AGLYCOSYLATED ANTIBODY Fc REGION FOR TREATING CANCER
20220348654 · 2022-11-03
Assignee
Inventors
Cpc classification
C12N15/10
CHEMISTRY; METALLURGY
C07K16/283
CHEMISTRY; METALLURGY
C07K2317/41
CHEMISTRY; METALLURGY
C07K2317/92
CHEMISTRY; METALLURGY
C07K16/00
CHEMISTRY; METALLURGY
C07K2317/732
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C07K16/28
CHEMISTRY; METALLURGY
A61K39/395
HUMAN NECESSITIES
Abstract
The present disclosure relates to a polypeptide containing an Fc domain in which a part of an amino acid sequence of a human antibody Fc domain is substituted with another amino acid sequence, or an aglycosylated antibody containing the same. The Fc domain of the present disclosure is optimized by substituting a part of an amino acid sequence of a wild-type Fc domain with another amino acid sequence. Therefore, it is useful in treatment of cancer due to superior selective binding ability to FcγRIIIa among Fc receptors, and can be prepared as a homogeneous aglycosylated antibody through bacterial culture.
Claims
1. A nucleotide molecule encoding a polypeptide, the polypeptide comprising a human antibody Fc domain, the Fc domain comprising the following amino acid substitutions according to the Kabat numbering system: a) 8 amino acid substitutions of S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L; and b) one or more additional amino acid substitution selected from a group consisting of C226R, F243L, K246E, T250I, I253N, V264E, T307S, C347R, T350A, S400T and N421S.
2. The nucleotide molecule according to claim 1, wherein the polypeptide encoded by the nucleotide molecule comprises the following 9 amino acid substitutions: V264E, S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L.
3. The nucleotide molecule according to claim 1, wherein the polypeptide encoded by the nucleotide molecule comprises the following 9 amino acid substitutions: S298G, T299A, T307S, K326I, A327Y, L328G, E382V, N390D and M428L.
4. The nucleotide molecule according to claim 1, wherein the polypeptide encoded by the nucleotide molecule comprises the following 9 amino acid substitutions: S298G, T299A, K326I, A327Y, L328G, C347R, E382V, N390D and M428L.
5. The nucleotide molecule according to claim 1, wherein the polypeptide encoded by the nucleotide molecule comprises the following 10 amino acid substitutions: V264E, S298G, T299A, K326I, A327Y, L328G, T350A, E382V, N390D and M428L.
6. The nucleotide molecule according to claim 1, wherein the polypeptide encoded by the nucleotide molecule comprises the following 10 amino acid substitutions: T250I, I253N, S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L.
7. The nucleotide molecule according to claim 1, wherein the polypeptide encoded by the nucleotide molecule comprises the following 10 amino acid substitutions: V264E, S298G, T299A, K326I, A327Y, L328G, E382V, N390D, N421S and M428L.
8. The nucleotide molecule according to claim 1, wherein the polypeptide encoded by the nucleotide molecule comprises the following 11 amino acid substitutions: V264E, S298G, T299A, K326I, A327Y, L328G, T350A, E382V, N390D, N421S and M428L.
9. The nucleotide molecule according to claim 1, wherein the polypeptide encoded by the nucleotide molecule comprises the following 11 amino acid substitutions: C226R, F243L, K246E, S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L.
10. The nucleotide molecule according to claim 1, wherein the Fc domain of the polypeptide encoded by the nucleotide molecule comprising the amino acid substitution has improved binding ability for FcγRIIIa as compared to the Fc domain with only 8 amino acids of S298G, T299A, K326I, A327Y, L328G, E382V, N390D and M428L substituted.
11. An aglycosylated antibody comprising the polypeptide encoded by the nucleotide molecule according to claim 1.
12. A vector comprising the nucleotide molecule according to claim 11.
13. A host cell comprising the vector according to claim 12.
14. The host cell according to claim 13, wherein the host cell is a bacterial cell.
15. A composition comprising a polypeptide, the nucleotide molecule according to claim 1 encoding the polypeptide.
16. The composition according to claim 15, wherein the composition is a pharmaceutical composition.
17. A method for preparing a polypeptide comprising a human antibody Fc domain, comprising: a) a step of culturing a host cell comprising a vector comprising the nucleotide molecule encoding the polypeptide according to claim 1; and b) a step of recovering the polypeptide expressed by the host cell.
18. A method for preparing an aglycosylated antibody, comprising: a) a step of culturing a host cell expressing an aglycosylated antibody comprising a polypeptide encoded by the nucleotide molecule according to claim 1; and b) a step of purifying the antibody expressed by the host cell.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
MODE FOR INVENTION
[0098] Hereinafter, the present disclosure will be described in detail through examples. However, the following examples are for illustrative purposes only and it will be apparent to those of ordinary skill in the art that the scope of the present disclosure is not limited by the examples.
EXAMPLES
Example 1: Fc Variant Cloning for Displaying Aglycosylated Antibody on Bacterial Inner Membrane as Full-Length IgG (A/IYG, Fc1004-IYG)
[0099] In order to display the A/IYG (U.S. Pat. No. 8,815,237) variant and Fc1004-IYG as full-length IgG, each Fc variant was constructed as a heavy chain-type plasmid. A pMopac12-PeIB-VH-CH1-CH2-CH3(wild type)-FLAG plasmid was split into two fragments for T299A substitution, and each strand was amplified with the Vent polymerase (New England Biolabs) using MJ #36, MJ #43/MJ #42 and MJ #37 primers. The two fragments were constructed into a pMopac12-PeIB-VH-CH1-CH2-CH3(T299A)-FLAG plasmid through assembly PCR using MJ #36 and MJ #37 primers, SfiI (New England Biolabs) cutting and ligation using T4 DNA ligase (Invitrogen). 326IYG substitution was conducted using the plasmid as a template and using MJ #36, MJ #39/MJ #38 and MJ #37 primers by the same method (construction of pMopac12-PeIB-VH-CH1-CH2-CH3(A/IYG)-FLAG). Then, pMopac12-PeIB-VH-CH1-CH2-CH3(Fc1004-IYG)-FLAG was conducted by introducing 326IYG point mutation to pMopac12-PeIB-VH-CH1-CH2-CH3(Fc1004)-FLAG using the same MJ #36, MJ #39/MJ #38 and MJ #37 primers.
TABLE-US-00001 TABLE 1 Primers used in the experiment Primer # Nucleotide sequence (5′.fwdarw.3′) MJ#36 (SEQ ID NO 17) CGCAGCGAGGCCCAGCCGGCCATGGCGGA GGTTCAATTAGTGGAATCTG MJ#43 (SEQ ID NO 18) GGACGCTGACCACACGGTACGCGCTGTTG TACTGCTCCTCCCG MJ#42 (SEQ ID NO 19) CGGGAGGAGCAGTACAACAGCGCGTACCG TGTGGTCAGCGTCC MJ#37 (SEQ ID NO 20) CGCAATTCGGCCCCCGAGGCCCCTTTACC CGGGGACAGGGAG MJ#39 (SEQ ID NO 21) GGTTTTCTCGATGGGGGCTGGGCCATAAA TGTTGGAGACCTTGCATTTGTACTCCTTG MJ#38 (SEQ ID NO 22) CAAGGAGTACAAATGCAAGGTCTCCAACA TTTATGGCCCAGCCCCCATCGAGAAAACC MJ#45 (SEQ ID NO 23) CGACAAGAAAGTTGAGCCCAAATCTTGT MJ#46 (SEQ ID NO 24) CGCAATTCCGGCCCCCGAGGCCCC MJ#44 (SEQ ID NO 25) ACAAGATTTGGGCTCAACTTTCTTGTCG MJ#2 (SEQ ID NO 26) CTGCCCATGTTGACGATTG MJ#49 (SEQ ID NO 27) CGCAGCGAGCGCGCACTCCATGGCGGAG GTTCAATTAGTGGAATCTG MJ#50 (SEQ ID NO 28) CCCTAAAATCTAGACCTTTACCCGGGGA CAGGGAG
Example 2: Preparation of Tetrameric FcγRIIIa and Fluorescence Labeling Using Alexa 488 Fluor
[0100] The pMAZ-FcγRIIIa (V158)-FLAG-streptavidin-His plasmid was expressed in 300 mL of HEK 293F cells and affinity chromatography was conducted using 1 mL of Ni-NTA agarose (Qiagen) slurry. After the culturing, the suspended culture was centrifuged at 7000 rpm for 10 minutes to remove the cells. The supernatant was equilibrated using 25×PBS and then filtered through a 0.2-μm bottle top filter (Merck Millipore). After adding Ni-NTA slurry equilibrated with PBS and stirring at 4° C. for 16 hours, the solution was flown through a polypropylene column (Thermo Fisher Scientific). After taking the pass-through solution and binding again to a resin, it was sequentially washed with 50 mL of 1×PBS, 25 mL of 10 mM of imidazole buffer, 25 mL of 20 mM imidazole buffer and 200 μL of 250 mM imidazole buffer. After eluting with 2.5 mL of 250 mM imidazole buffer and replacing the buffer with PBS through Amicon Ultra-4 (Merck Millipore), the purified protein was investigated by SDS-PAGE (
Example 3: Comparison of Binding Ability of Wild Type, Fc1004 and A/IYG for FcγRIIIa
[0101] Because the clones to be analyzed are heavy chain-encoding plasmids, pMopac12-PeIB-VH-CH1-CH2-CH3 (wild type)-FLAG, pMopac12-PeIB-VH-CH1-CH2-CH3(Fc1004)-FLAG and pMopac12-PeIB-VH-CH1-CH2-CH3(A/IYG)-FLAG, E. coli Jude 1 cells (F′ [Tn10(Tet.sup.r) proAB.sup.+lacl.sup.qΔ(lacZ)M15] mcrA Δ(mrr-hsdRMS-mcrBC)80dlacZΔM15 ΔlacX74 deoR recA1 araD139 Δ(ara leu)7697 galU galKrpsLendA1nupG) (Kawarasaki et al., 2003) were transformed with the pBAD30-Km-PeIB-VL-Ck-NIpA-VL-Ck-His-cMyc plasmid, such that heavy chains and light chains could be expressed in the periplasmic region. After culturing in 5 mL of Terrific broth (TB, BD) containing 2% glucose (Sigma-Aldrich) at 37° C. for 16 hours, 5.5 mL of TB was transferred to a 100-mL flask for 1:100 inoculation. After culturing to OD.sub.600=0.6, followed by cooling at 25° C. and 250 rpm for 20 minutes, overexpression was conducted at 25° C. and 250 rpm for 20 hours by adding 0.2% arabinose and 1 mM IPTG. After the overexpression, the cells were OD.sub.600 normalized and harvested by centrifuging at 14000 rpm for 1 minute. A washing procedure of resuspending the cells by adding 1 mL of 10 mM Tris-HCl (pH 8.0) and centrifuging for 1 minute was repeated twice. After resuspending the cells in 1 mL of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)], the outer membrane of the cells was removed by rotating at 37° C. for 30 minutes. After centrifuging, discarding the supernatant and resuspending by adding 1 mL of solution A [0.5 M sucrose, 20 mM MgCl.sub.2, 10 mM MOPS pH 6.8], centrifugation was carried out. After resuspending in 1 mL of a solution obtained by mixing 1 mL of solution A and 20 μL of 50 mg/mL lysozyme solution, the peptidoglycan layer was removed by rotating at 37° C. for 15 minutes. After centrifuging, removing the supernatant and resuspending in 1 mL of PBS, 300 μL was taken and spheroplasts were fluorescence-labeled by rotating at room temperature after adding 700 μL of PBS and fluorescence-labeled tetrameric FcγRIIIa-Alexa 488 Flour. After the labeling and washing once with 1 mL of PBS, analysis was conducted using the Guava instrument (Merck Millipore) (
Example 4: Comparison of Binding Ability of A/IYG and Fc1004-IYG for FcγRIIIa
[0102] pMopac12-PeIB-VH-CH1-CH2-CH3 (IYG)-FLAG and pMopac12-PeIB-VH-CH1-CH2-CH3 (Fc1004-IYG)-FLAG were prepared such that heavy chains and light chains could be expressed in the periplasmic region by transforming E. coli Jude 1 cells together with the pBAD30-Km-PeIB-VL-Ck-NIpA-VL-Ck-His-cMyc plasmid. After culturing the cells at 37° C. for 16 hours in 5 mL of TB containing 2% glucose, 5.5 mL of TB was transferred to a 100-mL flask for 1:100 inoculation. After culturing to OD.sub.600=0.6, followed by cooling at 25° C. and 250 rpm for 20 minutes, overexpression was conducted at 25° C. and 250 rpm for 20 hours by adding 0.2% arabinose and 1 mM IPTG. After the overexpression, the cells were OD.sub.600 normalized and harvested by centrifuging at 14000 rpm for 1 minute. A washing procedure of resuspending the cells by adding 1 mL of 10 mM Tris-HCl (pH 8.0) and centrifuging for 1 minute was repeated twice. After resuspending the cells in 1 mL of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)], the outer membrane of the cells was removed by rotating at 37° C. for 30 minutes. After centrifuging, discarding the supernatant and resuspending by adding 1 mL of solution A [0.5 M sucrose, 20 mM MgCl.sub.2, 10 mM MOPS pH 6.8], centrifugation was carried out. After resuspending in 1 mL of a solution obtained by mixing 1 mL of solution A and 20 μL of 50 mg/mL lysozyme solution, the peptidoglycan layer was removed by rotating at 37° C. for 15 minutes. After centrifuging, removing the supernatant and resuspending in 1 mL of PBS, 300 μL was taken and spheroplasts were fluorescence-labeled by rotating at room temperature after adding 700 μL of PBS and fluorescence-labeled tetrameric FcγRIIIa-Alexa 488 Flour. After the labeling and washing once with 1 mL of PBS, analysis was conducted using the Guava instrument (Merck Millipore) (
Example 5: Construction of Aglycosylated Antibody Library Based on Fc1004-1YG
[0103] In order to construct an aglycosylated antibody Fc library based on Fc1004-IYG, error prone PCR and assembly PCR were conducted using pMopac12-PeIB-VH-CH1-CH2-CH3 (Fc1004-IYG)-FLAG as a template. The error prone PCR technique using Taq polymerase (Invitrogen) was used to introduce random point mutation to the Fc (CH2-CH3) region. The point mutation was introduced to 0.5% of nucleotides of the full-length Fc gene using MJ #45 and MJ #46 primers. The forward region of Fc was designed to overlap with Fab, such that assembly as heavy chains was possible. The entire heavy chain-type PCR product was constructed by conducting conventional PCR for the Fab (VH-CH1) region using MJ #36 and MJ #44 primers and Vent polymerase, and then conducting assembly PCR to ligate the Fab fragment with the Fc fragment using MJ #36 and MJ #46 primers. Then, after SfiI restriction enzyme treatment and ligation, the heavy chain-type aglycosylated antibody Fc library was constructed by transforming into Jude 1 cells (library size: 1.14×10.sup.9, experimental error rate: 0.457%). After obtaining the gene from the library and then transforming again to Jude 1 cells transformed with pBAD30-Km-PeIB-VL-Ck-NIpA-VL-Ck-His-cMyc, a library in which the full-length IgG was displayed on the inner membrane of E. coli was constructed (
Example 6: Screening of Constructed Library by Flow Cytometry and Selection of Variants MG42, MG48, MG59, MG87, etc. (Confirmation of Binding Ability for FcγRIIIa)
[0104] The constructed library was unfolded in 25 mL of TB containing 2% glucose in a 250-mL flask, incubated in a vial (1 mL) at 37° C. for 4 hours, and then transferred to 110 mL of TB in a 2.5-L flask for 1:100 inoculation. After culturing to OD.sub.600=0.6, followed by cooling at 25° C. and 250 rpm for 20 minutes, overexpression was conducted at 25° C. and 250 rpm for 20 hours by adding 0.2% arabinose and 1 mM IPTG. After the overexpression, the cells were OD.sub.600 normalized and harvested by centrifuging at 14000 rpm for 1 minute. After preparing spheroplasts as described above, the cells were labeled with tetrameric FcγRIIIa-Alexa 488 Flour and then washed once with 1 mL of PBS. Finally, the sample resuspended in 1 mL of PBS was diluted with 20 mL of PBS and only the cells emitting upper 3% signals were sorted using the S3 cell sorter (BioRad). The separated cells were sorted once again. Genes were amplified from the sorted cells by PCR using MJ #36 and MJ #2 primers and Taq polymerase (Biosesang). Then, a sublibrary in which the genes of the sorted cells were amplified was obtained through SfiI restriction enzyme treatment, ligation and transformation. After repeating this procedure for a total of 5 rounds, variants exhibiting high affinity for FcγRIIIa were selected by analyzing more than 90 individual clones (
TABLE-US-00002 TABLE 2 Point mutation of major variants Fc variants Point mutation A/IYG (SEQ ID NO 5) T299A, K326I, A327Y, L328G Fc1004 (SEQ ID NO 3) S298G, T299A, E382V, N390D, M428L Fc1004-IYG (SEQ ID NO 7) S298G, T299A, K326I, A327Y, L328G, E382V, N390D, M428L MG42 (SEQ ID NO 9) (Fc1004-IYG) + 264E, 350A, 421S MG48 (SEQ ID NO 11) (Fc1004-IYG) + 264E, 350A MG59 (SEQ ID NO 13) (Fc1004-IYG) + 264E MG87 (SEQ ID NO 15) (Fc1004-IYG) + 264E, 421S
[0105] In addition to these variants, the variants exhibiting higher affinity for FcγRIIIa than A/IYG were screened additionally (MG61: (Fc1004-IYG)+T307S, MG86: (Fc1004-IYG)+C226R+F243L+K246E MG54: (Fc1004-IYG)+T250I+I253N, MG14: (Fc1004-IYG)+C347R) (
Example 7: Cloning for Expression of Screened Variants in Animal Cells, and Expression and Purification Thereof
[0106] In order to prepare MG59, MG87 and MG48 among the screened variants together with wild type and A/IYG, as controls, into IgG forms soluble in HEK293F cells, pMAZ-IgH (wild type), pMAZ-IgH (A/IYG), pMAZ-IgH (MG59), pMAZ-IgH (MG87) and pMAZ-IgH (MG48) were constructed by amplifying the ‘VH-CH1-CH2-CH3’ region encoding the heavy chain by PCR using the Vent polymerase and MJ #49 and MJ #50 primers, followed by treatment with BssHII and XbaI restriction enzymes (New England Biolabs) and ligation. For expression as IgG, they were co-transfected into HEK 293F cells together with the pMAZ-IgL plasmid and expressed transiently at 300 mL scale. After culturing and removing the medium by centrifuging at 7000 rpm for 10 minutes, the supernatant was equilibrated using 25×PBS and filtered through a 0.2-μm bottle top filter (Merck Millipore). After adding 1 mL of protein A agarose (Genscript) slurry equilibrated with PBS and stirring at 4° C. for 16 hours, the solution was flown through a polypropylene column (Thermo Fisher Scientific). After taking the pass-through solution and binding again to a resin, it was washed by flowing 10 CV (column volume) or more of 1×PBS. After eluting with 3 mL of 100 mM glycine-HCl (pH 2.7), the eluate was neutralized immediately with 1 mL of 1 M Tris (pH 8.0). After replacing the buffer with PBS through Amicon Ultra-4 (Merck Millipore), the purified protein was investigated by SDS-PAGE (BioRad) (
Example 8: ELISA Analysis of Variants for Confirmation of Binding Ability for FcRs
[0107] 50 μL of each IgG Fc variant diluted with 0.05 M Na.sub.2CO.sub.3 (pH 9.6) to 4 μg/mL was fixed onto the Flat Bottom Polystyrene High Bind 96-well microplate (Costar) at 4° C. for 16 hours, and then blocked at room temperature with 100 μL of 5% BSA (in 0.05% PBST) for 2 hours. After washing 4 times with 180 μL of 0.05% PBST, 50 μL of FcRs serially diluted with a blocking solution was added to each well. After the washing, antibody reaction was conducted at room temperature for 1 hour using 50 μL of anti-His-HRP conjugate (Sigma-Aldrich) and anti-GST-HRP conjugate (GE Healthcare), respectively. After adding 50 μL of 1-Step Ultra TMB-ELISA substrate solution (Thermo Fisher Scientific) for color development, the reaction was terminated by adding 50 μL of 2 M H.sub.2SO.sub.4 and analysis was conducted using the Epoch microplate spectrophotometer (BioTek) (
Example 9: Measurement of K.SUB.D .Values of FcγRIIIa and Trastuzumab Variants by SPR
[0108] The binding ability of the trastuzumab variants was measured using BIAcore T200 (GE Healthcare). After fixing each of the wild-type aglycosylated antibody (Aglyco-T), A/IYG, wild-type glycosylated antibody (Glyco-T; produced by culturing HEK 293F cells), Herceptin (clinical drug produced in CHO cells), MG48 and MG59 on a CM5 chip through amine coupling, dimeric FcγRIIIa-V158-GST, FcγRIIa-F158-GST was injected using HBS-EP buffer (10 mM HEPES pH 7.4, 150 mM NaCl, 3.4 mM EDTA, and 0.005% P20 surfactant) (GE Healthcare) and the binding ability was analyzed (
TABLE-US-00003 TABLE 3 SPR K.sub.D values of variants K.sub.D (M) Fold increase FcγRIIIa (158V) FcγRIIIa (158F) (V/F) Aglyco-T N.D N.D 0 A/IYG 1.110 × 10.sup.−6 1.737 × 10.sup.−5 1 Glyco-T (HEK) 1.200 × 10.sup.−7 5.782 × 10.sup.−6 9.25/3.00 Herceptin (CHO) 8.418 × 10.sup.−8 5.142 × 10.sup.−6 13.19/3.38 MG48 6.793 × 10.sup.−8 6.763 × 10.sup.−7 16.34/25.68 MG59 1.070 × 10.sup.−7 1.049 × 10.sup.−6 10.37/16.56
[0109] As a result, it was confirmed that the MG48 and MG59 screened in the present disclosure showed binding ability improved by up to 16 times for FcγRIIIa-V158 and up to 25 times or more for FcγRIIa-F158, as compared to A/IYG.
Example 10: Investigation of HER2 Expression Level in SKBR-3 and MCF-7 Target Cells
[0110] Cells were cultured on a 100-mm dish (80% confluency). After removing the medium and washing once with DPBS, the cells were treated with 1.5 mL of Accutase (Merck Millipore) and incubated for 2-3 minutes in a 37° C. CO.sub.2 incubator. After confirming that the cells adhered to the bottom of the dish, 6 mL of a cell culture medium was added. After taking all the solution including the cells using a 10-mL pipette, the solution was transferred to a 15-mL tube and centrifuged at 1200 rpm for 3 minutes. After completely removing the solution from the 15-mL tube and adding 5 mL of DPBS and mixing well with the cells, centrifugation was performed at 1200 rpm for 3 minutes. After removing the DPBS from the tube and adding 3 mL of washing buffer (PBS+1% BSA) and mixing well with the cells, centrifugation was performed at 1200 rpm for 3 minutes and the washing buffer was removed from the tube. After repeating the washing procedure 2 times, 1 mL of washing buffer was added finally and mixed well with the cells. FACS tubes (Falcon) were prepared for non-staining, isotype control (normal human IgG-Alexa 488) and trastuzumab-Alexa 488, respectively. The cells were counted and transferred to each tube at 1×10.sup.5 cells/300 μL. After blocking at 4° C. for 15 minutes, centrifugation was carried out and the supernatant was removed. 100 μL of washing buffer was added to the FACS tube and mixed well with the cells. 1 μg of isotype control and trastuzumab-Alexa 488 was added except for the non-staining tube. After blocking light with aluminum foil and conducting antibody reaction at 4° C. for 30 minutes, centrifugation was carried out and the supernatant was removed. The remaining cells were washed by adding 1 mL of washing buffer. This procedure was repeated 3 times. After adding 300 μL of running buffer (PBS) to each tube and mixing well with the cells, FACS analysis was carried out. As a result, it was confirmed that SKBR-3 showed much higher HER2 expression than MCF-7 (
Example 11: Preliminary Experiment for Determination of Effector Cell (PBMC):Target Cell (SKBR-3, MCF-7) Ratio for ADCC
[0111] After culturing SKBR-3 and MCF-7 target cells, the target cells were seeded onto a 96-well V-bottom plate (Corning) at 1×10.sup.4 cells/50 μL/well and then 10 μL of trastuzumab (20 μg/mL) was added per each well. PBMCs (CTL, Table 4) were quickly thawed in a 37° C. water bath and treated with DNase I for 30 minutes at room temperature. After counting the cells, an adequate number of the PBMCs were added to each well.
TABLE-US-00004 TABLE 4 Data of PBMC donors Sample ID # Ethnicity Age Gender ABO/PH 20091026 Caucasian 24 Male A/POS 20100412 Hispanic 30 Male A/POS HHU20120530 African/American 35 Male AB/POS HHU20130318 Asian 38 Male A/POS HHU20150924 Asian/Filipino 40 Male A/POS
[0112] The effector cell:target cell ratio was set to 1.5625:1, 3.125:1, 6.25:1, 12.5:1 and 25:1. After centrifuging at 100×g for 1 minute, the cells were cultured in a 37° C., CO.sub.2 incubator for 4 hours. 4 hours later, the plate was centrifuged at 300×g for 3 minutes. 50 μL of the supernatant was taken and transferred onto a SpectraPlate 96-well plate (PerkinElmer). Then, incubation was conducted at room temperature for 30 minutes after adding 50 μL of CytoTox 96® reagent (Promega) per each well. After terminating the reaction by adding 50 μL of a stop solution, absorbance was measured at 490 nm. This procedure was repeated 3 times in duplicates and the mean value was taken. As a result, the ADCC assay using SKBR-3 (1×10.sup.4 cells/well) with high HER2 expression as target cells and using PBMC as effector cells showed effector cell number-dependent increase in cytotoxicity. Although MCF-7 with low HER2 expression also showed effector cell number-dependent increase in cytotoxicity, the increase was lower as compared to SKBR-3 exhibiting higher HER2 expression (
TABLE-US-00005 TABLE 5 ADCC activity depending on effector cell:target cell ratio % Cytotoxicity Effector:target SKBR-3 MCF-7 1.5625:1 1.65 0.23 3.125:1 2.00 0.98 6.25:1 13.54 1.01 12.5:1 17.47 7.00 .sup. 25:1 40.21 10.38
Example 12: Comparison of ADCC Activity of Herceptin Variants Using Human PBMC
[0113] SKBR-3 and MCF-7 cells were seeded onto a 96-well plate (V-bottom) at 1×10.sup.4 cells/50 μL per well, and 10 μL of the test substance was added at 0, 0.032, 0.16, 0.8, 4 and 20 μg/mL to each well. Five individual PBMC samples were quickly thawed in a 37° C. water bath and treated with DNase I for 30 minutes at room temperature. After counting the cells and adding 2.5×10.sup.5 cells/50 μL of PBMC to each well, the plate was centrifuged at 100×g for 1 minute and then cultured in a 37° C. CO.sub.2 incubator for 4 hours. 4 hours later, the plate was taken out and centrifuged at 300×g for 3 minutes. After taking 50 μL of the supernatant and transferred onto a SpectraPlate 96-well plate, 50 μL of CytoTox 96® reagent was added to each well and reaction was conducted at room temperature for 30 minutes. After terminating the reaction by adding 50 μL of a stop solution, absorbance was measured at 490 nm. This procedure was repeated 3 times in duplicates and the mean value was represented as % cytotoxicity. The SKBR-3 cells with HER2 expression showed high % cytotoxicity of 4-31%, whereas the MCF-7 cells with low HER2 expression showed low % cytotoxicity of 2-15%. Accordingly, it was confirmed that the cytotoxicity of the test substance is target-specific. In addition, it was confirmed that the cancer cell killing effect is improved remarkably as compared to the wild-type aglycosylated antibody and the human IgG antibody (
[0114] Those skilled in the art will appreciate that the conceptions and specific embodiments disclosed in the foregoing description may be readily utilized as a basis for modifying or designing other embodiments for carrying out the same purposes of the present disclosure. Those skilled in the art will also appreciate that such equivalent embodiments do not depart from the spirit and scope of the disclosure as set forth in the appended claims.