Diagnostic transcript and splice patterns of HPV16 in different cervical lesions
09803253 · 2017-10-31
Assignee
Inventors
Cpc classification
C12Q2545/113
CHEMISTRY; METALLURGY
International classification
Abstract
A method is described for differentiating in a subject with HPV16 between (i) a severe form of HPV16 infection and (ii) a mild form of HPV16 infection based on determining the amount of a first gene product and a second gene product in a sample of a subject and calculating a ratio of the amount of the first gene product and the amount of the second gene product. A composition is also described, including an oligonucleotide mixture, and also a kit and a device adapted to carry out the described method.
Claims
1. A method for differentiating in a human subject with HPV16 between (i) a severe form of HPV16 infection and (ii) a mild form of HPV16 infection, said human subject not comprising the HPV16 genome in an integrated form, and for treating said human subject having said severe form infection comprising the steps of: a) determining, in a sample of said human subject, the presence or absence of a gene product of 880^2582, said sample selected form the group consisting of a scrape, a biopsy, or a wash/rinse fluid from urogenital tract, a cervical smear, and a Pap smear, and b) differentiating between (i) a severe form of HPV16 infection and (ii) a mild form of HPV16 infection based on the determination performed in step a), wherein the presence of the gene product of 880^2582 indicates the severe form of HPV16 infection, and wherein the absence of the gene product of 880^2582 indicates a mild form of HPV16 infection, wherein the determination of the presence or absence of the gene product comprises the steps of amplifying the gene product with primer oligonucleotides that specifically amplify the gene product and determining the presence or absence of the amplified gene product, wherein the amplification step comprises generation of a cDNA, wherein the determining step is performed by a probe oligonucleotide having a nucleic acid sequence that comprises SEQ ID NO: 4, and c) treating said human subject having said severe form infection comprising a treatment step selected from the group consisting of conisation, loop electrosurgical excision procedure (LEEP), trachelectomy, hysterectomy, chemotherapy, and radiochemotherapy.
2. The method of claim 1, wherein the gene product of 880^2582 are spliced transcripts comprising the 880^2582 junction.
3. The method of claim 1, wherein the probe oligonucleotide has a nucleic acid sequence that comprises SEQ ID NO: 63.
4. A method for differentiating in a human subject with HPV16 between (i) a severe form of HPV16 infection and (ii) a mild form of HPV16 infection, and for treating said human subject having said severe form infection comprising the steps of: a) determining, in a sample of said human subject, the presence or absence of a gene product of 880^2582, said sample selected form the group consisting of a scrape, a biopsy, or a wash/rinse fluid from urogenital tract, a cervical smear, and a Pap smear, b) assessing in the sample of said human subject the integration status of the HPV16 genome and c) differentiating between (i) a severe form of HPV16 infection and (ii) a mild form of HPV16 infection based on the determination performed in step a), wherein the presence of the gene product of 880^2582 indicates the severe form of HPV16 infection, and wherein the absence of the gene product of 880^2582 indicates a mild form of HPV16 infection, wherein the determination of the presence or absence of the gene product comprises the steps of amplifying the gene product with primer oligonucleotides primers that specifically amplify the gene product and determining the presence or absence of the amplified gene product, wherein the amplification step comprises generation of a cDNA, wherein the determining step is performed by a probe oligonucleotide having a nucleic acid sequence that comprises SEQ ID NO: 4, and treating said human subject having said severe form infection comprising a treatment step selected from the group consisting of conisation, loop electrosurgical excision procedure (LEEP), trachelectomy, hysterectomy, chemotherapy, and radiochemotherapy.
5. A method for differentiating in a human subject with HPV16, between (i) a low-grade squamous intraepithelial lesions (LSIL), high-grade squamous intraepithelial lesions (HSIL), or cervix carcinoma and (ii) a negative for intraepithelial lesions or malignancy (NIL/M), said human subject not comprising the HPV16 genome in an integrated form, and for treating said human subject in category (i) comprising the steps of: a) determining, in a sample of said human subject, the presence or absence of a gene product of 880^2582, said sample selected form the group consisting of a scrape, a biopsy, or a wash/rinse fluid from urogenital tract, a cervical smear, and a Pap smear, and b) differentiating between (i) a LSIL, HSIL, or cervix carcinoma and (ii) a NIL/M based on the determination performed in step a), wherein the presence of the gene product of 880^2582 indicates the severe form of HPV16 infection, and wherein the absence of the gene product of 880^2582 indicates a mild form of HPV16 infection, wherein the determination of the presence or absence of the gene product comprises the steps of amplifying the gene product with primer oligonucleotides that specifically amplify the gene product and determining the presence or absence of the amplified gene product, wherein the amplification step comprises generation of a cDNA, wherein the determining step is performed by a probe oligonucleotide having a nucleic acid sequence that comprises SEQ ID NO: 4, and treating said human subject in category (i) comprising a treatment step selected from the group consisting of conisation, loop electrosurgical excision procedure (LEEP), trachelectomy, hysterectomy, chemotherapy, and radiochemotherapy.
6. A method for diagnosing in a human subject with HPV16 a severe form of HPV16 infection, said human subject not comprising the HPV16 genome in an integrated form, and for treating said human subject having said severe form infection comprising the steps of: a) determining, in a sample of said human subject, the presence or absence of a gene product of 880^2582, said sample selected form the group consisting of a scrape, a biopsy, or a wash/rinse fluid from urogenital tract, a cervical smear, and a Pap smear, and b) diagnosing a severe form of HPV16 infection based on the determination performed in step a), wherein the presence of the gene product of 880^2582 indicates the severe form of HPV16 infection, and wherein the absence of the gene product of 880^2582 indicates a mild form of HPV16 infection, wherein the determination of the presence or absence of the gene product comprises the steps of amplifying the gene product with primer oligonucleotides that specifically amplify the gene product and determining the presence or absence of the amplified gene product, wherein the amplification step comprises generation of a cDNA, wherein the determining step is performed by a probe oligonucleotide having a nucleic acid sequence that comprises SEQ ID NO: 4, and treating said human subject having said severe form infection comprising a treatment step selected from the group consisting of conisation, loop electrosurgical excision procedure (LEEP), trachelectomy, hysterectomy, chemotherapy, and radiochemotherapy.
Description
BRIEF DESCRIPTION OF THE DRAWING
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
EXAMPLES
(9) The following Examples shall merely illustrate the invention. They shall not be construed, whatsoever, to limit the scope of the invention.
Example 1: Assay Design
(10) In the current study, a novel procedure for the detection and quantification of spliced and unspliced RNA sequences in the uterine cervix was developed. These RNA patterns were characterised with respect to their diagnostic potential in cervical lesions of different grade. As such, novel assays for detection of 10 spliced (226^409 (E6*I), 226^526 (E6*II), 226^1358 (E6*III), 226^2709 (E6*IV), 880^2582, 880^2709, 880^1358, 1302^1358, 1302^5639, 3632^5639) (reviewed in Zheng, Z. M., and C. C. Baker. 2006. Papillomavirus genome structure, expression, and post-transcriptional regulation. Front Biosci 11:2286-302,
(11) NASBA uses isothermal target amplification with the simultaneous reaction of three enzymes, avian myeloblastosis virus reverse transcriptase (AMV-RT), RNase H, and T7 RNA polymerase. The steps take place in one reaction tube at a particular temperature (41° C.). A feature of the test is that the first oligonucleotide primer (P1) contains a T7 RNA polymerase promoter sequence. During the reaction, AMV-RT generates a single DNA copy of the target RNA. The RNase H degrades the RNA portion of the DNA/RNA hybrid, and the second primer (P2) anneals to the remaining DNA strand. For later detection using LUMINEX®, the second primer contains a 5′ generic sequence. The DNA-dependent DNA polymerase activity of AMV-RT extends P2 and produces a dsDNA copy of the original target RNA with an intact T7 RNA polymerase promoter. This T7 promoter is recognised by the T7 RNA polymerase which initiates transcription of large amounts of anti-sense RNA amplimers.
(12) The NUCLISENS® Basic Kit (Nucleic Acid Sequence-Based Amplification) (BIOMERIEUX® Ltd., France) was used according to the manufacturer's instructions. Briefly, 2.5 μL RNA template was added to 5 μl of reaction mixtures containing 80 mM of KCl, 0.2 μmoles of each primer and 1× of Reagent Sphere without enzymes, and the mixtures were heated to 65° C. for 2 minutes before placing at 41° C. for an additional 2 minutes. Then, 2.5 μL of pooled enzymes were added to each reaction, and amplification reactions were incubated at 41° C. for 90 min.
(13) Anti-sense RNA can be specifically detected by hybridisation to oligonucleotide probes coupled to LUMINEX® beads (Table 1). Upon annealing of a biotin-labelled detector probe to the generic part of P2, which was incorporated into the anti-sense RNA, staining by Strep-PE and measurement in the LUMINEX® analyser takes place. RNA amplicons generated by NASBA were detected using bead-coupled oligonucleotide probes (Table 1). RNA specific probes were coupled as described recently (Schmitt, M., I. G. Bravo, P. J. Snijders, L. Gissmann, M. Pawlita, and T. Waterboer. 2006. Bead-based multiplex genotyping of human papillomaviruses. J Clin Microbiol 44:504-12). All solutions and buffers were certified DNase/RNase free. Of the NASBA reactions, 1 to 0.1 μl were transferred to PCR plates. Using a multi-channel pipette, 49 μl hybridisation solution composed of 33 μl 1.5 M TMAC, 75 mM Tris-HCl, pH 8.0, 6 mM EDTA, pH 8.0, 1.5 g/L sarkosyl, 16 μl TE buffer, 0.2 μmolar 5′-biotinylated decorator probe, and a mixture of 2,000 hybridisation probe-coupled beads per sort were added. The whole mixture was denatured at 95° C. for 5 min and immediately placed on ice for 1 minute. The hybridisation plate was transferred to a heated block shaker and the hybridisation was performed at 41° C. for 30 min. The content of each well was transferred to a wash plate by using a multi-channel pipette. Subsequently, the wells were washed with 100 μlof washing buffer (1×PBS, 0.02% Tween) on a wash station. Beads were resuspended for 20 min on a shaker at RT in 50 μl of detection solution (2 M TMAC, 75 mM Tris-HCl, pH 8.0, 6 mM EDTA, pH 8.0, 1.5 g/L sarkosyl) containing 1/1000 diluted Strep-PE. Beads were washed twice with 100 μl washing buffer and resuspended in 100 μl washing buffer for 2 min on a shaker. Analysis was performed with a LUMINEX® 100 analyser.
(14) To discriminate spliced from full-length RNA sequences, splice site specific LUMINEX® probes rather than specific primers were used. Due to the high degree of homology between splice sites of different HPV types, additional type specific downstream probes were employed.
(15) Table 1. Overview of oligonucleotide hybridisation probes used in the NASBA-LUMINEX® experiments.
(16) TABLE-US-00002 TABLE 1 Overview of oligonucleotide hybridisation probes used in the NASBA-Luminex experiments. Transcript splice site/ SEQ. target full-length probe ID. 226{circumflex over ( )}409 CGACGTGAGGTGTATTAAC 61 226{circumflex over ( )}526 GCGACGTGAGATCATCRAG 62 880{circumflex over ( )}2582 TCCTRCAGATTCYAGGTGGC 63 880{circumflex over ( )}2709 TGATCCTRCAGGACGTGGTC 77 880{circumflex over ( )}3358 TGATCCTRCAGCAGCRACG 64 3632{circumflex over ( )}5639 TACATTTAAAAGATGTCTCTTT 65 E6 fl.sup.a AGAYATTATTGTTATAGTKTG 66 E7 fl AGAGCCCATTACAATATTGTA 67 E5 fl TGTCTRCATACACATCATTA 68 E1 fl GTACATTTGAMTTATCACRGA 69 L1 fl AAGGCTCTGGGYCTACTGC 70 p16 ATAGATGCCGCGGAAGGTC 71 ubc TCGCRGTTCTTGTTTGTGGATC 72 apm1 TCCACATGCGGAAGCACACA 73 U1A AGAAGAGGAAGCCCAAGAGCCA 74 .sup.afl, full-length ORF containing RNA sequence
Example 2: Development of Quantitative NASBA
(17) Quantification and internal performance control in the NASBA assays required addition of in vitro-transcribed calibrator RNA (Q-RNA) of known concentration to the NASBA mix. The only difference between wild-type (wt-) and Q-RNA, the hybridisation probe binding region, allowed the discrimination and quantification of the amplimers using LUMINEX® technology. Wt- and Q-RNA were converted into cDNA and coamplified with the same primers allowing competitive amplification of both RNA. The ratio of the two amplimers at the end of amplification reflected the ratio of the two targets, wt and Q, present at the beginning of amplification. The wt-mRNA present in the unknown sample was quantified using an external standard curve. This standard curve was formed by 10-fold dilution series of in vitro-transcribed RNA in a constant amount of Q-RNA. The in vitro-transcribed wt-RNA was expected to exhibit NASBA-properties similar to wt-mRNA.
(18) Q-RNA templates were generated by fusion-PCR, cloned into Bluescript M13-KS vector and linearised with an appropriate restriction enzyme. Using T3 RNA polymerase, Q-RNA was in vitro-transcribed and treated with DNaseI to remove plasmid DNA. The input level of calibrator RNA molecules per NASBA reaction was optimised for accurate quantification of the wt-RNA by spiking defined quantities of Q-RNA into serial dilution series of wt-RNA followed by NASBA LUMINEX® analysis. To obtain the standard curve, wt-versus Q-RNA ratios were computed and plotted against the wt-RNA copy number. Input amounts higher than 106 copies of wt-RNA per assay were not tested, as they were considered clinically irrelevant. This development is exemplarily shown for the E6*I NASBA-LUMINEX® assay (
(19) Optimal Q-RNA concentrations were determined for every NASBA target and are summarised in Table 2. In general, all NASBA standard curves showed a wide dynamic range of 4 to 5 logs, and were of polynomial rather than linear shape. Due to a flat middle part of the polynomial curve, interpolation of RNA concentrations in unknown samples is imprecise in this part. Nevertheless, all NASBA assays allowed faithful discrimination of 10-fold RNA copy number differences. In addition to quantification, a partial or complete failure of the Q-RNA NASBA, with a simultaneous negative result in the wt-NASBA, indicated the presence of NASBA inhibitors, such as ethanol (data not shown).
(20) Taken together, quantitative NASBA LUMINEX® assays were able to quantify over 4 to 5 orders of magnitude 10-fold differences in wt-RNA quantities present in the sample.
(21) TABLE-US-00003 TABLE 2 Detection limits (DL) and Q-RNA amounts of quantitative NASBA-LUMINEX® assays Quantitative Length DL [copy Q-RNA amp- Transcript/ Coding # in vitro [copy # limer splice site potential transcripts] per reaction] [nt] viral 226{circumflex over ( )}409 E6*I, E7 250 1,000 146 226{circumflex over ( )}526 E6*II, E7 25 10,000 133 880{circumflex over ( )}2582 E1C, E2, E5 25 1,000 106 880{circumflex over ( )}2708 E2, E5 250 500 140 880{circumflex over ( )}3358 E1{circumflex over ( )}E4, E5 25 5,000 147 3632{circumflex over ( )}5639 L1 25 50,000 157 E6 fl E6 25 1,000 115 E7 fl E7 250 10,000 145 E1 fl E1 250 1,000 112 E5 fl E5 25 2,000 128 L1 fl L1 250 10,000 132 cellular Apm1 250 1,000 116 U1A 25 1,000 226 Ubc 25 1,000 145 p16.sup.INK4A 25,000 10,000,000 127
Example 3: Sensitivity of NASBA Reactions
(22) The detection of various spliced and full-length RNA from HPV16 as well as cellular transcripts required the design of splice site specific hybridisation probes and transcript specific primers annealing up- and downstream of the splice site (Table 1 and Table 3). Careful design of NASBA primers appeared to be crucial for optimal sensitivity. For detection of U1A housekeeping transcripts, validated sensitive primer sequences have been described (U.S. Pat. No. 5,876,937).
(23) Oligonucleotide primers were tested in NASBA-LUMINEX® reactions using serially diluted in vitro-transcribed wt-RNA from RNA targets from HPV16, and cellular transcripts with optimised Q-RNA quantity input (refer to Table 2). The detection limit was defined as the lowest RNA amount revealing a positive result. Of three independent assays performed on different days the highest detection limit is indicated (Table 2).
(24) Detection limits for all NASBA targets ranged from 25 to 2,500 copy numbers per NASBA reactions. The only exception was the detection of the cellular p16.sup.INK4A requiring 25,000 RNA copies. Moreover, SiHa total RNA was purified, serially diluted and tested by E6*I, E6*II, E7 fl, U1A and Ubc NASBA followed by LUMINEX® hybridisation. As little as 0.3 SiHa cell equivalents could be detected using E6*I and E7 specific NASBA primers while E6*II, Ubc and U1A NASBA primers detected 3 cells (
(25) Table 3. Oligonucleotide primers used in the NASBA-LUMINEX® experiments
(26) TABLE-US-00004 TABLE 3 Oligonucleotide primers used in the NASBA-Luminex experiments RNA target P1 sequence.sup.a SEQ.ID. P2 sequence.sup.b SEQ.ID. 226{circumflex over ( )}409 ACAAGACATACATCGACCGGTCCA 35 GTGTACTGCAAGCAACAGTTA 34 226{circumflex over ( )}526 GATCAGTTGTCTCTGGTTGCA 42 GTGTACTGCAAGCAACAGTTA 34 880{circumflex over ( )}2582 GGATTTCCGTTTTCGTCAAATGGA 30 CATCTGTTCTCAGAAACCATA 29 880{circumflex over ( )}2709 TTAGTATTTTGTCCTGACACA 78 CATCTGTTCTCAGAAACCATA 29 880{circumflex over ( )}3358 CTGTGTTTCTTYGGTGCCCA 33 CATCTGTTCTCAGAAACCATA 29 3632{circumflex over ( )}5639 CATGATAATATATGTTTGTGCGTGCAA 32 AATAGTAACACTACACCCATA 31 E6 fl GTTCTAAWGTTGTTCCATAC 43 ATAGTATATAGAGATGGGAAT 44 E7 fl GTCACACTTGCAACARAAGGTT 45 TTTGCAACCAGAGACAACTGAT 46 E5 fl TCCACAATASTAATACCAATA 47 CCACAACATTACTGGCGTGCT 48 E1 fl CTACTATGTCATTATCGTAGGC 49 GGAGACACGCCAGAATGGAT 50 L1 fl AGGTAACCATAGAACCACTAGGTGTA 51 GACATTTATTTAATAGGGCTGGT 52 p16 TAGGACCTTCGGTGACTGATGATCTA 53 GCACCAGAGGCAGTAACCATGCCCGCA 54 UBC TCACGAAGATCTGCATTGTCA 55 GGATCTCCGTGGGGCGGTGA 56 APM1 ATGTGGTTCTTGAGGTCGTAGTT 57 ATGTGCACCATCTGCGAGGTC 58 U1A.sup.c GGCCCGGCATGTGGTGCATAA 59 CAGTATGCCAAGACCGACTCAGA 60 .sup.aThe 5′-end of the P1 primer contained a T7 RNA polymerase promoter sequence consisting of the following 25 nucleotides: 5′-AAT TCT AAT ACG ACT CAC TAT AGG G-3′ (SEQ ID NO: 82). .sup.bP2 primer contained a 5′-generic sequence (5′-ata tac tac gga tgg cct g-3′) (SEQ ID NO: 83) which was required for the hybridisation with the decorator probe and a 3′-stretch of nucleotides that was identical to the target RNA sequence. .sup.cP1 and P2 U1A primers have been published (Greijer, A. E., C. A. Dekkers, and J. M. Middeldorp. 2000. Human cytomegalovirus virions differentially incorporate viral and host cell RNA during the assembly process. J Virol 74: 9078-82.).
Example 4: HPV16 RNA Patterns in Lesions of Different Grade
(27) The expression of HPV16 full-length and spliced as well as cellular p16INK4A, Apm1 and housekeeping RNA sequences in cervical lesions of different grades was analysed by singleplex quantitative NASBA-LUMINEX® assays for targets listed in Table 2. In collaboration with Dr. C. Clavel (Reims, France), RNA samples purified from cervical exfoliated cells stored in PreservCyt™ medium were obtained. The groups consisted of HPV16 DNA-positive smears with normal (NIL/M, n=25), LSIL (n=24), HSIL (n=24) and CxCa (n=7) cytology. This cross-sectional study aimed at identifying transcripts or transcript patterns being predictive for the presence of low- or high-grade cervical lesions.
(28) Prevalence of Single Transcripts in Different Lesion Types
(29) The spliced transcript 880^2582 was almost exclusively detected in lesions and its prevalence gradually increased from LSIL (30%) to CxCa (57%).
(30) E6*I was detected in 70% of NIL/M, 75% of LSIL, 83% of HSIL and 100% of CxCa cases and, thus, was more often detected than E6*II in all groups (57% of NIL/M, 55% of LSIL, 75% of HSIL and 86% of CxCa cases). The E6*II NASBA primers were also able to anneal to and amplify a 263 nucleotide long E6*I transcript generating a larger RNA amplimer. Despite of the larger size, E6*II primers were even more efficient in amplifying E6*I (this combination was abbreviated with *I(*II)) and identifying a slightly higher prevalence of E6*I in LSIL and HSIL.
(31) In contrast to L1 full-length containing transcripts which were highly prevalent in all lesion types, the spliced transcript 3632^5639, encoding L1 protein, was most abundant in LSIL (60%), and less frequent in CxCa and also NIL/M (42 and 39%, respectively).
(32) Although E7 full-length containing transcripts were already present in almost all of the NIL/M cases, p16.sup.INK4A transcripts were rather rare in this stage but highly prevalent in HSIL to CxCa.
(33) TABLE-US-00005 TABLE 4 Prevalence (%) of transcripts in different cytological groups. HPV16 transcript cellular spliced full-length transcript N *I *I(*II).sup.1 *II 3632{circumflex over ( )}5639 880{circumflex over ( )}2582 880{circumflex over ( )}2709 880{circumflex over ( )}3358 E1 E5 E6 E7 L1 p16 apm1 7 100 100 86 43 57 43 71 100 86 100 100 100 71 86 24 83 92 75 54 42 67 92 96 92 88 96 96 58 75 20 75 85 55 60 30 70 90 95 100 90 95 90 40 75 23 70 65 57 39 4 61 70 96 91 87 96 87 30 91 .sup.1*I(*II), E6*I transcripts amplified by E6*II primers and detected by E6*I probe
Expression Levels of Single Transcripts
(34) Among the upregulated transcripts, the early oncogene transcripts E6*I, *I(*II), E6*II, E6 full-length and E7 full-length showed a highly significant upregulation in their expression between NIL/M and CxCa (data not shown). To analyse whether the ratio of spliced versus full-length E6 transcripts changed relatively during carcinogenesis, E6*I and E6*II expression was correlated to E6 full-length expression. In contrast to E6*I, only the median of E6*II versus E6 full-length ratios was increased during progression from LSIL towards CxCa (
(35) In addition, the transcript 880^2582, encoding a potential LCR transactivator, was highly significantly more often expressed in high-grade lesions (HSIL, CxCa) than in NIL/M.
(36) The cellular marker transcripts p16.sup.INK4A showed a significant upregulation (p<0.05) in high-grade versus low-grade lesions.
(37) Conversely, expression of transcripts, such as 880^3358, 3632^5639 and L1 encoding proteins required for virus capsid formation and release, although frequently present, was downregulated during progression from LSIL to CxCa (data not shown). This downregulation was particularly strong for the 880^1358 expression that was highly significantly reduced from LSIL to CxCa lesions. L1 full-length expression was highly significantly upregulated (p<0.01) from NIL/M to LSIL indicating low viral activity in infections with normal cytology. L1 full-length sequences, which were detectable in all CxCa, tended to be downregulated in their expression in high-grade lesions compared to LSIL (p>0.05).
(38) The quantitative expression data confirmed the already known upregulation of early oncogene transcripts during cancer progression. In contrast to oncogene transcripts, L1 full-length and 880^3358 (E1^E4) RNA were downregulated during progression. In addition, the 880^2582 transcript was almost exclusively detected in cervical lesions.
Example 5: Transcript Pair Patterns
(39) A limitation of the quantitative transcript analysis in cervical smears (Example 4) is the fact that these samples are likely to contain variable amounts of HPV-infected cells. Normalisation for total RNA corrects for variation in the total amount of cells and RNA quality but not for fractions of HPV-infected cells. The number of HPV-infected cells, however, can have a strong influence on the overall HPV RNA concentrations. To normalise for different amounts of HPV infected cells, pairwise pattern analyses of HPV transcripts were undertaken. Assuming that patterns of two or more transcripts are similar in the majority of HPV-positive cells of a given lesion group, this would be irrespective of whether 100 or 1,000 cells are analysed.
(40) Ratios of expression levels of transcript pairs were correlated to lesion groups: high-grade versus low-grade lesions (CxCa/HSIL versus LSIL/NTL/M). Samples, double negative for both transcripts of interest, were excluded from the analysis. Correlations were evaluated using Wilcoxon rank sum test. Significance of differences of transcript pair expression level ratios between groups was sorted and summarised in Table 5.
(41) TABLE-US-00006 TABLE 5 HPV transcript marker combinations from the present invention, their significance and respective cutoffs to discriminate between high-and low-grade lesions Reference Discrimination of high- and Ratio ratio.sup.a Result low-grade lesions (p-value).sup.b high-grade marker 880{circumflex over ( )}2582 versus 3632{circumflex over ( )}5639 >0.003 high-grade lesion <0.01 880{circumflex over ( )}2582 versus 880{circumflex over ( )}3358 >0.002 high-grade lesion <0.01 880{circumflex over ( )}2582 versus U1A >0.005 high-grade lesion <0.01 880{circumflex over ( )}2582 versus Apm1 >0.3 high-grade lesion <0.01 880{circumflex over ( )}2582 versus Ubc >0.03 high-grade lesion <0.01 880{circumflex over ( )}2582 versus E1 >0.02 high-grade lesion <0.05 880{circumflex over ( )}2582 versus E5 >0.01 high-grade lesion <0.05 880{circumflex over ( )}2582 versus L1 >0.1 high-grade lesion <0.05 880{circumflex over ( )}2582 versus E6*I >0.01 high-grade lesion <0.05 E6*II versus U1A >0.7 high-grade lesion <0.01 E6*II versus Ubc >1 high-grade lesion <0.01 E6*II versus Apm1 >6 high-grade lesion <0.01 p16 vs 880{circumflex over ( )}3358 >0.006 high-grade lesion <0.01 high-grade E6*II vs 880{circumflex over ( )}3358 >1.5 high-grade lesion integrated 0.02 and E6*II vs E5 >0.6 high-grade lesion integrated 0.02 integration- E6*II vs 880{circumflex over ( )}2709 >100 high-grade lesion integrated >0.05 marker E6 vs E5 >0.3 high-grade lesion integrated 0.03 E1 vs E5 >0.7 high-grade lesion integrated 0.03 high-grade marker 880{circumflex over ( )}2582 versus 3632{circumflex over ( )}5639 <0.003 low-grade lesion <0.01 880{circumflex over ( )}2582 versus 880{circumflex over ( )}3358 <0.002 low-grade lesion <0.01 880{circumflex over ( )}2582 versus U1A <0.005 low-grade lesion <0.01 880{circumflex over ( )}2582 versus Apm1 <0.3 low-grade lesion <0.01 880{circumflex over ( )}2582 versus Ubc <0.03 low-grade lesion <0.01 880{circumflex over ( )}2582 versus E1 <0.02 low-grade lesion <0.05 880{circumflex over ( )}2582 versus E5 <0.01 low-grade lesion <0.05 880{circumflex over ( )}2582 versus L1 <0.1 low-grade lesion <0.05 880{circumflex over ( )}2582 versus E6*I <0.01 low-grade lesion <0.05 E6*II versus U1A <0.7 low-grade lesion <0.01 E6*II versus Ubc <1 low-grade lesion <0.01 E6*II versus Apm1 <6 low-grade lesion <0.01 p16 vs 880{circumflex over ( )}3358 <0.006 low-grade lesion <0.01 high-grade E6*II vs 880{circumflex over ( )}3358 <1.5 low-grade lesion not integrated 0.02 and E6*II vs E5 <0.6 low-grade lesion not integrated 0.02 integration E6*II vs 880{circumflex over ( )}2709 <100 low-grade lesion not integrated >0.05 marker E6 vs E5 <0.3 low-grade lesion not integrated 0.03 E1 vs E5 <0.7 low-grade lesion not integrated 0.03 .sup.acutoff used for discrimination of high- and low-grade lesions; unit, signals of the expression of transcript 1 divided by transcript 2 .sup.bWilcoxon rank sum test, p-values below 0.05 were considered statistically significant and p-values below 0.01 were considered highly significant
(42) Transcript-to-transcript ratios showing statistically significant and statistically highly significant differences during progression from normal (NIL/M) to CxCa are presented in Table 5. In general, ratios containing at least one spliced transcript were always more significant than ratios utilising full-length transcripts only (state of the art) as determined by NASBA-LUMINEX® tests (Table 6).
(43) TABLE-US-00007 TABLE 6 HPV transcript marker combinations known in the art and from the present invention and their significance as analysed by NASBA-LUMINEX® assays. Discrimination of high- and low-grade Transcript combination lesions (p-value).sup.a State of the art E7 vs E5 p > 0.05 E6 vs E5 p < 0.05 E7 vs L1 p > 0.05 E6 vs L1 p > 0.05 E7 vs Ubc p > 0.05 E6 vs Ubc p > 0.05 Present invention 880{circumflex over ( )}2582 versus 3632{circumflex over ( )}5639 p < 0.01 E6*II versus Ubc p < 0.01 p16 vs 880{circumflex over ( )}3358 p < 0.01 .sup.awilcoxon rank sum test, p-values below 0.05 were considered statistically significant and p-values below 0.01 were considered highly significant.
(44) A limited number of viral transcripts, such as E6*II, *I(*II) and 880^2582, normalised with either cellular transcripts (Apm1, U1A, Ubc) or with spliced viral transcripts (880^3358, 3632^5639) allowed highly significant discrimination (p<0.01) of high-grade CxCa/HSIL lesions versus either low-grade lesions, LSIL alone, or NIL/M alone. These ratios were driven by the marked upregulation of 880^2582 and E6*II in high-grade lesions. In comparison to HSIL/CxCa, LSIL showed a highly significantly lower expression of E6*II versus 880^3358.
(45) In accordance with the literature, p16.sup.INK4A expression appeared to be upregulated in CxCa and HSIL, and when normalised to 880^1358 allowed a highly significant discrimination between CxCa/HSIL and LSIL/NIL/M.
(46) Cellular transcripts, including Apm1, and housekeeping transcripts U1A and Ubc, proved valuable in normalising especially E6*I expression. The resulting normalisations were highly significantly different between high- and low-grade lesions, and independent of the cellular transcript used (
(47) Taken together, the analyses of spliced transcripts rather than analyses of full-length transcripts provided more significant differences between cytological groups. Among the spliced transcripts E6*II and 880^2582 exhibited strongest differences between groups and could be normalised by a variety of cellular and viral transcripts. Moreover, the expression of 880^2582 strongly correlated with the presence of especially high-grade lesions. Thus, 880^2582 may play a so far unknown role during cancer development, making it a novel HPV marker candidate for high-grade and cancerous lesions.
Example 6: Analysis of the Integration Status
(48) Integration of HPV16 is known to be an important factor during carcinogenesis. In most cases integrations present in tumor cells occurred within the E1/E2/E5 region and lead to the disruption of the viral DNA. Early sequences within E6/E7/E1 are probably not destroyed during integration, and therefore the ratio of early transcripts versus 880^3358, 880^2709 or E5 fl could be used to assess the viral integration event.
(49) The median expression of E6*II versus 880^3358 was most significantly increased in high-grade compared to low-grade lesions. This finding is in good agreement with the known high HPV16 integration prevalence in high-grade lesions (
(50) In conclusion, the detection and quantification of E6*II RNA sequences in comparison to either 880^3358 or 880^2709 containing RNA sequences appeared to be highly suitable for the assessment of the HPV16 integration status, especially when only integrated genomes are involved. In addition, the E6*II versus 880^3358 ratio or the E6*II versus 880^2709 ratio was superior compared to other ratios containing full-length transcripts.
Example 7: Combination of Different HPV Transcript Markers for Sophisticated Molecular Diagnostics of HPV-Associated Lesions
(51) Data from Example 5 and 6 suggested that cervical high-grade lesions may exist with distinct but characteristic transcription patterns.
(52) As such, it was found that compared to the commercially available BIOMERIEUX® HPV kit, a combination of (i) 880^2582 versus 3632^5639 and (ii) E6*II versus 880^3358 markedly increased the sensitivity and specificity of predicting the presence of high-grade or low-grade lesions. Using this combination, a total of 7 CxCa cases (100%), 15 HSIL (63%) were correctly identified as high-grade (CxCa/HSIL), and 14 LSIL (70%) and 21 (91%) normal samples were correctly identified as low-grade (LSIL/NIL/M). In comparison to the PreTect HPV Proofer®, the specificity of NASBA-LUMINEX® assay for discriminating high-grade and low-grade lesions strongly increased from 23% to 83% (
(53) In total, this study provided evidence for the existence of diagnostic HPV16 RNA patterns for grading of cervical lesions. Of the 20 analysed transcripts, only 4 viral splice-site containing transcripts and 1 housekeeping transcript (for RNA quality control) may be sufficient for diagnostic application. Alternatively, shorter oligonucleotides or splice site specific antibodies detecting specific epitopes could be used to detect the respective gene products (Table 7).
(54) TABLE-US-00008 TABLE 7 Splice site specific peptides and antibodies Splice Peptide SEQ. Splice site specific SEQ. site sequence ID. nucleotide sequence ID. 226{circumflex over ( )}409 LLRREVY 16 CGTGAGGTGTAT 15 226{circumflex over ( )}526 RREIIK 39 CGTGAGATCATC 38 880{circumflex over ( )}2582 DPADSRW 5 CTRCAGATTCYA 4 880{circumflex over ( )}3358 DPAAATK 12 CTRCAGCAGCRA 12 880{circumflex over ( )}2709 — — CTRCAGGACGTG 82
Example 8: Management of Patients Using the Current Invention
(55) A woman, 35 years-old, consults her gynaecologist during the routine cervical cancer precursor screening program. The Pap-test indicates presence of low-grade lesion (LSIL), while a subsequent HPV genotyping assay reveals the presence of HPV16. The cautious physician suggests an RNA profiling test as described above. The result indicates the presence of 880^2582 containing mRNA and thus a high-grade lesion. The physician proposes a follow-up after 1 year. After one year, the woman is tested again by the Pap-test that, this time, indicates the presence of high-grade lesion (HSIL) and the woman is referred to therapy.
(56) Another woman, 37 years-old, consults her gynaecologist during the routine cervical cancer precursor screening program. The Pap-test indicates presence of high-grade lesion (HSIL), and a subsequent HPV genotyping assay reveals the presence of HPV16. The physician suggests an RNA profiling test as described above. The result indicates the presence of a low-grade lesion or normal cytology. The physician proposes a referral to colposcopy that confirms low-grade lesion.
(57) The example from the 35 years-old woman describes that the RNA profiling test as described above, could predict the future development of high-grade lesions. The examples of the 37 years-old woman describes the fact that the Pap-test is often inaccurate and leads to overtreatment of woman diagnosed HSIL positive. Using the RNA profiling test as described above, could reduce unnecessary referrals to colposcopy and therapy.
(58) In a preferred embodiment, primary screening of women is conducted by a Pap-test and/or a hrHPV DNA genotyping assay. HrHPV-positive women are subsequently analysed by the hrHPV RNA test quantifying the gene products from the present invention. In a first step, E1C and the gene product from a second gene e.g. 3632^5639 are evaluated (criterion 1, according to Example 7). Patients with a high-grade result are referred to therapy. Patients being negative for criterion 1, are analysed for integration of HPV, e.g. by assessing the expression of the gene product from E6*II versus e.g. 880^3358 (criterion 2 according to Example 7). Women being positive for criteria 2 are referred to therapy. Patients negative for criteria 1 and 2, are followed up (