FUSARIUM CHITIN SYNTHASE GENE Chs3b AND THE USE THEREOF
20170314040 · 2017-11-02
Inventors
- Yucai Liao (Wuhan, CN)
- Heping Li (Wuhan, CN)
- Xiushi Song (Wuhan, CN)
- Wei Cheng (Wuhan, CN)
- Peng Yang (Wuhan, CN)
Cpc classification
C12N15/8218
CHEMISTRY; METALLURGY
C12N2310/111
CHEMISTRY; METALLURGY
International classification
C12N15/82
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention discloses RNAi constructs derived from a Fusarium chitin synthase gene Chs3b, which has a nucleotide sequence as shown by SEQ ID NO: 1. Five distinct RNAi vectors are constructed for 5 different segments of the Chs3b gene (named Chs3b-1, 2, 3, 4, and 5, respectively), and separately transformed into Fusarium. It is found that siRiNAs in the transformed Fusarium shows a significant inhibition in fungal growth, development, and pathogenicity. The expression of the RNAi vectors against Chs3b in plants may inhibit the infection of Fusarium and improve the resistance of the transgenic plants to Fusarium head blight.
Claims
1.-5. (canceled)
6. A RNAi construct targeting a Fusarium chitin synthase gene Chs3b having a nucleotide sequence of SEQ ID NO. 1, a fragment or homologue thereof.
7. The RNAi construct according to claim 1, wherein the RNAi construct is designed based on a hairpin loop structure and/or to form a dsRNA/siRNA or antisense sequence directed to the Fusarium chitin synthase gene Chs3b, a fragment or homologue thereof.
8. The RNAi construct according to claim 1, wherein the RNAi construct is directed to a fragment of Fusarium chitin synthase gene Chs3b selected from the group consisting of: Chs3b-1 having a nucleotide sequence of SEQ ID NO. 2, Chs3b-2 having a nucleotide sequence of SEQ ID NO. 3, Chs3b-3 having a nucleotide sequence of SEQ ID NO. 4, Chs3b-4 having a nucleotide sequence of SEQ ID NO. 5, and Chs3b-5 having a nucleotide sequence of SEQ ID NO. 6.
9. The RNAi construct according to claim 1, which is a fungal transformation vector preferably selected from the group consisting of: pChs3bRNAi-1, pChs3bRNAi-2, pChs3bRNAi-3, pChs3bRNAi-4 and pChs3bRNAi-5.
10. The RNAi construct according to claim 1, which is a plant transformation vector, preferably wherein the hairpin loop structure sequence therein is modulated by a constitutive promoter (e.g., a corn Ubi promoter) and terminated by a terminator (e.g., Nos terminator), and more preferably it is selected from the group consisting of: pXJC-Chs3bRNAi-1, pXJC-Chs3bRNAi-2, pXJC-Chs3bRNAi-3, pXJC-Chs3bRNAi-4 and pXJC-Chs3bRNAi-5.
11. A tranfected cell comprising the RNAi construct according to claim 1, wherein the cell is a bacterial cell (preferably fungal cell), an animal cell or a plant cell.
12. A method for producing a plant resistant to Fusarium head blight, comprising the steps of transforming the plant with the RNAi construct according to claim 1, and expressing the RNAi construct to form a dsRNA/siRNA or antisense sequence directed to the Fusarium chitin synthase gene Chs3b, a fragment or homologue thereof.
13. The method according to claim 7, wherein the plant is selected from the group consisting of wheat, barley, corn, rice, rapeseed and oat.
14. A plant resistant to Fusarium head blight produced by the method of claim 7.
15. The plant resistant to Fusarium head blight according to claim 9, which is selected from the group consisting of wheat, barley, corn, rice, rapeseed and oat.
Description
THE DESCRIPTION OF FIGURES
[0022]
[0023]
[0024] A: The phenotypes of wild-type strain 5035 and respective Chs3bRNAi strains cultured in a PDA medium or in a PDA medium supplemented with various stressing agents for 3 days. B: left: the pathogenicity analysis of wild-type strain 5035 and respective Chs3bRNAi strains introduced into wheat strain Annong 8455 at seedling stage ; right: the pathogenicity analysis of wild-type strain 5035 and respective Chs3bRNAi strains introduced into wheat strain Sumai No. 3 at flowering stage (P<0.05).
[0025]
[0026]
[0027]
[0028] Chs3bRNAi wheat plants T.sub.5). Y15: negative control plant; H.sub.2O: blank control plant; R1 and R2: two transgenic Chs3bRNAi-positive plants, respectively.
[0029]
[0030]
EMBODIMENTS
Example 1
The Isolation and Cloning of cDNA of Chs3b Gene
[0031] Chs3b gene of the present invention corresponds to the sequence of FGSG_10116 disclosed in Fusarium Comparative Database (http://www.broadinstitute.org/annotation/genome/fusarium_graminearum/Multi Home.html). cDNA sequence was amplified from the hyphae of Fusarium graminearum 5035 cultured on PDA medium for 3 days by routine RT-PCR. method (see, “Molecular Cloning: A Laboratory Manual 3.sup.rd Edition”, Joseph Sambrook and David W Russell, translated by HUANG Peitang and WANG Jiaxi, Science Press, 2002).
[0032] A method for cloning Fusarium chitin synthase gene Chs3b according to the present invention, comprising the steps of:
[0033] 1) RNA was extracted from the hyphae of Fusarium graminearum 5035 (a Fusarium graminearum strain having high pathogenicity, which was isolated and preserved by the applicant's lab in Wu Han, in 1999) cultured on PDA medium for 3 days by using Trizol extraction kit (invitrogen) according to the manufacturer's instructions.
[0034] 2) Synthesis of first strand cDNA: (1) Genomic DNA mixed in the total RNA was degraded with DNase I (RNase free). A 50 μl reaction system was prepared: 10× DNase I Buffer 5 μl, DNaseI (RNase free) 2 μl, RNase inhibitor (40 U/μl) 0.5 μl, total RNA 3 μg, ddH.sub.2O (RNase free) q.s. to 50 μl. After reaction at 37° C. for 40 min, 150 μl of ddH.sub.2O (RNase free) was supplemented; then, 200 μl of P.C.I. was added and mixed thoroughly; centrifugation was performed at 4° C., 12000 r/min for 15 min.; 180 μl of upper liquid was transferred to a new centrifuge tube, to which an equal volume of C.I. was then added and mixed thoroughly; centrifugation was performed at 4° C., 12000 r/min for 1.0 min; 160 μl of upper liquid was transferred to a new centrifuge tube, to which 160 μl of isopropanol was then added and mixed thoroughly, left at room temperature for 15 min; centrifugation was performed at 4° C., 12000 r/min for 15 min; the supernatant was removed, and then the precipitant was washed with 500 μl of 75% (v/v) ethanol solution pre-cooled at 4° C.; centrifugation was performed at 12000 r/min. for 15 min; the supernatant was removed, and the precipitant was left at room temperature and allowed to be dried; 20 μl of ddH.sub.2O (RNase free) was added to dissolve RNA; and 1 μl of the solution was sampled for electrophoresis. (2) RNA of high quality thus obtained was subjected to following reaction using first strand cDNA synthesis kit (SuperScript™ III Reverse Transcriptase Kit) according to the manufacturer's instructions: Oligo (dT)20 (100 ng/μl) 3 μl, dNTPs (10 mmol/L) 1 μl, and RNA 2 μg were mixed; to the mixture, ddH.sub.2O (RNase free) was added to 13 μl; reaction was performed at 65° C. in water bath for 5 min, followed immediately by ice bathing for 3 min.; after short centrifugation for seconds, 5× First-stand Buffer 4 μl, DTT (0.1 mol/L) 1 μl, RNase inhibitor (40 U/μl) 0.5 μl, SuperScript™ III Reverse Transcriptase (200 U/μl) 0.5 μl, and ddH2O (RNase free) 1 μl were added and gently mixed; the reaction mixture was incubated at 50° C. for 60 min, then heated to 70° C. for 15 min to inactivate the enzyme, and then cooled in ice bath for 3 min; and stored at −20° C. for use.
[0035] 3) Full-length Chs3b cDNA was amplified by PCR using the following primers designed in accordance with the cDNA sequence of Chs3b (FGSG_10116) gene in the Fusarium Comparative Database:
TABLE-US-00002 Chs3bcdnacloneP1: ATGGCGTACAATGGCCGTGAC Chs3bcdnacloneP2: TTAATTTCTTGAGAAACAG.
[0036] PCR reaction system (total 50 μl): cDNA first strand template 1 μl, 10× LA PCR buffer 5μl, 10 mM dNTP 4 μl, each of forward and reverse primers 1 μl, LATaq enzyme 0.5 μl, water added q.s. to 50 μl (the agents used in the PCR reaction can be purchased from Takara Bio., Da Lian). PCR reaction conditions: pre-denaturing at 95° C. for 3 min; 95° C. 20 s, 54° C. 30 s, 72° C. 2.5 min, for 35 cycles; extending at 72° C. for 10 min, and 4° C. for storage.
[0037] 4) The product of the PCR reaction was ligated to T/A cloning vector pMD18-T (Takara Bio., Da Lian) and sequenced by using primers M13F and M13R. (provided together with pMD18-T) for verification. The cDNA sequence of Chs3b gene, as an isolated gene, was thus obtained. An isolated gene having a nucleotide sequence of SEQ ID NO. 1 (2718 bp in length). An isolated protein having an amino acid sequence of SEQ ID NO. 2 (905 amino acids).
Example 2
Construction of RNAi Vectors Against Respective Segments of Chs3b Gene and the Transformation Into Fungi
[0038] 1) According to the present invention, Chs3b gene was divided into 5 segments (
TABLE-US-00003 Chs3bRNAi1s-P1: TCCCCCGGGTCTTGAGGGTGAAGTCGTTGGGAT Chs3bRNAi1s-P2: ATAAGAATGCGGCCGCCCGTGACCAGGAGTATGGAGGC Chs3bRNAi2s-P1: TCCCCCGGGTGTAGAAACCCTCCCAAAGAGCAAG Chs3bRNAi2s-P2: ATAAGAATGCGGCCGCCTTCACCCTCAAGAACGGTTACGA Chs3bRNAi3s-P1: TCCCCCGGGCAGAGTGGCAGCGAACGAACC Chs3bRNAi3s-P2: ATAAGAATGCGGCCGCTCCTTGCTCTTTGGGAGGGTTTC Chs3bRNAi4s-P1: TCCCCCGGGTAATAAGAGCGACCAGAATAACACCACCAG Chs3bRNAi4s-P2: ATAAGAATGCGGCCGCTCGTTCGCTGCCACTCTGTACTCGCTGATG Chs3bRNAi5s-P1: TCCCCCGGGCCTGCCGAGGAACCACAAGAAACC Chs3bRNAi5s-P2: ATAAGAATGCGGCCGCGCTGGTGGTGTTATTCTGGTCGCTCTT
[0039] PCR reaction system (total 50 μl): cDNA first strand template 1 μl, 10× LA PCR buffer 5 μl, 10 mM dNTP 4 μl, each of forward and reverse primers 1 μl, LATaq enzyme 0.5 μl, water q.s. to 50 μl (the agents used in the PCR reaction can be purchased from Takara Bio., Da Lian). PCR reaction condition: pre-denaturing at 95° C. for 3 min; 95° C. 20 s, 56° C. 30 s, 72° C. 30 s, for 35 cycles; extending at 72° C. for 10 ruin. The product of the PCR reaction recovered from gel was subjected to cleavage of restrict enzymes SmaI and NotI and then ligated into pBlueScript SK (+) vector, resulting in pBlue-Chs3b vectors carrying respective forward segments.
[0040] PDK intron+reverse sequence of each of respective segments of Chs3b was amplified by using the following SOE-PCR primers:
TABLE-US-00004 PDK-P1: ATAAGAATGCGGCCGCGCTTGGTAAGGAAATAATTA Chs3bRNAi1as-P2: TTCCCCGCGGGGATCGAGCTCTCTTGAGGGTGAAGTCGTTG Chs3bRNAi2as-P2: TTCCCCGCGGGGATCGAGCTCTGTAGAAACCCTCCCAAAGAGCAAG Chs3bRNAi3as-P2: TTCCCCGCGGGGATCGAGCTCCAGAGTGGCAGCGAACGAACC Chs3bRNAi4as-P2: TTCCCCGCGGGGTTCGAGCTCTAATAAGAGCGACCAGAATAACACC Chs3bRNAi5as-P2: TGCTCCGCGGCGATCGAGCTTTAATTTCTTGAGAAACAGCACATG
[0041] SOE-PCR reaction system (total 50 μl): 10× LA PCR buffer 5 μl, 10 mM dNTP 4 μl, each of forward and reverse primers 1 μl, LATaq enzyme 0.5 μl, water q.s. to 48 μl; 95° C. 3 min; 95° C. 10 s, 56° C. 30 s, 72° C. 40 s, for 7 cycles; adding PDK intron and each of the reverse segments of Chs3b at a molar ratio of 1:1; 95° C. 10 s, 56° C. 30 s, 72° C. 40 s, for 35 cycles; extending at 72° C. for 10 min. The product of the PCR reaction recovered from gel was subjected to cleavage of restrict enzymes NotI and SacII and then ligated into the pBlue-Chs3b vectors carrying the forward segments, resulting in a pBlue-Chs3bRNAi vector carrying each of the segments. Then, Chs3b sense-PDK intron-Chs3b antisense hairpin loop structure was digested by SmaI and SacII, and then the product of the digestion was ligated into fungal transformation vectors to form pChs3bRNAi vectors carrying each of the segments (pChs3bRNAi-1, pChs3bRNAi-2, pChs3bRNAi-3, pChs3bRNAi-4 and pChs3bRNAi-5, see
[0042] 2) The five RNAi interference vectors were introduced into the protoplasts of Fusarium graminearum 5035 by using fungal protoplast transformation method (Maier et: al., Development of a highly efficient gene targeting system for Fusarium graminearum using the disruption of a polyketide synthase gene as a visible marker. FEN/IS Yeast Res. 2005. (5): 653-662). A promoter, Chs3bRNAi hairpin loop structure sequence, and terminator were incorporated into PLS gene site in a site-directed manner, which resulted in Fusarium graminearum strains Chs3bRNAi-1, Chs3bRNAi-2, Chs3bRNAi-3, Chs3bRNAi-4, and Chs3bRNAi-5.
Example 3
Screening for Effective RNAi Interfering Segments for Fusarium graminearum Chs3b Gene
[0043] 1. Osmotic Pressure Sensitivity Assay.
[0044] The following medium plates were prepared: FDA (potato 200 g, boiled for 15 min to obtain extract, to which glucose 20 g and agar 15 g were added, followed by distilled water to a total volume of 1000 ml, and sterilized at 121° C. for 20 min); PDA supplemented with 1.2 mol/L sorbitol and 0.025% (w/v) SDS; PDA supplemented with 1.2 mol/L NaCl; PDA supplemented with 6 mmol/L HCl; PDA supplemented with 1.43 mmol/L H.sub.2O.sub.2; and, PDA supplemented with 1.2 mol/L sorbitol. 7 ml of each of the media was added into a 6-cm dish. 10 μl of fresh conidium or ascospore liquid of each of the strains having a concentration of 5×10.sup.5/ml was seeded on the center of the medium plates, which were then placed in an incubator at 28° C. in dark for 3 days. Subsequently, the morphology of the colonies formed was observed. The results showed that: the strains Chs3bRNAi-1, Chs3bRNAi-3, and Chs3bRNAi-5 cultured in a PDA medium or in a PDA medium supplemented with various stressing agents showed the most significant decrease in biomass, followed by Chs3bRNAi-2 strain (
[0045] 2. Challenging at Seedling Stage and Flowering Stage.
[0046] 1) Challenging at seedling stage.
[0047] Mature seeds were sterilized on surface: treated with 70% (vol/vol) ethanol for 30 sec; washed once with sterilized water quickly; sterilized with 0.1% mercuric chloride for 6-8 min; washed with sterilized water for 3-4 times, 2 min each time. After sterilization, the seeds were placed with back up evenly in a plastic box covered with wet filter paper, and incubated at room temperature for 3 days for germination. The tips of the coleoptiles of the simultaneously budding seeds were cut off by 2-3 mm. 3 μL of Fusarium 5035 spore suspension (5×10.sup.5/mL) was applied at the wound of the coleoptiles, and then incubated at 25° C., 95% relative humidity, with 16 h light on, for 7 days. The plaques on the coleoptiles were photograghed and their length was measured.
[0048] 2) Challenging at flowering stage.
[0049] 10 μL of the suspension of Fusarium 5035 spores (5×10.sup.5/mL) was injected by a microsyringe between the outer rafter and inner rafter of a floweret outside the middle of the main ears of wheat grown well and uniformly at an early flowering stage, and kept wet at 25° C., 90% relative humidity or above for 3 days. Subsequently, a relative humidity of about 70% -80% was maintained by spraying water three times a day (in the morning, at noon, and in the evening). After 21 days, the number of ill spikelets and the total number of spikelets were investigated, and spikelet illness rate was calculated using the following equation:
[0050] The results were analysed for their differentiation by using Student's test and multiple comparison in variance analysis.
[0051] The analysis of the pathogenicity at seedling stage and at flowering stage showed that, the pathogenicity of the Fusarium graminearum was reduced especially for Segments 1, 2, 3, and 5 of Chs3b gene (reduction by 22-47% at seedling stage, and by 64-72% at flowering stage,
[0052] 3. Measuring Chitin Content
[0053] Formulation: 50 mg/ml N-acetylglucosamine: 250 mg of
[0054] N-acetylglucosamine was dissolved in ultrapure water to a final volume of 5 ml, divided into aliquots and stored at −20° C.; 6 mol/L HCl: ultrapure water was added to 51.72 ml of conc. HCl to a final volume of 100 ml; Solution A (1.5 mol/L Na.sub.2CO.sub.3 in 4% (v/v) acetylacetone): Na.sub.2CO.sub.3 15.9 g, 100% (v/v) acetylacetone (Sigma) 4 ml, dissolved in sterilized water to a final volume of 100 ml, and stored at 4° C.; Solution B (1.6 g of 4-dimethylaminobenzaldehyde in 30 ml conc. HCl and 30 ml 95% ethanol): 4-dimethylaminobenzaldehyde 1.6 g, dissolved in 30 ml of 95% ethanol, to which 30 ml of conc. HCl was added and gently stirred, the resulting solution was stored at 4° C.
[0055] Spores of each of the strains were colllected by centrifugation using centrifue tubes which had been pre-weighed, and washed twice with sterilized water. Supernatant was removed, and the spores left in the centrifue tubes were lyophilized, The centrifue tubes together with the spores therein were weighed, making sure that the net weight of the spores in the centrifue tubes is 5 mg. 1 ml of 6 mol/L HCl was added to the spores for acidolysis at 100° C. for 17 h. Samples were dried in a vacuum drier at 52° C. to remove HCl. The dried samples were redissolved in 1. ml of sterilized water. After thorough dissolution, centrifugation was performed to remove insoluble substances. To 100 μl of the resulting supernatant, 100 μl of Solution A was added and mixed. Then, the mixture was placed in a water bath and boiled at 100° C. for 20 min, The boiled sample was removed and allowed to cool to room temperature. Then, 700 μl of 95% (vol/vol) ethanol and 100 μl of Solution B were added and mixed thoroughly. The mixture was left at room temperature for 1 h, followed by measuring the OD.sub.520 value of the sample. There were 18 replicates for each strain. Chitin content was expressed as the percentage of the weight of the glucosamine released from the acidolysis accounting for the weight of the lyophilized hyphae or spores. The results showed that: chitin content decreased significantly (by 5.3-33% , P<0.01) with RNA interference for Segments 2and 5 of Chs3b gene as compared to wild-type strains (see,
Example 4
Construction and Genetic Transformation of Plant Chs3bRNAi Expression Vectors
[0056] 1. Construction of Plant Chs3bRNAi Expression Vectors.
[0057] The screening for effective RNAi interfering segments of Fusarium graminearum Chs3b gene showed that, the RNAi interfering effect of segments Chs3b-1, Chs3b-3 and Chs3b-5 was most significant. To confirm whether expression of dsRNA/siRNA against this target gene in plants by using HIGS technology can improve the resistance of transgenic wheat plants to Fusarium head blight, plant expression vectors of present invention, pXJC-Chs3bRNAi-1, pXJC-Chs3bRNAi-3, and pXJC-Chs3bRNAi-5, were constructed (see
[0058] 2. Wheat Genetic Transformation.
[0059] The plant expression vectors pXJC-Chs3bRNAi-1, pXJC-Chs3bRNAi-3, and pXJC-Chs3bRNAi-5 and a screening marker gene, bar, in minimum expression cassette, were co-transformed into a wheat plant “Yangmai 15” by a wheat genetic transformation method using gene gun. Resistant plants were obtained through immature embryo callus induction, gene gun bombardment, recovery culturing, differentiation screening, and rooting, sound seedling cultivation, and transplant. The specific process of the wheat genetic transformation was as follows:
[0060] 1) Taking off immature embryo and callus induction:
[0061] The ears of wheat were cut off 12-14 days after flowering, and uniform immature seeds were taken off from the middle part. The seeds were placed in a sterile flask in a laminar flow cabinet. To the seeds, an amount of 70% ethanol was added for sterilization for 30 sec. Then, the seeds were washed once quickly with sterilized water. Then, 0.1% mercuric chloride was added for sterilization for 6-8 min. Then, the seeds were washed with sterilized water for 3-4 times, 2 min for each time. The process was performed with the flask shaked continuously for thorough sterilization. Semi-transparent immature embryos (0.8-1.2 mm) were taked off under a sterile condition. The immature embryos were seeded into induction medium IMI with scutellum upward at 50-60 embryos per dish, and incubated at 27° C. in dark for 4-6 days.
[0062] 2) Hypertonic treatment:
[0063] Embryogenic calluses in a sound state were selected and transferred into hypertonic medium MSH in a circle having a diameter of about 2 cm. After 4-6 hours of hypertonic treatment, transformation was performed by gene gun bombardment, followed by further hypertonic treatment for 16-20 h and cultivation at 27° C. in dark.
[0064] 3) Gene gun bombardment:
[0065] Preparation of vector particles: 50 μL of a prepared suspension of gold powder (50 mg/mL) was dissolved at room temperature, and sonicated for 1 min; gold powder was mixed by vortex, then 5 μL of DNA (3 μg/μL) was added and mixed by vortex; thereafter, 50 μL of 2.5 mol/L CaCl.sub.2.2H.sub.2O (sterilized by suction filtration) and mixed by vortex; 20 μL of 0.1 mol/L spermidine (sterilized by suction filtration) was added slowly dropwise, with centrifuge tubes in continuous vortexing for 3 min; the tubes were then left in ice bath for 1.5 min; supernatant was removed by pipetting; 300 μL of 70% (vol/vol) ethanol was further added to resuspend the precipitant, and the resuspension was then left in ice bath for 15 min; supernatant was removed by pipetting; the precipitant was finally resuspended in 100 μL of absolute ethanol (10 μL/shot), vortexed to homogeneous and then applied onto particle supporting sheet, and air-dried in a laminar flow cabinet for subsequent gene gun bombardment.
[0066] Bombardment parameters: pressure: 1100 psi; distance: 9 cm; degree of vacuum: 27.5 inches number of bombardment: 1; the amount of gold powder used for each shot: 250 μg/shot; the amount of DNA used: 1.5 μg/shot.
[0067] 4) Recovery culturing:
[0068] After bombardment, the calluses were subjected to further hypertonic treatment for 16-20 h, and then transferred to induction medium MS1 for recovery culturing at 27° C. in dark for 2-3 weeks, followed by differentiation screening.
[0069] 5) Differentiation screening:
[0070] After recovery culturing, the calluses were transferred to differentiation screening medium MSB3 (3 mg/L Bialaphos) for a first run of differentiation screening at 22° C. in light for 16 h. After 2 weeks, the calluses having green spots were transferred to differentiation screening medium. MSBS (5 mg/L, Bialaphos) for a second run of differentiation screening. Regenerated seedlings (height>2 cm) were transferred to rooting screening medium MST5 (5 mg/L Bialaphos) in a straight tube or a triangle flask for 1-2 runs of further screening (2 weeks for each run).
[0071] 6) Seedling cultivation, vernalization and transplant:
[0072] After rooting screening, robust seedlings were transferred to seedling cultivation medium MST0 (without screening pressure) for 3-4 days and then placed at 4° C. for vernalization for 2 weeks, and then transplanted to green house (20-22° C., 16 h light on) for growing.
[0073] See Table 1 for the composition of the media.
TABLE-US-00005 TABLE 1 Media used in the wheat genetic transformation Medium Type Composition Induction medium MS + 0.1 g/L inositol + 0.5 g/L glutamine + 0.1 g/L casein hydrolysate + 30 g/L sucrose + 2 mg/L 2, 4-D + 2.7 g/L phytagel, pH 5.8 Hypertonic medium Induction medium + 0.2 mol/L mannitol + 0.2 mol/L sorbitol + 2.7 g/L phytagel, pH 5.8 Differentiation MS + 0.1 g/L, inositol + 30 g/L sucrose + screening medium 5 mg/L ZT + 3-5 mg/L Bialaphos + 2.7 g/L phytagel, pH 5.8 Rooting screening MS (major element reduced to a half level) + medium 0.1 g/L inositol + 20 g/L sucrose + 0.5 mg/L NAA + 5 mg/L Bialaphos + 2.7 g/L phytagel, pH 5.8 Seedling cultivation MS (major element reduced to a half level) + medium 0.1 g/L inositol + 20 g/L sucrose + 0.5 mg/L, NAA + 2.7 g/L, phytagel, pH 5.8
Example 5
PCR Assay of Chs3bRNAi Transgenic Wheat
[0074] To confirm whether the resistant plants thus obtained were positive transgenic plants, 2 stable transgenic plants, named R1 and R2 respectively, were obtained by PCR assay performed on the plants of T.sub.0-T.sub.5 generation. The results of PCR assay on the plants of T.sub.5 are shown in
[0075] 1. Extraction of Genomic DNA from Wheat (CTAB Method):
[0076] 1) Leaves of wheat at 3-4 leaf stage were placed in a 2-mL centrifuge tube containing a steel ball. After pre-cooling in liquid nitrogen, samples were ground using TissueLyser II (QIAGEN).
[0077] 2) To the samples, 900 μL of pre-heated CTAB buffer was added and mixed is to homogeneous, and left in water bath at 65° C. for 1 h, with the tubes upside down for 3-4 times.
[0078] 3) 305 μL of 5 mol/L, KAc and 225 μL of chloroform were added and mixed to homogeneous by upside down until the color of the bottom of the solution turned to dark green, for about 5 min, and left at −20° C. for 30 min.
[0079] 4) After centrifugation at 12000 r/min. for 15 min, 900 μL, of supernatant was transferred to a new centrifuge tube, to which 900 μL of PCI was added and mixed to homogeneous gently by reversing the tube for 5 min.
[0080] 5) After centrifugation at 12000 r/min. for 15 min, 800 μL, of supernatant was removed (white particle-like solid of protein at the interface of upper liquid and lower liquid should not be taken). To the supernatant, an equal volume of CI was added and mixed to homogeneous by reversing. Then, centrifugation was performed at 12000 r/min for 15 min to remove the remaining phenol.
[0081] 6) 700-800 μL, of supernatant was transferred from the centrifuge tube to a new 1.5-mL centrifuge tube, to which 0.8-fold volume of isopropanol and 0.1-fold volume of 3 mol/L NaAc were added and mixed by reversing and left at room temperature for 10 min.
[0082] 7) After centrifugation at 12000 r/min for 15 supernatant was removed, is and precipitant was washed with 500 μL of pre-cooled 70% (vol/vol) ethanol. After centrifugation at 12000 r/min for 5 min, supernatant was discarded.
[0083] 8) After air-drying at room temperature, an appropriate volume of TER (TE:RNAase=499:1) was added to dissolve DNA before storage at −20° C. for use.
[0084] 2. PCR Assay:
[0085] Reaction system: 2× Taq PCR Mix 10 μL, 0.5 μL, of 10 μmol/L each of forward and reverse primers (see, Table 2), template DNA 100-150 ng, ddR.sub.2O q.s. to 20 μL. Reaction procedure: pre-denaturing at 95° C. for 5 min; denaturing at 94° C. for 40 sec, annealing at 58° C. (annealing temperature depends on the primers employed) for 40 sec, extending at 72° C. for 30 sec (time for extension depends on the length of the fragment to be amplified, extending rate: generally 1 kb/min), for 35 cycles; further extending at 72° C. for 7 min. After PCR reaction, 1.0 μL of PCR product was subjected to electrophoresis (1% (w/v) agarose gel, 90 V, −40 min). The gel was photographed and recorded by using a UV imaging device.
TABLE-US-00006 TABLE 2 Primers for PCR amplification Annealing Size Primer site Sequence (5′-3′) (bp) ZJB Ubi promoter GTTTCTTTTGTCGATGCTC ACCC Chs3bR1 Chs3bRNAi-1 CCGACTCTGCCTTTGATCC 333.sup.a TG Chs3bR3 Chs3bRNAi-3 ATCTTGGTGGTGCTTGTGG 533.sup.b T Chs3bR5 Chs3bRNAi-5 GTCGCTCTTATTACCATTT 633.sup.c ACG .sup.aTarget fragment (333 bp) of Ubi-Chs3bRNAi-1 for PCR assay was amplified with primers ZJB and Chs3bR1 .sup.bTarget fragment (533 bp) of Ubi-Chs3bRNAi-3 for PCR assay was amplified with primers ZJB and Chs3 bR3 .sup.cTarget fragment (633 bp) of Ubi-Chs3bRNAi-5 for PCR assay was amplified with primers ZJB and Chs3bR5
Example 6
siRNA-Northern Blotting Assay of Chs3bRNAi Transgenic Wheat
[0086] To confirm whether siRNA was formed in the Chs3bRNAi transgenic wheat plants, the transgenic plants R1 and R2 as well as the negative control plants were tested by northern blotting (
[0087] 1. Extraction of Small RNA from the Transgenic pPlants (Purelink™ miRNA Isolation Kit)
[0088] 1) 0.1 g of leaf tissue of the plant was ground in liquid nitrogen into powder which was then transferred into a 1.5-mL centrifuge tube. Then, 300 μl of L3 was added and vortexed.
[0089] 2) Centrifugation was performed at room temperature at 12000 rpm for 2 min. Supernatant was transferred into a new centrifuge tube, to which, 300 μl of 70% (v/v) ethanol was added to a final concentration of 35%, with vortexing.
[0090] 3) The mixture solution was loaded onto a column, and then centrifuged at 12000 rpm for 1 min, with total RNA bound on the column. The liquid in the collective tube was preserved 4) To the collective tube, 96%-100% ethanol was added to a final concentration of 70% (i.e., 700 μL of 96% -100% ethanol was added to 600 μL of the solution), and then vortexed.
[0091] 5) 700 μL of the vortexed solution was loaded onto a second column, and then centrifuged at 12000 rpm for 1 min, with siRNA/miRNA bound on the column. The waste was discarded. This step may be repeated once.
[0092] 6) 500 μL of washing solution (W5) was added. Centrifugation was performed at 12000 rpm for 1 min. The waste was discarded. This step may be repeated once.
[0093] 7) Centrifugation was performed at a maximum rate of 13200 rpm for 2-3 min. Residual washing solution was discarded.
[0094] 8) The centrifuge column was placed into a 1.5-mL centrifuge tube. 50 μL of DEPC ddH.sub.2O (pH>7.0) was added for elution. The eluent was allowed to stand at room temperature for 1. min, centrifuged at a maximum rate for 1 min, and then stored at −80° C. for use.
[0095] 2. SDS-PAGE:
[0096] 1) Glass plates, comb, and tank to be used in electrophoresis were first washed with Liquinox washing agent, followed by DEPC H.sub.2O containing 10% (w/v) of SDS and then with 95% ethanol in DEPC H.sub.2O.
[0097] 2) The glass plates, comb, and tank were assembled.
[0098] 3) Electrophoresis buffer 0.5× TBE was prepared with DEPC H.sub.2O.
[0099] 4) 15% polyacrylamide gel (10 mL)
TABLE-US-00007 5 × IBE 1 mL 30% polyacrylamide 5 mL Urea 4.2 g DEPC H.sub.2O 0.75 mL
[0100] Urea was completely dissolved at 37° C. or room temperature. Then, 70 μL of 10% (w/v) APS and 3.5 μL of TEMED were added and mixed by reversing but no vortexing. The mixture was immediately poured into the gel plate. The comb was inserted into the plate. Polymerization was carried out for 30 min or more.
[0101] 5) Electrophoresis was pre-run at 100V for 30 min.
[0102] 6) To the RNA sample (30 μg), 2×RNA Loading buffer was added and mixed. After short centrifugation, the mixture was heated at 65° C. for 10 min. Thereafter the sample was immediately cooled on ice for 1 min and then loaded. Make sure each sample has an identical volume.
[0103] 7) Electrophoresis was performed at 100-150V until bromophenol blue (bottom dye) reached the lower quarter of the gel.
[0104] 3. Blot transferring (Bio-Rad Semi-dry)
[0105] 1) After the electrophoresis, the gel plate was removed and placed in 0.5×TBE to separate gel sheet with its part of loading holes discarded.
[0106] 2) 2 pieces of extra-thick whatman filter paper and 1 piece of nitrocellulose membrane (Hybond-N.sup.+ Amersham) were cut to have an identical size to the gel and soaked in 0.5×TBE for 5-10 min. 3) One filter paper, nitrocellulose membrane, gel, and the other filter paper were aligned from anode to cathode with no bubble therebetween.
[0107] 4) Transferring was performed at 400 mA for 45 min, and then the device was disassembled.
[0108] 5) The membrane was dried at room temperature and fixed using UV transmission crosslinking device (1200J×100) for subsequent hybridization or storage at 4° C.
[0109] 4. Pre-hybridization and Hybridization:
[0110] 1) The membrane was placed in a hybridization tube of an appropriate volume. To the tube, 5 mL of PerfectHyb™ plus buffer was added for pre-hybridization at 38° C. in a hybridization oven for at least 1 h.
[0111] 2) Preparation of probes: DNA segments were amplified by PCR, electrophoresed, and recovered from gel. Probes were radiolabelled using a random primers labeling kit (Takara). Labeling was performed as follows: to a 1.5-mL centrifuge tube, 150 ng of DNA segment and 2 μL of random primers were added, and then water was added to a volume of 17 μL; the mixture was boiled in boiling water for 5 ruin, then cooled in cold water for 8 min, and then centrifuged; 2.5 μL of 10× Buffer, 2.5 μL of dNTP, 2 μL of α-[.sup.32P]-dCTP, and 1 μL of DNA polymerase were added and incubated in water bath at 37° C. for 3 h.
[0112] 3) The labeled probes were boiled in boiling water for 5 min, then cooled in an ice bath for 10 ruin, and then added to a hybridization tube (direct addition on a membrane was not allowed). Hybridization was performed at 38° C. for about 16 h.
[0113] 5. Membrane Washing and Autoradiograph:
[0114] 1) Hybridization buffer was poured into a barrel for radioactive waste.
[0115] 1×SSC and 0.1% SDS were added into the hybridization tube, and rotated gently for washing the membrane for 2-3 times. The hybridizated membrane was transferred from the hybridization tube to a tray containing sufficient membrane washing solution (1×SSC and 0.1% SDS). The tray was shaked for 15 min. The second-time membrane washing solution was poured into a barrel for radioactive waste. Sufficient membrane washing solution (0.1×SSC and 0.1% SDS) was added, and shaked at 40° C. for 10-20 min. During washing, the membrane should be kept wet. The radioactivity of the membrane should be monitored through the washing. When radioactivity signal reduced significantly, the washing was stopped.
[0116] 2) The membrane was removed from the membrane washing solution and placed on clean filter paper. Most of liquid was removed (too dry was not allowed; no visible water spot would just be OK). The membrane was wrapped with a piece of preservative film. When the signal was 20-25 caps, the wrapped membrane was placed in an exposure folder and allowed to contact a phosphor screen with the membrane facing the white side for 3-12 h. Then, the phosphor screen was removed and imaged on a phosphor screen imager. The membrane was then washed with membrane washing solution (0.1×SSC and 0.1% SDS) for each time, and the signal was monitored until it was 8-15 caps. The time for exposure was correspondingly increased to 24-72 h.
Example 7
Identification of the Resistance of Chs3bRNAi Transgenic Wheat Plants to Diseases
[0117] To determine whether siRNA formed in the Chs3bRNAi transgenic wheat plants can inhibit the growth of invading Fusarium, the trait of the transgenic plants resistant to Fusarium head blight was confirmed by challenging at seedling stage and at flowering stage (see, Table 3 and
TABLE-US-00008 TABLE 3 Identification of the resistance of the Chs3bRNAi transgenic wheat plants to Fusarium head blight Plaque length Spikelet illness rate (challenging at seedling (challenging at flowering Genotype stage) (cm) stage) (%) R1 0.16 ± 0.03a 11.1 ± 1.71a R2 0.36 ± 0.11a 16.3 ± 2.04a Y15 1.45 ± 0.16b 36.9 ± 4.23b