TRIPLE TRANSGENIC PIGS SUITABLE FOR XENOGRAFT
20170311579 · 2017-11-02
Assignee
Inventors
Cpc classification
A01K2217/15
HUMAN NECESSITIES
A61P17/02
HUMAN NECESSITIES
A61K35/22
HUMAN NECESSITIES
A61K35/12
HUMAN NECESSITIES
A01K2267/025
HUMAN NECESSITIES
International classification
A61K35/12
HUMAN NECESSITIES
Abstract
The application provides methods of improving a rejection related symptom, reducing premature separation and methods of producing a compound of interest with an altered epitope profile are provided. Knockout pigs with a disrupted gene or genes, and porcine organs, tissues, and cells therefrom are provided.
Claims
1. A transgenic pig comprising a disrupted α(1,3)-galactosyltransferase, CMAH and β4GalNT2 gene in the nuclear genome of at least one cell of said pig, wherein expression of α(1,3)-galactosyltransferase, CMAH and β4GalNT2 is decreased as compared to a wild-type pig.
2. A porcine organ, tissue, transfusion product or cell isolated from said transgenic pig of claim 1.
3. The porcine organ, tissue or cell of claim 2, wherein said porcine organ, tissue, transfusion product or cell is selected from the group consisting of skin, heart, liver, kidneys, lung, pancreas, thyroid, small bowel, blood and components thereof.
4. The transgenic pig of claim 1 wherein when an organ, tissue, transfusion product or cell from said pig is transplanted into a human, a rejection related symptom is improved as compared to when an organ, tissue, transfusion product or cell from a wild-type pig is transplanted into a human.
5. The transgenic pig of claim 4 wherein when an organ, tissue, transfusion product or cell from said pig is transplanted into a human, said rejection related symptom is selected from the group comprising a cellular rejection response related symptom, a humoral rejection response related symptom, a hyperacute rejection related symptom, an acute humoral xenograft reaction rejection related symptom and an acute vascular rejection response related symptom.
6. The transgenic pig of claim 4 wherein when an organ, tissue, transfusion product or cell from said pig is transplanted into a human, thrombocytopenia is decreased as compared to when an organ, tissue, transfusion product or cell from a wild-type pig is transplanted into a human.
7. The transgenic pig of claim 1 wherein when a liver from said transgenic pig is exposed to human platelets, said liver exhibits reduced platelet uptake as compared to when a liver from a wild-type pig is exposed to human platelets.
8. A skin related product obtained from the transgenic pig of claim 1 wherein said skin related product exhibits reduced premature separation from a wound.
9. The skin related product of claim 8, wherein said wound is a human skin wound.
10. The transgenic pig of claim 4 wherein when a kidney from said transgenic pig is transplanted into a human, a rejection related symptom is decreased as compared to when a kidney from a wild-type pig is transplanted into a human.
11. A method of preparing transplant material for xenotransplantation into a human, the method comprising providing the transgenic pig of claim 1 as a source of said transplant material and wherein said transplant material is selected from the group consisting of organs, tissues, transfusion products and cells, and wherein said transplant material has a reduced level of αGal antigens, a reduced level of Neu5GC antigens and a reduced level of Sd.sup.a-like antigens.
12. A transgenic pig comprising a disrupted α(1,3)-galactosyltransferase, CMAH and β4GalNT2 gene in the nuclear genome of at least one cell of said pig, wherein the disruption of said α(1,3)-galactosyltransferase gene is selected from the group of disruptions comprising a 3 base pair deletion adjacent to a G to A substitution, a single base pair deletion, a single base pair insertion, a two base pair insertion, a six base pair deletion, a ten base pair deletion, a seven base pair deletion, an eight base pair insertion for a five base pair deletion, a five base pair insertion, an eleven base pair deletion and an eighteen base pair deletion; wherein the disruption of said CMAH gene is selected from the group of disruptions comprising a four base pair insertion, a one base pair deletion, a two base pair deletion, a three base pair deletion, a five base pair deletion, an eight base pair deletion, a twenty base pair deletion, an eleven base pair deletion, a twelve base pair deletion, a single base pair insertion, a two base pair insertion for single base pair deletion, a three base pair deletion for a four base pair insertion, a sixty-six base pair deletion and twelve base pair insertion, and a five base pair deletion with a one base pair substitution wherein the disruption of said β4GalNT2 gene is selected from the group of disruptions comprising a twelve base pair deletion, a five base pair deletion, a fourteen base pair deletion, a twelve base pair deletion and one base pair substitution, a 271 base pair deletion with a one base pair insertion, and a single base pair insertion, and wherein expression of α(1,3)-galactosyltransferase, CMAH and β4GalNT2 are decreased as compared to a wild-type pig, and when tissue from said transgenic pig is transplanted into a human, a hyperacute rejection related symptom is improved as compared to when tissue from a wild-type pig is transplanted into a human.
13. The transgenic pig of claim 12, wherein the disruption of said α(1,3)-galactosyltransferase gene is selected from the group comprising a five base pair deletion, a seven base pair deletion, and both a five base pair deletion and a seven base pair deletion, wherein the disruption of said CMAH gene is selected from the group of disruptions comprising a twelve base pair deletion and a four base pair substitution for a three base pair deletion, wherein the disruption of said β4GalNT2 gene is selected from the group of disruptions comprising a twelve base pair deletion, a five base pair deletion and a single base pair insertion, and wherein expression of α(1,3)-galactosyltransferase, CMAH and β4GalNT2 are decreased as compared to a wild-type pig, and when tissue from said transgenic pig is transplanted into a human, a hyperacute rejection related symptom is improved as compared to when tissue from a wild-type pig is transplanted into a human.
14. The transgenic pig of claim 12, wherein the disruption of the α(1,3)-galactosyltransferase gene is selected from the group of disruptions comprising an eleven base pair deletion and an eighteen base pair deletion, wherein the disruption of the CMAH gene is selected from the group of disruptions comprising a sixty-six base pair deletion/twelve base pair insertion and a five base pair deletion/one base pair substitution, wherein the disruption of the β4GalNT2 gene is selected from the group of disruptions comprising a fourteen base pair deletion, a twelve base pair deletion, and a 271 base pair deletion/1 base pair insertion, and wherein expression of α(1,3)-galactosyltransferase, CMAH and β4GalNT2 are decreased as compared to a wild-type pig, and when tissue from said transgenic pig is transplanted into a human, a hyperacute rejection related symptom is improved as compared to when tissue from a wild-type pig is transplanted into a human.
15. A method of increasing the duration of the period between when a human subject is identified as a subject in need of a human organ transplant and when the human organ transplant occurs, said method comprising providing an organ from a transgenic pig comprising a disrupted α(1,3)-galactosyltransferase, CMAH and β4GalNT2 gene in the nuclear genome of at least one cell of said pig, wherein expression of α(1,3)-galactosyltransferase, CMAH and β4GalNT2 in said pig is decreased as compared to a wild-type pig, and surgically attaching said organ from said transgenic pig to said human subject in a therapeutically effective manner.
16. The method of claim 15, wherein said organ from said transgenic pig is surgically attached internal to said human subject.
17. The method of claim 15, wherein said organ from said transgenic pig is surgically attached external to said human subject.
18. The method of claim 15, wherein said organ is directly or indirectly attached to said subject.
19. A method of increasing the duration of the period between when a human subject is identified as a subject in need of a human liver transplant and when said human liver transplant occurs, said method comprising providing a liver from a transgenic pig comprising a disrupted α(1,3)-galactosyltransferase, CMAH and β4GalNT2 gene in the nuclear genome of at least one cell of said pig, wherein expression of α(1,3)-galactosyltransferase, CMAH and β4GalNT2 in said pig is decreased as compared to a wild-type pig, and surgically attaching said liver from said transgenic pig to said human subject in a therapeutically effective manner.
20. A method of reducing premature separation of a skin related product from a human, comprising the steps of providing a transgenic pig comprising disrupted α(1,3)-galactosyltransferase, CMAH, and β4GalNT2genes wherein expression of α(1,3)-galactosyltransferase, CMAH and β4GalNT2 in said pig is decreased as compared to a wild-type pig, and preparing a skin related product from said transgenic pig.
21. A method of improving a hyperacute rejection related symptom in a human subject comprising transplanting porcine transplant material having reduced levels of αGal, Sda-like and Neu5GC antigens, into a subject in need of a transplant, wherein a hyperacute rejection related symptom is improved as compared to when porcine transplant material from a wild-type pig is transplanted into a human subject.
22. A cell culture reagent that exhibits an altered epitope profile wherein said cell culture reagent is isolated from a transgenic pig comprising disrupted α(1,3)-galactosyltransferase, CMAH, and β4GalNT2 genes and wherein expression of α(1,3)-galactosyltransferase, CMAH and β4GalNT2 in said transgenic pig is decreased as compared to a wild-type pig.
23. The cell culture reagent of claim 22, wherein said cell culture reagent is selected from the group comprising cell culture media, cell culture serum, cell culture additive and an isolated cell capable of proliferation.
24. The cell culture reagent of claim 22, wherein said cell culture reagent is isolated from a transgenic pig wherein the disruption of said α(1,3)-galactosyltransferase gene is selected from the group comprising a five base pair deletion, a seven base pair deletion, and both a five base pair deletion and a seven base pair deletion, wherein the disruption of said CMAH gene is selected from the group of disruptions comprising a twelve base pair deletion and a five base pair substitution for a three base pair deletion, wherein the disruption of said β4GalNT2 gene is selected from the group of disruptions comprising a twelve base pair deletion, a five base pair deletion and a single base pair insertion.
25. The cell culture reagent of claim 22, wherein said cell culture reagent is isolated from a transgenic pig wherein the disruption of said α(1,3)-galactosyltransferase gene is selected from the group comprising disruption of the α(1,3)-galactosyltransferase gene is selected from the group of disruptions comprising an eleven base pair deletion and an eighteen base pair deletion, wherein the disruption of the CMAH gene is selected from the group of disruptions comprising a sixty-six base pair deletion/twelve base pair insertion and a five base pair deletion/one base pair substitution, wherein the disruption of the β4GalNT2 gene is selected from the group of disruptions comprising a fourteen base pair deletion, a twelve base pair deletion/one base pair substitution, and a 271 base pair deletion/1 base pair insertion.
26. A method of producing a compound of interest with an altered epitope profile, said method comprising the steps of providing a cell culture reagent that exhibits an altered epitope profile wherein said cell culture reagent is isolated from a transgenic pig comprising disrupted α(1,3)-galactosyltransferase, CMAH, and β4GalNT2genes and wherein expression of α(1,3)-galactosyltransferase, CMAH and β4GalNT2 in said transgenic pig is decreased as compared to a wild-type pig, and incubating an isolated cell capable of expressing said compound of interest with said cell culture reagent; and wherein the level of Neu5Gc, Sd.sup.a-like or alphaGal epitopes on said compound of interest is lower than the level of said epitopes on said compound of interest when said compound of interest is produced from an isolated cell incubated with a cell culture reagent isolated from a wild-type pig.
27. The method of claim 26, wherein said compound of interest is selected from the group comprising glycolipids and glycoproteins.
28. The method of claim 27, wherein the compound of interest is a glycoprotein selected from the group of glycoproteins comprising antibodies, growth factors, cytokines, hormones and clotting factors.
29. The method of claim 26 wherein said cell culture reagent is isolated from a transgenic pig wherein the disruption of said α(1,3)-galactosyltransferase gene is selected from the group comprising a five base pair deletion, a seven base pair deletion, and both a five base pair deletion and a seven base pair deletion, wherein the disruption of said CMAH gene is selected from the group of disruptions comprising a twelve base pair deletion and a five base pair substitution for a three base pair deletion, wherein the disruption of said β4GalNT2 gene is selected from the group of disruptions comprising a twelve base pair deletion, a five base pair deletion and a single base pair insertion.
30. The method of claim 26 wherein said cell culture reagent is isolated from a transgenic pig wherein the disruption of said α(1,3)-galactosyltransferase gene is selected from the group of disruptions comprising an eleven base pair deletion and an eighteen base pair deletion, wherein the disruption of said CMAH gene is selected from the group of disruptions comprising a sixty-six base pair deletion/twelve base pair insertion and a five base pair deletion/one base pair substitution, wherein the disruption of said β4GalNT2 gene is selected from the group of disruptions comprising a fourteen base pair deletion, a twelve base pair deletion/one base pair substitution, and a 271 base pair deletion/1 base pair insertion, and wherein expression of α(1,3)-galactosyltransferase, CMAH and β4GalNT2 are decreased as compared to a wild-type pig.
31. A porcine transplant material for transplantation into a human, wherein said transplant material has a reduced level of αGal antigens, a reduced level of Sd.sup.a-like antigens and wherein said transplant material has a reduced level of Neu5Gc antigens.
32. A transgenic pig comprising a disrupted α(1,3)-galactosyltransferase, CMAH and β4GalNT2 gene in the nuclear genome of at least one cell of said pig, wherein expression of α(1,3)-galactosyltransferase, CMAH and β4GalNT2 is decreased as compared to a wild-type pig and wherein VVL binding is reduced.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0028]
[0029] Panel B presents portions of wild-type and disrupted CMAH genes for an exemplary triple transgenic pig. A portion of the wildtype (wt) CMAH gene is shown in the top line. The nucleotide sequences of both alleles of the comparable regions from the same triple transgenic pig are shown below the wild type sequence. The disrupted CMAH sequences of the triple transgenic pig include a twelve base pair deletion and a three base pair deletion/four base pair insertion. Dashes indicate the region of the nucleotide sequence in which the deletions occurred.
[0030] Panel C presents portions of wild-type and disrupted β4GalNT2 genes for an exemplary triple transgenic pig. A portion of the wildtype (wt) β4GalNT2 gene is shown in the top line. The nucleotide sequences of the comparable regions from the same exemplary triple transgenic pig are shown below the wild type sequence. As shown, the disrupted β4GalNT2 sequences of the triple transgenic pig include a single base pair insertion, a twelve base pair deletion and a five base pair deletion. Unlike the GGTA1 and CMAH sequences, three different alleles were detected. It is possible that the β4GalNT2 sequence occurs at more than one distinct locus in the porcine genome. Dashes indicate the region of the nucleotide sequence in which the β4GalNT2 deletions occurred.
[0031]
[0032]
[0033] The far left graphs depict data from a negative control (white) and cells incubated with IB4 lectin (dark). IB4 interacts with the alpha galactose linked carbohydrates created by the gene product of GGTA1. Curves with overlap between the control (negative) and experimental (positive) results are shown with gray. Wildtype cells incubated with IB4 show a distinct separate peak from unstained wildtype cells. Cells from the triple transgenic pig incubated with IB4 show no significant second peak, indicative of significantly reduced αGal linked carbohydrates.
[0034] The center graphs depict data from a negative control (white) and cells incubated with HD antibody (dark). The negative control was an irrelevant isotype control antibody. The HD antibody interacts with the Neu5Gc carbohydrate produced by the product of the CMAH gene. Curves with overlap between the control (negative) and experimental (positive) results are shown with gray. Wildtype cells incubated with HD antibody show a distinct separate peak from wildtype cells treated with an unrelated antibody. Cells from the triple transgenic pig incubated with HD antibody show no significant second peak, indicative of significantly reduced Neu5Gc epitope levels.
[0035] The far left graphs depict data from a negative control (white) and cells incubated with DBA lectin (dark). DBA lectin interacts with the carbohydrate structure produced by the gene product of β4GalNT2. Curves with overlap between the control (negative) and experimental (positive) results are shown with gray. Wildtype cells incubated with DBA show a distinct separate peak from unstained wildtype cells. Cells from the triple transgenic pig incubated with DBA show no significant second peak, indicative of significantly reduced carbohydrates produced by the gene product of β4GalNT2.
[0036] Panel B presents a scatter graph of results obtained from flow cytometry experiments to evaluate the relative binding of human IgG (X-axis) and IgM (Y-axis) in serum from 44 unique humans to PBMCs from various pig types. Results with PBMC from wildtype (WT) pigs are shown with open squares, results from single transgenic αGal disrupted (GGTA1.sup.−/−) pigs are shown with triangles, results from double transgenic CMAH/αGal disrupted (GGTA1.sup.−/− and CMAH.sup.−/−) pigs are shown with empty circles, and results from triple transgenic CMAH/αGal/B4GalNT2 disrupted (GGTA1.sup.−/− and CMAH.sup.−/− and β4GalNT2.sup.−/−) pigs are shown with solid circles. Results from triple transgenic CMAH/αGal/B4GalNT2 disrupted (GGTA1.sup.−/− and CMAH.sup.−/− and β4GalNT2.sup.−/−) pigs are clustered at low levels of IgM and IgG binding; a few data points indicate moderate IgG binding to triple transgenic cells.
[0037]
[0038]
[0039]
[0040]
[0041] Panel C shows the relative levels of IgM and IgG that eluted from each type of RBC after incubation with separate aliquots of the same serum as determined by mass spectroscopy. The AUC from the mass spectrometry analyses were all normalized to the values obtained for the total IgG or IgM binding to the autologous human red blood cells for each serum. Total antibody was calculated for IgG by summing the AUC for each isotype. Results from wildtype pig red blood cells (W), triple knockout pig red blood cells (B), and autologous human red blood cells (A) are shown. Autologous human red blood cells are from the same subject from which the tested serum was obtained.
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
DETAILED DESCRIPTION OF THE INVENTION
[0049] The present application provides transgenic pigs and porcine organs, tissues and cells for transplantation into a human that do not express the indicated pig genome encoded products and methods of making and using the same. In one embodiment the application provides a triple transgenic pig comprising disrupted α (1,3)-galactosyltransferase, β4GalNT2 and cytidine monophosphate-N-acetylneuraminic acid hydroxylase genes, wherein expression of functional α (1,3)-galactosyltransferase, β4GalNT2 and cytidine monophosphate-N-acetylneuraminic acid hydroxylase in the knockout pig is decreased as compared to a wild-type pig.
I. In General
[0050] In the specification and in the claims, the terms “including” and “comprising” are open-ended terms and should be interpreted to mean “including, but not limited to . . . ” These terms encompass the more restrictive terms “consisting essentially of” and “consisting of”.
[0051] As used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural reference unless the context clearly dictates otherwise. As well, the terms “a” (or “an”), “one or more” and “at least one” can be used interchangeably herein. It is also to be noted that the terms “comprising”, “including”, and “having” can be used interchangeably.
[0052] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications and patents specifically mentioned herein are incorporated by reference in their entirety for all purposes including describing and disclosing the chemicals, instruments, statistical analyses and methodologies which are reported in the publications which might be used in connection with the invention. All references cited in this specification are to be taken as indicative of the level of skill in the art. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.
II. Compositions and Methods
[0053] Transgenic animals suitable for use in xenotransplantation and methods of producing mammals suitable for use in xenotransplantation are provided. Specifically, the present application describes the production of triple transgenic pigs with decreased expression of alpha 1,3 galactosyltransferase (αGal), β 1,4 N-acetylgalactosaminyltransferase (β4GalNT2) and cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH).
[0054] In embodiments of the present invention, pigs and porcine organs, tissues and cells therefrom are provided in which the αGal, β4GalNT2 and CMAH genes are less active, such that the resultant αGal, β4GalNT2 and CMAH products no longer generate wild-type levels of α1,3-galactosyl epitopes, Sd.sup.a-like epitopes, or Neu5Gc on a cell surface, glycoprotein or glycolipid. In an alternative embodiment the αGal, β4GalNT2 and CMAH genes are inactivated in such a way that no transcription of the gene occurs. In various embodiments triple αGal/B4GalNT2/CMAH knockout pigs were made. Methods of making transgenic pigs, and the challenges thereto, are discussed in Galli et al 2010 Xenotransplantation 17(6) p. 397-410. Methods and cell cultures of the invention are further detailed below herein.
[0055] The term “transgenic mammal” refers to a transgenic mammal wherein a given gene has been altered, removed or disrupted. It is to be emphasized that the term is to be intended to include all progeny generations. Thus, the founder animal and all F1, F2, F3 and so on progeny thereof are included, regardless of whether progeny were generated by somatic cell nuclear transfer (SCNT) from the founder animal or a progeny animal or by traditional reproductive methods. By “single transgenic” is meant a transgenic mammal wherein one gene has been altered, removed or disrupted. By “double transgenic” is meant a transgenic mammal wherein two genes have been altered, removed or disrupted. By “triple transgenic” is meant a transgenic mammal wherein three genes have been altered, removed or disrupted. By “quadruple transgenic” is meant a transgenic mammal wherein four genes have been altered, removed or disrupted.
[0056] In principle, transgenic animals may have one or both copies of the gene sequence of interest disrupted. In the case where only one copy or allele of the nucleic acid sequence of interest is disrupted, the knockout animal is termed a “heterozygous transgenic animal”. The term “null” mutation encompasses both instances in which the two copies of a nucleotide sequence of interest are disrupted differently but for which the disruptions overlap such that some genetic material has been removed from both alleles, and instances in which both alleles of the nucleotide sequence of interest share the same disruption. In various embodiments disruptions of the three genes of interest may occur in at least one cell of the transgenic animal, at least a plurality of the animal's cells, at least half the animal's cells, at least a majority of animal's cells, at least a supermajority of the animal's cells, at least 70%, 75″, 80%, 85%, 90%, 95%, 98%, or 99% of the animal's cells.
[0057] The term “chimera”, “mosaic” or “chimeric mammal” refers to a transgenic mammal with a knockout in some of its genome-containing cells. A chimera has at least one cell with an unaltered gene sequence, at least several cells with an unaltered gene sequence or a plurality of cells with an unaltered sequence.
[0058] The term “heterozygote” or “heterozygotic mammal” refers to a transgenic mammal with a disruption on one of a chromosome pair in all of its genome containing cells.
[0059] The term “homozygote” or “homozygotic mammal” refers to a transgenic mammal with a disruption on both members of a chromosome pair in all of its genome containing cells. A “homozygous alteration” refers to an alteration on both members of a chromosome pair.
[0060] A “non-human mammal” of the application includes mammals such as rodents, sheep, dogs, ovine such as sheep, bovine such as beef cattle and milk cows, and swine such as pigs and hogs. Although the application provides a typical non-human animal (pigs), other animals can similarly be genetically modified.
[0061] A “mutation” is a detectable change in the genetic material in the animal that is transmitted to the animal's progeny. A mutation is usually a change in one or more deoxyribonucleotides, such as, for example adding, inserting, deleting, inverting or substituting nucleotides.
[0062] By “pig” is intended any pig known to the art including, but not limited to, a wild pig, domestic pig, mini pigs, a Sus scrofa pig, a Sus scrofa domesticus pig, as well as in-bred pigs. Without limitation the pig can be selected from the group comprising Landrace, Yorkshire, Hampshire, Duroc, Chinese Meishan, Chester White, Berkshire Goettingen, Landrace/York/Chester White, Yucatan, Bama Xiang Zhu, Wuzhishan, Xi Shuang Banna and Pietrain pigs. Porcine organs, tissues, cells or transfusion products are organs, tissues, devitalized animal tissues, cells or transfusion products from a pig.
[0063] The alpha 1,3 galactosyltransferase (αGal, GGTA, GGT1, GT, aGT, GGTA1, GGTA-1) gene encodes an enzyme (GT, αGal, α1,3 galactosyltransferase). Ensemble transcript ENSSSCG00000005518 includes the porcine GGTA1 nucleotide sequence. Functional α1,3 galactosyltransferase catalyzes formation of galactose-α1,3-galactose (αGal,Gal,Gal, gal1,3gal, gal1-3gal) residues on glycoproteins. The galactose-α1,3-galactose (αGal) residue is an antigenic epitope or antigen recognized by the human immunological system. Removing αGal from transgenic organ material does not eliminate the human immunological response to transplant of foreign material, suggesting an involvement of additional antibodies in the rapid immunological response to xenotransplant. (Mohiudden et al (2014), Am J. Transplantation 14:488-489 and Mohiudden et al 2014 Xenotransplantation 21:35-45). Disruptions of the αGal gene that result in decreased expression of functional αGal may include but are not limited to a 3 base pair deletion adjacent to a G to A substitution, a single base pair deletion, a single base pair insertion, a two base pair insertion, a six base pair deletion, a ten base pair deletion, a seven base pair deletion, an eight base pair insertions for a five base pair deletion, a five base pair insertion, an eleven base pair deletion, and an eighteen base pair deletion (see Table 1). The Crispr target sequence is in exon 3 of the gene, near the start codon.
[0064] The cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMP-Neu5Ac hydroxylase gene, CMAH) gene encodes an enzyme (CMAH). Functional CMAH catalyzes conversion of sialic acid N-acetylneuraminic acid (Neu5Ac) to N-glycolylneuraminic acid (Neu5Gc). The Neu5Gc residue is an antigenic epitope or antigen recognized by the human immunological system. The Ensembl database id Gene: ENSSSCG00000001099 includes the porcine CMAH nucleotide sequence, and the Crispr target area is near exon 6. Disruptions of the CMAH gene that result in decreased expression of functional CMAH may include but are not limited to a four base pair insertion, a one base pair deletion, a two base pair deletion, a three base pair deletion, a twenty base pair deletion, a five base pair deletion, an eight base pair deletion, an eleven base pair deletion, a twelve base pair deletion, a single base pair insertion, a two base pair insertion for single base pair deletion, a three base pair deletion for a four base pair insertion, a sixty-six base pair deletion/twelve base pair insertion, and a five base pair deletion/1 base pair substitution (see Table 1).
[0065] The β1,4 N-acetylgalactosaminyltransferase (B4GalNT2, β4GalNT2, B1,4GalNT2, β1,4GalNT2) gene encodes the β1,4 N-acetylgalactosaminyltransferase 2 glycosyltransferase (B4GalNT2). Functional B4GalNT2 produces Sd.sup.a-like glycans (Dall'Olio et al (2014) Biochemica Biophysica Acta 1840:443-453 and Blanchard et al (1983) JBC 258:7691-7685). B4GalNT2 is thought to be expressed in most humans; prior work suggested that only 5% of humans lack expression of functional B4GalNT2. Disruption of β4GalNT2 in pig cells significantly decreases crossmatching in more than 5% of the human samples tested; this result was unexpected. Sd.sup.a-like glycans may include Sd.sup.a and similar glycans related to blood type or blood group determination and gastro-intestinal cancer inhibition. The Ensembl database ENSSSCG00000030269 entry includes the β4GalNT2 cDNA and amino acid sequences. Genomic porcine β4GalNT2 spans multiple exons across approximately 40,000 base pairs and may occur at multiple loci. The CrispR target region utilized in these experiment is found in exon 2 and is CTGTATCGAGGAACACGCTT. Disruptions of the β4GalNT2 gene that result in decreased expression of functional β4GalNT2 may include, but are not limited to, a one base pair insertion, a twelve base pair deletion, a five base pair deletion, a fourteen base pair deletion, a twelve base pair deletion/one base pair substitution, a 271 base pair deletion/one base pair insertion.
TABLE-US-00001 TABLE 1 Examples of Disruptions of Genes of Interest in Viable Pigs with Decreased Functional Gene Product Disruption Class wildtype disruption Descriptor GGTA1-SEQ ID NO: 1 GGTA1- 3 base pair deletion GTCATCTTTTACATCATGGTGGAT GTCATCTTTTACATCATG___ adjacent to a G to A GATATCTCCAGGATGCC AAT GATATCTCCAGGATGCC substitution GGTA1- GGTA1- Single base pair CTTTTCCCAG GAGAAAATAAT CTTTTCCCAG deletion GAATGTCAAA GGAAGAGTGG TTCT GAGAAAATAAT GAATGT_AAA GGAAGAGTGG TTCT GGTA1- GGTA1- 6 base pair deletion CTTTTCCCAG GAGAAAATAAT CTTTTCCCAG GAATGTCAAA GGAAGAGTGG TTCT GAGAAAATAAT ______ CAAA GGAAGAGTGG TTCT GGTA1- GGTA1- 2 base pair insertion CTTTTCCCAG GAGAAAATAAT CTTTTCCCAG GAATGTCAAA GGAAGAGTGG TTCT GAGAAAATAAT GAATGTATCAAA_ _________ GGAAGAGTGG TTCT GGTA1- GGTA1- 10 base pair deletion CTTTTCCCAG GAGAAAATAAT CTTTTCCCAG GAATGTCAAA GGAAGAGTGG TTCT GAGAAAATAA_ _________ A GGAAGAGTGG TTCT GGTA1- GGTA1 7 base pair deletion CTTTTCCCAG GAGAAAATAAT CTTTTCCCAG GAATGTCAAA GGAAGAGTGG TTCT GAGAAAATAAT GAA_______ GGAAGAGTGG TTCT GGTA1- GGTA1 7 base pair deletion GAGAAAATAAT GAATGTCAAAGG GAGAAAATAAT G_______ AAGG GGTA1- GGTA1 8 base pair substitution CTTTTCCCAG GAGAAAATAAT CTTTTCCCAG for 5 base pair deletion GAATGTCAAA GGAAGAGTGG TTCT GAGAAAATAAT GAA GGAATAAT AA GGAAGAGTGG TTCT GGTA1- GGTA1- Single base pair CTTTTCCCAG GAGAAAATAAT CTTTTCCCAG insertion GAATGTCAAA GGAAGAGTGG TTCT GAGAAAATAAT GAATGTTCAAA GGAAGAGTGG TTCT GGTA1- GGTA1- 5 base pair insertion GAGAAAATAAT GAATGTCAAAGG GAGAAAATAAT_____ TCAAAGG GGTA1- GGTA1- 11 base pair deletion AGGAGAAAATAAT GAATGTCAAAGG AGGAGAAAATAAT AAGAGTGGTTCTGT GAAGAGTGGTTCTGT_________ GGTA1- GGTA1- 18 base pair deletion AGGAGAAAATAAT AGGAGAAAAT____________ GAATGTCAAAGGAAGAGTGGTTCTGT AGTGGTTCTGT CMAH-SEQ ID NO: 2 CMAH- 4 base pair insertion AAACTCCTGA ACTACAAGGC AAACTCCTGA TCGGCTGGTG AAGGA ACTACAAGGAA GGC TCGGCTGGTG AAGGA CMAH- CMAH- 2 base pair deletion CAGGCGTGAG TAAGGTACGT CAGGCGTGAG GATCTGTTGGA AGACAGTGA TAAGGTACGT GATC__ GATTCAGATGAT TTGGA AGACAGTGA GATTCAGATGAT CMAH- CAGGCGTGAG 8 base pair deletion CAGGCGTGAG TAAGGTACGT TAAGGTACGT G________ GATCTGTTGGA AGACAGTGA GA AGACAGTGA GATTCAGATGAT GATTCAGATGAT CMAH- CAGGCGTGAG 5 base pair deletion CAGGCGTGAG TAAGGTACGT TAAGGTACGT G GATCTGTTGGA AGACAGTGA TTGGA AGACAGTGA GATTCAGATGAT GATTCAGATGAT CMAH- CAGGCGTGAG 3 base pair deletion CAGGCGTGAG TAAGGTACGT TAAGGTACGT GA___ GATCTGTTGGA AGACAGTGA GTTGGA AGACAGTGA GATTCAGATGAT GATTCAGATGAT CMAH- CAGGCGTGAG 2 base pair insertion for CAGGCGTGAG TAAGGTACGT TAAGGTACGT single base pair deletion GATCTGTTGGA AGACAGTGA GATCACGTTGGA GATTCAGATGAT AGACAGTGA GATTCAGATGAT CMAH- CAGGCGTGAG 20 base pair deletion CAGGCGTGAG TAAGGTACGT TAAGGTACGT GAT_____ GATCTGTTGGA AGACAGTGA _____________ GATTCAGATGAT TCAGATGAT CMAH- CAGGCGTGAG 1 base pair insertion CAGGCGTGAG TAAGGTACGT TAAGGTACGT GATCTGTTGGA AGACAGTGA GATCTTGTTGGA GATTCAGATGAT AGACAGTGA GATTCAGATGAT CMAH- CAGGCGTGAG 1 base pair deletion CAGGCGT GAG TAAGGTACGT TAAGGTACGT GATCTGTTGGA AGACAGTGA GATC_GTTGGA GATTCAGATGAT AGACAGTGA GATTCAGATGAT CMAH CMAH 11 base pair deletion GAGTAAGGTACG TGATCTGTTGG GAGTAAGG___________ AAGACAGT TTGG AAGACAGT CMAH CMAH 12 base pair deletions GAGTAAGGTACG TGATCTGTTGG GAGTAAGGTACG TGA____________ AAGACAGT CAGT CMAH CMAH 3 base pair deletion 4 GAGTAAGGTACG GAGTAAGGTACG base pair insertion TGATCTGTTGGAAGACAGT TGAGTAAG TTGG AAGACAGT CMAH CMAH 66 base pair deletion, ATTAACCAAG GATCGAACAC ATTAACtctcaataactaa 12 base pair insertion CATCCTCTTG TCTCCCAGCT _________________ TGAGGTCCAT GCAGGCGT _________________ GAGTAAGGTACG TGATCTGTTGG AA GA--CTGTTGGAA CMAH CMAH 5 base pair deletion, 1 ATTAACCAAG GATCGAACAC ATTAACCAAG GgTCGAACAC base pair substitution CATCCTCTTG TCTCCCAGCT CATCCTCTTG TCTCCCAGCT TGAGGTCCAT GCAGGCGT TGAGGTCCAT GAGTAAGGTACG TGATCTGTTGG AA GCAGGCGTGA GTAAGGTACG TG____ TTGGAA B4 Gal NT2 SEQ ID NO:3- CTGTATCGAGG AACACG G 1 base pair insertion CTGTATCGAGG CTTCGGAACATAAA AACACGCTTCGGAACATAAA B4 Gal NT2 CTGTATCGAGG AAC A___________ 12 base pair deletion CTGTATCGAGG AACA TAAA CGCTTCGGAACATAAA B4 Gal NT2 B4 Gal NT2 5 base pair deletion CTGTATCGAGG CTGTATCGAGG AACACG_ _ AACACGCTTCGGAACATAAA GAACATAAA B4 Gal NT2 B4 Gal NT2 14 base pair deletion TCTGTATCGA GGAACACGCT TCTGTATCG- TCGGAACATA AAGAGTCCAA ---GAACATA AAGAGTCCAA CGCTCAGGACC CGCTCAGGACC B4 Gal NT2 B4 Gal NT2 12 base pair deletion, 1 TCTGTATCGA GGAACACGCT TCTGTATCGA GGAACA______ base pair substitution TCGGAACATA AAGAGTCCAA TA AAGAGCCCAA CGCTCAGGACC CGCTCAGGACC B4 Gal NT2 SEQ ID NO:4 B4 Gal NT2 271 nt deletion, 1 nt GATGGGTG AGTTGAAG AGACTGAA GATGGGTG AGTTGAAG insertion GTCTGTATC GAGGAACAC AGACTGAA GTCTGTATC //GCTTCGGAAC ATAAAGAG GAGGAACAC //_______// TCCAACGCT CAGGACCAA GAGCAAGCTT AAGCACCAT CGATATCTT TTGCACAGCA GAGGATCGA CAGACATCT CAAAAAGATC AGGGCTGTT GGGACACAA GAGAGCAAA CGCTGTTAAA AAGGAAACCA TAAAATAACC ATCTTTTCTG AGTATGTTAA AAAAGATTT CATTGTGCGA CATAGATGGG AATAGCAACT TGAGCAAAAA TGCAAGTCAA ACCTGTTTTGT ACACTACGTAT CAAAATTGAT TTCTTCCCAAA GCAAAAGAGA AAGAAAAGCA AAAATAAACC TAAGCAAACT// GAGCAAGCTT TTGCACAGCA AAGGAAACCA TAAAATAACC CAAAAAGATC
[0066] The phrase “disrupted gene” is intended to encompass insertion, interruption, or deletion of a nucleotide sequence of interest wherein the disrupted gene either encodes a polypeptide having an altered amino acid sequence that differs from the amino acid sequence of the endogenous sequence, encodes a polypeptide having fewer amino acid residues than the endogenous amino acid sequence or does not encode a polypeptide although the wild-type nucleotide sequence of interest encodes a polypeptide.
[0067] The present specification provides a transgenic animal with reduced expression of functional αGal, β4GalNT2 and CMAH genes. The animal can be any mammal suitable for xenotransplantation. In a specific embodiment, the animal is a pig. “CMAH/aGAL double knockouts”, “CMAH/αGAL DKO”, “CMAH/αGal”, “CMAH/αGal DKO”, “CMAH.sup.−/−/GAL.sup.−/−”, “αGal/CMAH DKOs”, “αGAL/CMAH double knockouts”, “GGTA1/CMAH DKO”, “GT1/CMAH DKO”, “GGTA1.sup.−/−/CMAH.sup.−/−”, “GGT1.sup.−/−/CMAH.sup.−/−”, “CMAH/GGTA DKO”, “GT/CMAH-KO”, “GGTA1/CMAH KO”, “DKO (αGal/CMAH)”, “DKO (αGAL & CMAH)”, “CMAH-/αGal”, “αGal-/CMAH-”, “CMAH-/αGAL-” and variants thereof refer to transgenic animals, cells, or tissues that lack expression of functional alpha 1,3 galactosyltransferase and cytidine monophosphate-N-acetylneuraminic acid hydroxylase. A triple knockout product or pig may be created in a wild-type background or in a CMAH/αGal double knockout background. “CMAH/αGAL/B4GalNT2 triple knockouts”, “CMAH/αGAL/β4GalNT2 triple knockouts”, “CMAH/αGAL/B4GalNT2 TKO”, “CMAH/αGal/β4GalNT2”, “CMAH/αGal/B4GalNT2 TKO”, “CMAH.sup.−/−/GAL.sup.−/−/B4GalNT2.sup.−/−”, “αGal/CMAH/β4GalNT2 TKOs”, “αGAL/CMAH/β4Gal triple knockouts”, “GGTA1/CMAH/B4GalNT2 TKO”, “GT1/CMAH/β4GalNT2 TKO”, “GGTA1.sup.−/−/CMAH.sup.−/−/β4GalNT2.sup.−/−”, “GGT1.sup.−/−/CMAH.sup.−/−/β4GalNT2.sup.−/−”, “CMAH/GGTA/β4GalNT2 TKO”, “GT/CMAH/β4GalNT2-KO”, “GGTA1/CMAH/β4GalNT2 KO”, “TKO (αGal/CMAH/β4GalNT2)”, “TKO (αGAL, CMAH, β4GalNT2)”, “CMAH-/αGal-/β4GalNT2-”, “αGal-/CMAH-/β4GalNT2-”, “CMAH-/αGAL-β4GalNT2-” and variants thereof refer to transgenic animals, cells, or tissues that lack expression of functional alpha 1,3 galactosyltransferase, cytidine monophosphate-N-acetylneuraminic acid hydroxylase and β4GalNT2.
[0068] Transgenic transplant material. Transplant material encompasses organs, tissue, transfusion products and/or cells from an animal for use as xenografts. Transplant material for use as xenografts may be isolated from transgenic animals with decreased expression of αGal, β4GalNT2 and CMAH. Transgenic transplant material from transgenic or knockout pigs can be isolated from a prenatal, neonatal, immature or fully mature transgenic animal. The transplant material may be used as temporary or permanent organ replacement for a human subject in need of an organ transplant. Any porcine organ can be used including, but not limited to, the brain, heart, lungs, eye, stomach, pancreas, kidneys, liver, intestines, uterus, bladder, skin, hair, nails, ears, glands, nose, mouth, lips, spleen, gums, teeth, tongue, salivary glands, tonsils, pharynx, esophagus, large intestine, small intestine, small bowel, rectum, anus, thyroid gland, thymus gland, bones, cartilage, tendons, ligaments, suprarenal capsule, skeletal muscles, smooth muscles, blood vessels, blood, spinal cord, trachea, ureters, urethra, hypothalamus, pituitary, pylorus, adrenal glands, ovaries, oviducts, uterus, vagina, mammary glands, testes, seminal vesicles, penis, lymph, lymph nodes and lymph vessels.
[0069] In another embodiment, the application provides non-human tissues that are useful for xenotransplantation. In various embodiments, the non-human tissue is porcine tissue from a triple αGal/CMAH/β4GalNT2 transgenic pig. Any porcine tissue can be used including but not limited to, epithelium, connective tissue, blood, bone, cartilage, muscle, nerve, adenoid, adipose, areolar, brown adipose, cancellous muscle, cartilaginous, cavernous, chondroid, chromaffin, dartoic, elastic, epithelial, fatty, fibrohyaline, fibrous, Gamgee, gelatinous, granulation, gut-associated lymphoid, skeletal muscle, Haller's vascular, indifferent, interstitial, investing, islet, lymphatic, lymphoid, mesenchymal, mesonephric, multilocular adipose, thymus tissue, mucous connective, myeloid, nasion soft, nephrogenic, nodal, osteoid, osseus, osteogenic, bone marrow, retiform, periapical, reticular, smooth muscle, hard hemopoietic and subcutaneous tissue, devitalized animal tissues including heart valves, skin, and tendons, and vital porcine skin.
[0070] Another embodiment provides cells and cell lines from porcine triple transgenic animals with reduced or decreased expression of αGal, B4GalNT2 and CMAH. In one embodiment these cells or cell lines can be used for xenotransplantation. Cells from any porcine tissue or organ can be used including, but not limited to: epithelial cells, fibroblast cells, neural cells, keratinocytes, hematopoietic cells, melanocytes, chondrocytes, lymphocytes (B and T), macrophages, monocytes, mononuclear cells, cardiac muscle cells, other muscle cells, granulosa cells, cumulus cells, epidermal cells, endothelial cells, Islet of Langerhans cells, pancreatic insulin secreting cells, bone cells, bone precursor cells, neuronal stem cells, primordial stem cells, hepatocytes, aortic endothelial cells, microvascular endothelial cells, fibroblasts, liver stellate cells, aortic smooth muscle cells, cardiac myocytes, neurons, Kupferr cells, smooth muscle cells, Schwann cells, erythrocytes, platelets, neutrophils, lymphocytes, monocytes, eosinophils, basophils, adipocytes, chondrocytes, pancreatic islet cells, thyroid cells, thymus cells, parathyroid cells, parotid cells, glial cells, astrocytes, red blood cells, white blood cells, macrophages, somatic cells, pituitary cells, adrenal cells, hair cells, bladder cells, kidney cells, retinal cells, rod cells, cone cells, heart cells, pacemaker cells, spleen cells, antigen presenting cells, memory cells, T cells, B cells, plasma cells, muscle cells, ovarian cells, uterine cells, prostate cells, vaginal epithelial cells, sperm cells, testicular cells, germ cells, egg cells, leydig cells, peritubular cells, sertoli cells, lutein cells, cervical cells, endometrial cells, mammary cells, follicle cells, mucous cells, ciliated cells, nonkeratinized epithelial cells, keratinized epithelial cells, lung cells, goblet cells, columnar epithelial cells, dopaminergic cells, squamous epithelial cells, osteocytes, osteoblasts, osteoclasts, bone marrow, embryonic stem cells, fibroblasts and fetal fibroblasts.
[0071] Nonviable derivatives include tissues stripped of viable cells by enzymatic or chemical treatment these tissue derivatives can be further processed through crosslinking or other chemical treatments prior to use in transplantation. In a preferred embodiment, the derivatives include extracellular matrix derived from a variety of tissues, including skin, bone, urinary, bladder or organ submucosal tissues. In addition, tendons, joints, and bones stripped of viable tissue to including but not limited to heart valves and other nonviable tissues as medical devices are provided. In an embodiment, serum or medium suitable for cell culture and isolated from a transgenic pig of the invention are provided. Components of porcine transgenic organs, tissues or cells are also provided. Components may also be modified through any means known in the art including but not limited to crosslinking and aldehyde crosslinking. Components may vary depending on the larger organ or tissue from which the component is obtained. Skin components may include but are not limited to stripped skin, collagen, epithelial cells, fibroblasts and dermis. Bone components may include but are not limited to collagen and extracellular matrix. Heart components may include but are not limited to valves and valve tissue.
[0072] “Xenotransplantation” encompasses any procedure that involves the transplantation, implantation or infusion of cells, tissues or organs into a recipient subject from a different species. Xenotransplantation in which the recipient is a human is particularly envisioned. Thus xenotransplantation includes but is not limited to vascularized xenotransplant, partially vascularized xenotransplant, unvascularized xenotransplant, xenodressings, xenobandages, xenostructures and xenotransfusions.
[0073] In embodiments, cell culture reagents isolated from a transgenic pig comprising disrupted α(1,3)-galactosyltransferase, β4GalNT2 and CMAH genes are provided. Cell culture reagents are reagents utilized for tissue culture, in vitro tissue culture, microfluidic tissue culture, cell culture or other means of growing isolated cells or cell lines. Cell culture reagents may include but are not limited to cell culture media, cell culture serum, a cell culture additive, a feeder cell, and an isolated cell capable of proliferation. By an “isolated cell capable of proliferation” is intended a cell isolated or partially isolated from other cell types or other cells wherein the cell is capable of proliferating, dividing or multiplying into at least one additional clonal cell.
[0074] Cells grown in culture may synthesize or metabolically incorporate antigenic epitopes into a compound of interest produced by the cultured cell. The antigenic epitopes may result in increased binding by human antibodies and decreased efficacy of the compound of interest. See Ghaderi et al 2010 Nature Biotechnology 28(8):863-867, herein incorporated by reference in its entirety. Growing the producing cell in a cell culture reagent with an altered epitope profile such as a reduced level of αGal, B4GalNT2 or Neu5Gc may reduce the level of αGal antigens, Neu5Gc antigens, and/or Sd.sup.a-like antigens, on the compound of interest. Compounds of interest may include but are not limited to glycoproteins and glycolipids. Glycoproteins of interest may include but are not limited to an antibody, growth factor, cytokine, hormone or clotting factor. Glycolipids of interest may include but are not limited to therapeutics, antigens, and biosurfactants.
[0075] The word “providing” is intended to encompass preparing, procuring, getting ready, making ready, supplying or furnishing. It is recognized that methods of providing a cell may differ from methods of providing a subject, methods of providing an organ may differ from methods of providing a pig, methods of providing a kidney may differ from methods of providing a liver and methods of providing an organ may differ from methods of providing a material suitable for transfusion.
[0076] Transplant rejection occurs when transplanted tissue, organs, cells or material are not accepted by the recipient's body. In transplant rejection, the recipient's immune system attacks the transplanted material. Multiple types of transplant rejection exist and may occur separately or together. Rejection processes included but are not limited to hyperacute rejection (HAR), acute humoral xenograft rejection reaction (AHXR), thrombocytopenia, acute humoral rejection, hyperacute vascular rejection, antibody mediated rejection and graft versus host disease. By “hyperacute rejection” we mean rejection of the transplanted material or tissue occurring or beginning within the first 24 hours post-transplant involving one or more mechanisms of rejection. Rejection encompasses but is not limited to “hyperacute rejection”, “humoral rejection”, “acute humoral rejection”, “cellular rejection” and “antibody mediated rejection”. The acute humoral xenograft reaction (AHXR) is characterized by a spectrum of pathologies including, but not limited to, acute antibody mediated rejection occurring within days of transplant, the development of thrombotic microangiopathy (TMA), microvascular angiopathy, pre-formed non-Gal IgM and IgG binding, complement activation, microvascular thrombosis and consumptive thrombocytopenia within the first few weeks post transplant. Thrombocytopenia is a quantity of platelets below the normal range of 140,000 to 440,000/μl. Thrombocytopenia related symptoms include, but are not limited to, internal hemorrhage, intracranial bleeding, hematuria, hematemesis, bleeding gums, abdominal distension, melena, prolonged menstruation, epistaxis, ecchymosis, petechiae or purpura. Uptake of human platelets by pig livers contributes to the development of thrombocytopenia in xenograft recipients. Thrombocytopenia may occur upon reperfusion of the xenotransplanted organ or after the immediate post-reperfusion period.
[0077] In another embodiment, the invention provides a method of improving a rejection related symptom in a patient comprising transplanting porcine organs, tissue or cells having reduced expression of αGal, β4GalNT2 and Neu5Gc on the porcine organs, tissue or cells into a human, wherein one or more rejection related symptoms is improved as compared to when tissue from a wild-type swine is transplanted into a human. By “improving”, “bettering”, “ameliorating”, “enhancing”, and “helping” is intended advancing or making progress in what is desirable. It is also envisioned that improving a rejection related symptom may encompass a decrease, lessening, or diminishing of an undesirable symptom. It is further recognized that a rejection related symptom may be improved while another rejection related symptom is altered. The altered second rejection related symptom may be improved or increased. A second altered rejection related symptom may be altered in a less desirable manner. Rejection related symptoms include but are not limited to hyperacute rejection related symptoms and acute humoral xenograft reaction related symptoms. Rejection related symptoms may include, but are not limited to, thrombotic microangiopathy (TMA), microvascular angiopathy, pre-formed non-Gal IgM and IgG binding, complement activation, agglutination, fibrosis, microvascular thrombosis, consumptive thrombocytopenia, consumptive coagulopathy, profound thrombocytopenia, refractory coagulopathy, graft interstitial hemorrhage, mottling, cyanosis, edema, thrombosis, necrosis, fibrin thrombi formation, systemic disseminated intravascular coagulation, IgM deposition in glomerular capillaries, IgG deposition in glomerular capillaries, elevated creatinine levels, elevated BUN levels, T cell infiltrate, infiltrating eosinophils, infiltrating plasma cells, infiltrating neutrophils, arteritis, antibody binding to endothelium, altered expression of ICOS, CTLA-4, BTLA, PD-1, LAG-3, or TIM-3, and systemic inflammation.
[0078] “Hyperacute rejection related symptom” is intended to encompass any symptom known to the field as related to or caused by hyperacute rejection. It is recognized that hyperacute rejection related symptoms may vary depending upon the type of organ, tissue or cell that was transplanted. Hyperacute rejection related symptoms may include, but are not limited to, thrombotic occlusion, hemorrhage of the graft vasculature, neutrophil influx, ischemia, mottling, cyanosis, edema, organ failure, reduced organ function, necrosis, glomerular capillary thrombosis, lack of function, hemolysis, fever, clotting, decreased bile production, asthenia, hypotension, oliguria, coagulopathy, elevated serum aminotransferase levels, elevated alkaline phosphatase levels, jaundice, lethargy, acidosis and hyperbilirubenemia and thrombocytopenia.
[0079] Thrombocytopenia is a quantity of platelets below the normal range of 140,000 to 440,000/μl. Thrombocytopenia related symptoms include, but are not limited to, internal hemorrhage, intracranial bleeding, hematuria, hematemesis, bleeding gums, abdominal distension, melena, prolonged menstruation, epistaxis, ecchymosis, petechiae or purpura. Uptake of human platelets by pig livers contributes to the development of thrombocytopenia in xenograft recipients.
[0080] Platelets, also known as thrombocytes, are enucleate fragments of megakaryocytes involved in blood coagulation, hemostasis and blood thrombus formation. Human platelets are routinely isolated through a variety of methods including, but not limited to, platelet apheresis, plateletpheresis and ultracentrifugation.
[0081] The phrase “platelet uptake” is intended to encompass the incorporation of a platelet into a liver or liver cell. While not being limited by mechanism, such uptake may occur through a phagocytic process. Platelet uptake may be monitored by any platelet uptake monitoring assay known in the art. Platelet uptake monitoring assays include, but are not limited to immunological methods, western blots, immunoblotting, microscopy, confocal microscopy, transmission electron microscopy and phagosome isolation. It is recognized that the appropriate platelet uptake monitoring assay may depend upon the type of label used. Platelet uptake may be measured as a percentage of total platelets absorbed, percentage of total platelets not absorbed, a ratio of absorbed to unabsorbed platelets, percentage of cells absorbing at least one platelet, percentage of cells not absorbing a platelet, or number of platelets absorbed per cell. It is recognized that platelet uptake by more than one cell type may contribute to the total platelet uptake of the liver. Total platelet uptake by an animal liver may include platelet uptake by liver sinusoidal endothelial cells, platelet uptake by Kuppffer cells, platelet uptake by LSECs and Kupffer cells and platelet uptake by additional cell types. It is recognized that platelet uptake by different cell types may contribute similar or disparate fractions of the total platelet uptake by a liver. Thus an alteration, inhibition, reduction, decrease, or lowering of platelet uptake by a liver comprises an alteration, inhibition, reduction, decrease, or lowering of platelet uptake by one or more liver cell types.
[0082] While not being limited by mechanism, platelet uptake may occur through phagocytosis by LSEC and Kupffer cells. Phagocytosis is characterized by the formation of an endosome which by the fusion of lysosomes containing degradative enzymes becomes a phagosome.
[0083] Any method of evaluating, assessing, analyzing, measuring, quantifying, or determining a rejection related symptom known in the art may be used with the claimed compositions and methods. Methods of analyzing a rejection related symptom may include, but are not limited to, laboratory assessments including CBC with platelet count, coagulation studies, liver function tests, flow cytometry, immunohistochemistry, standard diagnostic criteria, immunological methods, western blots, immunoblotting, microscopy, confocal microscopy, transmission electron microscopy, IgG binding assays, IgM binding assays, expression asays, creatinine assays and phagosome isolation.
[0084] Expression of a gene product is decreased when total expression of the gene product is decreased, a gene product of an altered size is produced or when the gene product exhibits an altered functionality. Thus if a gene expresses a wild-type amount of product but the product has an altered enzymatic activity, altered size, altered cellular localization pattern, altered receptor-ligand binding or other altered activity, expression of that gene product is considered decreased. Expression may be analyzed by any means known in the art including, but not limited to, RT-PCR, Western blots, Northern blots, microarray analysis, immunoprecipitation, radiological assays, polypeptide purification, spectrophotometric analysis, Coomassie staining of acrylamide gels, ELISAs, 2-D gel electrophoresis, in situ hybridization, chemiluminescence, silver staining, enzymatic assays, ponceau S staining, multiplex RT-PCR, immunohistochemical assays, radioimmunoassay, colorimetric assays, immunoradiometric assays, positron emission tomography, fluorometric assays, fluorescence activated cell sorter staining of permeablized cells, radioimunnosorbent assays, real-time PCR, hybridization assays, sandwich immunoassays, flow cytometry, SAGE, differential amplification or electronic analysis. Expression may be analyzed directly or indirectly. Indirect expression analysis may include but is not limited to, analyzing levels of a product catalyzed by an enzyme to evaluate expression of the enzyme. See for example, Ausubel et al, eds (2013) Current Protocols in Molecular Biology, Wiley-Interscience, New York, N.Y. and Coligan et al (2013) Current Protocols in Protein Science, Wiley-Interscience New York, N.Y. Gene expression assays for porcine ASGR1 are commercially available (Applied Biosystems™, Carlsbad Calif.).
[0085] “As compared to” is intended encompass comparing something to a similar but different thing, such as comparing a data point obtained from an experiment with a transgenic pig to a data point obtained from a similar experiment with a wildtype pig. The word “comparing” is intended to encompass examining character, qualities, values, quantities, or ratios in order to discover resemblances or differences between that which is being compared. Comparing may reveal a significant difference in that which is being compared. By “significant difference” is intended a statistically significant difference in results obtained for multiple groups such as the results for material from a transgenic pig and material from a wild-type pig. Generally statistical significance is assessed by a statistical significance test such as but not limited to the student's t-test, Chi-square, one-tailed t-test, two-tailed t-test, ANOVA, Dunett's post hoc test, Fisher's test and z-test. A significant difference between two results may be results with a p<0.1, p<0.05, p<0.04, p<0.03, p<0.02, p<0.01 or greater.
[0086] The word “isolated” is intended to encompass an entity that is physically separated from another entity or group. An isolated cell is physically separated from another group of cells. Examples of a group of cells include, but are not limited to, a developing cell mass, a cell culture, a cell line, a tissue, and an animal. The word “isolating” is intended to encompass physically separating an entity from another entity or group. Examples include physically separating a cell from other cells, physically separating a cell component from the remainder of the cell and physically separating tissue or organ from an animal. An isolated cell or cell component is separated by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, up to 100% from other naturally occurring cells or cell components. Methods for isolating one or more cells from another group of cells are known in the art. See for example Freshney (ED) Culture of Animal Cells: a manual of basic techniques (3.sup.rd Ed.) 1994, Wiley-Liss; Spector et al (Eds)(1998) Cells: a Laboratory Manual (vol. 1) Cold Spring Harbor Laboratory Press and Darling et al (1994) Animal Cells: culture and media John Wiley & Sons. Methods of isolating a tissue or an organ from an animal are known in the art and vary depending on the tissue or organ to be isolated and the desired method of transplanting the tissue or organ. Methods of isolating a transfusion product from an animal or sample are known in the art and vary depending on the desired transfusion product. Such methods include but are not limited to centrifugation, dialysis, elution, apheresis and cryoprecipitation.
[0087] A “skin related product” encompasses products isolated from skin and products intended for use with skin. Skin related products isolated from skin or other tissues may be modified before use with skin. Skin related products include but are not limited to replacement dressings, burn coverings, dermal products, replacement dermis, dermal fibroblasts, collagen, chondroitin, connective tissue, keratinocytes, cell-free xenodermis, cell-free pig dermis, composite skin substitutes and epidermis and temporary wound coverings. See for example Matou-Kovd et al (1994) Ann Med Burn Club 7:143, herein incorporated by reference in its entirety.
[0088] The attachment period of a skin related product is the time between application of the skin related product to a human subject and natural separation of the skin related product from the human subject. When a human subject's skin wound has sealed, a skin related product may be removed by natural separation or mechanical separation. However natural separation of a skin related product from a human subject may occur prematurely. Premature natural separation occurs before separation is desired by a medical practitioner. By way of example and not limitation, premature natural separation may occur before the wound has been sealed. Premature natural separation may also be termed “sloughing”, “shedding”, or “flaking”. Clinical management of premature natural separation may include reapplication of a skin related product, dressing application, bandage application, administering antibiotic, and administering fluids. A skin wound may be sealed by any means known in the art including but not limited to by growth of the subject's skin and by skin grafting. Reduced premature separation encompasses a decreased, lower, less frequent, diminished, smaller amount of natural separation of a skin related product before separation is desired by a medical practitioner. The reduced premature separation may relate to a lower number of complete, a lower number of partial premature separation events, and involvement of a smaller portion of the skin related product in a partial premature separation event than compared to a skin related product obtained from a wild-type pig. A skin related product of the instant application may also exhibit an increased, lengthened, improved, extended, or expanded attachment period. Use of a skin related product of the instant application may increase the duration of the attachment period.
[0089] A skin wound encompasses any injury to the integument including but not limited to an open wound, burn, laceration, ulcer, leg ulcer, foot ulcer, melanoma removal, cancer removal, plastic surgery, and bite.
[0090] By “surgically attaching” is intended joining, combining, uniting, attaching, fastening, connecting, joining or associating through any surgical method known in the art.
[0091] In an embodiment the application provides non-human material suitable for transfusions from multiple knockout porcine animals with reduced expression of the αGal, CMAH and β4GalNT2 genes. These materials suitable for transfusions may include, but are not limited to, blood, whole blood, plasma, serum, red blood cells, platelets, and white bloods cells. Such materials may be isolated, enriched or purified. Methods of isolating, enriching or purifying material suitable for transfusion are known in the art. Serologically porcine red blood cells (RBCs) share a number of common characteristics with human RBCs (Pond W. G, Houpt K. A, The Biology of the Pig Ithaca: Comstock Pub. Associates, 1978 and Jandl, J. H. Blood: Textbook of Hematology, Boston: Little, Brown, 1996). As in other mammals, the primary site for erythropoiesis in pigs is bone marrow. The pRBC is a biconcave disk of approximately 4-8 microns in diameter. The hematocrit of pig blood is 35-47%, with a hemoglobin concentration of 6-17 g/100 ml. The half-life of pRBC is approximately 40 days, in comparison to 60 days for human RBCs.
[0092] Fifteen pig blood group systems have so far been identified. The most important and well-studied is the A-O(H), which is closely related to the human ABO system. The A and O antigens on pRBC are passively adsorbed from circulating plasma glycosphingolipids, in a similar mechanism as human Lewis antigens (Marcus, D. M. & Cass, L. E. (1969) Science 164:553-555). pRBC phenotyping is not entirely reliable. Phenotyping of pigs can be achieved by immunohistochemical staining of buccal epithelial cells with an anti-A monoclonal antibody (mAb)(as used in Blood Banks) and an anti-H lectin antibody (Ulex europaeus) (Villarroya H et al 1990 Autoimmunity 6:47-60). The glycolipids bearing blood group A have been isolated from porcine stomach mucosa, epithelial cells and erythrocytes. Among a few of the well-characterized proteins derived from pRBC, porcine hemoglobin shares 85% sequence identity with its human counterpart and demonstrates a similar three-dimensional structure at 2.8 Å resolution. Unlike most tissue cells, porcine RBCs do not contain a nucleus and therefore are less likely to harbor retroviruses such as, but not limited to, porcine endogenous retroviruses (PERVs). pRBCs also lack intracellular organelles and a relatively short half-life in vivo.
[0093] The following Examples are offered for illustrative purposes only and are not intended to limit the scope of the present invention in any way. Indeed various modifications in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and the following examples and fall within the scope of the appended claims.
EXAMPLES
Example 1. DNA Sequencing Analysis of Targeted CMAH, GGTA1 and B4GalNT2 Regions
[0094] Genomic DNA from a cloned pig was extracted using GenElute Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich, St. Louis, Mo.). PCR amplification of the CMAH, GGTA1 and β4GalNT2 Crispr/Cas9 target regions was performed. Primers were used to sequence the targeted CMAH, GGTA1 and β4GalNT2 regions.
[0095] Pwo Master (Roche, Indianapolis Ind.) was used, Pwo SuperYield DNA polymerase, dNTPack (Roche Applied Science, Indianapolis, Ind.) was used. PCR conditions for GGTA1 were as follows: 94° C., 2 min; 94° C., 15 sec, 54° C., 30 sec, and 72° C., 45 sec for 15 cycles; 94° C., 15 sec, 54° C., 30 sec, 72° C., 45 sec with additional 5 sec each cycle for 25 cycles; and a final extension step of 72° C. for 5 min. For CMAH, 94° C., 2 min; 94° C., 15 sec, 56° C., 30 sec, and 72° C., 45 sec for 15 cycles; 94° C., 15 sec, 56° C., 30 sec, 72° C., 45 sec with additional 5 sec each cycle for 25 cycles; and a final extension step of 72° C. for 5 min. For β4GALNT2, 94° C., 2 min; 94° C., 15 sec, 62° C., 30 sec, 72° C., 40 sec for 15 cycles, 94° C. 15 sec, 62° C., 30 sec, 72° C. 40 sec with additional 5 sec each cycle for 25 cycles; and a final extension step of 72° C. for 5 min. The PCR products were separated on 1% agarose gel and purified by GenElute Gel Extraction Kit (Sigma-Aldrich, St. Louis, Mo.). The PCR products were sequenced by the Sanger method (DNA Sequencing Core Facility, Indiana University School of Medicine) with the specific sequencing primer, 5′ CCTTAGTATCCTTCCCAACCCAGAC 3′ (SEQ ID NO:5) for GGTA1; 5′ CATTTTCTTCGGAGTTGAGGGC 3′ (SEQ ID NO:6) for CMAH; 5′ AAAGCCACAGGAGGAGCCAG 3′ (SEQ ID NO:7) for 84GALNT2. Once the mutations were detected, PCR products were inserted into pCR4blunt-TOPO vector and transformed into E. coli. Individual clones were sequenced again to further investigate the mutation in each allele of the individual gene.
[0096] Results from an exemplary DNA sequence analysis are summarized in
Example 2. Production of Knockout Pigs (Triple Transgenic Pigs)
[0097] Oligo annealing and cloning into the PX330 plasmid to drive gRNA expression was performed using Addgene plasmid 42230 [http://www.addgene.org/42230 and 20]. Oligo pairs for the targeted genes are GGTA1 (NCB1 Accession: XM_005660398.1), 5′CACCGAGAGAAAATAATGAATGTCAA-3′ forward) (SEQ ID NO:8), 5′AAATTGACATTCATTATTTTCTC-3′ (reverse) (SEQ ID NO:9); CMAH (NCBI Accession: NM_001113015.1) 5′-CACCGAGTAAGGTACGTGATCTGT-3′ (forward) (SEQ ID NO:10), 5′-AAACACAGATCACGTACCTTACTC-3′ (reverse) (SEQ ID NO:11; 64GalNT2 (NCBI Accession: NM.sub.— 001244330.1) 5′-CACCGTGTATCGAGGAACACGCTT-3′ (forward) (SEQ ID NO:12), 5′-AAACAAGCGTGTTCCTCGATACAC-3′ (reverse) (SEQ ID NO:13).
[0098] Liver-derived cells were cotransfected with all three gRNA/Cas9 plasmids. After 48 hr, the treated cells were passed over an IB4-lectin column to isolate α-Gal null cells. Two million α-Gal negative cells were further stained with fluorescein labeled Dolichos biflorus Agglutinin (DBA)-FITC (Vector Laboratories, Burlingame, Calif., USA) at 2 μg/ml in 500 μl HBSS with 0.5% BSA and flow-sorted for DBA-negative cells using a BD FACSARia sorter (BD Bioscience, San Jose, Calif., USA). The presence of Neu5Gc, an indicator of CMAH gene function, was not analyzed prior to somatic cell nuclear transfer.
[0099] Somatic cell nuclear transfer (SCNT) was performed using in vitro matured oocytes (DeSoto Biosciences Inc., St. Seymour Tenn. and Minitube of America (Mount Horeb Wis.). Cumulus cells were removed from the oocytes by pipetting in 0.1% hyaluronidase. Oocytes with normal morphology and a visible polar body were selected and incubated in manipulation media (calcium-free NCSU-23 with 5% fetal bovine serum (FBS) containing 5 μg/ml bizbenzimide and 7.5 μg/ml cytochalasin B for 15 minutes. Following this incubation period, oocytes were enucleated by removing the first polar body and metaphase II plate. For the triple transgenic pigs, single cells of site-targeted, IB4 counter-selected, DBA negative liver derived cells (LDC) were injected into each enucleated oocyte. Some triple transgenic pigs were developed from SCNT of fetal fibroblasts obtained from an aborted triple knockout pig fetus created from site-targeted, IB4 counter-selected, DBA negative liver derived cells. Electrical fusion was induced with a BTX electroporator (Harvard Apparatus, Holliston Mass.). In various instances enucleated oocytes injected with a cell (couples) were exposed to two DC pulses of 140 V of 50 μs in 280 mM mannitol, 0.001 mM CaCl.sub.2 and 0.05 mM MgCl.sub.2 or 180 V for 50 μs in 280 mM mannitol, 0.1 mM CaCl.sub.2, and 0.05 mM MgCl.sub.2. After activation the oocytes were placed in NCSU-23 medium with 0.4% bovine serum albumin (BSA) and incubated at 38.5° C., 5% CO.sub.2 in a humidified atmosphere for less than one hour. Within an hour after activation, oocytes were transferred into a recipient pig. Recipient pigs were synchronized occidental pigs on their first day of estrus. Pregnancies were verified by ultrasound at day 25 or day 26 after embryo transfer.
[0100] All animals used in this study were approved by the Institutional Biosafety Committee (IBC) and Institutional Animal Care and Use Committee (IACUC).
Example 3. IB4 Counterselection of Triple Knockouts
[0101] Liver-Derived Cells (LDCs) were transfected with three sets of targeting constructs (αGal, β4GalNT2 and CMAH). Cells were selected with IB4, a substance that binds αGal. DNA from cells in the bulk population of cells that survived IB4 counterselection was obtained, and the target gene sequences were evaluated. The bulk population cells that survived IB4 counterselection were used directly in SCNT to make pregnant pigs.
Example 4. Design of Targeting Vectors
[0102] Targeting vectors such as CrispR constructs, Zn finger constructs and TALEN constructs are designed to target the sequence of porcine CMAH (Ensemble transcript ENSSSCT00000001195) at a suitable site. Targeting vector constructs are designed to target GGTA1 (Ensemble transcript ENSSSCT00000006069) at a suitable site. Targeting vector constructs are designed to target β4GalNT2 ata suitable site in NCBI GeneID:100621328 and Ensemble: ENSSSCG00000030269.
[0103] A CMAH Crispr construct with a primer sequence that is the reverse complement of a portion of the sequence listed in the Ensemble transcript was created and utilized in the creation of a triple knockout pig. A Gal Crispr construct with a primer sequence identical to a portion of that in the appropriate Ensemble transcript was created and utilized in the creation of a triple transgenic pig. An β4GalNT2 Crispr construct with a primer sequence identical to a portion of the above indicated NCBI sequence NCBI GeneID:100621328 was created and utilized in the creation of a triple transgenic pig.
Example 5. Crossmatch of Human Sera with Transgenic PBMCs
[0104] Porcine whole blood from transgenic (triple GGTA-1/β4GalNT2/CMAH for example) and wild-type pigs were collected in ACD from venous puncture. The whole blood was mixed 1:1 with PBS and separated with Ficoll. Porcine peripheral blood monocytes (PBMCs) were prepared from the whole blood using Ficoll-Paque Plus (GE Healthcare). PBMCs were removed from Ficoll layers and washed several times with PBS followed by lysis solution as need to remove red blood cells. PBMCs were suspended in EX-CELL media at 4 million cells/ml (EX-Cell 610 HSF-Serum free Medium for Hybridoma Cells 14610C).
[0105] Sera were obtained from 44 healthy human volunteers. Twenty-five percent heat inactivated serum was prepared. 25 μl of heat-inactivated serum, 25 μl of EX-CELL media and 50 μl of suspended cells were added to each well on a 96 well V-bottom plate. Cells were incubated at 4° C. for 30 minutes, and then washed three times with EX-CELL media. Cells were stained with secondary antibody as follows: Alexa Flour 488 goat anti-human IgG 109-546-170 at 1:250 concentration in EX-CELL media, Alexa Flour 488 goat anti-human IgM 709-546-073 at 1:250 concentration in EX-CELL media, 100 μl of secondary was added. Cells were suspended with a pipet. Cells were incubated at 4° C. for 30 minutes. Cells were washed once with EX-CELL media and resuspended with pipet in EX-Cell media or 1:1 EX-CELL media and Flow Fixative Solution (1% buffered paraformaldehyde). Flow cytometric analysis was completed with channel FL-1 gating for Alexa flour 488. Results from one such experiment are shown in
Example 6. DBA Lectin Flow Cytometry Staining
[0106] Whole blood from triple transgenic pigs and other pigs of interest was collected in anticoagulant citrate dextrose (ACD). The whole blood was mixed 1:1 with PBS and separated with ficoll (Ficoll-Paque PLUS, GE Healthcare 17-1440-03). Flow wash and staining buffers containing calcium were obtained. The flow wash buffer was HBSS with 0.5% BSA IgG-free 0.1% sodium azide pH 7.4), 0.45 μM filtered to remove particulates. PBMCs were resuspended in Flow Wash Buffer at 2×10.sup.6 cells/ml and suspended homogenously. The cells were blocked for 15 minutes on ice. Cells were resuspended again. 100 μl (2×10.sup.5 cells) were added to 5 ml flow tubes. DBA-fluorescein (2 mg/ml stock) was obtained. The DBA-fluorescein lectin stock was diluted 1:10 in Flow Buffer to a final concentration of 0.2 μg/ml. DBA-fluorescein lectin was added to the cells at a ratio of 1 μg DBA: 1×10.sup.6 cells (0.2 μg/2×10.sup.5 cells or 1 μl). DBA lectin and cells were incubated 30 minutes at room temperature. Cells were washed thoroughly with 4 ml Flow Wash HBSS. Cells were spun at 400×g for 5 minutes and the wash supernatant was removed. Cells were resuspended in 200 μl Flow Wash HBSS. The same parameters were utilized if additional washes were performed. If desired, cells were fixed in approximately 200 μl Flow Fixative/2×10.sup.5 cells after the last wash and stored at 4° C. until analysis. Flow cytometry analysis was performed with the gate on forward and sidelight scatter. Cellular fluorescent events were collected in FL-1; 10,000 events were collected in scatter gate. For each cell line both cells only and DBA-fluorescein data were collected. IB4 lectin interacts with αGal linked carbohydrates produced by the αGal gene product. The HD antibody interacts with the Neu5Gc carbohydrate produced by the CMAH gene product. DBA lectin interacts with the carbohydrate structure produced by the β4GalNT2 gene product. Results from one such experiment are presented in
Example 7. IgG Antibody Binding to RBC
[0107] Human A and two human O sera and RBC were obtained. Porcine wildtype and j/CMAH/GAL triple knockout RBC were obtained. Erythrocytes were isolated from whole blood collected in acid-citrate-dextrose tubes (Becton Dickinson & Co., Franklin Lakes N.J.) using Ficoll-Paque Plus (GE Health, Uppsala Sweden). Fresh serum was isolated by collecting whole blood in the absence of anticoagulant and centrifuging to remove clotted material. After density isolation, RBC were washed three times with PBS and diluted 1:10 in PBS at room temperature. To determine the antibody binding to RBC (2×10.sup.5 cells/well) were incubated with diluted, heat-inactivated human serum for 30 min at 4° C., final serum concentration 25%. The cells were washed three times in PBS with azide and stained with goat anti-human IgG Alexa Fluor 488 or donkey anti-human IgM Alexa Fluor 488 (Jackson ImmunoResearch Laboratories, Inc., West Grove, Pa., USA). Flow cytometry analysis was performed using an Accuri C6 flow cytometer and CFlow software (Accuri, Ann Arbor, Mich. USA). RBC gating was based on forward and side scatter. Exemplary IgG antibody binding to RBC flow cytometry traces are shown in
[0108] Cell surface analysis of porcine RBC cell surface glycans was performed using antibodies/lectin isolectin Griffonia simplicifolia GS-IB4 Alexa Fluor 647 (Invitrogen, Grand Island N.Y., USA) for αGal, a chicken anti-Neu5Gc antibody kit (BioLegend, San Diego Calif.) for Neu5Gc, and Fluorescein Dolichos Biflorus Agglutinin (DBA) (Vector Laboratories, Inc. Burlingame, Calif. USA) for β4GalNT2-derived carbohydrates. Traces from one such a series of experiments are presented in
Example 8. RBC Stripping and Associated Flow Cytometry
[0109] Following density isolation, RBCs were washed three times in PBS and suspended in 50% Alsever's solution. RBC's were pelleted at 21,300×g for 2 minutes. Serum was added to the pelleted cells at a 1:1 of cell pellet volume to serum volume. Serum RBC mixture was mixed and incubated for 20 minutes at 4° C. Cells were pelleted at 21,300×g for 2 minutes and washed once with Alsever's solution. Cells were mixed with acid stripping buffer (pH 2.75 Citric Acid/Phosphate at 300 mOs/kg) to remove bound antibodies and neutralized with 1 M Tris-base, pH 9.0 (Calbiochem, LaJolla Calif.). Material that eluted during the low pH treatment was analyzed by SDS-PAGE and mass spectrometry (see below). Matching flow cytometric analysis for antibody elution sample was completed using 2×10.sup.6 RBCs. Cells were suspended in EX-CELL 610-HSF Serum-Free Medium (Sigma, St. Louis, Mo. USA) with 0.1% sodium azide incubated for 30 min at 4° C. with a mixture of 25% heat inactivated serum. RBCs were washed three times and stained with goat anti-human IgG Alexa Fluor 488 or donkey anti-human IgM Alexa Fluor 488 (Jackson ImmunoResearch Laboratories Inc., West Grove Pa., USA) antibodies. Secondary antibodies were incubated with RBCs for 30 minutes at 4° C. and washed. Flow cytometric analysis completed on BD Accuri C6 flow cytometer (Accuri, Ann Arbor, Mich., USA) and histograms were generated using FlowJo 7.6.5 (FlowJo LLC, Ashland Oreg., USA). Representative traces are shown in
Example 9. SDS-PAGE Gel Analysis of Proteins Eluting from RBC
[0110] A single human serum was incubated with various RBC (wildtype pigs (W), CMAH/GAL DKO (D), CMAH/GAL/64GalNT2 (T); and autologous human (A)). After the stripping described above, neutralized eluates were precipitated by diluting 100 μl elution into 900 μl acetone and then incubated in minus 20° C. for 30 minutes. Precipitates were spun 20,000×g at 4° C. for 15 min. Supernatant was discarded and pellets were washed with 70% v/v ethanol in water. Precipitates were spun again at 20,000×g at 4° C. for 15 minutes. Supernatant was again discarded and pellets were dried in a Vacufuge Plus (Eppendorf, Hauppauge, N.Y., USA) at 37° C. for 30 min. Samples were then dissolved in 100 microliters of 2×Laemmeli Buffer (Bio-Rad, Hercules, Calif., USA) containing 2-mercaptoethanol (Sigma-Aldrich, St. Louis, Mo., USA) according to the manufacturer's instructions. Samples were then heated at 95° C. for 5 min and then allowed to cool to room temperature. Fifteen microliters of each sample was then loaded onto a 26-well, 4-20% Stain-Free TGX gel (Bio-Rad) and electrophoresed under denaturing and reducing conditions at 200 V for 42 min using the Bio-Rad criterion system. After electrophoresis, gel was removed and stained for 30 min with 100 milliliters G-250 Bio-Safe Coomassie Stain (Bio-Rad). Gel was then destained in water and imaged using a 700 nm laser on a Li-Cor Classic Imager (LiCor Biosciences, Lincoln, Nebr. USA). Respective samples were then shipped on dry ice for mass spectrometry preparation and analysis. A process schematic is shown in
Example 10. Mass Spectrometry Quantitation of Immunoglobulin Eluted from RBC
[0111] Mass spectrometry analysis was performed by MSBioworks, LLC. 50 μl aliquots of each sample were treated with PNGase F (New England Biolabs) according to manufacturer's instructions. Each sample was acetone precipitated for 30 minutes followed by a wash with 70% ethanol at 4° C. per client protocol. Resultant precipitates were dried and re-suspended in 40 μl 1.4×LDS loading buffer with DTT. 20 μl was run on a 4-12% bis tris SDS PAGE gel in the MOPS buffer system.
[0112] The region containing the heavy chain (50 kDa) was excised and trypsin digestion was performed using a robot (ProGest, DigiLab) with the following protocol: 1) Washed with 25 mM ammonium bicarbonate followed by acetonitrile. 2) Reduced with 10 mM dithiothreitol at 60° C. followed by alkylation with 50 mM iodoacetamide at RT. 3) Digested with trypsin (Promega) at 37° C. for 4 h. 4) Quenched with formic acid and the supernatant was analyzed directly without further processing.
[0113] The gel digests were analyzed by nano LC/MS/MS with a Waters NanoAcquity HPLC system interfaced to a ThermoFisher Q Exactive. Peptides were loaded on a trapping column and eluted over a 75 μm analytical column at 350 nL/min; both columns were packed with Jupiter Proteo resin (Phenomenex). The mass spectrometer was operated in data-dependent mode, with MS and MS/MS performed in the Orbitrap at 70,000 FWHM resolution and 17,500 FWHM resolution, respectively. The fifteen most abundant ions were selected for MS/MS. The area under the curve (AUC) was identified and calculated for each isotype specific-peptide. Comparing AUC enables a quantitative evaluation of the levels of each antibody in a sample. Representative traces are shown in
TABLE-US-00002 Missed- Missed- Cleaved Iso- Peptide Cleaved Peptide type Peptide (M/Z) Peptide (M/Z) IgG1 EEQYNSTYR 595.7516 TKPREEQYNSTYR 836.8999 IgG2 EEQFNSTFR 579.7567 TKPREEQFNSTFR 820.9049 IgG3 EEQYNSTFR 587.7542 TKPREEQYNSTFR 828.9024 IgG4 EEQFNSTYR 587.7542 TKPREEQFNSTYR 828.9024 IgM YKnNSDISSTR 643.3044 [0114] Lower case n in the IgM peptide represents a deamidated asparagine residue presumably occurring as a consequence of PNGase F treatment.
Example 11. Data Processing
[0115] Data were searched using a local copy of Mascot with the following parameters: Enzyme: Trypsin, Database: Swissprot Human (forward and reverse appended with common contaminants), Fixed modification: Carbidomethyl (C), Variable modifications: Oxidation (M), Acetyl (Protein N-term), Deamidation (NQ), Pyro-Glu (N-term Q). Mass values: Monoisotopic Peptide Mass Tolerance: 10 ppm Fragment Mass Tolerance: 0.02 Da Max Missed Cleavages: 2 Mascot DAT files were parsed into the Scaffold software for validation, filtering and to create a nonredundant list per sample. Data were filtered 1% protein and peptide level false discover rate (FDR) and requiring at least two unique peptides per protein. Raw LC/MS data was inspected for the accurate m/z values of the target peptides the selected ion chromatograms were extracted in QualBrowser (Thermo); the peak area in each case was calculated.
Example 12. Comparison of Mass Spectrometry and Flow Cytometry Techniques for Quantitating Antibody Binding to RBC
[0116] The use of fluorescent secondary antibodies, a potential for artificial masking and the inability to easily report on different IgG isotypes may impact flow cytometry results. Quantitative mass spectrometry may allow direct peptide analysis without secondary reagents and can provide information on individual isotype levels. Mass spectrometry and flow cytometry provide measures of antibody binding that may reflect different inherent biases in the methods. Individual isotype levels may contribute differently to various immune effector functions. Serum and RBC were collected from three people. Each serum was incubated with its autologous RBC (A) and with pig RBC (wildtype (W) or triple knockout (T)). Immunoglobulin binding was evaluated using flow cytometry and mass spectrometry.
Example 13. Isotype Analysis of Antibody Binding to RBC
[0117] Mass spectrometry AUC was used to quantitate the binding of each isotype to the different RBC. Evaluations were performed using GGTA1/CMAH knockout RBC (D), GGTA1/CMAH/β4GalNT2 knockout RBC (T) and autologous human RBC (A). Zero values in serum 1 indicate no binding of the particular isotypes to a target cell. IgG4 binding to autologous human cells in sera 2, 3 and 4 increased in a range from 10-fold to 16-fold. IgG2 was the only other isotype to show increased binding to human cells (A) compared to the pig (T) RBC in multiple sera, but the increases were smaller than those seen for IgG4 (ranges 3 to 6-fold, see sera 2, 3, and 4). Results from one such series of experiments are shown in
Example 14. Lectin Staining of Different Pigs
[0118] Porcine kidneys from GGTA1/CMAH DKO pigs were flushed with 0.025% of collagenase type IV from Clostridium histolyticum (Sigma, St. Louis, Mo., USA). Primary RMEC were isolated and cultured with RPMI medium supplemented with 10% of DKO pig serum, 100 μg/ml endothelial cell-specific growth factor, penicillin, streptomycin, and amphotericin B. After a 3-day culture, the porcine RMEC were infected for 24 h with lentiviral supernatant, containing lentiviral vector in which a c-DNA expresses the large and small T antigen of SV40 (Applied Biological Materials Inc, Richmond, BC, Canada). Single-cell clones were isolated and amplified up to 10 passages. iRMEC were cultured with RPMI medium supplemented with 10% of DKO pig serum, 100 μg/ml endothelial cell-specific growth factor, penicillin, streptomycin, and were used for characterization within passages 15-40. αGal/CMAH/β4GalNT2/SLA antigen disrupted iREC's were obtained.
[0119] Primary aortic endothelial cells from aortic thoracic and abdominal branches of GGTA1/CMAH/B4GALNT2 KO pig were isolated with 0.025% of collagenase type IV from Clostridium histolyticum (Sigma, St. Louis, Mo., USA).sup.2. The AEC were cultured with RPMI 1640 medium supplemented with GGTA1/CMAH/B4GALNT2 KO pig serum, 100 μg/ml endothelial cell-specific growth factor, penicillin, streptomycin, and amphotericin B, as well as 10% FBS for WT/GGTA1 KO AEC or 5% GGTA1/CMAH DKO pig serum for GGTA1/CMAH DKO and GGTA1/CMAH/B4GALNT2 AEC. These cells were used within 5 passages. CMAH deficient porcine cells were grown in GGTA1/CMAH DKO pig serum to prevent uptake of Neu5Gc from bovine serum.
[0120] Primary AEC cells (2×10.sup.5 cells) were staining using Fluorescein labeled Dolichos biflorus agglutinin lectin (diluted at 1:1000 in HBSS) (DBA, Vector Laboratories, Burlingame, Calif., USA), fluorescein labeled Artocarpus integrifolia lectin (diluted at 1:1000 in HBSS) (AIL, Vector Laboratories), fluorescein labeled Vicia villosa lectin (diluted at 1:1000 in HBSS) (VVL, Vector Laboratories), fluorescein labeled Arachis hypogaea lectin (diluted at 1:1000 in HBSS) (PNA, Vector Laboratories), and Alexa Fluor 488 labeled Isolectin IB.sub.4 (diluted at 1:1000 in HBSS) from Griffonia simplicifolia (Invitrogen, Grand Island, N.Y., USA). For Neu5GC, cells were stained at a ratio of 1:5000 final dilution from a 0.5 mg/mL stock with Alexa Fluor labeled Anti-Neu5GC or normal chicken IgY (BioLegend). Cells were stained for 30 minutes at 4° C. Cells were then washed and analyzed using a C6 flow cytometer (BD Biosciences). Fluorescence intensity was then calculated compared to either unstained cells in the case of lectins or isotype control in the case of Neu5GC. Representative traces are shown in
Example 15. Phenotype Analysis of PBMC
[0121] Peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll-Paque (GE Healthcare, Uppsala, Sweden) and counted. Cells were then resuspended at a density of 2×10.sup.6 cells/milliliter in Neu5GC Blocking Buffer (Biolegend, San Diego, Calif., USA) diluted in Hank's Balanced Salt Solution (HBSS) per manufacturer's instructions. Cells were incubated on ice for 15 minutes prior to staining. One hundred microliters (2×10.sup.5 cells) were added to 12×75 mm polystyrene flow staining tubes (BD Biosciences, Bedford, Mass., USA). Cells were stained at a ratio of one microgram per 1×10.sup.6 cells of: Fluorescein labeled Dolichos biflorus agglutinin lectin (DBA, Vector Laboratories, Burlingame, Calif., USA), fluorescein labeled Artocarpus integrifolia lectin (AIL, Vector Laboratories), fluorescein labeled Vicia villosa lectin (VVL, Vector Laboratories), fluorescein labeled Arachis hypogaea lectin (PNA, Vector Laboratories), and Alexa Fluor 488 labeled Isolectin IB.sub.4 from Griffonia simplicifolia (Invitrogen, Grand Island, N.Y., USA). For Neu5GC, cells were stained at a ratio of 1:5000 final dilution from a 0.5 mg/mL stock with Alexa Fluor labeled Anti-Neu5GC or normal chicken IgY (BioLegend). Cells were stained for 30 minutes while incubating on ice. Cells were then washed with four milliliters of Neu5GC Blocking Buffer and pelleted at 400×g for five minutes. The supernatant was discarded and cells were resuspended in 200 microliters of the blocking buffer and analyzed immediately. Cells were analyzed using a C6 flow cytometer (BD Biosciences) by collecting 10,000 events using a forward and side scatter gating method. Fluorescence intensity was then calculated compared to either unstained cells in the case of lectins or isotype control in the case of Neu5GC.
Example 16. Clinical Crossmatch Testing
[0122] PBMC from triple transgenic pigs were subjected to human clinical crossmatch testing utilized in allotransplantation. Sera were obtained from 31 human subjects with a panel of reactive antibodies (PRA) of 0 (top graph) and 19 human subjects with a panel PRA score exceeding 80 (bottom graph). Clinicians routinely transplant human organs with a cytotoxicity score of 1. Ficoll treated PBMC from triple transgenic pigs were adjusted to a cell concentration of 2×10.sup.6 cells/ml. Some sera aliquots were treated with DTT. Two sets of crossmatch trays were prepared. Sera and controls were loaded in the crossmatch trays. The cell preparation was thoroughly mixed and drawn up slowly in a Hamilton repeating dispenser. One microliter of cells were added to each well containing sera over an illuminated view box. Test cells were added last to positive control wells. Equal numbers of trays were placed into opposing buckets of a Sorvall centrifuge. The centrifuge was turned on and allowed to reach 1000 rpm, then the centrifuge was turned off. Trays were examined over an illuminated view box to ensure cell droplets were mixed with serum. Trays were incubated for 30 minutes at room temperature. All trays were washed four times with 15 μl PBS to each well using Jet Pipette. Cells were allowed to settle for 2-3 minutes using a gentle wash technique. PBS, oil and serum was removed.
[0123] A working dilution of AHG/C′ Class 1 mixture was prepared. One set of trays was treated with 5 μl AHG/C′; the other set of tray was treated with 5 μl undiluted rabbit complement (No AHG trays). Trays were optionally placed on a rotator for 4 minutes at 60 rpm. Trays were incubated for 60 minutes at room temperature. Cells were stained with 5 μl Fluoroquench and allowed to stand for 5′. Trays were placed on an inverted phase fluorescent microscope; each well was evaluated using a total magnification of 160×.
[0124] The percentage of dead cells in each well is estimated. AO crosses intact cell membranes of living cells, intercalates DNA and fluoresces green (535 nm) when excited at 490 nm. Dead cells stained with ethidium bromide fluoresce red (605 nm) when excited at 490 nm. Each well is scored using the system described below:
TABLE-US-00003 % Dead Cells Score Interpretation 0-10% 1 Negative 11-20% 2 Positive 21-50% 4 Positive 51-80% 6 Positive 81-100% 8 Strong Positive ? 0 Not Readable.
[0125] Results from one such series of experiments are shown in
Example 17. Ex Vivo Perfusion of Human Platelets Through Transgenic Liver
[0126] A triple transgenic GGTA1/CMAH/β4GalNT2 pig is anesthetized and intubated. A midline abdominal incision is made. The liver is removed and placed in a perfusion device under normothermic conditions. Humidity, temperature and air flow are maintained in the perfusion device. The perfusion device maintains constant pressure by varying the flow rate. Centrifugal flow through the portal vein and pulsatile flow through the hepatic artery are used. Both flow rates are set at porcine physiological pressure. The base perfusion solution is an oxygenated Ringers solution with physiologic nutrition and insulin.
[0127] Human platelets are obtained from healthy volunteer subjects or purchased commercially less than six days from isolation and are stored at 20-24° C. Approximately 1×10.sup.11 human platelets are washed in sterile phosphate buffered saline (PBS) containing the anti-coagulant citrate dextrose. Platelets may be labeled with CFSE according to the manufacturer's protocol.
[0128] Pig livers are perfused two hours prior to the addition of platelets. Platelet samples are obtained prior to addition to the perfusion system and after the addition of the platelets at predetermined time points. Platelet levels in the pre-perfusion and post-perfusion samples are evaluated. Pre and post-perfusion evaluation of the pig liver are performed. Wild-type pig livers are obtained, and the livers are perfused under similar conditions.
Example 18. Evaluation of Response to a Transgenic Xenograft
[0129] Porcine livers are obtained from a triple knockout pig (αGal,CMAH,β4GalNT2). The livers are surgically transplanted into a recently deceased human cadaver using the piggyback method. After the surgery, biological samples are obtained from the human cadaver. Clinical indicia of a rejection related response are monitored.
Example 19. Evaluation of Response to a Transgenic Xenograft
[0130] Porcine kidneys are obtained from a triple transgenic pig (αGal,CMAH,β4GalNT2). A highly sensitized human subject is administered compounds to manage preexisting and de novo donor-specific antibodies. The porcine kidneys are surgically transplanted into the subject. After the surgery, biological samples are obtained from the human cadaver. Clinical indicia of a graft rejection are monitored.
Example 20. Confocal Microscopy Analysis
[0131] Piglets (triple GGTA1, CMAH, βGalNT2 knockouts, wild type or other piglets of interest) are euthanized. Liver, heart and kidney tissue are obtained from the pig. Frozen sections of each tissue are prepared. Mounted tissues are blocked in Odyssey blocking buffer (Li-Cor Biosciences, Lincoln Nebr.) in HBSS for one hour. The slides are fixed in 4% paraformaldehyde for 10 minutes. Tissues are stained with IB4 lectin Alexa Fluor 647 (Invitrogen, Grand Island N.Y.) to visualize the presence of the Gal epitope. To visualize the Neu5Gc epitope, tissues are stained with a chicken anti-Neu5Gc antibody or with a control antibody (Sialix, Vista Calif.) for an hour. Tissues are stained with DBA to visualize the presence of Sd.sup.a-like epitopes Tissues are washed three times with HBSS. Donkey anti-chicken Dylight 649 (Jackson ImmunoResearch Laboratories Inc, West Grove Pa.) secondary antibody is incubated with the tissue for approximately an hour. Tissues are washed three times with 0.1% HBSS Tween. To stain the nucleus, DAPI stain (Invitrogen, Grand Island N.Y.) is added to all the slides for 1 minute followed by two 0.1% HBSS Tween washes. Tissues are mounted in ProLong Gold (Invitrogen, Grand Island N.Y.). Confocal microscopy is performed using an Olympus FV1000.
Example 21. Antibody-Mediated Complement-Dependent Cytotoxicity
[0132] Antibody-mediated complement dependent cytotoxic assays are known in the art. A method of Diaz et al (Diaz et al., 2004 Transplant Immunology 13(4):313-317) is performed. Human serum is obtained from healthy volunteers. Twenty-five percent heat inactivated serum is prepared. Heat-inactivated human sera are serially diluted and 100 μl of each concentration is placed in a 96 well v-bottom assay plate. The sera is mixed with a 100 μl aliquot of PBMC obtained from a pig of interest (GGTA1/CMAH/β4GalNT2 triple transgenic or other). PBMC final concentrations are either 5×10.sup.6/ml or 1×10.sup.6/ml. Serum concentrations vary from 50%, 17%, 2%, 0.6%, 0.2%, and 0.07%. The mixtures are incubated for 30 minutes at 4° C. After 30 minutes, the plates are centrifuged for 4 minutes at 400×g. The plates are decanted and washed with HBSS. Rabbit complement (150 μl of a 1:15 dilution) is added to each well and incubated for 30 minutes at 37° C. PBMC are labeled with a fluorescein diacetate (FDA) stock solution, prepared fresh daily in HBSS (1 μg/ml) from a 1 mg/ml stock solution in acetone and with propidium iodide (PI), prepared at 50 μg/ml in phosphate buffered saline (PBS). After incubation in complement, the samples are transferred by pipette to tubes containing 250 μl of HBSS and 10 μl of FDA/PI for analysis using an Accuri C6 flow cytometer.
[0133] The percentage of dead cells (PI+/FDA−), damaged cells (PI+/FDA+) and live cells is determined. Double negative events (PI/FDA−) are excluded from calculations. The percentage of cytotoxicity in cells not exposed to serum is considered spontaneous killing. Values for cytotoxicity are corrected for spontaneous killing.
Example 22. Porcine Liver Procurement
[0134] Pigs are premedicated, intubated and anesthetized with propofol and placed in the supine position. A midline incision to the abdomen is made. Ligamentous attachments to the liver are taken down. The portal vein and hepatic artery are cannulated and flushed with 2 liters of cold histidine-tryptophan-ketoglutarate solution (Essential Pharmaceuticals, LLC). Livers are removed from pigs and stored in histidine-tryptophan-ketoglutarate solution on ice at 4° C. until being placed in a liver perfusion circuit. Cold-ischemia time varies between 45 minutes to 3 hours. In certain experiments porcine livers may be obtained from abbatoirs. Porcine livers from abbatoirs are flushed with histidine-tryptophan-ketoglutarate solution containing heparin (2000 U/L) within two minutes of exsanguinations.
Example 23. Platelet Uptake Analysis I
[0135] Platelets are labeled with carboxyfluorecein diacetate succinimidyl ester (CFSE), a fluorescent green cytoplasmic marker. A normothermic pig liver perfusion system is used. Pig livers from knockout pigs of interest or wild-type pigs are perfused for two hours prior to the addition of platelets. Approximately 300 billion platelets (unlabeled 70%, labeled 30%) are added to the perfusion system. Biopsies are taken from the pig livers at various predetermined time points. Biopsies are examined by confocal microscopy. Biopsies are treated with a stain specific for Wieble-Palade bodies. Wieble-Palade bodies occur in platelets and endothelial cells. Fluorescent ELISA based assays are performed. Platelets are human or baboon. Alternatively biopsies are labeled with endothelial markers and a lysosomal marker, prior to confocal microscopy
Example 24. Platelet Uptake Analysis II
[0136] Platelets are labeled with carboxyfluorecein diacetate succinimidyl ester (CFSE), a fluorescent green cytoplasmic marker. A normothermic pig liver perfusion system is used. Pig livers from knockout pigs of interest or wild-type pigs are perfused for two hours prior to the addition of platelets. Biopsies are analyzed by transmission electron microscopy (TEM).
Example 25. In Vitro Platelet Uptake
[0137] Primary liver sinusoidal endothelial cells (LSECs) are isolated from the sinusoid of a pig liver or livers of interest. Primary wild-type porcine LSECs loose phagocytic ability after 5 days in culture; these experiments are performed with day 3 and 4 primary LSECs. Human or baboon platelets are labeled with CFSE as described elsewhere herein. Isolated LSECs and labeled platelets are incubated together. Samples are analyzed by confocal microscopy.
Example 26. Kidney Xenograft in NHP
[0138] Recipient non-human primates (NHP) are treated with one dose of anti-CD4/anti-CD8 (50 mg/kg), anti-CD154/anti-CD28 dAbs, MMF and steroids. In certain studies tacrolimus is used (target levels 8-12). Rhesus macaques (Macaca mulatta) are used as the NHP. In some experiments, macaques may be 3-5 years old and less than 6 kg. Knockout porcine kidneys (or wildtype control kidneys) are transplanted into the NHP recipients. Samples (blood, urine and kidney biopsy samples) are collected at defined time points for analysis. Renal function, serum creatinine, the presence and quantity of xenoantibodies (flow cytometry and multi-parameter flow cytometry), cytokine secretion, transcript profiles from peripheral blood, urine and graft biopsies, xenograft histology and development of anti-pig antibody (flow-based xenocrossmatch assay) are followed. The CMAH deletion is not helpful for study in NHP. For NHP studies, pigs with a wild-type CMAH gene are used (Gal-/β4GalNT2). Ultrasound guided needle biopsies are performed at 2, 5 and 10 weeks post transplant.
Example 27. Veterinary Care of NHP
[0139] NHP are housed in individual cages and provided with clean, adequately sized living quarters; fed twice daily; and are checked at least twice daily by animal care technicians and once daily by clinical veterinary staff. Physical examinations are performed each time an animal is anesthetized for blood collection or other procedures.
Example 28. NHP Phlebotomy and Tissue Sampling
[0140] Phlebotomy and tissue sampling (for example: blood collections, lymph node biopsies and bone marrow aspirates) of NHP's are performed either under ketamine (10 mg/kg) or Telazol (4 mg/kg) anesthesia on fasting animals. Buprenephrine (0.01 mg/kg every 6 hrs) is administered as post-operative analgesia for animals undergoing renal transplant and as needed as determined by the attending veterinarian. Animals are monitored for “irreversible critical illness” such as but not limited to loss of 25% of body weight from baseline; complete anorexia for 4 days; major organ failure or medical conditions unresponsive to treatment such as respiratory distress, icterus, uremia, intractable diarrhea, self-mutilation or persistent vomiting, and surgical complications unresponsive to immediate intervention: bleeding, vascular graft/circulation failure, infection and wound dehiscence.
Example 29. Porcine Embryo Transfer Surgery, Phlebotomy and Harvesting Procedures
[0141] Embryo transfer surgery: Before surgery, the sow is anesthetized with TKX (Telazol (500 mg)+Ketamine (250 mg) and Xylazine (250 mg); 1 cc per 50 lbs, IM) for intubation plus isoflurane by inhalation through ET tube using a precision vaporizer and waste gas scavenging. During the recovery period, animals are monitored at least once every 15 minutes and vital signs (temperature, heart rate, respiration rate and capillary refill time) are assessed and recorded. Trained animal care technicians or veterinarians monitor the animals until they can maintain themselves in voluntary sternal recumbrance. Animals are returned to regular housing areas upon approval by the attending veterinarian. Post-operative analgesics include buprenorphine 0.01-0.05 mg/kg IM every 8-12 hours or carprofen 2-4 mg/kg SC daily. Approximately 26 days after embryo transfer, ultrasound is performed to confirm establishment of pregnancy while the sow is distracted by food. About 10 days later a second ultrasound is performed. Birth occurs through natural parturition unless clinical difficulty arises. Caesarian section is performed recommended by the veterinary staff. Standard caesarian section protocols are used with the general anesthesia protocol utilized in the embryo transfer surgery. Experimental piglets are cleaned and the umbilical cord is disinfected. Every piglet receives colostrum during the first hours after birth. Piglets are watched 24/7 until they are at least 7 days old. Farrowing crates are used to protect the piglets from their mother while maintaining the piglets' ability to nurse.
[0142] All phlebotomy is performed under either ketamine (10 mg/k) or Telazol (4 mg/kg) anesthesia on fasting animals. Organ harvesting, a terminal surgical procedure, uses the anesthesia protocol (Telazol (500 mg)+ketamine (250 mg)+xylazine (250 mg); 1 cc per 50 lbs; IM)+/−pentothal (10-20 mg/kg) IV if needed for intubation and isoflurane by inhalation through ET tube using a precision vaporizer, to effect with waste gas scavenging. Swine are perfused with saline followed by removal of the heart and other tissue/organs. Alternatively swine are anesthetized with inhaled anesthetic and treated with a barbituric acid derivative (100-150 mg/kg) and a bilateral pneumothorax is performed.
Example 30. CFSE MLR Assessment of Immunosuppressive Agents on T Cell Proliferative Response
[0143] PBMCs from rhesus macaques are incubated with pig PBMCs from GGTA-/β4GalNT2-double knockout or control pigs. Dilution of CFSE is used to asses T cell proliferation in T cell subsets.
Example 31. Assessment of Immunosuppressive Agents in Renal Xenograft
[0144] Recipient macaques are immunologically mature (CMV+, LCV+, SV40+, >4 kg), MHC- and pedigree-defined. Immunosuppressive candidates (anti-CD154 dAb, clone 5C8 anti-CD154) are administered to the rhesus macaques. Recipient macaques are treated with T-cell depletion (anti-CD4/anti-CD8, single dose), MMF, steroids and the immunosuppressive candidate prior to transplant. Renal function is assessed using serum creatinine. Increase in creatinine and/or BUN>5.0 mg/dl or 100 mg/dl respectively are considered negative outcomes. Ultrasound guided needle biopsies are performed at 2, 5 and 10 weeks post-transplant. Pre-transplant and weekly post-transplant peripheral blood samples are collected for immunophenotyping using multi-parameter flow cytometry (T, B and other cellular subsets). Functional assays including ex vivo assessment of cytokine secretion as well as transcript profiles are peripheral blood, urine and graft biopsies at defined time points. Expression of costimulatory and co-inhibitory receptors (such as, but not limited to, ICOS, CTLA-4, BTLA, PD-1, LAG-3, TIM-3) in peripheral blood samples may be evaluated.
[0145] The invention is not limited to the embodiments set forth herein for illustration but includes everything that is within the scope of the claims. Having described the invention with reference to the exemplary embodiments, it is to be understood that it is not intended that any limitations or elements describing the exemplary embodiments set forth herein are to be incorporated into the meanings of the patent claims unless such limitations or elements are explicitly listed in the claims. Likewise, it is to be understood that it is not necessary to meet any or all of the identified advantages or objects of the invention disclosed herein in order to fall within the scope of any claims, since the invention is defined by the claims, and since inherent and/or unforeseen advantages of the present invention may exist even though they may not be explicitly discussed herein.
[0146] Furthermore all references cited herein are hereby incorporated by reference in their entirety and for all purposes as if fully set forth herein.