MEDICAMENT DESIGN POCKET OF ORNITHINE DECARBOXYLASE AND APPLICATION OF MEDICAMENT DESIGN POCKET

20170314007 · 2017-11-02

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a medicament design pocket of ODC. Based on the crystal structure of human ODC, the binding site area of putrescine and PLP ligand on the ODC homodimer interface is the medicament pocket, which is used for screening or designing or modifying inhibitors of human ODC, or screening or designing or modifying inhibitors of non-human ODC, or screening or designing or modifying protein inhibitor highly homologous to the binding site of putrescine and pyridoxal phosphate on the interface of ODC homodimer. The invention also provides the structure of the inhibitor and its application thereof. The technical solutions in the invention provide reliable theoretical basis for the research and development of human ODC, the prevention, treatment and diagnosis of tumors and pathogenic microbial infections, and the research and development and preparation of medicaments for the treatment of tumors or pathogenic microbial infections.

Claims

1. A medicament design pocket of ornithine decarboxylase, wherein medicament molecules that inhibit the ornithine decarboxylase (ODC) activity are screened and designed using a binding site area of putrescine and PLP ligand on an ODC homodimer interface as a medicament pocket based on a crystal structure of human ODC, and after binding to the pocket, the medicament molecule may inhibit the formation of ODC dimer or form an inactive ODC dimer.

2. The application of the medicament design pocket of ODC according to claim 1 in screening or designing or modifying inhibitors of human ODC.

3. The application of the medicament design pocket of ODC according to claim 1 in screening or designing or modifying inhibitors of non-human ODC.

4. The application of medicament design pocket of the ODC according to claim 1 in screening or designing or modifying inhibitors highly homologous to the binding site of putrescine and pyridoxal phosphate on the ODC homodimer interface.

5. (canceled)

6. The inhibitor according to claim 1, wherein the medicament molecule is: ##STR00017##

7-16. (canceled)

17. A method of inhibiting ODC of the medicament molecule according to claim 6, comprising Step 1) construction of ODC prokaryotic expression plasmid, Step 2) ODC protein expression, Step 3) purification of ODC protein, Step 4) detection of ODC protein activity and Step 5) detection of inhibitory activity of inhibitor for ODC protein, wherein, in Step 1), ODC gene sequence is inserted into pET28a plasmid by BamH I and Xho I cleavage sites to construct pET28a-hODC plasmid, which is verified by DNA sequencing: in Step 2), the plasmid pET28a-hODC constructed in the step 1) is transformed into Escherichia coli BL21 strain by CaCl2 method and screened by kanamycin, and then strains grown on a kanamycin-containing Luria-Bertani (LB) culture plate are inoculated to kanamycin-containing LB liquid medium, cultured to logarithmic phase at 37° C. and 250 rpm, and then IPTG is added to 0.5 mM for induced expression 4 hours at 28° C., finally, centrifuged to collect bacteria; in Step 3), the bacteria collected in step 2) are re-suspended with lysate solution, then cells are lysed by an ultrasonic method; after lysis bufferis centrifuged at 12000 rpm/min at 4° C., a supernatant is retained; finally, the supernatant is bound and purified using Ni-NTA His labeled protein binding packing, to get ODC protein; the ODC protein elation buffer is 50 mM Tris/HCl, pH 8.0, 300 mM NaCl, 1 mM DTT, 100 mM imidazole; in Step 4), 400 μL substrate reaction mixture and 50 ug ODC protein are added to a first EP tube, mixed evenly, and the first EP tube is placed in 37° C. water bath for 30 min; 400 uL 10% PDA is added to terminate the reaction, centrifoged 5 min at 5000 rpm at room temperature, then 100 uL supernatant is fetched and mixed with 200 uL of 4 mol/L NaOH, 400 uL of n-amyl alcohol is added to mix well, centrifuged 5 mm at 2000 rpm, then 200 uL of the supernatant is transferred to a second EP tube, and 200 uL of 0.1 mol/L sodium tetraborate (pH 8.0) is added to mix evenly, and 200 uL of 10 mmol/L trinitrobenzene sulfonic acid is added to mix fully, and then 400 uL DMSO is added to fix folly for 1 min, centrifuged 5 min at 3000 rpm; finally the supernatant is fetched to 96-well plate and its absorbance at 426 nm is detected by a microplate reader, to get an OD value without adding enzyme; in Step 5), according to procedures in step 4), after adding 400 μL substrate reaction mixture, a small molecule ODC inhibitor is added immediately, and subsequent procedures ate the same as the step 4); ODC inhibition ratio is calculated according to following formula: control difference=mean OD value of a control group adding the inhibitor−mean OD value of a control group without adding inhibitor, of which, the inhibitor added in step 5) in the control group is DFMO inhibitor; experimental difference=mean OD value of an experiment group adding the small molecule inhibitor−mean OD value of an experiment group without adding the small molecule inhibitor, ODC inhibition ratio=[(control difference−experimental difference)/control difference]×100%.

18. The method according to claim 17, wherein the lysis buffer described in step 3) is a mixture of 50 mM Tris/HCl, pH 8.0, 300 mM NaCl, 1 mM DTT, 1 mM PMSF and 5mM imidazole.

19. The method according to claim 17, wherein the substrate reaction mixture in step 4) is a mixture that dissolves 17.57 ul β-mercaptoethanol 55.84 mg of 1.5 mM EDTA disodium salt, 75 nM PLP stock solution and 2 mM ornithine hydrochloride in 150 mM PBS (pH 7.1).

20. The method of claim 17, wherein the ODC is a human ODC, a non-human ODC or a protein highly homologous to a putrescine substrate and PLP binding site of human ODC.

21. (canceled)

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0046] FIG. 1 shows a schematic diagram of ODC homodimer.

[0047] FIG. 2 shows a schematic diagram of the binding site of ODC substrate putrescine and PLP.

[0048] FIG. 3 shows a schematic diagram of a medicament design pocket in the invention.

[0049] FIG. 4 shows a histogram of inhibitory activity of α-difluoromethylornithine (DFMO) inhibitor on human ODC.

[0050] FIG. 5 shows a histogram of inhibitory activity of 4-(2-3-dihydro-1H-pyrimidin-2-yl) benzonitrile inhibitor on human ODC.

[0051] FIG. 6 shows a model of binding of 4-(2-3-dihydro-1H-pyrimidin-2-yl) benzonitrile inhibitor and ODC.

[0052] FIG. 7 shows a histogram of inhibitory activity of ethyl-3-(benzoylamino) methyl benzoate inhibitor on human ODC.

[0053] FIG. 8 shows a model of binding of ethyl-3-(benzoylamino) methyl benzoate inhibitor and ODC.

[0054] FIG. 9 shows a histogram of inhibitory activity of 4-(dimethylamino)-benzaldehyde-(4,6-diamino-1,3,5) triazine inhibitor on human ODC.

[0055] FIG. 10 shows a model of binding of 4-(dimethylamino)-benzaldehyde-(4,6-diamino-1,3,5) triazine inhibitor and ODC.

[0056] FIG. 11 shows a histogram of inhibitory activity of 2-[(hydroxyimino) methyl]-1-[2-(4-methoxyphenyl) -2-oxoethyl] pyridinium inhibitor on human ODC.

[0057] FIG. 12 shows a model of binding of 2-[(hydroxyimino) methyl]-1-[2-(4-methoxyphenyl)-2-oxoethyl] pyridinium inhibitor and ODC.

DETAILED DESCRIPTION

Embodiment 1

[0058] In the present invention, the substrate and PLP ligand are analyzed based on human ODC crystal structure using Pocket protein medicament pocket analysis software, to establish a theoretical model of the protein pocket, then 190,000 small molecules in the SPECS medicament library are docked into the protein pocket model using the protein docking program DOCK, to screen out small molecules containing at least 15 non-hydrogen heavy-atoms, at least 2 hydrogen bonds, at least one hydrophobic center and docking score no more than -10; and then the above small molecules are docked to the above protein pocket for computation using the protein-small molecule docking program Autodock, and finally small molecules with docking score below -7are selected.

[0059] In the experimental validation, the inhibitor involved is 4-(2-3-dihydro-1H-pyrimidin-2-yl) benzonitrile.

[0060] In the present invention, the ODC inhibitor having a similar inhibitory effect that is obtained by side chain addition, deletion and fragment replenishment using 4-(2-3-dihydro-1H-pyrimidin-2-yl) benzonitrile as a parent body is not excluded.

[0061] In the following, the experimental procedure of inhibition is described by taking 4-(2-3-dihydro-1H-pyrimidin-2-yl) benzonitrile as an example.

[0062] The structure of 4-(2-3-dihydro-1H-pyrimidin-2-yl) benzonitrile:

##STR00013##

[0063] 1. Construction of Prokaryotic Expression Plasmid of Human ODC.

[0064] The gene sequence of human ODC is inserted in to pET28a plasmid by BamH I and Xho I cleavage sites, to construct pET28a-hODC plasmid, which is verified by DNA sequencing. The gene sequences of human ODC:

TABLE-US-00001 atgaacaactttggtaatgaagagtttgactgccacttcctcgatgaagg ttttactgccaaggacattctggaccagaaaattaatgaagtttcttctt ctgatgataaggatgccttctatgtggcagacctgggagacattctaaag aaacatctgaggtggttaaaagctctccctcgtgtcacccccttttatgc agtcaaatgtaatgatagcaaagccatcgtgaagacccttgctgctaccg ggacaggatttgactgtgctagcaagactgaaatacagttggtgcagagt ctgggggtgcctccagagaggattatctatgcaaatccttgtaaacaagt atctcaaattaagtatgctgctaataatggagtccagatgatgacttttg atagtgaagttgagttgatgaaagttgccagagcacatcccaaagcaaag ttggttttgcggattgccactgatgattccaaagcagtctgtcgtctcag tgtgaaattcggtgccacgctcagaaccagcaggctccttttggaacggg cgaaagagctaaatatcgatgttgttggtgtcagcttccatgtaggaagc ggctgtaccgatcctgagaccttcgtgcaggcaatctctgatgcccgctg tgtttttgacatgggggctgaggttggtttcagcatgtatctgcttgata ttggcggtggctttcctggatctgaggatgtgaaacttaaatttgaagag atcaccggcgtaatcaacccagcgttggacaaatactttccgtcagactc tggagtgagaatcatagctgagcccggcagatactatgttgcatcagctt tcacgcttgcagttaatatcattgccaagaaaattgtattaaaggaacag acgggctctgatgacgaagatgagtcgagtgagcagacctttatgtatta tgtgaatgatggcgtctatggatcatttaattgcatactctatgaccacg cacatgtaaagccccttctgcaaaagagacctaaaccagatgagaagtat tattcatccagcatatggggaccaacatgtgatggcctcgatcggattgt tgagcgctgtgacctgcctgaaatgcatgtgggtgattggatgctctttg aaaacatgggcgcttacactgttgctgctgcctctacgttcaatggcttc cagaggccgacgatctactatgtgatgtcagggcctgcgtggcaactcat gcagcaattccagaaccccgacttcccacccgaagtagaggaacaggatg ccagcaccctgcctgtgtcttgtgcctgggagagtgggatgaaacgccac agagcagcctgtgcttcggctagtattaatgtgtag.←

[0065] The aforesaid human ODC sequences used have a change of base compared with the sequences in the database (http://www.ncbi.nlm.nih.gov/nuccore/NM_002539.1)(The bold marked C is T in the database sequence, and the corresponding amino acid is changed from arginine to cysteine), but its activity is not affected.

[0066] 2. Expression of Human ODC Protein

[0067] The plasmid pET28a-hODC constructed is transformed into Escherichia coli BL21strain by CaCl.sub.2 method and screened by kanamycin, and then the strains grown on the kanamycin-containing Luria-Bertani (LB) culture plate are inoculated to kanamycin-containing LB liquid medium, cultured to logarithmic phase at. 37° C and 250 rpm, and then IPTG is added to 0.5 mM for induced expression 4 hours at 28° C., finally, centrifuged to collect bacteria;

[0068] 3. Purification of Human ODC Protein

[0069] The bacteria collected in the above step are re-suspended with lysis buffer (50 mM Tris/HCl, pH 8.0, 300 mM NaCl, 1 mM DTT, 1 mM PMSF, 5 mM imidazole), then cells are lysed by ultrasonic method. After lysis buffer is centrifuged at 12000 rpm/min at 4° C., the supernatant is retained; finally, the supernatant is bound and purified using Ni-NTA His labeled protein binding packing., to get human ODC protein. The ODC protein elation butter is 50 mM Tris/HCl, pH 8.0, 300 mM NaCl, 1 mM DTT 100 mM imidazole.

[0070] 4. Detection of ODC Protein Activity

[0071] 400 uL substrate reaction mixture (17.57 ul of β-mercaptoethanol, 55.84 mg of 1.5 mM EDTA disodium salt, 75 nM PLP stock solution, 2 mM ornithine hydrochloride are dissolved in 150 mM PBS (pH 7.1)) and 50 ug ODC protein are added to a 1.5 mL of EP tube, mixed evenly, and the EP tube is placed in 37° C water bath for 30 min; 400 uL 10% TDA is added to terminate the reaction, centrifuged 5 min at 5000 rpm at room temperature, then 100 uL supernatant is fetched and mixed with 200 uL of 4 mol/L NaOH, 400 uL of n-amyl alcohol is added to mix well, centrifuged 5 min at 2000 rpm then 200 uL of the supernatant is transferred to a new EP tube, and 200 uL of sodium tetraborate (0.1 mol/L, pH 8.0) is added to mix evenly, and 200 uL of 10 mmol/L trinitrobenzene sulfonic acid is added to mix fully, and then 400 uL DMSO is added to fix fully for 1 min, centrifuged 5 min at 3000 rpm, finally the supernatant is fetched to 96-well plate and its absorbance at 426 nm is detected by a microplate reader.

[0072] 5. Detection of Inhibitory Activity of 4-(2-3-dihydro-1H-pyrimidin-2-yl) Benzonitrile Inhibitor for Human ODC Protein.

[0073] According to the above detection steps, after adding 400 μL substrate reaction mixture, small molecule medicament is added and mixed immediately, aid subsequent procedures are the same.

[0074] The ODC inhibition ratio is calculated according to the following formula;

[0075] Control difference=the mean OD value of the control group adding the inhibitor−the mean OD value of the control group without adding inhibitor

[0076] Experimental difference=the mean OD value of the experiment group adding the inhibitor−the mean OD value of the experiment group without adding inhibitor

[0077] ODC inhibition ratio=[(control difference−experimental difference)/control difference]×100%.

[0078] FIG. 5 shows a histogram of inhibitory activity of 4-(2-3-dihydro-1H-pyrimidin-2-yl) benzonitrile inhibitor on human ODC. The results show that, this inhibitor has the ability to inhibit human ODC activity within the range of 1 nM-5 mM, and the higher the concentration, the stronger tire inhibitory ability.

[0079] FIG. 6 shows a binding model of 4-(2-3-dihydro-1H-pyrimidin-2-yl) benzonitrile inhibitor with ODC. As shown from the FIG., the black represents a chain of ODC homodimer, and the grey represents another chain. The small molecule medicament is shown as a rod-like model that binds to the dimer interface pocket. The residues that may be involved in the interaction within 4 angstroms around the small molecule medicament are marked to show the side chains.

Embodiment 2

[0080] The small molecule inhibitor involved, in the invention is ethyl-3-(benzoylamino) methyl benzoate inhibitor, having the structural formula as follows;

##STR00014##

[0081] In the embodiment the ODC inhibitor having a similar inhibitory effect that is obtained by side chain addition, deletion and fragment replenishment using this medicament as a parent body is not excluded.

[0082] The specific steps are the same as embodiment 1.

[0083] FIG. 7 shows a histogram of inhibitory activity of ethyl-3-(benzoylamino) methyl benzoate inhibitor on human ODC. By comparing the histogram of inhibitory activity of ethyl-3-(benzoylamino) methyl benzoate inhibitor with the DFMO inhibitor on human ODC, results show that the inhibitory capacity of 1 mM of this medicament (No. D17) on human ODC is equivalent to that of 2.5 mM DFMO.

[0084] FIG. 8 shows a binding model of ethyl-3-(benzamido) methyl benzoate inhibitor and ODC. As shown from the figure, the black represents a chain of ODC homodimer, and the grey represents another chain. The small molecule medicament is shown as a rod-like model that binds to the dimer interface pocket. The residues that may be involved in the interaction within 4 angstroms around the small molecule medicament are marked to show the side chains.

Embodiment 3

[0085] The small molecule inhibitor involved in the invention is 4-(dimethylamino)-benzaldehyde-(4,6-diamino-1,3,5) triazine inhibitor, having the structural formula as follows:

##STR00015##

[0086] In the embodiment, the ODC inhibitor having a similar inhibitory effect that is obtained by side chain addition, deletion and fragment replenishment using 4-(dimethylamino)-benzaldehyde-(4,6-diamino-1,3,5) triazine as a parent body is not excluded.

[0087] The specific steps are the same as embodiment 1.

[0088] By comparing the histogram of inhibitory activity of 4-(dimethylamino)-benzaldehyde-(4,6-diamino-1,3,5) triazine inhibitor with tire DFMO inhibitor on human ODC, results show that this medicament has inhibitory effect on human ODC activity within the concentration range of 1 nM-1 mM.

[0089] The results of binding model of 4-(dimethylamino)-benzaldehyde-(4,6-diamino-1,3,5) triazine inhibitor with ODC show that, the small molecule medicament is in a rod-like model. The two monomers of homodimer are displayed as black and light gray cartoon models respectively. The residues that may be involved in the interaction within 4 angstroms around the small molecule medicament are marked to show the side chains.

Embodiment 4

[0090] The small molecule inhibitor involved in the invention is 2-[(hydroxyimino)methyl]-1-[2-(4-methoxyphenyl)-2-oxoethyl] pyridinium inhibitor, having the structural formula as follows:

##STR00016##

[0091] In the embodiment, the ODC inhibitor having a similar inhibitory effect that is obtained by side chain addition, deletion and fragment replenishment using 2-[(hydroxyimino) methyl]-1-[2-(4-methoxyphenyl)-2-oxoethyl] pyridinium as a parent body is not excluded.

[0092] The specific steps ate the same as embodiment 1.

[0093] By comparing the histogram of inhibitory activity of 2-[(hydroxyimino) methyl]-1-[2-(4-methoxyphenyl)-2-oxoethyl] pyridinium inhibitor with the DFMO inhibitor on human ODC, results show that the inhibitory capacity of 1 mM of this medicament (No.D19) on human ODC is equivalent to that of 2.5 mM DFMO.

[0094] The results of binding model of 2-[(hydroxyimino) methyl]-1-[2-(4-methoxyphenyl)-2-oxoethyl] pyridinium inhibitor with ODC show that, the black represents a chain of ODC homodimer and the grey represents another chain; the small molecule medicament is in a rod-like model that binds to the dimer interface pocket. The residues that may be involved in the interaction within 4 angstroms around the small molecule medicament are marked to show the side chains.