Compounds for alleviating phosphate starvation symptoms in plants

Abstract

The present invention pertains to plant additives capable of alleviating phosphate starvation symptoms in plants and promoting the growth of phosphate deprived plants. These plant additives are molecules comprising the group of formula. ##STR00001##

Claims

1. A method for promoting growth of a plant, comprising adding to growing medium or soil in which the plant is grown a compound of formula (I):
A-R.sub.1  (I) wherein A represents a 4-chlorothiophenol group of formula (II): ##STR00012## linked to R.sub.1 through its sulfur atom, R.sub.1 represents: a hydrogen atom; a group A as defined above, linked to the first group A through its sulfur atom; an electroattractive group selected from the group consisting of O—R, S—R, CO—R and Ar—R, wherein R represents an unsubstituted or substituted, linear or branched C.sub.1-C.sub.6 alkyl group, a C.sub.1-C.sub.6 alkoxy group, a C.sub.1-C.sub.6, alkenyl group, a C.sub.1-C.sub.6 alkynyl group and an aromatic C.sub.4-C.sub.6 group, optionally substituted by a group selected from the group consisting of oxygen, sulfur, a halogen atom, NH, NH.sub.2, OH, and an unsubstituted or substituted C.sub.1-C.sub.6 alkyl group, where Ar represents a C.sub.4-C.sub.6 aromatic group Ar-A, wherein Ar and A are as defined above R.sub.2-A, wherein:  R.sub.2 represents an unsaturated C.sub.4-C.sub.6 cycle, optionally substituted with at least one oxygen atom, where the oxygen atom is linked by a double bond to the C.sub.4-C.sub.8 cycle;  A is a group as defined above, linked to R.sub.2 through its sulfur atom; and a group of formula (III): ##STR00013## wherein B represents an unsaturated C.sub.5-C.sub.6 monocycle or a fused bicycle in which each cycle is an unsaturated C.sub.5-C.sub.6 cycle, optionally substituted with a linear or branched C.sub.1-C.sub.6 alkyl group; R.sub.3 and R.sub.5 are identical or different, and represent independently a group selected from the group consisting of oxygen, sulfur, a halogen atom, NH, NH.sub.2, OH, and an unsubstituted or substituted C.sub.1-C.sub.6 alkyl group; R.sub.4 represents a linear or branched unsubstituted or substituted C.sub.1-C.sub.6 alkyl group.

2. The method according to claim 1, wherein the plant which is growing in the growing medium or soil in which the compound of formula (I) is being added to is Arabidopsis thaliana.

3. The method according to claim 1 wherein the compound of formula (I) is selected from the group consisting of PTN1 of formula (IV): ##STR00014## PTN2 of formula (V) ##STR00015## PTN3 of formula (VI) ##STR00016## PTN4 of formula (VII) ##STR00017##

4. The method according to claim 1, wherein the plant is grown under phosphate limiting conditions.

Description

(1) Foregoing and other objects and advantages of the invention will become more apparent from the following detailed description and accompanying drawing. It is to be understood however that this foregoing detailed description is exemplary only and is not restrictive of the invention.

(2) FIG. 1 shows the identification of compounds altering PHT1;4 expression. (A) Presentation of the screen used to identify PTN compounds. GUS staining of pht1;4-1 plantlets germinated and grown 5 days on +Pi (500 μM) and transferred for 5 days on +Pi+DMSO, −Pi (15 μM) +DMSO or on −Pi+phosphatin1 (PTN1 25 μM). (B) Structure of PTN1.

(3) FIG. 2 shows that phosphatins (PTNs) reduced the PHT1;4 expression in a dose dependant manner. (A) Structure of Phosphatin 2 (PTN2). (B) Impact of PTN1 and PTN2 treatment on PHT1;4 transcript level. Measures were performed using qPCR experiments on root mRNA extracted from plants treated or not with the PTNs.

(4) FIG. 3 shows that PTN1 modulated Pi uptake. (A) Impact of PTN1 treatment on various PHT1 transcript level. Measures were performed using qPCR experiments on root mRNA extracted from plants treated or not with 40 μM (−Pi: white bars; −Pi+PTN1: dark grey bars; +Pi: light grey bars). (B) Impact of PTN1 on phosphate influx. (C) Impact of PTN1 on total phosphorus content. Measures were performed using Inductively Coupled Plasma (ICP) assays. n.d. for not detected expression. Asterisks represent significant difference between −Pi and −Pi+PTN1 (student's t test, P<0.01). 7-day-old plantlets have been used for various experiments.

(5) FIG. 4 shows that PTN1 modulation of phosphatases expression did not impact the phosphatase activity by measuring the impact of PTN1 on the phosphatase activity. Assay of the activity on root samples of 7-days-old plants grown on −Pi, −Pi+PTN1 40 μM or +Pi conditions.

(6) FIG. 5 shows that PTN1 reduced metabolic stress during phosphate starvation. (A) Measure of transcript level (by qPCR) of genes involved in the lipids synthesis for plants grown on −Pi, −Pi+PTN1 (40 μM) and +Pi during 14 days. (B) Balance between phospholipids (white sectors) and glycolipids (grey sectors) for plants grown on −Pi, −Pi+PTN1 and +Pi media. (C) Lipid composition of wild-type plants grown on low Pi (white bars), low Pi+PTN1 (dark grey bars) and high Pi (light grey bars). Total lipid was extracted from the aerial part of 10-day-old plants. Asterisks represent significant differences between −Pi and −Pi+PTN1 (student's t test, P<=0.01).

(7) FIG. 6 shows the structures of compounds tested for their effects on the primary root growth of wild-type (WT) seedlings (A, PTN3; B, PTN4) Active compounds. (C,D) Inactive compounds.

(8) FIG. 7 shows that PTNs unlocked the primary root arrest. (A) Identification of optimal PTN1 level to suppress Pi starvation effect on root growth. Similar effect can also be observed with PTN3 and PTN4 using respectively 100 μM or 10 μM application (B) Analysis of cell cycle using cycB1::GUS marker. Pictures of root tip of wild type (top) and cycB1::GUS (bottom) grown on −Pi, −Pi+PTN1 40 μM or +Pi conditions, after GUS staining. (C) Measure of cortical cell size on WT plantlets grown on the different medium (PTN4 10 μM). (A,B,C) 7-day-old plantlets have been used for various experiments. (D) Effect of Pi concentration on PTN effect on the primary root length. For the measure of the primary root growth, plants were grown during 5 days on Pi rich medium and transferred on various conditions tested during 24 hours (PTN4 10 μM). The line (between 6 an 7 mm) shows the maximum gain of growth conferred by PTN1 presence. (E) Effect of PTN treatment on mutants affected in the root architecture response to Pi starvation. Measure of the primary root growth of WT plants, pdr2 and phr1 mutants 9 days after germination on the different medium (PTN1 40 μM).

(9) FIG. 8 shows that PTN1 addition did not impact the primary root growth of Pi insensitive mutants, by measuring the impact of PTN1 on the primary root growth of mutants altered in their root sensitivity to Pi starvation. Measure of the primary root growth of 7-days-old plants grown on −Pi, −Pi+PTN1 40 μM or +Pi conditions.

(10) FIG. 9 shows that PTN1 effects were independent of Fe signaling using a test of the importance of the iron for PTN1 effects. (A) Curves of optical density of PTN1 at 40 μM, FeCl2 at 10 μM and 40 μM PTN1+ 10 μM FeCl2. (B) Fe content assay by ICP of plantlets grown on −Pi, −Pi+PTN1 40 μM and +Pi.

(11) FIG. 10 shows that PTN1 unlocked the general growth during a Pi starvation. (A) Effect of PTN1 addition on leaves growth. Shoot of 28-days-old plants grown on +Pi, −Pi or −Pi+PTN1 conditions. (B) Measure of the shoot area of Col-0 and lpr1 mutant, performed after 28 days of growth. (C) Anthocyanins content for plants grown on −Pi, −Pi+PTN1 or on +Pi. (D) Starch content revealed by shoot staining of with lugol.

(12) FIG. 11 shows that PTN1 addition led to an increase of the growth of the lpr1 mutant by measuring the impact of the lpr1 mutation on the shoot growth in Pi starvation conditions. Picture of WT and lpr1 28-days-old plants grown on −Pi, −Pi+PTN1 40 μM or +Pi conditions. Scale: 1 cm.

(13) FIG. 12 shows that the maintain of the primary root growth did not impact the gene regulation using a qPCR assay of genes regulated by Pi starvation in the WT Col-0 and the mutant lpr1 14 days-old plants. Same expression patterns were observed between the two lines.

EXAMPLE: IDENTIFICATION Of PHOSPHATIN, A COMPOUND ALLEVIATING PHOSPHATE STARVATION RESPONSE In ARABIDOPSIS

(14) 1) Material & Methods

(15) Plant Materials and Growth Conditions

(16) A “chemical genetics” approach has been carried out to isolate compounds that inhibit the phosphate (Pi) response in Arabidopsis thaliana. Compounds were screened for their ability to inhibit the expression of a phosphate starvation marker, namely the high affinity Pi transporter PHT1,4 gene. For the screening, the A. thaliana pht1;4-1 line (ecotype Wassilewskija) was chosen (Misson et al., 2004). It contains a T-DNA construct inserted into Pht1;4 gene creating a transcriptional fusion with a GUS reporter gene. For phenotypic analyses, A. thaliana Columbia and various lines derived from this ecotype were used. They are either transgenic lines expressing reporter gene as cycB1::GUS (Colón Carmona et al., 1999), MGD3::LUC, PHT1;4::LUC, At1g73010::LUC or various mutants affecting root response to low Pi such as: pdr2 (Ticconi et al., 2004), lpr1, lpr2 (Svistoonoff et al., 2007), lpi1, lpi2 and lpi3 (Sanchez-Calderon et al., 2006).

(17) For in vitro analyses, seeds were surface-sterilized and sown in vitro on square Petri plates with solid MS/10 medium (0.15 mM MgSO.sub.4, 2.1 mM NH.sub.4NO.sub.3, 1.9 mM KNO.sub.3, 0.5 or 0.005 mM NaH.sub.2PO.sub.4, 0.3 mM CaCl.sub.2, 0.5 μM KI, 10 μM Fe, 10 μM H.sub.3BO.sub.3, 10 μM MnSO.sub.4, 3 μM ZnSO.sub.4, 0.01 μMCuSO.sub.4, 0.01 μM CoCl.sub.2, 0.1 μM Na.sub.2MoO.sub.4, 2 μM EDTA, 0.03 μM thiamine, 0.24 μM pyridoxine, 0.4 μM nicotinic acid, 55 μM inositol, 14 mM MES (pH 5.7)), 0.5% sucrose and 0.8% agar. In the Pi deficient medium, NaCl (0.5 mM) was used to replace the equivalent amount of sodium provided by NaH.sub.2PO.sub.4. For controls of the effects of the compounds, 1% of DMSO (Dimethyl sulfoxid, SIGMA, 472301), solvent for the tested compounds, was added. After 2 days at 4° C., the plates were placed in a vertical position and plants were grown in a culture chamber under a 16 h light/8 h dark regime (24/21° C., 150 μE m.sup.−2s.sup.−1). For 4 weeks culture, large plates (24×24 cm) were placed in a horizontal position. Root architecture and aerial part area were quantified using program ImageJ.

(18) Chemical Genetics Screening

(19) For the screening, the LATCA collection of 3600 biologically active compounds (Zhao et al., 2007) was used at a final concentration of 25 μM in 1% DMSO. Four to five Arabidopsis seeds of pht1;4-1 (Misson et al., 2004) reporter line were sown in 96-well plates containing 100 μL liquid MS/10 medium with 500 μM of Pi at pH 5.7. After 2 days at 4° C., plants were grown for five days in a culture chamber under a 16 h light/8 h dark regime (24/21° C., 150 μE m.sup.−2s.sup.−1). Medium was then replaced by MS/10 with only 5 μM Pi and the tested compounds were added to the 96-well plates. Positive and negative controls were included by incubating seedling in MS/10 solutions containing 1% DMSO and completed with 5 or 500 μM Pi respectively (giving rise to −Pi or +Pi medium). Five days later, plantlets were analysed by GUS staining to assay the activity of the reporter gene inserted in pht1;4 gene. 100 μL of GUS staining solution were added in each well and plates were incubated 3 hours at 37° C. Then, plates were analysed using a MZ16 stereomicroscope (Leica microsystems, Germany).

(20) GUS Staining

(21) The GUS activity was detected as previously described by Jefferson et al. (1987), using a GUS staining solution containing 50 mM sodium phosphate buffer pH 7.0; 0.01% Triton X-100, 1 mM K.sub.3Fe(CN).sub.6, 1 mM K.sub.4Fe(CN).sub.6, 1 mg/ml 5-bromo-4-chloro-3-indolyl B-D-glucuronide (X-Gluc). For cycB1::GUS staining, plants were incubated 6 hours at 37° C.

(22) Bioluminescence Quantification

(23) Plants carrying the luciferase gene marker were analysed with the Bioluminescence Imaging System LV200 (Olympus, Japan) and PS-25 camera (Andor, US). Signals were quantified with ImageJ software.

(24) Transcriptome Analysis and Quantitative Real-Time Polymerase Chain Reaction

(25) Plant RNA was extracted with the RNeasy kit (QIAGEN, France). For transcriptome data, RNA were analysed by the CATMA technology (Complete Arabidopsis Transcriptome Microarray). For qPCR, poly(dT) cDNA were prepared from 500 ng total RNA with Superscript III reverse transcriptase (Invitrogen, France) and analysed on a LightCycler 480 apparatus (Roche Diagnostics, France) with the SYBR Green I Master kit (Roche Diagnostics, France) according to the manufacturer's instructions. Targets were quantified with specific primer pairs designed with Primer3 website (http://frodo.wi.mit.edu/primer3/) (see Table II below). Biological triplicates were performed for all experiments. Expression levels were normalized using At2g16600, At3g04120, At1g35160 and At1g32050 genes.

(26) TABLE-US-00002 TABLE II List of primers used for RTqPCR amplicon AGI forward reverse size PHT1; 1 CAACTTGAGGAGGCGTTGA GGTTTTGGTTGGGATTTGG 234 (SEQ ID NO: 3) (SEQ ID NO: 4) PHT1; GACTACCCACTTTCTGCCACCAT CTTTCCTCAAGCTCGATATCTGT 384 1_2_3 (SEQ ID NO: 5) (SEQ ID NO: 6) PHT1; 4 CCTCGGTCGTATTTATTACCACG CCATCACAGCTTTTGGCTCATG 239 (SEQ ID NO: 7) (SEQ ID NO: 8) PHT1; 5 CGTTGTTGATGCTTGCTTGT CTACCGGAATTTGCCACAGT 157 (SEQ ID NO: 9) (SEQ ID NO: 10) PHT1; 7 TCCCTCATTGTTTTGGGTGT GTTCGTTCTCACCGGACATT 106 (SEQ ID NO: 11) (SEQ ID NO: 12) PHT1; 8 AAACGCCACCAAGAATCAAG TCCCGGCTAGGTTTAGGTCT 180 (SEQ ID NO: 13) (SEQ ID NO: 14) MGD2 ACAAGAAATTGGCATCTGCAT TGGTCCAGCTTTTGTGATGA 125 (SEQ ID NO: 15) (SEQ ID NO: 16) MGD3 AGAGGCCGGTTTAATGGAGT CATCAGAGGATGCACGCTAA 122 (SEQ ID NO: 17) (SEQ ID NO: 18) SQD2 TACCTGAAGCTCGGATTGCT TGTGAGAGTTCATCGCCTTG 118 (SEQ ID NO: 19) (SEQ ID NO: 20) SQD1 AGCTTGGGCTAGACGTGAAA AGGCTCAAGTCCAAGTTCCA 110 (SEQ ID NO: 21) (SEQ ID NO: 22) PLDz2 TGCATTGCTGGAGACAAAAG TTTTGAAGCCGTTTCTTGCT 114 (SEQ ID NO: 23) (SEQ ID NO: 24)

(27) Quantification of Macro- and Microelements, Anthocyanins and Lipids

(28) For the quantification of ions content, 50 mg of dry weight of each sample were mineralized in 14% HNO3 using a MarsX microwave system (CEM) for the determination of macro- and microelements by inductively coupled plasma optical emission spectrometry (ICP OES Vista MPX, Varian). Biological triplicates were performed for all experiments.

(29) Lipids and anthocyanins were analyzed as previously described by Jouhet (2003) and Ticconi (2001).

(30) Phosphate Uptake Experiments

(31) Phosphate uptake experiments were performed as previously described by Narang et al. (2000). 24 seedlings per conditions were incubated separately in a phosphate incubation solution containing .sup.33PO.sub.4 (5 mM MES, 0.1 mM CaCl.sub.2, 20 μM KH.sub.2PO.sub.4, 0.15 μCi/ml .sup.33PO.sub.4) for 2 h. After incubation in the uptake solution, plantlets were transferred to a chilled desorption medium (5 mM MES, 0.1 mM CaCl.sub.2, 1 mM KH.sub.2PO.sub.4) for 2 h at 4° C. Then, the seedlings were dried in scintillation vials at 60° C. overnight. An amount of 2 ml of scintillation cocktail (InstaGel, PerkinElmer, Wellesley, Mass., USA) was added and the radioactivity was measured with a scintillation analyzer (TRICARB, Packard instrument company). The amount of phosphate absorbed during the experiment was calculated and normalized per cm of root.

(32) Protein Extraction and Phosphatase Activity

(33) Soluble proteins were extracted with 50 mM TRIS pH 7.4 and 1 mM DTE (1,4-Dithioerythritol, Sigma, 6892-68-8). The protein concentration was determined by the Bradford methods, using albumin from bovine serum (BSA, Sigma, 9048-46-8) as a standard. The phosphatase activity in solution was determined as previously described by Kolari and Sarjala, (1995), by measuring the release of nitrophenol from 0.6 mM p-nitrophenylphosphate in 50 mM sodium acetate pH 5. Reactions were incubated at 30° C. for 30, 60 and 90 mM and were stopped with 10% of Na2CO3, after which the absorbance at 405 nm was measured.

(34) Starch Staining

(35) Starch staining was performed according to Zakhleniuk et al. (2001). Aerial part of plants was placed 6 h in EtOH 90% before to be iodine stained for 30 min in lugol (lugol solution; Sigma, France) and washed several times in water.

(36) Statistical Analyses

(37) Data were analysed by student's t test. Asterics represent means that were statistically different at P<0.05 as mentioned.

(38) 2) Results

(39) Identification of Compounds Inhibiting the Low-Phosphate Induced PHT1;4 Gene

(40) The commercially available LATCA library (UC Riverside) containing 3,580 biologically active compounds (Zhao et al., 2007) was screened at 25 μM to identify compounds inhibiting the expression of PHT1;4. This gene is strongly induced by Pi starvation as revealed by previous studies (Karthikeyan et al., 2002; Misson et al., 2004; Misson et al., 2005). The A. thaliana line used for the screen, pht1;4-1, contained a GUS transcriptional fusion with the endogenous PHT1;4 gene allowing to monitor its expression (Misson et al., 2004). For the screen, seedlings were germinated and grown during the first five days on Pi rich medium (+Pi, 500 μM) before transfer on Pi limiting medium (−Pi, 5 μM) with the tested compounds for five more days. Then, GUS staining was performed to monitor the expression of PHT1.4.

(41) This screen identified 21 compounds that partially (alleviate) or totally inhibit PHT1;4::GUS expression. For most of them the reduced expression of the marker turns out to result from the presumably toxic effects of the tested compound (revealed by growth arrest of the plantlets). For two compounds the reduced expression of the reporter gene was not explained by toxicity (see below). Commercially available compounds MWP00917 and KM03772 in the Maybridge library were named Phosphatin1 (PTN1) and Phosphatin2 (PTN2) respectively (see FIGS. 1 (A), (B) and FIG. 2 (A)). Both compounds assayed on PHT1;4 acted in a dose dependant manner and PTN1 was found twice more efficient than PTN2 (see FIG. 2 (B)) and was therefore selected to pursue experiments.

(42) PTN1 Reduced Gene Expression Modulation by Phosphate Starvation

(43) To investigate on a wider scale the putative Phosphatin1 effect, a transcriptional analysis of the global genome was performed using the CATMA technology (http://www.catma.org/, URGV, France). It was compared transcript expression in roots of 14-days-old plantlets, grown in −Pi, −Pi+PTN1 or +Pi.

(44) When compared to the −Pi conditions, the +Pi conditions modulated the expression of 1062 genes: 783 repressed and 279 significantly induced (see Table III below), whereas PTN1 modulated 2667 genes: 1001 induced and 1666 repressed (based on statistical analysis, Bonferroni test <0.05, with more than two fold change) (see Table ff1).

(45) Table III: Comparison of PTN1 treatment and phosphate supply on global transcriptomic analysis. For this analysis, 14-days-old WT root samples of plants grown on −Pi, −Pi+PTN1 (40 μM) and +Pi were used. Data are expressed as ratio values between +Pi and −Pi or −Pi+PTN1 and −Pi respectively. Number of genes regulated by Pi and PTN1 addition and percentage of genes regulated by +Pi also regulated by PTN1 (selected genes exhibited at least two fold change difference with −Pi control and statistical Bonferroni test <0.05) are shown.

(46) TABLE-US-00003 1666 genes 1001 genes repressed by PTN1 induced by PTN1 783 genes repressed +Pi/−Pi 316 (40.3%) 30 (3.8%) 279 genes induced +Pi/−Pi 11 (3.9%) 115 (41.2%)

(47) Interestingly, a broad part of genes whose expression was modulated by +Pi turns out to be modulated in a similar way by PTN1 addition in −Pi conditions (40% and 41% respectively for repressed or induced transcripts (Table III). Only very few genes (around 4%) were found significantly de-regulated by PTN1 addition in an opposite way when compared with +Pi treatment (Table III). For genes modulated by PTN1 and not by Pi supply, analyze with Genevestigator (https://www.genevestigator.com) also pinpoint links with phosphorus metabolic process and phosphate-containing compound metabolic process. This transcriptomic result indicated that PTN1 overall mimicked the addition of Pi in the growth medium.

(48) In order to refine this transcriptomic analysis, it was looked whether PTN1 modulated the expression of a particular class of genes, as defined by Thibaud et al. (2010) according to their local or long distance regulation by phosphate. Among the so-called systemic genes that were repressed or induced by Pi in these experimental conditions, respectively 65% and 55% were also regulated by PTN1 in the same direction as Pi. Many of them have predicted function involved in Pi recycling, recovery or transport. Among the so-called local genes that were repressed by Pi in these experimental conditions, 45% were also repressed by PTN1. These genes are transcription factors, metal-related genes, linked to hormone or stress-related response, or else involved in the development.

(49) All together this analysis revealed that PTN1 mimicked Pi in the regulation of many genes involved in different metabolisms, and there was no specificity with respect to the local or long distance regulation. The physiology of the plants treated by Phosphatin was investigated to measure the impact of the modifications triggered by PTN1 addition.

(50) PTN Reduced the Metabolic Adaptation Triggered by Pi Starvation

(51) The reduced level of expression of PHT1;4 as assayed by GUS staining was confirmed by qPCR experiments in WT seedlings (see FIG. 3 (A)) and by transcriptomic analysis reported above. This last experiment revealed also the down regulation of other PHT1 genes such as PHT1;5 and PHT1;8. All these genes have been reported to be down regulated by Pi presence in the past (Mudge et al., 2002; Misson et al., 2004; Shin et al., 2004; Misson et al., 2005; Nagarajan et al., 2011). To investigate further the impact of PTN1 on the PHT1 genes, the expression of several additional members of this family were tested. As shown in FIG. 3 (A), PTN1 strongly reduced (at least 50%) the impact of Pi starvation on the level of induction of all these transcripts. Since the PHT1 was the main Pi-influx transporters during Pi-starvation and that the expression of several PHT1 genes was less induced by −Pi in seedlings treated with PTN1, it was tested whether Pi uptake was also reduced by PTN1. Pi uptake experiments and analysis of phosphorus content were performed to measure the impact of these modifications on Pi import. The Pi influx capacity is higher in Pi-starved seedlings (FIG. 3 (B), compare −Pi with +Pi). PTN1 reduced (by 25%) also the Pi uptake capacity. Seedlings treated with PTN1 contained higher amounts of phosphorous than the −Pi control (+90% and +40% in shoot and leaves respectively, FIG. 3 (C)).

(52) Another way to recover Phosphorus in the medium for plants is to secrete acid phosphatase (PAP) to mobilize putative organic Pi present in the growth medium. As already described (del Pozo et al., 1999), it was observed that Pi-starvation stimulated transcription of the PAP12, PAP17 and PAP22 genes as well as the phosphatase activity (FIG. 4). However, although PTN1 reduced the expression level of these three PAP genes, the phosphatase activity was not altered (FIG. 4).

(53) The lipid composition was also checked. The conversion of phospholipids to galactolipids and sulfolipids is a well-established response to Pi starvation (Dormann and Benning, 2002; Nakamura et al., 2009; Moellering and Benning, 2010; Nussaume et al., 2011). This lipid conversion relies on several enzymes such as SQD2, MGD3, PLDz2, SQD1 and MGD2 whose gene expression is induced during the starvation (Dormann and Benning, 2002; Nakamura et al., 2009; Moellering and Benning, 2010; Nussaume et al., 2011). The transcriptomic analysis showed that PTN1 down regulated several of these genes including PLDζ2 and MGD3. This result was confirmed and extended by qPCR showing that PTN1 repressed the expression of genes SQD2, MGD3, PLDz2, SQD1 and MGD2 (see FIG. 5 (A)).

(54) It was then determined whether lipid composition was altered in seedlings treated by PTN1. As shown in the FIG. 5 (B), the ratio of phospholipids onto glycolipids (galacto and sulfolipids) is 19%/81% and 46%/54% in Pi-rich versus Pi-starved seedlings, respectively. Interestingly, in seedlings grown on a −Pi medium containing PTN1, this ratio was 25%/75%; this was intermediate between the two controls. Therefore, PTN1 significantly reduced the effect of Pi-starvation on the overall lipid composition.

(55) The remodelling of glycerolipids consists into a hydrolysis of several phospholipids (phosphatidylcholine (PC), phosphatidylinositol (PI) and phosphatidylethanolamine (PE)) and into an increase of the synthesis of galactolipids (digalactosyldiacylglycerol or DGDG). As shown in FIG. 5 (C), −Pi seedlings contained much less PC and PE than +Pi seedlings, and PTN1 partially reverted the effect of −Pi (FIG. 5 (C)). Conversely, the DGDG content, which increased in Pi-starved plants, was reduced by 27% by PTN1 (FIG. 5 (C)). These biochemical analyses demonstrated that PTN1 reduced the phospholipids conversions of Pi-starved plants, in accordance with the transcriptomic results.

(56) PTN1 Promoted Root Growth of −Pi Seedlings

(57) As reported above, PTN1 reduced significantly several of the adaptative mechanisms known to help the plant to cope with sparse Pi availability (i.e. increase of Pi uptake and phospholipids recycling). Thus, one can expect that PTN1 reduced also plant growth by inhibiting these adaptative responses. Indeed, the loss of function mutant of PHR1, a transcription factor regulating many of the low-Pi responses (Rubio et al., 2001; Bustos et al., 2010; Thibaud et al., 2010, displays a marked growth reduction (Bustos et al., 2010). The effects of PTN1 and PTN4 (an active structural analogue of PTN1; see FIG. 6) was therefore monitored on plant growth. Unexpectedly and in contrast to what it was expected, PTN1 turned out to promote the primary root growth in a dose dependent manner (FIG. 7 (A)). Like for the inhibition of PHT1;4, a maximum effect of PTN1 was observed at 40 nM.

(58) Importance of 4-Chlorothiophenol Motif

(59) This impact on root growth of PTN compounds provided an easy quantitative screen to monitor PTN effects on plants. It was therefore used to test various analogues of PTN1 in order to try to identify the active motif present in PTN1 structure. Both PTN1 and PTN2 presented a common structure composed of a benzene aromatic cycle with sulfur and chlorine residue in para disposition. Such structure (4-chlorothiophenol named PTN3) was commercially available and could therefore be tested (see FIG. 6 (A)). It sustained also the primary root growth, and repressed PHT1;4 expression but requested higher concentration (100 μM; FIG. 7 (A)). Several other analogues containing similar putative active motif were also tested for their inhibitor activity of PHT1;4 expression and their effect on the growth (see FIG. 6). One of them, named PTN4, containing like PTN1 two 4-chlorothiophenol motifs, was found active at a lover concentration (10 μM; FIG. 7 (A)). This analysis confirmed the activity of 4-chlorothiophenol structure. The importance of the sulfur environment was also highlighted as PTN5 and PTN6, which present additional bonds to methyl or oxygen, were found inactive (see FIG. 6 (C), (D)).

(60) Detailed Analysis of PTN Impact on Root Growth

(61) To better understand how PTN promoted root growth of −Pi seedlings, it was investigated the meristematic activity and the cell elongation rate, two key parameters of growth. Meristem activity was tested using the cell cycle marker cycB1::GUS. Cyclin B1 is expressed predominantly during G2/M phase of the cell cycle (Colón Carmona et al., 1999). As already described by (Sanchez-Calderon et al., 2005), this marker is expressed in the root meristematic zone of seedlings grown on +Pi medium, but not in −Pi seedlings. At 40 μM of PTN1, the CycB1 was expressed in the root tip of −Pi seedlings but there were fewer stained cells than in the +Pi control (see FIG. 7 (B)).

(62) As published by Reymond et al. (2006), Pi starvation strongly reduces root cell elongation as monitored on epidermis cells. This observation was confirmed on cortical cells and it was found that their length is reduced by 50% (FIG. 7 (C)). Interestingly, PTN1 restored root cell elongation of −Pi seedlings to an extant closed to the untreated control grown on a +Pi medium (FIG. 7 (C)). These results showed that PTNs acted on both the meristematic activity and the cell elongation rate to sustain root growth on −Pi medium.

(63) Since PTN somehow mimicked Pi, it was experimentally determined which external Pi concentration was necessary to obtain the same primary root growth as with 40 uM of PTN4 on a −Pi medium. In the range of Pi concentrations tested (15-250 uM), the primary root length was proportional to the external Pi (grey bars in FIG. 7 (D)). The addition of 10 uM of PTN4 (FIG. 7 (D)) or PTN1 (not shown) improved root growth until 50/75 μM of Pi. At 75 μM of Pi and above, no significant differences were observed between plants grown with or without PTNs. Interestingly, at Pi concentrations between 15 and 75 μM, the sustained growth promoted by PTNs was found seemingly independent of external Pi.

(64) A few mutants altering root growth in response to low Pi were available offering additional tools to investigate the PTNs effects. The lpi mutants (Sanchez-Calderon et al., 2006), lpr1 and lpr2 (Svistoonoff et al., 2007) have been identified previously on the basis of their reduced sensitivity to Pi starvation effects on root architecture. When grown on −Pi medium they display a longer primary root than the WT control. Excepted lpr2, no additive effect of PTN1 or PTN4 were found to affect the primary root growth of lpr1 or lpi mutants (see FIG. 8). By contrast, the lpr2 mutant exhibited a moderate root length phenotype compared to lpr1 and lpi, and it responded to PTNs leading to a 50% increase of the primary root length (Fig S4).

(65) The pdr2 mutant shows an hypersensitive response to low Pi and exhibits a very short primary root when grown on low Pi (Ticconi et al., 2004). Epistasis analysis indicates that PDR2 (coding for a P-type 5 ATPase) and LPR1 acted in a same functional pathway controlling the root growth response to −Pi (Ticconi et al., 2009). Interestingly, PTN1 substantially reverted the root growth defect of pdr2 (FIG. 7 (E)).

(66) The response of phr1 mutant was also investigated because PHR1 was described as a major regulator of the transcriptional response to a Pi starvation (Franco-Zorrilla et al., 2004). Compared to the WT, the phr1 seedlings have a shorter primary root in both a −Pi and a +Pi medium (Bustos et al., 2010). Like for pdr2, phr1 responded to PTN1 which partially alleviated the of root growth restriction imposed by −Pi (FIG. 7 (E)).

(67) These results showed that the LPR2, PDR2 and PHR1 functions are not essential for PTN1 to restore root growth in low Pi.

(68) The primary root growth response to a Pi starvation has been shown to depend on the iron concentration in the medium (Svistoonoff et al., 2007; Ward et al., 2008). Indeed, reducing iron concentration in the medium suppressed root architecture modifications associated to Pi starvation. A hypothesis that could explain the PTN1 effect on root growth is the chelation of iron in a biologically inactive form. However, the absorption spectrum of a solution containing PTN1 and Fe.sup.2+ (FeCl.sub.2) is identical to the PTN1 control without FeCl.sub.2 (see FIG. 9), suggesting an absence of chemical interaction between these two compounds.

(69) This was reinforced by ICP analysis of the Fe content in plants (FIG. 9 (B)). The Pi starvation strongly increased the Fe content both in leaves and in roots as previously described (Hirsch et al., 2006). Nevertheless, PTN1 did not reduce the Fe content (FIG. 9 (B)). Accordingly to these chemical results, PTN1 action seemed to be independent of iron.

(70) PTNs Reduced the Growth Restriction

(71) As PTNs sustained root growth, it was investigated whether it also affects the development of the aerial part. Although plants cultivated four weeks on −Pi+PTN1 are not as big as those growing on +Pi, the PTN compound significantly improved leaf growth (+50% rosette area) on the −Pi medium (see FIG. 10 (A), (B)). Same results were obtained with PTN4 (data not shown). Together with results on roots, this showed that the PTNs substantially improve the whole plant growth in low Pi conditions, suggesting that these compounds unlock a mechanism restricting growth.

(72) The accumulation of anthocyanin and starch in leaves are two others Pi-starvation responses shared by many plants (Poirier and Bucher, 2002; Ciereszko et al., 2001). As shown in FIGS. 10 (A), (C), and (D), PTN1 strongly reduced these two symptoms. Anthocyanin accumulated in PTN1-treated plants is around 60% less than in the control grown on −Pi (FIG. 10 (C)). Starch accumulation, as assessed by lugol staining, was also severely attenuated by PTN1 (FIG. 10 (D)). These results indicate that PTN1 reduced some main metabolic consequences associated with Pi starvation.

(73) PTNs somehow phenocopy the growth and development of the lpr1 mutants. Indeed, the lpr1 plants display a long root (Reymond et al., 2006; Svistoonoff et al., 2007) and a larger rosette when grown in −Pi (see below). If LPR1 is the target of PTN (i.e. inhibits its expression our activity), then it was expected that the PTN did not improve further the growth of lpr1. When grown on −Pi conditions, lpr1 plants displayed a rosette 30% larger than in the WT control (FIGS. 10 (B) and 11). Unlike roots, PTN1 and PTN4 further increased the growth of the lpr1 rosette (+25%) (FIGS. 10 (D) and 11). It was also observed that leaves of lpr1 grown in −Pi were darker than in +Pi, most probably because of anthocyanins accumulation, and that PTN1 substantially suppressed this accumulation (FIG. 11). Therefore, although root growth of lpr1 is not improved by PTN, the aerial part still responded to PTNs.

(74) The molecular responses of lpr1 when treated with PTN1 was also investigated. First, it was observed that the level of the induction of genes involved in Pi uptake (PHT1;4, PHT1;8), Pi recycling (MGD3, PLDz2, SQD2), and Pi signaling (SPX1) were similar between Col-0 and the mutant, grown in −Pi conditions (see FIG. 12). Second, PTN1 repressed the expression of these genes in lpr1 to a similar level as observed in the WT (FIG. 12).

(75) Altogether, the growth and molecular results showed that the plant responses to PTN1 were not altered in the lpr1 mutant, suggesting that LPR1 is not a target of PTNs. However, it cannot be excluded the hypothesis that LPR1 is involved for root growth phenotype in presence of PTN1.

REFERENCES

(76) Abel S (2011) Curr Opin Plant Biol. 14: 303-309 Arnaud C, et al. (2010) C R Biol. 333: 335-343 Bustos R, et al. (2010) PLoS Genet. 6 Ciereszko I, et al. (2001) Planta 212: 598-605 Colón Carmona A, et al. (1999) Plant J. 20: 503-508 del Pozo J C, et al. (1999) Plant J. 19: 579-589 Dormann P and Benning C (2002) Trends Plant Sci. 7: 112-118 Drew M C (1975) New Phytol. 75: 479-490 Franco-Zorrilla J M, et al. (2004) J Exp Bot. 55: 285-293 Gilbert N (2009) Nature 461: 716-8 Hirsch J, et al. (2006) Biochimie 88: 1767-1771 Hurley B A et al. (2010) Plant Physiol. 153: 1112-1122 Karthikeyan A S, et al. (2002) Plant Physiol. 130: 221-233 Kobayashi K et al., (2009) Plant J. 57: 322-331 Kolari K K and Sarjala T (1995) Tree Physiology 15: 747 Linkohr B I, et al. (2002) Plant J. 29: 751-760 Lopez-Bucio J, et al. (2002) Plant Physiol. 129: 244-256 Misson J, et al. (2004) Plant Mol Biol. 55: 727-741 Misson J, et al. (2005) Proc Natl Acad Sci USA 102: 11934-11939 Moellering E R and Benning C (2010) Trends in Plant Science Mudge S R, et al. (2002) Plant J. 31: 341-353 Nagarajan V K, et al. (2011) Plant Physiol. 156: 1149-1163 Nakamura Y, et al. (2009) Proc Natl Acad Sci. 106: 20978 Narang R A, et al. (2000) Plant Physiol. 124: 1786-1799 Nussaume L, et al. (2011) The Plant Plasma Membrane: 237-251 Peret B, et al. (2011) Trends Plant Sci. 16: 442-450 Poirier Y and Bucher M (2002) The Arabidopsis Book Raghothama K G (1999) Annu Rev Plant Physiol Plant Mol Biol. 50: 665-693 Reymond M, et al. (2006) Plant Cell Environ. 29: 115-125 Rouached H, et al. (2011) Plant J. 65: 557-570 Rubio V, et al. (2001) Genes Dev. 15: 2122-2133 Sanchez-Calderon L, et al. (2005) Plant Cell Physiol. 46: 174-184 Sanchez-Calderon L, et al. (2006) Plant Physiol. 140: 879-889 Shen J, et al. (2011) Plant Physiol. 156: 997-1005 Shin H, et al. (2004) Plant J. 39: 629-642 Svistoonoff S, et al. (2007) Nat Genet. 39: 792-796 Thibaud M C, et al. (2010) Plant J. 64: 775-789 Ticconi C A, et al. (2001) Plant Physiol. 127: 963-72 Ticconi C A and Abel S (2004) Trends in Plant Science 9: 548-555 Ticconi C A, et al. (2004) Plant J. 37: 801-814 Ticconi C A, et al. (2009) Proc Natl Acad Sci USA 106: 14174-14179 Tran H T, et al. (2010) Plant Science 179: 14-27 Ward J T, et al. (2008) Plant Physiol. 147: 1181-1191 Zakhleniuk O V, et al. (2001) Planta 212: 529-534 Zhao Y, et al. (2007) Nature Chemical Biology 3: 716-721