygen level of this solution was measured over a 20 min period at 2 min intervals using a dissolved oxygen meter. Ultrasound was applied after 4.5 min for 1 min, using a frequency of 1 MHz, an ultrasound power density of 3.0 Wcm.sup.−2 and a duty cycle of 50% (pulse frequency=100 Hz). Control experiments using PFBMBs were also performed following the same procedure.
[0165] If O.sub.2MBs are to be successful as carrier for oxygen delivery in vivo, it is important that gas exchange between the core of the MB and blood is minimised until the MB is exposed to ultrasound at the target site. The half-life of commercial MBs ranges from 0.97 min in men to 1.23 min in women. Therefore, it is important that O.sub.2MBs can retain their oxygen for at least this time period in situations where an oxygen diffusion gradient may exist. In an attempt to simulate such a scenario, O.sub.2MBs (0.5 mL, 1×10.sup.8) were added to 4.5 mL of degassed PBS (pH 7.4±0.1) in a glass vial and the contents agitated periodically at 37° C. As the O.sub.2MBs float at the top of the PBS solution they were in direct contact with air in the headspace of the open vial. The amount of dissolved O.sub.2 in the PBS solution was determined using a dissolved oxygen meter and was measured for 4.5 min before and 14.5 min after ultrasound treatment. As a control, experiments using PFBMBs were also conducted. The results are shown in
Example 6—In Vitro Cytotoxicity Experiments
[0166] Human primary pancreatic adenocarcinoma cell lines MIA PaCa-2 and PANC-1 were maintained in Dulbecco's Modified Eagle's Medium while BxPC-3 cells were maintained in RPMI-1640 medium, all of which were supplemented with 10% (v/v) foetal bovine serum in a humidified 5% CO.sub.2 atmosphere at 37° C. These cell lines were plated into the wells of a 96-well plate at a concentration of 5×10.sup.3 cells per well and incubated for 21 h at 37° C. in a humidified 5% CO.sub.2 atmosphere before being transferred to a hypoxic chamber at 37° C. (O.sub.2/CO.sub.2/N.sub.2, 0.1:5:94.9 v/v/v) for 3 h (this is intended to mimic the hypoxic conditions found at a tumor site). The medium was then removed from each well and replaced with O.sub.2MB-RB (50 μL, 5 μM RB) and O.sub.2MB-5FU (50 μL, 100 μM 5FU) conjugates. Individual wells were then treated with ultrasound delivered using a Sonidel SP100 sonoporator (30 sec, frequency=1 MHz, ultrasound power density=3.0 Wcm.sup.−2, duty cycle=50% with pulse repetition frequency=100 Hz). Cells were kept in the hypoxic environment for a further 3 hours before the treatment solution was removed, the cells washed with PBS and fresh media added (200 uL per well). Plates were then incubated in normoxic conditions (i.e. humidified 5% CO.sub.2 atmosphere at 37° C.) for a further 21 hours before cell viability was determined using a MTT assay (McHale et al., Cancer Lett 1988; 41, 315-21). A similar procedure was repeated for the vehicle only, gemcitabine (drug approved for use in pancreatic cancer treatment), 5-FU, O.sub.2MB-5FU+US, O.sub.2MB-RB+US and the O.sub.2MB-RB/O.sub.2MB-5FU mix−US. In all experiments the amount of RB, 5-FU and gemcitabine used was 5 μM, 100 μM and 100 μM respectively. All groups were also repeated using PFBMB conjugates with the same amount of RB or 5-FU attached.
[0167] The results, shown in
Example 7—In Vivo Cytotoxicity Experiments
[0168] BxPc-3 cells were maintained in RPMI-1640 medium supplemented with 10% foetal calf serum as described above. Cells (1×10.sup.6) were re-suspended in 100 μL of Matrigel® and implanted into the rear dorsum of female Balb/c SCID (C.B-17/IcrHan®Hsd-Prkdcscid) mice. Tumour formation occurred approximately 2 weeks after implantation and tumour measurements were taken every other day using calipers. Once the tumours had reached an average volume of 218 mm.sup.3, calculated from the geometric mean diameter using the equation tumour volume=4πR.sup.3/3, animals were randomly distributed into 10 groups (n=4). Following induction of anaesthesia (intraperitoneal injection of Hypnorm/Hypnovel), a 100 μL mixture of PBS containing O.sub.2MB-RB (MB=1.6×10.sup.7, [RB]=90.8 μM) and O.sub.2MB-5FU (MB=5.2×10.sup.7, [5FU]=440 μM) was injected directly into each tumour. Intratumoural injection was chosen as the route of administration to preclude experimental variation resulting from pharmacokinetic behaviour of the platform. Where appropriate, tumours were then treated with ultrasound for 3.5 min at an ultrasound frequency of 1 MHz, an ultrasound power density of 3.5 Wcm.sup.−2 (I.sub.SATP; spatial average temporal peak) and using a duty cycle of 30% at a pulse repetition frequency of 100 Hz. Additional treatment groups included (i) no drug; (ii) O.sub.2MB-RB conjugate alone±ultrasound treatment; and (iii) O.sub.2MB-5FU conjugate alone±ultrasound treatment. Gemcitabine (440 μM) and 5-FU (440 μM) only treatments were also performed. After treatment, animals were allowed to recover from anaesthesia and tumour volume and body weight were recorded daily for nine days. The % increase in tumour volume was calculated employing the pre-treatment measurements for each group.
[0169] The tumour volume was measured daily for 9 days and the % change in tumour volume for each group plotted as a function of time. For ease of interpretation, only results from six of the ten groups are shown in
[0170] In these experiments, gemcitabine was administered as an intra-tumoral injection at a concentration of 0.264 mg/kg in order to provide a direct molar comparison with the amount of 5-FU used (440 μM). Even though this amount was delivered directly to the tumour it is significantly less than the normal systemic dose of gemcitabine (120 mg/kg) used in mice.
[0171] In order to compare the effectiveness of the combined SDT/5-FU therapy against systemic gemcitabine therapy, we treated mice bearing ectopic BxPC-3 tumours with gemcitabine (120 mg/kg) administered by intraperitoneal (IP) injection on days 0, 3 and 8. Tumour volume was measured daily as before and compared to untreated animal controls. These results (
Example 8—In Vivo NIR Fluorescence Imaging of O.SUB.2.MB-9 Conjugates Following IV Administration to Tumour Bearing Mice
[0172] Athymic nude mice were anaesthetised (intraperitoneal injection of Hypnorm/Hypnovel) and the O.sub.2MB-9 conjugate (100 uL) was administered via tail vein injection. In the treatment group, ultrasound (conditions as in 2.10 above) was applied to the tumours during and for 3 minutes after IV injection while no ultrasound was applied to the tumours in the control group (n=3 in each group). Following administration (at t=5 min and t=10 min), animals were placed in the chamber of a Xenogen IVIS® Lumina imaging system on fluorescence mode using the ICG filter set (excitation: 705-780 nm; emission: 810-885 nm). Data were captured and analyzed using the Living Image® software package version 2.60. Quantitative data were obtained by drawing a region of interest around the tumour and comparing the fluorescent signal (photons/second) at t=5 and t=10 min post O.sub.2MB-9 administration with the fluorescent signal obtained prior to administration.
Example 9—Immunohistochemistry and qRT-PCR Analysis
[0173] We were also interested in probing the effects of combined SDT/5-FU treatment at the molecular level when compared to 5-FU treatment alone. In order to do this, tumours in the control group (i.e. no treatment), the O.sub.2MB-5FU+US group (i.e. 5-FU), and O.sub.2MB-RB/O.sub.2MB-5FU mix+US group (i.e. combined treatment) were harvested at the end of the monitoring period and subjected to immunohistochemistry and qRT-PCR analysis.
HIF1α Expression in the Tumour Post IV Administration of O.SUB.2.MB
[0174] Athymic nude mice were anaesthetised (intraperitoneal injection of Hypnorm/Hypnovel) and either PFBMBs or O.sub.2MBs (100 uL) were administered via tail vein injection (n=3 in each group). Ultrasound (conditions as in 2.10 above) was applied to the tumour during and for 3 minutes after IV injection and the tumours were excised 30 minutes later. For Western blotting analysis of HIF-1α protein expression, total protein was extracted using urea buffer. Primary murine antibodies employed in these studies were anti-HIF1α (Millipore, 1:500), and anti-GAPDH (Sigma, 1:1000). Protein samples were electrophoresed on a 4-12% TruPAGE® gel and transferred to nitrocellulose membranes. Blocking of non-specific binding was carried out in 5% (w/v) bovine serum albumin diluted in 1×tris buffered saline containing 0.05% (v/v) Tween 20. Membranes were then incubated in the appropriate secondary antibody, goat anti-mouse IgG-HRP (1:10000 of the stock solution). Secondary antibodies were purchased from Santa Cruz Biotechnology, Heidelberg, Germany. Densitometry was carried out to quantify HIF1α protein expression using GAPDH as a housekeeping reference.
Immune Response Characterisation
[0175] To characterise the immune response in tissues subjected to therapy, Bcl3 and Bcl2 protein expression was examined using immunohistochemistry in tissue samples harvested at the end of the monitoring period. Immunohistochemical (IHC) evaluation for Bcl2 and Bcl3 proteins was performed on paraffin-embedded sections. The paraffin-embedded tissue samples were cut to a 4 μm thickness using a Leica RM2235 microtome (Leica Biosystems Ltd., Newcastle) and examined on a coated glass slide. IHC analysis for Bcl2 (clone: BCL-2/100/D5) and Bcl3 (clone: 1E8) were diluted 1:200 and 1:150 respectively. Both antibodies were mouse anti-human obtained from Leica Biosystems. Immunostaining was carried out using the automated Bond-Max system (Leica Biosystems Ltd., Newcastle) using on board heat-induced antigen retrieval with Bond Epitope Retrieval Solution 2 (EDTA based on pH 9.0) for 30 min. Endogenous peroxidase activity was blocked using 0.3% hydrogen peroxide for 5 min. The histological specimens were incubated with the primary antibody for 15 min at room temperature and the slides were incubated with rabbit anti-mouse for 8 min at room temperature. The slides were then incubated with goat anti-rabbit polymer reagent for 8 min at room temperature. The reactions were developed using a bond polymer refine detection kit and followed by colour development with 3,3′-diaminobenzidine tetrahydrochloride as a chromogen for 10 min. The immunohistochemistry intensity and proportion scores were carried out according to Allred et al. (Prognostic and predictive factors in breast cancer by immunohistochemical analysis. 1998, 11(2):155-68). In order to confirm immunohistochemical studies Bcl3 expression was also examined at the transcriptional level. mRNA expression of Bcl3 was measured with gene specific qRT-PCR using the primers listed in Table 1:
TABLE-US-00001 TABLE 1 Primers used in qRT-PCR. Primer Sequence Bcl3 Forward CCTTTGATGCCCATTTACTCTA [Seq ID No 1] Bcl3_Reverse AGCGGCTATGTTATTCTGGAC [Seq ID No 2] β-Actin Forward CGTGGGCCGCCCTAGGCACCA [Seq ID No 3] β-Actin Reverse TTGGCCTTAGGGTTCAGGGGGG [Seq ID No 4] 18SrRNA_Forward TGACTCAACACGGGAAACC [Seq ID No 5] 18SrRNA_Reverse TCGCTCCACCAACTAAGAAC [Seq ID No 6]
qRT-PCR and analysis were performed following previously published protocols (Hamoudi et al., Leukemia, 2010, vol. 24, no. 8, pp. 1487-1497; and Bi et al., Haematologica, 2012, 97, 926-930). Briefly, RNA was extracted from microdissected slides using the RecoverAll Kit (Life Technologies, Paisley, UK). cDNA synthesis was carried out using the Superscript III First Strand cDNA synthesis kit (Life Technologies, Paisley, UK) using the reverse primer of each of the genes including the two housekeeping genes; 18S rRNA and 62 -actin. qRT-PCR was carried out using the SYBR Green kit on the CFX96 instrument (BioRad, UK). The qRT-PCR cycle was as follows: 95° C. for 3 minutes, 95° C. for 10 seconds, 60° C. for 45 seconds for 40 cycles. For analysis, the geometric mean of 18S rRNA and β-actin was taken as the single housekeeping value. Statistical comparison between the groups was carried out using two-way ANOVA with Bonferroni post-hoc analysis.
Results
[0176] The immunohistochemistry results revealed that at the protein level, there was Bcl3 and Bcl2 deregulation between both treatment groups and the control group. At this level of analysis, Bcl3 intensity and proportion were higher in the control and 5FU groups but decreased in the combined treatment group. Similarly, Bcl2 protein expression was highest in the control group, decreased in the 5FU group and was undetectable in the combined treatment group (
Example 10—NIR Imaging
[0177] To be suitable for clinical translation, the MB suspension will need to be administered intravenously and the MBs disrupted at the tumour site using appropriate ultrasound conditions. Such a strategy should enhance localisation of the sensitiser/chemotherapeutic and increase tumour pO.sub.2 at the tumour site. To test the feasibility of such an approach the biotin functionalised near infrared absorbing cyanine dye (9) was employed as a surrogate for RB and 5-FU (Scheme 2)—see Example 4. The UV-Vis and fluorescence spectra of 9 reveal absorbance (750 nm) and emission maxima (818 nm) in the NIR region making this compound ideal for in vivo imaging.
[0178] As described in Example 4, dye (9) was loaded onto the MB surface following the same procedure used for RB and 5-FU. The O.sub.2MB-9 conjugate was then administered intravenously via the tail vein of athymic nude mice bearing ectopic Bx-PC3 tumours. Ultrasound was applied directly to the tumour during and for 3 minutes after IV administration. Control experiments in the absence of ultrasound were used for comparative purposes. The mice were imaged before, 5 and 30 minutes after administration using an IVIS whole body imaging system. Representative images (
Example 11—Monoiodo ICG Synthesis (I.SUB.2.-IR783 or “I2-IRCYDYE”)
[0179] ##STR00009##
Synthesis of (4-iodophenyl)hydrazine (1)
[0180] 20 g (91.3 mmol) of 4-iodoaniline was stirred with a solution of 15 ml concentrated hydrochloric acid and 15 ml of water. The mixture was cooled to about −10° C. and 12.6 g (182.6 mmol) of NaNO.sub.2 in 45 ml of water was added drop wise with continuous stirring. The suspension was allowed to stir for another 30 minutes and then an ice cold solution of SnCl.sub.2.2H.sub.2O (67.99 g, 301.3 mmol in 40 ml of concentrated HCl) was added drop wise keeping the temperature at −10° C. The reaction mixture was stirred at that temperature for 1.5 hr and at 5° C. overnight. The light brown precipitate obtained was filtered and washed three times with water. This solid mass thus obtained was then stirred with saturated solution of NaOH in water (100 ml) and extracted with ether (200 ml). The ether layer was washed with aqueous solution of NaOH, Na.sub.2S.sub.2O.sub.3 and water. After drying with MgSO.sub.4 (anhydrous), the ether layer was evaporated to dryness to afford 17.94 g of (4-iodophenyl)hydrazine as brown powder. m.p=104-106° C.
[0181] .sup.1H NMR (CDCl.sub.3): 7.48 (d, J=8.0 Hz, 2H, Ar—CH), 6.62 (d, J=8.0 Hz, 2H, Ar—CH), 5.18 (brs, 1H, NH), 3.55 (brs, 2H, NH.sub.2).
[0182] ESMS (M+H) found=235.00, calculated for C.sub.6H.sub.7IN.sub.2=234.04.
Synthesis of 5-iodo-2,3,3-trimethyl-3H-indole (2)
[0183] 12.68 g (54.1 mmol) of (4-iodophenyl)hydrazine (1) and 8 g (92.8 mmol) of 3-methyl-2-butanone were refluxed in 100 ml of glacial acetic acid for 20 hrs. The acetic was evaporated and the residue was dissolved in ether. Insoluble precipitate was filtered off, and the etheric solution was washed with aqueous solution of NaOH followed by Na.sub.2S.sub.2O.sub.3 and water. The organic layer was dried with anhydrous Na.sub.2SO.sub.4 and the ether was removed under reduced pressure to afford 10.5 g of 5-iodo-2,3,3-trimethyl-3H-indole (2) as red gummy liquid.
[0184] .sup.1H NMR (CDCl.sub.3): 7.60 (dd, J=4.5, 8.0 Hz, 2H, Ar—CH), 7.28 (d, J=8.0 Hz, 1H, Ar—CH), 2.25 (s, 3H, CH.sub.3), 1.20 (s, 6H, CH.sub.3 X 2).
[0185] .sup.13C NMR (CDCl.sub.3): 153.4 (C), 148.1 (C), 139.3 (C), 136.6 (CH), 130.6 (CH), 121.8 (CH), 89.9 (C), 54.0 (C), 23.0 (CH.sub.3), 22.9 (CH.sub.3), 15.3 (CH.sub.3).
[0186] ESMS (M+H) found=286.1, calculated for C.sub.11H.sub.12IN=285.12.
Synthesis of 5-iodo-2,3,3-trimethyl-1-(4-sulfobutyl)-3H-indol-1-ium (3)
[0187] Toluene (70 ml), 5-iodo-2,3,3-trimethyl-3H-indole (2) (12 g, 42.1 mmol) and 1,4-butane sultone (8.6 g, 63.1 mmol) were heated under reflux for 18 hrs. The reaction mixture was allowed to cool to room temperature. The resulting brown crystals were filtered and washed with acetone (3×10 ml). The filtered product was recrystallized from a solution of MeOH and diethyl ether. The crystals were collected and dried in vacuo to yield 8 g of 5-iodo-2,3,3-trimethyl-1-(4-sulfobutyl)-3H-indol-1-ium (3).
[0188] .sup.1H NMR (dmso-d.sub.6): 8.27 (s, 1H, Ar—CH), 7.95 (s, 1H, Ar—CH), 7.82 (s, 1H, Ar—CH), 4.42 (brs, 2H, CH.sub.2), 2.79 (s, 3H, CH.sub.3), 2.47 (brs, 2H, CH.sub.2), 1.90 (brs, 2H, CH.sub.2), 1.69 (brs, 2H, CH.sub.2), 1.49 (s, 6H, CH.sub.3 X 2).
[0189] .sup.13C NMR (DMSO-d.sub.6):176.2, 148.4, 139.9, 136.7, 132.5, 126.8, 96.8, 49.8, 46.8, 42.6, 26.8, 25.6, 10.5.
[0190] ESMS (M+H) found=422.10, calculated for C.sub.15H.sub.21INO.sub.3S.sup.+=422.30.
Synthesis of 2-((E)-2-((E)-2-chloro-3-((E)-2-(5-iodo-3,3-dimethyl-1-(4-sulfobutyl)indolin-2-ylidene)ethylidene)cyclohex-1-en-1-yl)vinyl)-5-iodo-3,3-dimethyl-1-(4-sulfobutyl)-3H-indol-1-ium (5)
[0191] A solution of 3 (0.2 g, 0.47 mmol), 4 (prepared according to the method described in Flanagan et al., Bioconjugate Chem, 1997, 8, 751-756) (0.153 g, 0.47 mmol) and anhydrous sodium acetate (0.077 g, 0.93 mmol) in absolute EtOH (10 ml) under N.sub.2 atmosphere was heated under reflux for 4 hr. The EtOH was removed under reduced pressure and the residue was purified by column chromatography (silica 60-120 mesh) using 25% MeOH-CHCl.sub.3 mixture as eluting agent. The product (0.152 g, 33% yield) was isolated as greenish powder.
[0192] .sup.1H NMR (MeOH-d.sub.4): 8.26 (d, J=7.8 Hz, 1H, Ar—CH), 8.03-7.98 (m, 2H, Ar—CH), 7.68-7.63 (m, 2H, Ar—CH), 7.63-7.49 (m, 1H, Ar—CH), 6.39-6.36 (m, 2H, CH X 2), 4.34-4.33 (m, 2H, CH X 2), 3.33-3.34 (m, 4H, CH.sub.2 X 2), 2.92-2.90 (m, 2H, CH.sub.2), 2.89-2.80 (m, 2H, CH.sub.2), 2.08-1.96 (m, 26H, CH.sub.2 X 7, CH.sub.3 X 4).
[0193] .sup.13C NMR (DMSO-d.sub.6): 174.7, 173.9, 150.1, 149.6, 148.0, 146.7, 145.9, 130.8, 134.8, 132.6, 130.1, 129.8, 128.3, 126.4, 124.7, 120.7, 116.1, 114.9, 104.6, 102.8, 98.6, 62.1, 60.1, 50.4, 29.1, 48.7, 30.5, 28.4, 28.5, 26.3, 26.2, 24.6.
[0194] ESMS (M-H.sup.+) found=977.2, calculated for C.sub.38H.sub.46ClI.sub.2N.sub.2O.sub.6S.sub.2.sup.+=979.06.
Example 12—Diiodo-IR-820 Synthesis (I.SUB.4.-IR783 or “I4-IRCYDYE”)
[0195] ##STR00010##
Synthesis of 3,5-diiodonitrobenzene (2)
[0196] To concentrated H.sub.2SO.sub.4 (96%, 15 mL) solution cooled at 0° C. was added 2,6-diiodo 4-nitroaniline 1 (3.9 g, 10 mmol) in small portions. This solution was stirred 20 minutes at this temperature and NaNO.sub.2 (1.5 g, 22 mmol) was added. Stirring was continued at 0° C. for 2 h. Then, the viscous solution was poured into ice (100 g) and any solid material was filtered off. The yellow filtrate was carefully poured into a refluxed solution of CuSO.sub.4.5H.sub.2O (160 mg, 1 mmol) in EtOH (200 mL) and stirred for 2 h to reduce the diazonium salt. After cooling to room temperature, solid 3,5-diiodonitrobenzene (2) was separated. The product was filtered off and washed with water until neutral. The product was recrystallized from EtOH to give 2.48 g (66% yield) of fine brown needles.
[0197] .sup.1H NMR (CDCl3) δ=8.43 (t, J=1.4 Hz, 2H, Ar—CH X2), 8.29 (s, 1H, Ar—CH);
[0198] .sup.13C NMR (CDCl3)δ=94.1, 131.7, 148.4, 151.0.
[0199] ESMS [M+H.sup.+]: calculated for C.sub.6H.sub.3I.sub.2NO.sub.2Na 397.8, found 398.9 m/z.
Synthesis of 3,5-diiodoaniline (3)
[0200] To a suspension of 2 (7.15 g, 19 mmol) in anhydrous EtOH (75 mL) under argon atmosphere was added SnCl.sub.2.2H.sub.2O (21.6 g, 96 mmol). This mixture was brought to boil and a solution of NaBH.sub.4 (361 mg, 9.5 mmol) in EtOH (40 mL) was added dropwise. The reaction mixture was stirred at reflux for 45 min. After the reaction was cooled down to 0° C., water (60 mL) was added and the mixture was neutralized with NaOH (2.5 M in H.sub.2O). The aniline derivative was extracted with diethyl ether, dried over Na.sub.2SO4 and evaporated under reduced pressure to afford aniline 3 (5.86 g, 89% crude yield).
[0201] .sup.1H NMR (CDCl3) δ=7.39 (s, 1H, Ar—CH), 6.97 (s, 2H, Ar—CH X 2), 3.66 (brs, 2H, NH.sub.2).
[0202] .sup.13C NMR (CDCl3)δ=148.5, 134.8, 122.9, 95.1.
[0203] ESMS [M+H.sup.+]: calculated for C.sub.6H.sub.5I.sub.2N 344.8, found 345.5 m/z.
Synthesis of 3,5-diiodophenylhydrazine (4)
[0204] This compound was synthesised according to the procedure described in US 2013/0231604.
Synthesis of 4,6-diiodo-2,3,3-trimethyl-3H-indole (5)
[0205] This compound was synthesised according to the procedure described in US 2013/0231604.
Synthesis of 4,6-diiodo-2,3,3-trimethyl-1-(4-sulfobutyl)-3H-indol-1-ium (6)
[0206] Toluene (10 ml), 4,6-diiodo-2,3,3-trimethyl-3H-indole (5) (2.1 g, 5.1 mmol) and 1,4-butane sultone (3.5 g, 25.7 mmol) were heated under reflux for 18 hrs. The reaction mixture was allowed to cool to room temperature. The resulting brown crystals were filtered and washed with acetone (3×10 ml). The filtered product was recrystallized from a solution of MeOH and diethyl ether. The crystals were collected and dried in vacuo to yield 1.9 g of 4,6-diiodo-2,3,3-trimethyl-1-(4-sulfobutyl)-3H-indol-1-ium (6).
[0207] .sup.1H NMR (MeOH-d.sub.4): 8.42 (s, 1H, Ar—CH), 8.36 (s, 1H, Ar—CH), 4.51-4.48 (m, 2H, CH.sub.2), 2.88-2.85 (m, 2H, CH.sub.2), 2.09-2.00 (m, 2H, CH.sub.2), 1.99-1.82 (m, 2H, CH.sub.2), 1.73 (s, 6H, CH.sub.3 X 2), 1.16 (s, 3H, CH.sub.3).
[0208] ESMS [M-H.sup.+]: calculated for C.sub.15H.sub.20I.sub.2NO.sub.3S.sup.+ 547.9, found 546.1 m/z.
Synthesis of 2-((E)-2-((E)-2-chloro-3-((E)-2-(4,6-diiodo-3,3-dimethyl-1-(4-sulfobutyl)indolin-2-ylidene)ethylidene)cyclohex-1-en-1-yl)vinyl)-4,6- diiodo-3,3-dimethyl-1-(4-sulfobutyl)-3H-indol-1-ium (8)
[0209] A solution of 8 (0.84 g, 1.5 mmol), 7 (prepared according to the method described in Flanagan et al., Bioconjugate Chem, 1997, 8, 751-756) (0.25 g, 0.7 mmol) and anhydrous sodium acetate (0.13 g, 1.5 mmol) in absolute EtOH (10 ml) under N.sub.2 atmosphere was heated under reflux for 4 hr. The EtOH was removed under reduced pressure and the residue was purified by column chromatography (silica 60-120 mesh) using 25% MeOH—CHCl.sub.3 mixture as eluting agent. The product (0.153 g, 8% yield) was isolated as brown powder.
[0210] .sup.1H NMR (MeOH-d.sub.4): 8.59 (s, 2H, Ar—CH X 2), 8.29 (s, 2H, Ar—CH X 2), 6.77-6.75 (m, 2H, CH X 2), 5.30 (brs, 2H, CH X 2), 4.82-4.72 (m, 4H, CH.sub.2 X 2), 3.39 (brs, 4H, CH.sub.2 X 2), 2.60-2.47 (m, 14H, CH.sub.2 X 7), 2.23 (s, 12H, CH.sub.3 X 4).
[0211] .sup.13C NMR (DMSO-d.sub.6): 170.2, 169.9, 158.9, 150.1, 149.7, 148.6, 146.8, 144.9, 140.8, 139.3, 134.2, 132.1, 126.7, 124.3, 104.0, 100.4, 96.7, 96.2, 94.5, 64.1, 59.5, 50.5, 48.7, 48.1, 30.3, 28.7, 28.2, 26.3, 26.1, 24.3.
[0212] ESMS [M-H.sup.+]: calculated for C.sub.38H.sub.44CI.sub.4N.sub.2O.sub.6S.sub.2Na.sup.+ 1253.85, found 1252.81 m/z.
Example 13—In Vivo PDT Effect of I.SUB.2.-IR783 in Mice Bearing Human Xenograft Ectopic BxPc-3 Pancreatic Cancer Tumours
[0213] BxPc-3 cells were maintained in RPMI-160 medium supplemented with 10% foetal calf serum. Cells were cultured at 37° C. under 5% CO2 in air. BxPc-3 cells (1×10.sup.6) were re-suspended in 100 μl of matrigel and implanted into the rear dorsal of male SCID mice. Tumour formation occurred approximately 2 weeks after implantation and tumour measurements were taken every day using callipers. Once the tumours had reached an average volume of 267 mm.sup.3 calculated from the geometric mean diameter using the equation tumour volume=4πR.sup.3/3, animals were randomly distributed into 2 groups (n=2). Following induction of anaesthesia (intraperitoneal injection of Hypnorm/Hypnovel), the treatment group received a 100 μl aliquot of I.sub.2-IR783 (1 mg/kg) in a PBS:DMSO (98:2) vehicle injected directly into each tumour and treated with 780 nm light irradiation (100 mW) for 3×3 min with a 1 minute lag in between treatments. The second group (control) received vehicle only. After treatment animals were allowed to recover from anaesthesia and tumour volume was monitored at the indicated times. The % increase in tumour volume was calculated employing the pre-treatment measurements for each group. At day 8 the treatment group received a second treatment as described above but also received an intra-humoral injection of 100 μl of O.sub.2MBs (1×10.sup.8 MB/mL) before light irradiation. Results are shown in
Example 14—Fluorescence of I2 and I4 Analogues of IR783 (“I2-IRCYDYE” and “I4-IRCYDYE”)
[0214]
Example 15—Singlet Oxygen Production and In Vitro Cytotoxicity of I2 and I4 Analogues of IR783 (“I2-IRCYDYE” and “I4-IRCYDYE”)
[0215]
[0216]
[0217] These results evidence that both I2-IRCYDYE and I4-IRCYDYE are effective NIR activated sensitisers and that I2-IRCYDYE also has potential as an imaging agent given its high NIR fluorescence. This provides the potential for image guided PDT and/or SDT of solid tumors, e.g. pancreatic tumors.
Example 16—Combined Antimetabolite/Sonodynamic Therapy of Human Pancreatic Cancer MiaPaCa-2 Cells Using Rose Bengal and 5-FU
Procedure
[0218] Human primary pancreatic adenocarcinoma cell lines MIA PaCa-2 were maintained in Dulbecco's Modified Eagle's Medium and supplemented with 10% (v/v) foetal bovine serum in a humidified 5% CO.sub.2 atmosphere at 37° C. The cells were plated into the wells of a 96-well plate at a concentration of 4×10.sup.3 cells per well and incubated for 21 h at 37° C. in a humidified 5% CO.sub.2 atmosphere. The medium was then removed and wells treated with either Rose Bengal, (3 μM), 5-Fluorouracil (50 μM) or a combination of both RB (3 μM) and 5-FU (50 μM) for 3 h. The drug solutions were then removed, fresh media added and selected wells treated with ultrasound delivered using a Sonidel SP100 sonoporator (30 sec, frequency=1 MHz, ultrasound power density=3.0 Wcm.sup.−2, duty cycle=50% with pulse repetition frequency=100 Hz). The cells were then incubated for 24 h before cell viability was determined using a MTT assay.
Results
[0219] The results are shown in
[0220] This experiment involved just the active agents. However, these are effectively the liberated species upon microbubble destruction. The results are thus expected to extend to the situation in which the active agents are delivered using the microbubble technology herein described.
Example 17—Combined Anthracycline/Sonodynamic Therapy of Human Breast Cancer MDA-MB-231 Tumours Using Oxygen Loaded Microbubble Rose Bengal and Doxorubicin Conjugates
Synthesis of Biotin-Rose Bengal and Biotin-Doxorubicin
[0221] Synthesis of Biotin-Rose Bengal has been detailed above in Example 2. Biotin-Doxorubicin (Biotin-Dox) was prepared according to Scheme 3:
##STR00011##
[0222] To an ice cold solution of biotin-N-hydroxysuccinimide ester (0.14 g, 0.41 mmol) in DMF (10 ml) was added doxorubicin (0.3 g, 0.41 mmol) under a nitrogen atmosphere. After stirring for 30 min, triethylamine (0.5 ml, 2 mmol) was added to this reaction mixture and was allowed to stir for another 12 hrs at room temperature. The reaction was monitored by TLC (Merck Silica 60, HF 254, 20:80 methanol-dichloromethane v/v). After completion of the reaction, excess diethyl ether (100 ml) was added to the reaction mixture. The red solid thus obtained was filtered and washed three times with diethyl ether (50 ml X 3). This red solid was then subjected to PTLC purification using methanol-dichloromethane (20:80, v/v) as an eluent to obtain 0.25 g (Yield=78%) of biotinylated doxorubin. An analytical sample was obtained from a recrystallization of this product from ethanol.
[0223] .sup.1H NMR (MeOH-d.sub.4)δ: 8.54 (brs, 1H, NH), 7.82-7.76 (m, 2H, aromatic), 7.47 (d, J=7.5 Hz, 1H, aromatic), 5.39 (brs, 1H, NH), 5.05 (brs, 2H, NH, OH), 4.71 (s, 2H, —CH.sub.2—OH), 4.67 (brs, 2H, OH X 2), 4.36-4.33 (m, 1H, CH), 4.25-4.22 (m, 1H, CH), 4.16-4.13 (m, 1H, CH), 3.99 (s, 3H, OCH.sub.3), 3.60-3.58 (m, 1H, CH), 3.55 (brs, 2H, OH X2), 3.30-2.5 (m, 4H, CH.sub.2 X1, CH X 2), 2.18-2.14 (m, 3H, CH.sub.2 X 1, CH), 2.00-1.96 (m, 1H, CH), 1.63-1.50 (m, 4H, CH.sub.2 X 2), 1.42-1.26 (m, 11H, CH.sub.3 X 1, CH.sub.2 X 4).
[0224] ESMS [M-H]: calculated for C.sub.37H.sub.43I.sub.2N.sub.3O.sub.13S=769.25, found=767.9 m/z.
Preparation of Oxygen Loaded Microbubble Rose Bengal (RBO.SUB.2.MB) and Doxorubicin (DoxO.SUB.2.MB) Conjugates
[0225] Solutions containing Biotin-RB (2.5 mg/mL) and Biotin-Dox (2.5 mg/mL) were prepared in a 0.5% DMSO solution in PBS (pH 7.4±0.1). A 2 mL aliquot of these stock solutions was then added separately to two 2 mL suspensions of avidin functionalised PFBMBs (1×10.sup.9 MB/mL) and the contents vortex mixed for 15 minutes. The suspensions were then centrifuged (900 rpm) for 5 min and the MB conjugates isolated as a milky suspension floating on top of the solution. The solution was removed and replaced with a further 2 mL of stock solution containing either Biotin-RB or Biotin-Dox and the mixing/centrifugation steps repeated. The MB suspensions were then washed with PBS (5 mL), centrifuged (900 rpm) for 5 minutes and the MBs transferred to a clean centrifuge tube. This washing procedure was repeated again and the isolated PFBMB-RB and PFBMB-Dox conjugates placed in a glass vial. The PFBMB-RB and PFBMB-Dox conjugates were then sparged with oxygen gas for 2 min and the resulting RBO.sub.2MB and DoxO.sub.2MB (see
Treatment of Human Xenograft MDA-MB-231 Using Breast Cancer Tumors in SCID Mice
[0226] All animals employed in this study were treated humanely and in accordance with licenced procedures under the UK Animals (Scientific Procedures) Act 1986. MDA-MB-231 cells were maintained in RPMI-1640 medium supplemented with 10% foetal calf serum as described above. Cells (1×10.sup.6) were re-suspended in 100 μL of Matrigel® and implanted into the rear dorsum of female Balb/c SCID (C.B-17/IcrHan®Hsd-Prkdcscid) mice. Tumour formation occurred approximately 2 weeks after implantation and tumour measurements were taken every other day using calipers. Once the tumours had reached an average volume of 100 mm.sup.3, calculated from the geometric mean diameter using the equation tumour volume=4πR.sup.3/3, animals were randomly distributed into 3 groups (n=3). Following induction of anaesthesia (intraperitoneal injection of Hypnorm/Hypnovel), group 1 received 100 μL of RBO.sub.2MB (300 μM RB); group 2 received 100 μL of DoxO.sub.2MB (475 μM) and group 3 received 100 μL containing RBO.sub.2MB (150 μM RB) and of DoxO.sub.2MB (237.5 μM). Intratumoural injection was chosen as the route of administration to preclude experimental variation resulting from pharmacokinetic behaviour of the platform. The tumours were then treated with ultrasound for 3.5 min at an ultrasound frequency of 1 MHz, an ultrasound power density of 3.5 Wcm.sup.−2 (I.sub.SATP; spatial average temporal peak) and using a duty cycle of 30% at a pulse repetition frequency of 100 Hz. Treatments were repeated on Day 14. After treatments, animals were allowed to recover from anaesthesia and tumour volume and body weight were recorded daily for nine days. The % increase in tumour volume was calculated employing the pre-treatment measurements for each group.
Results
[0227] The results are shown in