COMPOSITIONS AND METHODS FOR THE TREATMENT OF KCNT1 RELATED DISORDERS

20220056455 · 2022-02-24

    Inventors

    Cpc classification

    International classification

    Abstract

    The present disclosure features useful compositions and methods to treat KCNT1 related disorders, e.g., in a subject in need thereof.

    Claims

    1. A compound comprising an oligonucleotide comprising a nucleobase sequence at least 90% complementary to at least 10 contiguous nucleobases of a transcript comprising a sequence at least 90% identity to SEQ ID NO: 3526, or a contiguous 15 to 50 nucleobase portion of SEQ ID NO: 3526, wherein at least one nucleoside linkage of the nucleobase sequence is a modified internucleoside linkage.

    2. An oligonucleotide comprising a nucleobase sequence at least 90% complementary to at least 10 contiguous nucleobases of a transcript comprising a sequence at least 90% identity to SEQ ID NO: 3526, or a contiguous 15 to 50 nucleobase portion of SEQ ID NO: 3526, wherein at least one nucleoside linkage of the nucleobase sequence is a modified internucleoside linkage.

    3. The compound comprising an oligonucleotide of claim 1, or the oligonucleotide of claim 2, wherein the oligonucleotide comprises at least a contiguous 10 nucleobase sequence that shares 90% identity with an equal length portion of any one of SEQ ID NOs: 1-3525.

    4. The compound comprising an oligonucleotide of claim 1 or 3, or the oligonucleotide of claim 2 or 3, wherein the oligonucleotide comprises at least a contiguous 11, 12, 13, 14, 15, 16, or 17 nucleobase sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 1-3525.

    5. The compound comprising an oligonucleotide of claim 1 or 3 or the oligonucleotide of claim 2 or 3, wherein the oligonucleotide comprises at least a contiguous 10 nucleobase sequence that shares 90% identity with an equal length portion of any one of SEQ ID NOs: 1-116.

    6. The compound comprising an oligonucleotide of claim 1 or 3 or the oligonucleotide of claim 2 or 3, wherein the oligonucleotide comprises at least a contiguous 10 nucleobase sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525, wherein at least one nucleoside linkage of the nucleobase sequence is a modified internucleoside linkage.

    7. The compound comprising an oligonucleotide of any one of claim 1 or 3-6 or the oligonucleotide of any one of claims 2-6, wherein the oligonucleotide comprises at least a contiguous 10 nucleobase sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 4, 1046, 1071, 1388, 1551, 1546, or 2595.

    8. The compound comprising an oligonucleotide of any one of claim 1 or 3-7 or the oligonucleotide of any one of claims 2-7, wherein the oligonucleotide comprises at least a contiguous 11, 12, 13, 14, 15, 16, or 17 nucleobase sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525.

    9. The compound comprising an oligonucleotide of any one of claim 1 or 3-8 or the oligonucleotide of any one of claims 2-8, wherein the oligonucleotide comprises at least a contiguous 11, 12, 13, 14, 15, 16, or 17 nucleobase sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 4, 1046, 1071, 1388, 1551, 1546, or 2595.

    10. A compound comprising an oligonucleotide comprising at least 10 contiguous nucleobases that share 90% identity to an equal length portion of any one of SEQ ID 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525, wherein at least one nucleoside linkage of the nucleobase sequence is a modified internucleoside linkage.

    11. An oligonucleotide comprising at least 10 contiguous nucleobases that share 90% identity to an equal length portion of any one of SEQ ID NOs: 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1195-1224, 1496-1567, 2591-2631, or 3395-3525, wherein at least one nucleoside linkage of the nucleobase sequence is a modified internucleoside linkage.

    12. The compound comprising an oligonucleotide of claim 10, or the oligonucleotide of claim 11, wherein the oligonucleotide comprises at least 10 contiguous nucleobases that share 90% identity to an equal length portion of any one of SEQ ID NOs: 4, 1046, 1071, 1388, 1551, 1546, or 2595.

    13. The compound comprising an oligonucleotide of claim 10, or the oligonucleotide of claim 11, wherein the oligonucleotide comprises at least 11, 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleobases of any one of SEQ ID NOs: 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1338, 1496-1567, 2591-2631, or 3395-3525.

    14. The compound comprising an oligonucleotide of claim 13, or the oligonucleotide of claim 13, wherein the oligonucleotide comprises at least 11, 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleobases of any one of SEQ ID NOs: 4, 1046, 1071, 1388, 1551, 1546, or 2595.

    15. A compound comprising an oligonucleotide comprising at least 10 contiguous nucleobases which is at least 90% complementary to an equal length portion of nucleobases within a 10 nucleobase range of any one of positions 374, 661, 655-680, 765, 837, 1347, 1340-1370, 1629, 1760, 1752, 1795, 1775, 1740-1815, 2879, 3008, 3168, or 3110-3171 of SEQ ID NO: 3526, wherein at least one nucleoside linkage of the nucleobase sequence is a modified internucleoside linkage.

    16. An oligonucleotide comprising at least 10 contiguous nucleobases which is at least 90% complementary to an equal length portion of nucleobases within a 10 nucleobase range of positions 374, 661, 655-680, 765, 837, 1347, 1340-1370, 1629, 1760, 1752, 1795, 1775, 1740-1815, 2879, 3008, 3168, or 3110-3171 of SEQ ID NO: 3526, wherein at least one nucleoside linkage of the nucleobase sequence is a modified internucleoside linkage.

    17. The compound comprising an oligonucleotide of claim 15, or the oligonucleotide of claim 16, wherein the oligonucleotide comprises at least 10 contiguous nucleobases that are complementary to an equal length portion of nucleobases within any one of positions 655-680, 1340-137, 1740-1815, or 3110-3175 of SEQ ID NO: 3526.

    18. The compound comprising an oligonucleotide of claim 17, or the oligonucleotide of claim 17, wherein the oligonucleotide comprises at least 10 contiguous nucleobases that are complementary to an equal length portion of nucleobases within any one of positions 655-665, 660-670, 665-675, or 670-680 of SEQ ID NO: 3526.

    19. The compound comprising an oligonucleotide of claim 17, or the oligonucleotide of claim 17, wherein the oligonucleotide comprises at least 10 contiguous nucleobases that are complementary to an equal length portion of nucleobases within any one of positions 1340-1350, 1345-1355, 1350-1360, 1355-1365, or 1360-1370 of SEQ ID NO: 3526.

    20. The compound comprising an oligonucleotide of claim 17, or the oligonucleotide of claim 17, wherein the oligonucleotide comprises at least 10 contiguous nucleobases that are complementary to an equal length portion of nucleobases within any one of positions 1740-1750, 1745-1755, 1750-1760, 1755-1765, 1760-1770, 1765-1775, 1770-1780, 1775-1785, 1780-1790, 1785-1795, 1790-1800, 1795-1805, 1800-1810, or 1805-1815 of SEQ ID NO: 3526.

    21. The compound comprising an oligonucleotide of claim 17, or the oligonucleotide of claim 17, wherein the oligonucleotide comprises at least 10 contiguous nucleobases that are complementary to an equal length portion of nucleobases within any one of positions 3110-3120, 3115-3125, 3120-3130, 3125-3135, 3130-3140, 3135-3145, 3140-3150, 3145-3155, 3150-3160, 3155-3165, 3160-3170, 3165-3175, 3170-3180 of SEQ ID NO: 3526.

    22. The compound comprising an oligonucleotide of claim 15, or the oligonucleotide of claim 16, wherein the oligonucleotide comprises at least 11, 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleobases complementary to an equal length portion of nucleobases within any one of positions 374, 661, 765, 837, 1347, 1629, 2879, 3008, 3168, 1760, 1752, 1795, 1775, 655-680, 1340-1370, 1740-1815, or 3110-3171 of SEQ ID NO: 3526.

    23. The compound comprising an oligonucleotide of claim 15, or the oligonucleotide of claim 16, wherein the oligonucleotide comprises at least 11, 12, 13, 14, 15, 16, 17, 18, or 19 contiguous nucleobases complementary to an equal length portion of nucleobases within any one of 655-680, 1340-137, 1740-1815, or 3110-3175 of SEQ ID NO: 3526.

    24. The compound comprising an oligonucleotide of any one of claim 1 or 3-23, or the oligonucleotide of any one of claims 2-23, wherein the oligonucleotide is between 12 and 40 nucleobases in length.

    25. The compound of any one of claim 1, 10, or 15, wherein the oligonucleotide comprises: a. a gap segment comprising one or more of linked deoxyribonucleosides, 2′-Fluoro Arabino Nucleic Acids (FANA), and Fluoro Cyclohexenyl nucleic acid (F-CeNA); b. a 5′ wing segment comprising linked nucleosides; and c. a 3′ wing segment comprising linked nucleosides; d. wherein the gap segment comprises a region of at least 8 contiguous nucleobases having at least 80% identity to an equal length portion of any one of SEQ ID NOs: 1-3525 positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment and the 3′ wing segment each comprises at least two linked nucleosides; and wherein at least one nucleoside of each wing segment comprises a modified sugar.

    26. The oligonucleotide of any one of claim 2, 11, or 16 comprising; a. a gap segment comprising one or more of linked deoxyribonucleosides, 2′-Fluoro Arabino Nucleic Acids (FANA), and Fluoro Cyclohexenyl nucleic acid (F-CeNA); b. a 5′ wing segment comprising linked nucleosides; and c. a 3′ wing segment comprising linked nucleosides; d. wherein the gap segment comprises a region of at least 8 contiguous nucleobases having at least 80% identity to an equal length portion of any one of SEQ ID NOs: 1-3525 positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment and the 3′ wing segment each comprises at least two linked nucleosides; and wherein at least one nucleoside of each wing segment comprises a modified sugar.

    27. The compound comprising an oligonucleotide of claim 25, or the oligonucleotide of claim 26, wherein the oligonucleotide comprises at least 13, 14, 15, 16, 17, 18, 19, or 20 linked nucleosides.

    28. The compound comprising an oligonucleotide of any one of claim 1 or 3-27, or the oligonucleotide of any one of claims 2-27, wherein at least one nucleoside linkage of the nucleobase sequence is selected from the group consisting of a phosphodiester linkage, a phosphorothioate linkage, a 2′-alkoxy linkage, an alkyl phosphate linkage, alkyl phosphonate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a methylphosphonate linkage, a dimethylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage.

    29. The compound comprising an oligonucleotide of claim 25 or 27, or the oligonucleotide of claim 26 or 27, wherein the at least two linked nucleosides of the 5′ wing segment are linked through a phosphodiester internucleoside linkage and wherein the at least two linked nucleosides of the 3′ wing segment are linked through a phosphodiester internucleoside linkage, and wherein at least one of the internucleoside linkages of the gap segment is a modified internucleoside linkage.

    30. The compound comprising an oligonucleotide of any one of claim 25 or 27-29 or the oligonucleotide of any one of claims 26-29, wherein at least two, three, or four internucleoside linkages of the nucleobase sequence are phosphodiester internucleoside linkages.

    31. The compound comprising an oligonucleotide of any one of claim 25 or 27-30, or the oligonucleotide of any one of claims 26-30, wherein at least one, two, three, or four internucleoside linkages between nucleoside bases of the gap segment are phosphodiester internucleoside linkages.

    32. The compound comprising an oligonucleotide of any one of claim 1, 3-25, or 27-31, or the oligonucleotide of any one of claim 2-24 or 26-31, wherein at least two internucleoside linkages of the nucleobase sequence is a modified internucleoside linkage.

    33. The compound comprising an oligonucleotide of claim 32, or the oligonucleotide of claim 32, wherein the modified internucleoside linkage of the nucleobase sequence is a phosphorothioate linkage.

    34. The compound comprising an oligonucleotide of claim 32 or 33, or the oligonucleotide of claim 32 or 33, wherein all internucleoside linkages of the nucleobase sequence are phosphorothioate linkages.

    35. The compound comprising an oligonucleotide of any one of claim 25, 27-28, or 32-34, or the oligonucleotide of any one of claim 26-28 or 32-34, wherein the at least two linked nucleosides of the 5′ wing segment are linked through a modified internucleoside linkage.

    36. The compound comprising an oligonucleotide of any one of claim 25, 27-28, or 32-34, or the oligonucleotide of any one of claim 26-28 or 32-34, wherein the at least two linked nucleosides of the 3′ wing segment are linked through a modified internucleoside linkage.

    37. The compound comprising an oligonucleotide of any one of claim 25, 27-28, or 32-36, or the oligonucleotide of any one of claim 26-28 or 32-36, wherein the at least two linked nucleosides of the 5′ wing segment are linked through a phosphorothioate internucleoside linkage and wherein the at least two linked nucleosides of the 3′ wing segment are linked through a phosphorothioate internucleoside linkage, and wherein at least one of the internucleoside linkages of the gap segment is a modified internucleoside linkage.

    38. The compound comprising an oligonucleotide of any one of claim 25, 27-28, or 32-37, or the oligonucleotide of any one of claim 26-28 or 32-37, wherein at least two, three, or four internucleoside linkages of the nucleobase sequence are phosphorothioate internucleoside linkages.

    39. The compound comprising an oligonucleotide of any one of claim 25, 27-28, or 32-38, or the oligonucleotide of any one of claim 26-28 or 32-38, wherein at least one, two, three, or four internucleoside linkages between nucleoside bases of the gap segment are phosphorothioate internucleoside linkages.

    40. The compound comprising an oligonucleotide of any one of claim 25, 27-28, or 32-39, or the oligonucleotide of any one of claim 26-28 or 32-39, wherein the phosphorothioate internucleoside linkage is in a Rp configuration, a Sp configuration, or in any combination of Rp and Sp configuration.

    41. The compound comprising an oligonucleotide of any one of claim 1, 3-25, or 27-40, or the oligonucleotide of any one of claim 2-24 or 26-40, wherein the oligonucleotide comprises at least one modified nucleobase.

    42. The compound comprising an oligonucleotide of claim 41, or the oligonucleotide of claim 41, wherein the at least one modified nucleobase is 5′-methylcytosine, pseudouridine, or 5-methoxyuridine.

    43. The compound comprising an oligonucleotide of any one of claim 1, 3-25, or 27-42, or the oligonucleotide of any one of claim 2-24 or 26-42, wherein the oligonucleotide comprises at least one modified sugar moiety.

    44. The compound comprising an oligonucleotide of claim 43, or the oligonucleotide of claim 43, wherein the at least one modified sugar is a bicyclic sugar.

    45. The compound comprising an oligonucleotide of claim 44, or the oligonucleotide of claim 44, wherein the bicyclic sugar comprises a 4′-CH(R)—O-2′ bridge wherein R is, independently, H, C.sub.1-C.sub.12 alkyl, or a protecting group.

    46. The compound comprising an oligonucleotide of claim 45, or the oligonucleotide of claim 45, wherein R is methyl.

    47. The compound comprising an oligonucleotide of claim 45, or the oligonucleotide of claim 45, wherein R is H.

    48. The compound comprising an oligonucleotide of claim 43, or the oligonucleotide of claim 43, wherein the modified sugar moiety is one of a 2′-OMe modified sugar moiety, bicyclic sugar moiety, 2′-O-methoxyethyl (MOE), 2′-deoxy-2′-fluoro nucleoside, 2′-fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), constrained ethyl 2′-4′-bridged nucleic acid (cEt), S-cEt, tcDNA, hexitol nucleic acids (HNA), and tricyclic analog (e.g., tcDNA).

    49. The compound comprising an oligonucleotide of any one of claim 1, 3-25, or 27-48, or the oligonucleotide of any one of claim 2-24 or 26-48, wherein the oligonucleotide comprises one or more 2′-O-methoxyethyl nucleosides that are linked through phosphorothioate internucleoside linkages.

    50. The compound comprising an oligonucleotide of any one of claim 1, 3-25, or 27-49, or the oligonucleotide of any one of claim 2-24 or 26-49, wherein the oligonucleotide comprises three contiguous nucleoside bases that are linked through phosphorothioate internucleoside linkages at the 5′ end and three contiguous nucleoside bases that are linked through phosphorothioate internucleoside linkages at the 3′ end.

    51. The compound comprising an oligonucleotide of claim 50, or the oligonucleotide of claim 50, wherein the oligonucleotide comprises five contiguous nucleoside bases that are linked through phosphorothioate internucleoside linkages.

    52. The compound comprising an oligonucleotide of claim 50 or 51, or the oligonucleotide of claim 50 or 51, wherein the each of the five contiguous nucleoside bases are 2′-O-methoxyethyl nucleosides.

    53. The compound comprising an oligonucleotide of any one of claims 43-52, or the oligonucleotide of any one of claims 43-52, wherein each of the nucleoside bases of the oligonucleotide are 2′-O-methoxyethyl nucleosides.

    54. The compound comprising an oligonucleotide of any one of claims 43-52, or the oligonucleotide of any one of claims 43-52, wherein the gap segment comprises one or more 2′-O-methoxyethyl nucleosides.

    55. The compound comprising an oligonucleotide of any one of claims 43-54, or the oligonucleotide of any one of claims 43-54, wherein the gap segment comprises phosphorothioate internucleoside linkages, wherein the 5′ wing segment comprises two contiguous nucleoside bases that are linked through phosphodiester internucleoside linkages, and wherein the 3′ wing segment comprises two contiguous nucleoside bases that are linked through phosphodiester internucleoside linkages.

    56. The compound comprising an oligonucleotide of any one of claims 43-54, or the oligonucleotide of any one of claims 43-54, wherein five contiguous nucleoside bases in the gap segment are linked through phosphorothioate internucleoside linkages, wherein the 5′ wing segment comprises at least one phosphorothioate internucleoside linkage, and wherein the 3′ wing segment comprises at least one phosphorothioate internucleoside linkage.

    57. The compound comprising an oligonucleotide of any one of claim 1, 3-25, or 27-56, or the oligonucleotide of any one of claim 2-24 or 26-57, comprising one or more chiral centers and/or double bonds.

    58. The compound comprising an oligonucleotide of claim 57, or the oligonucleotide of claim 57, wherein the oligonucleotide exist as stereoisomers selected from geometric isomers, enantiomers, and diastereomers.

    59. The compound comprising an oligonucleotide of any one of claim 1, 3-25, or 27, or the oligonucleotide of any one of claim 2-24 or 26-27, wherein the oligonucleotide comprises sugar modifications in any of the following patterns: eeeee-d10-eeeee, d20, eeeee-d12-eeeee, eeeee-d8-eeeee, and eekk-d8-kkeee, wherein e=2′-O-methoxyethyl nucleoside; d=a 2′-deoxynucleoside; k=a locked nucleic acid (LNA), constrained methoxyethyl (cMOE) nucleoside, constrained ethyl (cET) nucleoside, or peptide nucleic acid (PNA).

    60. The compound comprising an oligonucleotide of any one of claim 1, 3-25, 27, or 59, or the oligonucleotide of any one of claim 2-24, 26, 27, or 59, wherein the oligonucleotide comprises internucleoside linkages in any of the following patterns: sssssssssssssssssss; sssssssssssssssssssss; sooosssssssssooss; and soosssssssssooss; wherein s=a phosphorothioate linkage, and o=a phosphodiester linkage.

    61. The compound comprising an oligonucleotide of any one of claim 1, 3-25, 27, 59, or 60, or the oligonucleotide of any one of claim 2-24, 26, 27, 59, or 60, wherein the oligonucleotide comprises sugar modification and internucleoside linkage combinations, respectively, in any of the following patterns: a) d20 and sssssssssssssssssss; b) eeeee-d10-eeeee and sssssssssssssssssss; c) eeeee-d12-eeeee and sssssssssssssssssssss; d) eeeee-d8-eeeee and sooosssssssssooss; and e) eekk-d8-kkeee and soosssssssssooss.

    62. The compound comprising an oligonucleotide of any one of claim 1, 3-25, 27, or 59-61, or the oligonucleotide of any one of claim 2-24, 26, 27, or 59-61, wherein the oligonucleotide comprises a modified cytosine.

    63. The compound comprising an oligonucleotide of claim 62, or the oligonucleotide of claim 62, wherein the modified cytosine is 5-methyl-dC.

    64. The compound comprising an oligonucleotide of claim 63, or the oligonucleotide of claim 63, wherein the oligonucleotide comprises sugar modification and internucleoside linkage combinations eeeee-d10-eeeee and sssssssssssssssssss, and the cytosine are modified as 5-methyl-dC.

    65. The compound comprising an oligonucleotide of claim 60 or 61, or the oligonucleotide of claim 60 or 61, wherein the oligonucleotide comprises sugar modification and internucleoside linkage combinations, respectively, in any of the following patterns: a) d20 and sssssssssssssssssss; b) eeeee-d12-eeeee and sssssssssssssssssssss; c) eeeee-d8-eeeee and sooosssssssssooss; and d) eekk-d8-kkeee and soosssssssssooss; and the any cytosine in the oligonucleotide is an unmodified cytosine.

    66. A compound or oligonucleotide according to the compound comprising an oligonucleotide of any one of claim 1, 3-25, or 27-56, or the oligonucleotide of any one of claim 2-24 or 26-65, complementary to a nucleobase sequence of a target region of a target nucleic acid sequence, wherein the nucleobase sequence of the target region of the target nucleic acid differs from the nucleobase sequence of at least one non-target nucleic acid sequence by 1-3 differentiating nucleobases, and wherein the non-target nucleic acid comprises a sequence of SEQ ID NO: 3526.

    67. The compound or oligonucleotide according to claim 66, wherein the 1-3 differentiating nucleobases comprises a single-nucleotide polymorphism (SNP).

    68. The compound or oligonucleotide of claim 67, wherein the SNP present in the target region is a SNP compared to an equal length portion of SEQ ID NO: 3526.

    69. The compound or oligonucleotide according to claim 66, wherein the single nucleotide polymorphism is selected from the group consisting of: rs397515403, rs397515402, rs587777264, rs397515404, rs866242631, rs886043455, rs397515407, and rs397515406.

    70. The compound or oligonucleotide according to claim 66, wherein the single nucleotide polymorphism is selected from the group consisting of: a C to a G at position 1112 of the sequence shown in SEQ ID NO: 3526, a C to a T at position 2845 of the sequence shown in SEQ ID NO: 3526, and a G to a T at position 885 of the sequence shown in SEQ ID NO: 3526.

    71. A pharmaceutical composition comprising the compound or oligonucleotide of any one of the above claims and a pharmaceutically acceptable carrier or excipient.

    72. The pharmaceutical composition of claim 71, wherein the pharmaceutical composition is suitable for topical, intrathecal, intracisternal, parenteral, oral, pulmonary, intratracheal, intranasal, transdermal, rectal, buccal, sublingual, vaginal, or intraduodenal administration.

    73. A composition comprising the compound or oligonucleotide of any one of the above claims and a lipid nanoparticle, a polyplex nanoparticle, a lipoplex nanoparticle, or a liposome.

    74. A method of reducing a level and/or activity of KCNT1 in a cell of a subject having a KCNT1 related disorder, the method comprising contacting the cell with the compound of any one of claim 1, 3-25, or 27-70, the oligonucleotide of any one of claim 2-24, or 26-70, or the pharmaceutical composition of claim 71 or 72 in an amount and for a duration sufficient to reduce the level and/or activity of KCNT1 in the cell.

    75. The method of claim 74, wherein the cell is a cell of the central nervous system.

    76. A method of treating a neurological disease in a subject in need thereof, the method comprising administering to the patient an inhibitor of a transcript, wherein the transcript shares at least 90% identity with SEQ ID NO: 3526.

    77. The method of claim 76, wherein the inhibitor is the compound comprising an oligonucleotide of any one of claim 1, 3-25, or 27-70, or the oligonucleotide of any one of claim 2-24, or 26-70 or the pharmaceutical composition of claim 71 or 72.

    78. A method of treating, preventing, or delaying the progression of a KCNT1 related disorder in a subject in need thereof, the method comprising administering to the subject the compound of any one of claim 1, 3-25, or 70, the oligonucleotide of any one of claims 2-24, or 26-70 or the pharmaceutical composition of claim 71 or 72 in an amount and for a duration sufficient to treat, prevent, or delay the progression of the KCNT1 related disorder.

    79. The method of any one of claims 74-78, wherein the KCNT1 related disorder is selected from the group consisting of epilepsy of infancy with migrating focal seizures, autosomal dominant nocturnal frontal lobe epilepsy, West syndrome, infantile spasms, epileptic encephalopathy, focal epilepsy, Ohtahara syndrome, developmental epileptic encephalopathy, and Lennox Gastaut syndrome.

    80. The method of any one of claims 74-79, wherein the subject has a gain-of-function mutation in KCNT1.

    81. The method of claim 80, wherein the gain-of-function mutation is selected from the group consisting of V271F, L274I, G288S, F346L, R398Q, R428Q, R474H, F502V, M516V, K629N, I760M, Y796H, E893K, M896I, M896K, P924L, R928C, F932I, A934T, A966T, H257D, R262Q, Q270E, V340M, C377S, P409S, L437F, R474C, A477T, R565H, K629E, G652V, I760F, Q906H, R933G, A934T, R950Q, R961H, R1106Q, K1154Q, R474Q, Y1903C, H469L, M896R, K946E, and R950L.

    82. The method of claim 80 or 81, wherein the gain-of-function mutation is G288S, R398Q, R428Q, R928C, or A934T.

    83. The method of any one of claims 74-82, wherein the method reduces one or more symptoms of the KCNT1 related disorder.

    84. The method of claim 83, wherein the one or more symptoms of the KCNT1 related disorder is selected from the group consisting of prolonged seizures, frequent seizures, behavioral and developmental delays, movement and balance issues, orthopedic conditions, delayed language and speech issues, growth and nutrition issues, sleeping difficulties, chronic infection, sensory integration disorder, disruption of the autonomic nervous system, and sweating.

    85. The method of any claims 74-84, wherein the oligonucleotide or pharmaceutical composition is administered topically, parenterally, intrathecally, intracisternally, orally, rectally, buccally, sublingually, vaginally, pulmonarily, intratracheally, intranasally, transdermally, or intraduodenally.

    86. The method of any one of claims 74-85, wherein the patient is a human.

    87. A compound comprising a modified oligonucleotide of 18-22 linked nucleosides in length and having at least 85% sequence complementarity to an equal length portion of H. sapiens KCNT1 and M. musculus KCNT1 transcript.

    88. A compound comprising a modified oligonucleotide of 18-22 linked nucleosides in length and having at least 85% sequence complementarity to an equal length portion of H. sapiens KCNT1 and M. fascicularis KCNT1 transcript.

    89. A compound comprising a modified oligonucleotide of 18-22 linked nucleosides in length and having at least 85% sequence complementarity to an equal length portion of H. sapiens KCNT1, M. musculus KCNT1, and/or M. fascicularis KCNT1 transcript.

    90. The compound of any one of claims 87-89, wherein the oligonucleotide comprises a GC content from 40% to 70%.

    91. The compound of any one of claims 87-90, wherein the oligonucleotide comprises no more than 2 mismatches to H. sapiens KCNT1 transcript.

    92. The compound of any one of claims 87-91, wherein the oligonucleotide comprises at least 3 mismatches to any non KCNT1 transcript.

    93. The compound of any one of claims 87-92, wherein the oligonucleotide lacks a GGGG tetrad.

    94. The method of any one of claims 74-86, wherein the oligonucleotide is not any one of SEQ ID NOs: 3512-3525.

    95. The pharmaceutical composition of claim 71 or 72, wherein the oligonucleotide is not any one of SEQ ID NOs: 3512-3525.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0084] These and other features, aspects, and advantages of the present invention will become better understood with regard to the following description, and accompanying drawings, where:

    [0085] FIG. 1 is a plot demonstrating percentage knockdown of hKCNT1 in response to antisense oligonucleotide treatments.

    DETAILED DESCRIPTION

    Definitions

    [0086] For convenience, the meaning of some terms and phrases used in the specification, examples, and appended claims are provided below. Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed technology, because the scope of the technology is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs. If there is an apparent discrepancy between the usage of a term in the art and its definition provided herein, the definition provided within the specification shall prevail.

    [0087] In this application, unless otherwise clear from context, (i) the term “a” may be understood to mean “at least one”; (ii) the term “or” may be understood to mean “and/or”; and (iii) the terms “including” and “comprising” may be understood to encompass itemized components or steps whether presented by themselves or together with one or more additional components or steps.

    [0088] As used herein, the terms “about” and “approximately” refer to a value that is within 10% above or below the value being described. For example, the term “about 5 nM” indicates a range of from 4.5 to 5.5 nM.

    [0089] The term “at least” prior to a number or series of numbers is understood to include the number adjacent to the term “at least”, and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, “at least 18 nucleotides of a 21-nucleotide nucleic acid molecule” means that 18, 19, 20, or 21 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that “at least” can modify each of the numbers in the series or range.

    [0090] As used herein, “no more than” or “less than” is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, an oligonucleotide with “no more than 3 mismatches to a target sequence” has 3, 2, 1, or 0 mismatches to a target sequence. When “no more than” is present before a series of numbers or a range, it is understood that “no more than” can modify each of the numbers in the series or range.

    [0091] As used herein, the term “administration” refers to the administration of a composition (e.g., a compound or a preparation that includes a compound as described herein) to a subject or system. Administration to an animal subject (e.g., to a human) may be by any appropriate route, such as one described herein.

    [0092] As used herein, a “combination therapy” or “administered in combination” means that two (or more) different agents or treatments are administered to a subject as part of a defined treatment regimen for a particular disease or condition. The treatment regimen defines the doses and periodicity of administration of each agent such that the effects of the separate agents on the subject overlap. In some embodiments, the delivery of the two or more agents is simultaneous or concurrent and the agents may be co-formulated. In some embodiments, the two or more agents are not co-formulated and are administered in a sequential manner as part of a prescribed regimen. In some embodiments, administration of two or more agents or treatments in combination is such that the reduction in a symptom, or other parameter related to the disorder is greater than what would be observed with one agent or treatment delivered alone or in the absence of the other. The effect of the two treatments can be partially additive, wholly additive, or greater than additive (e.g., synergistic). Sequential or substantially simultaneous administration of each therapeutic agent can be effected by any appropriate route including, but not limited to, oral routes, intravenous routes, intramuscular routes, and direct absorption through mucous membrane tissues. The therapeutic agents can be administered by the same route or by different routes. For example, a first therapeutic agent of the combination may be administered by intravenous injection while a second therapeutic agent of the combination may be administered orally.

    [0093] As used herein, the term “KCNT1” refers potassium sodium-activated channel subfamily T member 1, having an amino acid sequence from any vertebrate or mammalian source, including, but not limited to, human, bovine, chicken, rodent, mouse, rat, porcine, ovine, primate, monkey, and guinea pig, unless specified otherwise. The term also refers to fragments and variants of native KCNT1 that maintain at least one in vivo or in vitro activity of a native KCNT1. The term encompasses full-length unprocessed precursor forms of KCNT1 as well as mature forms resulting from post-translational cleavage of the signal peptide. KCNT1 is encoded by the KCNT1 gene. The nucleic acid sequence of an exemplary Homo sapien (human) KCNT1 gene is set forth in NCBI Reference No. NG_033070.1. The nucleic acid sequence of an exemplary Homo sapien (human) KCNT1 transcript is set forth in NCBI Reference No. NM_020822.2 and NM_001272003.1. The term “KCNT1” also refers to natural variants of the wild-type KCNT1 protein, such as proteins having at least 85% identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% identity, or more) to the amino acid sequence of wild-type human KCNT1. The nucleic acid sequence of an exemplary Mus musculus (mouse) KCNT1 transcript is set forth in NCBI Reference No. NM_175462.4 and NM_001145403.2, and NM_01302351.1. The nucleic acid sequence of an exemplary Macaca fascicularis (cyno) KCNT1 transcript is set forth in NCBI Reference No. XM_015436456.1.

    [0094] The term “KCNT1” as used herein also refers to a particular polypeptide expressed in a cell by naturally occurring DNA sequence variations of the KCNT1 gene, such as a single nucleotide polymorphism in the KCNT1 gene. Numerous SNPs within the KCNT1 transcript have been identified (see, e.g., Table 1).

    [0095] As used herein, “target sequence” refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a KCNT1 gene, including mRNA that is a product of RNA processing of a primary transcription product. In one embodiment, the target portion of the sequence will be at least long enough to serve as a substrate for oligonucleotide-directed (e.g., antisense oligonucleotide (ASO)-directed) cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a KCNT1 gene. The target sequence may be, for example, from about 9-36 nucleotides in length, e.g., about 15-30 nucleotides in length, e.g., about 18-22 nucleotides in length. For example, the target sequence can be from about 15-30 nucleotides, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

    [0096] “G,” “C,” “A,” “T,” and “U” each generally stand for a naturally-occurring nucleotide that contains guanine, cytosine, adenine, thymidine, and uracil as a base, respectively. However, it will be understood that the term “nucleotide” can also refer to an alternative nucleotide, as further detailed below, or a surrogate replacement moiety. The skilled person is well aware that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base can base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of oligonucleotides featured in the invention by a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the invention.

    [0097] The terms “nucleobase” and “base” include the purine (e.g. adenine and guanine) and pyrimidine (e.g. uracil, thymine, and cytosine) moiety present in nucleosides and nucleotides which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention, the term nucleobase also encompasses alternative nucleobases which may differ from naturally-occurring nucleobases, but are functional during nucleic acid hybridization. In this context “nucleobase” refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as alternative nucleobases. Such variants are for example described in Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1.

    [0098] The term “nucleoside” refers to a monomeric unit of an oligonucleotide or a polynucleotide having a nucleobase and a sugar moiety. A nucleoside may include those that are naturally-occurring as well as alternative nucleosides, such as those described herein. The nucleobase of a nucleoside may be a naturally-occurring nucleobase or an alternative nucleobase. Similarly, the sugar moiety of a nucleoside may be a naturally-occurring sugar or an alternative sugar.

    [0099] The term “alternative nucleoside” or “modified nucleoside” refers to a nucleoside having an alternative sugar or an alternative nucleobase, such as those described herein.

    [0100] In a some embodiments the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as an “alternative nucleobase” selected from isocytosine, pseudoisocytosine, 5-methyl cytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uridine, 5-bromouridine 5-thiazolo-uridine, 2-thio-uridine, pseudouridine, 1-methylpseudouridine, 5-methoxyuridine, 2′-thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

    [0101] The nucleobase moieties may be indicated by the letter code for each corresponding nucleobase, e.g. A, T, G, C, or U, wherein each letter may optionally include alternative nucleobases of equivalent function. In some embodiments, e.g., for gapmers, 5-methyl cytosine LNA nucleosides may be used.

    [0102] A “sugar” or “sugar moiety” includes naturally occurring sugars having a furanose ring. A sugar also includes an “alternative sugar,” defined as a structure that is capable of replacing the furanose ring of a nucleoside. In certain embodiments, alternative sugars are non-furanose (or 4′-substituted furanose) rings or ring systems or open systems. Such structures include simple changes relative to the natural furanose ring, such as a six-membered ring, or may be more complicated as is the case with the non-ring system used in peptide nucleic acid. Alternative sugars may also include sugar surrogates wherein the furanose ring has been replaced with another ring system such as, for example, a morpholino or hexitol ring system. Sugar moieties useful in the preparation of oligonucleotides having motifs include, without limitation, β-D-ribose, β-D-2′-deoxyribose, substituted sugars (such as 2′, 5′ and bis substituted sugars), 4′-S-sugars (such as 4′-S-ribose, 4′-S-2′-deoxyribose and 4′-S-2′-substituted ribose), bicyclic alternative sugars (such as the 2′-O—CH.sub.2-4′ or 2′-O—(CH.sub.2).sub.2-4′ bridged ribose derived bicyclic sugars) and sugar surrogates (such as when the ribose ring has been replaced with a morpholino or a hexitol ring system). The type of heterocyclic base and internucleoside linkage used at each position is variable and is not a factor in determining the motif. In most nucleosides having an alternative sugar moiety, the heterocyclic nucleobase is generally maintained to permit hybridization.

    [0103] A “nucleotide,” as used herein, refers to a monomeric unit of an oligonucleotide or polynucleotide that comprises a nucleoside and an internucleosidic linkage. The internucleosidic linkage may or may not include a phosphate linkage. Similarly, “linked nucleosides” may or may not be linked by phosphate linkages. Many “alternative internucleosidic linkages” are known in the art, including, but not limited to, phosphate, phosphorothioate, and boranophosphate linkages. Alternative nucleosides include bicyclic nucleosides (BNAs) (e.g., locked nucleosides (LNAs) and constrained ethyl (cEt) nucleosides), peptide nucleosides (PNAs), phosphotriesters, phosphorothionates, phosphoramidates, and other variants of the phosphate backbone of native nucleoside, including those described herein.

    [0104] An “alternative nucleotide,” as used herein, refers to a nucleotide having an alternative nucleoside or an alternative sugar, and an internucleoside linkage, which may include alternative nucleoside linkages.

    [0105] The terms “oligonucleotide” and “polynucleotide” as used herein are defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification. When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. The oligonucleotide of the invention may be man-made, is chemically synthesized, and is typically purified or isolated. Oligonucleotide is also intended to include (i) compounds that have one or more furanose moieties that are replaced by furanose derivatives or by any structure, cyclic or acyclic, that may be used as a point of covalent attachment for the base moiety, (ii) compounds that have one or more phosphodiester linkages that are either modified, as in the case of phosphoramidate or phosphorothioate linkages, or completely replaced by a suitable linking moiety as in the case of formacetal or riboacetal linkages, and/or (iii) compounds that have one or more linked furanose-phosphodiester linkage moieties replaced by any structure, cyclic or acyclic, that may be used as a point of covalent attachment for the base moiety. The oligonucleotide of the invention may comprise one or more alternative nucleosides or nucleotides (e.g., including those described herein). It is also understood that oligonucleotide includes compositions lacking a sugar moiety or nucleobase but is still capable of forming a pairing with or hybridizing to a target sequence.

    [0106] “Oligonucleotide” refers to a short polynucleotide (e.g., of 100 or fewer linked nucleosides).

    [0107] “Chimeric” oligonucleotides or “chimeras,” in the context of this invention, are oligonucleotides which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide or nucleoside in the case of an oligonucleotide. Chimeric oligonucleotides also include “gapmers.”

    [0108] The oligonucleotide may be of any length that permits specific degradation of a desired target RNA through an RNase H-mediated pathway, and may range from about 10-30 base pairs in length, e.g., about 15-30 base pairs in length or about 18-22 (e.g., 18-20) base pairs in length, for example, about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs in length, such as about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

    [0109] As used herein, the term “oligonucleotide comprising a nucleobase sequence” refers to an oligonucleotide comprising a chain of nucleotides or nucleosides that is described by the sequence referred to using the standard nucleotide nomenclature.

    [0110] The term “contiguous nucleobase region” refers to the region of the oligonucleotide which is complementary to the target nucleic acid. The term may be used interchangeably herein with the term “contiguous nucleotide sequence” or “contiguous nucleobase sequence.” In some embodiments all the nucleotides of the oligonucleotide are present in the contiguous nucleotide or nucleoside region. In some embodiments the oligonucleotide comprises the contiguous nucleotide region and may optionally comprise further nucleotide(s) or nucleoside(s), for example a nucleotide linker region which may be used to attach a functional group to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. In some embodiments the internucleoside linkages present between the nucleotides of the contiguous nucleotide region are all phosphorothioate internucleoside linkages. In some embodiments, the contiguous nucleotide region comprises one or more sugar-modified nucleosides.

    [0111] The term “gapmer” as used herein refers to an oligonucleotide which comprises a region of RNase H recruiting oligonucleotides (gap) which is flanked 5′ and 3′ by regions which comprise one or more affinity enhancing alternative nucleosides (wings or flanks). Various gapmer designs are described herein. Headmers and tailmers are oligonucleotides capable of recruiting RNase H where one of the wings is missing, e.g., only one of the ends of the oligonucleotide comprises affinity enhancing alternative nucleosides. For headmers, the 3′ wing is missing (e.g., the 5′ wing comprises affinity enhancing alternative nucleosides) and for tailmers the 5′ wing is missing (e.g., the 3′ wing comprises affinity enhancing alternative nucleosides). A “mixed wing gapmer” refers to a gapmer wherein the wing regions comprise at least one alternative nucleoside, such as at least one DNA nucleoside or at least one 2′ substituted alternative nucleoside, such as, for example, 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA (MOE), 2′-amino-DNA, 2′-Fluoro-RNA, 2′-F-ANA nucleoside(s), or bicyclic nucleosides (e.g., locked nucleosides or constrained ethyl (cEt) nucleosides). In some embodiments the mixed wing gapmer has one wing which comprises alternative nucleosides (e.g., 5′ or 3′) and the other wing (3′ or 5′ respectfully) comprises 2′ substituted alternative nucleoside(s).

    [0112] The term “linker” or “linking group” is a connection between two atoms that links one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds. Conjugate moieties can be attached to the oligonucleotide directly or through a linking moiety (e.g., linker or tether). Linkers serve to covalently connect a third region, e.g., a conjugate moiety to an oligonucleotide (e.g., the termini of region A or C). In some embodiments of the invention the conjugate or oligonucleotide conjugate of the invention may optionally, comprise a linker region which is positioned between the oligonucleotide and the conjugate moiety. In some embodiments, the linker between the conjugate and oligonucleotide is biocleavable. Phosphodiester containing biocleavable linkers are described in more detail in International Publication No. WO 2014/076195 (herein incorporated by reference).

    [0113] As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide or nucleoside sequence in relation to a second nucleotide or nucleoside sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide or nucleoside sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C., or 70° C., for 12-16 hours followed by washing (see, e.g., “Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides or nucleosides.

    [0114] “Complementary” sequences, as used herein, can also include, or be formed entirely from, non-Watson-Crick base pairs and/or base pairs formed from non-natural and alternative nucleotides or nucleosides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing. Complementary sequences between an oligonucleotide and a target sequence as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide or nucleoside sequence to an oligonucleotide or polynucleotide comprising a second nucleotide or nucleoside sequence over the entire length of one or both nucleotide or nucleoside sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via an RNase H-mediated pathway. “Substantially complementary” can also refer to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding KCNT1). For example, a polynucleotide is complementary to at least a part of a KCNT1 mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding KCNT1.

    [0115] As used herein, the term “region of complementarity” refers to the region on the oligonucleotide that is substantially complementary to all or a portion of a gene, primary transcript, a sequence (e.g., a target sequence, e.g., a KCNT1 mRNA nucleotide sequence or a KCNT1 mRNA transcript variant), or processed mRNA, so as to interfere with expression of the endogenous gene (e.g., KCNT1). Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5′- and/or 3′-terminus of the oligonucleotide.

    [0116] As used herein, an “agent that reduces the level and/or activity of KCNT1” refers to any polynucleotide agent (e.g., an oligonucleotide, e.g., an ASO) that reduces the level of or inhibits expression of KCNT1 in a cell or subject. The phrase “inhibiting expression of KCNT1,” as used herein, includes inhibition of expression of any KCNT1 gene (such as, e.g., a mouse KCNT1 gene, a rat KCNT1 gene, a monkey KCNT1 gene, or a human KCNT1 gene) as well as variants or mutants of a KCNT1 gene that encode a KCNT1 protein. Thus, the KCNT1 gene may be a wild-type KCNT1 gene, a mutant KCNT1 gene, or a transgenic KCNT1 gene in the context of a genetically manipulated cell, group of cells, or organism.

    [0117] By “reducing the activity of KCNT1” is meant decreasing the level of an activity related to KCNT1 (e.g., an ion channel function). The activity level of KCNT1 may be measured using any method known in the art (e.g., using standard biophysical methods).

    [0118] By “reducing the level of KCNT1” is meant decreasing the amount of KCNT1 in a cell or subject, e.g., by administering an oligonucleotide to the cell or subject. The level of KCNT1 may be measured using any method known in the art (e.g., by measuring the levels of KCNT1 mRNA or levels of KCNT1 protein in a cell or a subject).

    [0119] As used herein, the term “inhibitor” refers to any agent which reduces the level and/or activity of a protein (e.g., KCNT1). Non-limiting examples of inhibitors include polynucleotides (e.g., oligonucleotide, e.g., ASOs). The term “inhibiting,” as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating,” “suppressing,” and other similar terms, and includes any level of inhibition.

    [0120] The phrase “contacting a cell with an oligonucleotide,” such as an oligonucleotide, as used herein, includes contacting a cell by any possible means. Contacting a cell with an oligonucleotide includes contacting a cell in vitro with the oligonucleotide or contacting a cell in vivo with the oligonucleotide. The contacting may be done directly or indirectly. Thus, for example, the oligonucleotide may be put into physical contact with the cell by the individual performing the method, or alternatively, the oligonucleotide agent may be put into a situation that will permit or cause it to subsequently come into contact with the cell.

    [0121] Contacting a cell in vitro may be done, for example, by incubating the cell with the oligonucleotide. Contacting a cell in vivo may be done, for example, by injecting the oligonucleotide into or near the tissue where the cell is located, or by injecting the oligonucleotide agent into another area, e.g., the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the oligonucleotide may contain and/or be coupled to a ligand, e.g., GalNAc3, that directs the oligonucleotide to a site of interest, e.g., the liver. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell may also be contacted in vitro with an oligonucleotide and subsequently transplanted into a subject.

    [0122] In one embodiment, contacting a cell with an oligonucleotide includes “introducing” or “delivering the oligonucleotide into the cell” by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of an ASO can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. Introducing an oligonucleotide into a cell may be in vitro and/or in vivo. For example, for in vivo introduction, oligonucleotides can be injected into a tissue site or administered systemically. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below and/or are known in the art.

    [0123] As used herein, “lipid nanoparticle” or “LNP” is a vesicle comprising a lipid layer encapsulating a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., an oligonucleotide. LNP refers to a stable nucleic acid-lipid particle. LNPs typically contain a cationic lipid, a non-cationic lipid, and a lipid that prevents aggregation of the particle (e.g., a PEG-lipid conjugate). LNPs are described in, for example, U.S. Pat. Nos. 6,858,225; 6,815,432; 8,158,601; and 8,058,069, the entire contents of which are hereby incorporated herein by reference.

    [0124] As used herein, the term “liposome” refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, e.g., one bilayer or a plurality of bilayers. Liposomes include unilamellar and multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the oligonucleotide composition. The lipophilic material isolates the aqueous interior from an aqueous exterior, which typically does not include the oligonucleotide composition, although in some examples, it may. Liposomes also include “sterically stabilized” liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids.

    [0125] “Micelles” are defined herein as a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobic.

    [0126] The term “antisense,” as used herein, refers to a nucleic acid comprising an oligonucleotide or polynucleotide that is sufficiently complementary to all or a portion of a gene, primary transcript, or processed mRNA, so as to interfere with expression of the endogenous gene (e.g., KCNT1). “Complementary” polynucleotides are those that are capable of base pairing according to the standard Watson-Crick complementarity rules. Specifically, purines will base pair with pyrimidines to form a combination of guanine paired with cytosine (G:C) and adenine paired with either thymine (A:T) in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA. It is understood that two polynucleotides may hybridize to each other even if they are not completely complementary to each other, provided that each has at least one region that is substantially complementary to the other.

    [0127] As used herein, the terms “effective amount,” “therapeutically effective amount,” and “a “sufficient amount” of an agent that reduces the level and/or activity of KCNT1 (e.g., in a cell or a subject) described herein refer to a quantity sufficient to, when administered to the subject, including a human, effect beneficial or desired results, including clinical results, and, as such, an “effective amount” or synonym thereto depends on the context in which it is being applied. For example, in the context of treating a KCNT1 related disorder, it is an amount of the agent that reduces the level and/or activity of KCNT1 sufficient to achieve a treatment response as compared to the response obtained without administration of the agent that reduces the level and/or activity of KCNT1. The amount of a given agent that reduces the level and/or activity of KCNT1 described herein that will correspond to such an amount will vary depending upon various factors, such as the given agent, the pharmaceutical formulation, the route of administration, the type of disease or disorder, the identity of the subject (e.g., age, sex, and/or weight) or host being treated, and the like, but can nevertheless be routinely determined by one of skill in the art. Also, as used herein, a “therapeutically effective amount” of an agent that reduces the level and/or activity of KCNT1 of the present disclosure is an amount which results in a beneficial or desired result in a subject as compared to a control. As defined herein, a therapeutically effective amount of an agent that reduces the level and/or activity of KCNT1 of the present disclosure may be readily determined by one of ordinary skill by routine methods known in the art. Dosage regimen may be adjusted to provide the optimum therapeutic response.

    [0128] “Prophylactically effective amount,” as used herein, is intended to include the amount of an oligonucleotide that, when administered to a subject having or predisposed to having a KCNT1 related disorder, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the disease includes slowing the course of the disease or reducing the severity of later-developing disease. The “prophylactically effective amount” may vary depending on the oligonucleotide, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the subject to be treated. A prophylactically effective amount also refer to, for example, an amount of the agent reduces the level and/or activity of KCNT1 (e.g., in a cell or a subject) described herein refer to a quantity sufficient to, when administered to the subject, including a human, to delay the onset of a KCNT1 related disorder, as described herein, by at least 120 days, for example, at least 6 months, at least 12 months, at least 2 years, at least 3 years, at least 4 years, at least 5 years, at least 10 years or more, when compared with the predicted onset.

    [0129] A “therapeutically-effective amount” or “prophylactically effective amount” also includes an amount (either administered in a single or in multiple doses) of an oligonucleotide that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment. Oligonucleotides employed in the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.

    [0130] As used herein, the term “region of complementarity” refers to the region on the oligonucleotide that is substantially complementary to all or a portion of a gene, primary transcript, a sequence (e.g., a target sequence, e.g., a KCNT1 mRNA nucleotide sequence or KCNT1 mRNA transcript variant), or processed mRNA, so as to interfere with expression of the endogenous gene (e.g., KCNT1). Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5′- and/or 3′-terminus of the oligonucleotide.

    [0131] As used herein, the term “a subject identified as having a KCNT1 related disorder” refers to a subject identified as having a molecular or pathological state, disease or condition of or associated with a KCNT1 related disorder, such as the identification of a KCNT1 related disorder or symptoms thereof, or to refer to identification of a subject having or suspected of having a KCNT1 related disorder who may benefit from a particular treatment regimen.

    [0132] As used herein, “KCNT1 related disorder,” refers to a class of genetic diseases or disorders characterized by aberrant function of KCNT1. KCNT1 related disorders include, for example, epilepsy of infancy with migrating focal seizures (EIMFS), autosomal dominant nocturnal frontal lobe epilepsy (ADNFLE), West syndrome, infantile spasms, epileptic encephalopathy, focal epilepsy, Ohtahara syndrome, developmental epileptic encephalopathy, and Lennox Gastaut syndrome

    [0133] By “determining the level of a protein” is meant the detection of a protein, or an mRNA encoding the protein, by methods known in the art either directly or indirectly. “Directly determining” means performing a process (e.g., performing an assay or test on a sample or “analyzing a sample” as that term is defined herein) to obtain the physical entity or value. “Indirectly determining” refers to receiving the physical entity or value from another party or source (e.g., a third-party laboratory that directly acquired the physical entity or value). Methods to measure protein level generally include, but are not limited to, western blotting, immunoblotting, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunoprecipitation, immunofluorescence, surface plasmon resonance, chemiluminescence, fluorescent polarization, phosphorescence, immunohistochemical analysis, matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, liquid chromatography (LC)-mass spectrometry, microcytometry, microscopy, fluorescence activated cell sorting (FACS), and flow cytometry, as well as assays based on a property of a protein including, but not limited to, enzymatic activity or interaction with other protein partners. Methods to measure mRNA levels are known in the art.

    [0134] “Percent (%) sequence identity” with respect to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid or amino acid sequence identity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For example, percent sequence identity values may be generated using the sequence comparison computer program BLAST. As an illustration, the percent sequence identity of a given nucleic acid or amino acid sequence, A, to, with, or against a given nucleic acid or amino acid sequence, B, (which can alternatively be phrased as a given nucleic acid or amino acid sequence, A that has a certain percent sequence identity to, with, or against a given nucleic acid or amino acid sequence, B) is calculated as follows:


    100 multiplied by (the fraction X/Y)

    [0135] where X is the number of nucleotides or amino acids scored as identical matches by a sequence alignment program (e.g., BLAST) in that program's alignment of A and B, and where Y is the total number of nucleic acids in B. It will be appreciated that where the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, the percent sequence identity of A to B will not equal the percent sequence identity of B to A.

    [0136] By “level” is meant a level or activity of a protein, or mRNA encoding the protein (e.g., KCNT1), optionally as compared to a reference. The reference can be any useful reference, as defined herein. By a “decreased level” or an “increased level” of a protein is meant a decrease or increase in protein level, as compared to a reference (e.g., a decrease or an increase by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 150%, about 200%, about 300%, about 400%, about 500%, or more; a decrease or an increase of more than about 10%, about 15%, about 20%, about 50%, about 75%, about 100%, or about 200%, as compared to a reference; a decrease or an increase by less than about 0.01-fold, about 0.02-fold, about 0.1-fold, about 0.3-fold, about 0.5-fold, about 0.8-fold, or less; or an increase by more than about 1.2-fold, about 1.4-fold, about 1.5-fold, about 1.8-fold, about 2.0-fold, about 3.0-fold, about 3.5-fold, about 4.5-fold, about 5.0-fold, about 10-fold, about 15-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 100-fold, about 1000-fold, or more). A level of a protein may be expressed in mass/vol (e.g., g/dL, mg/mL, μg/mL, and ng/mL) or percentage relative to total protein or mRNA in a sample.

    [0137] The term “pharmaceutical composition,” as used herein, represents a composition containing a compound described herein formulated with a pharmaceutically acceptable excipient, and preferably manufactured or sold with the approval of a governmental regulatory agency as part of a therapeutic regimen for the treatment of disease in a mammal. Pharmaceutical compositions can be formulated, for example, for oral administration in unit dosage form (e.g., a tablet, capsule, caplet, gelcap, or syrup); for topical administration (e.g., as a cream, gel, lotion, or ointment); for intravenous administration (e.g., as a sterile solution free of particulate emboli and in a solvent system suitable for intravenous use); for intrathecal injection; for intracerebroventricular injections; for intraparenchymal injection; or in any other pharmaceutically acceptable formulation.

    [0138] A “pharmaceutically acceptable excipient,” as used herein, refers any ingredient other than the compounds described herein (for example, a vehicle capable of suspending or dissolving the active compound) and having the properties of being substantially nontoxic and non-inflammatory in a subject. Excipients may include, for example: antiadherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspensing or dispersing agents, sweeteners, and waters of hydration. Exemplary excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, crosslinked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl paraben, microcrystalline cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone, pregelatinized starch, propyl paraben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.

    [0139] As used herein, the term “pharmaceutically acceptable salt” means any pharmaceutically acceptable salt of the compound of any of the compounds described herein. For example, pharmaceutically acceptable salts of any of the compounds described herein include those that are within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and animals without undue toxicity, irritation, allergic response and are commensurate with a reasonable benefit/risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, pharmaceutically acceptable salts are described in: Berge et al., J. Pharmaceutical Sciences 66:1-19, 1977 and in Pharmaceutical Salts: Properties, Selection, and Use, (Eds. P. H. Stahl and C. G. Wermuth), Wiley-VCH, 2008. The salts can be prepared in situ during the final isolation and purification of the compounds described herein or separately by reacting a free base group with a suitable organic acid.

    [0140] The compounds described herein may have ionizable groups so as to be capable of preparation as pharmaceutically acceptable salts. These salts may be acid addition salts involving inorganic or organic acids or the salts may, in the case of acidic forms of the compounds described herein, be prepared from inorganic or organic bases. Frequently, the compounds are prepared or used as pharmaceutically acceptable salts prepared as addition products of pharmaceutically acceptable acids or bases. Suitable pharmaceutically acceptable acids and bases and methods for preparation of the appropriate salts are well-known in the art. Salts may be prepared from pharmaceutically acceptable non-toxic acids and bases including inorganic and organic acids and bases. Representative acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, and valerate salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, and magnesium, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, and ethylamine.

    [0141] By a “reference” is meant any useful reference used to compare protein or mRNA levels or activity. The reference can be any sample, standard, standard curve, or level that is used for comparison purposes. The reference can be a normal reference sample or a reference standard or level. A “reference sample” can be, for example, a control, e.g., a predetermined negative control value such as a “normal control” or a prior sample taken from the same subject; a sample from a normal healthy subject, such as a normal cell or normal tissue; a sample (e.g., a cell or tissue) from a subject not having a disease; a sample from a subject that is diagnosed with a disease, but not yet treated with a compound described herein; a sample from a subject that has been treated by a compound described herein; or a sample of a purified protein (e.g., any described herein) at a known normal concentration. By “reference standard or level” is meant a value or number derived from a reference sample. A “normal control value” is a pre-determined value indicative of non-disease state, e.g., a value expected in a healthy control subject. Typically, a normal control value is expressed as a range (“between X and Y”), a high threshold (“no higher than X”), or a low threshold (“no lower than X”). A subject having a measured value within the normal control value for a particular biomarker is typically referred to as “within normal limits” for that biomarker. A normal reference standard or level can be a value or number derived from a normal subject not having a disease or disorder (e.g., a KCNT1 related disorder); a subject that has been treated with a compound described herein. In preferred embodiments, the reference sample, standard, or level is matched to the sample subject sample by at least one of the following criteria: age, weight, sex, disease stage, and overall health. A standard curve of levels of a purified protein, e.g., any described herein, within the normal reference range can also be used as a reference.

    [0142] As used herein, the term “subject” refers to any organism to which a composition in accordance with the invention may be administered, e.g., for experimental, diagnostic, prophylactic, and/or therapeutic purposes. Typical subjects include any animal (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans). A subject may seek or be in need of treatment, require treatment, be receiving treatment, be receiving treatment in the future, or be a human or animal who is under care by a trained professional for a particular disease or condition.

    [0143] As used herein, the terms “treat,” “treated,” or “treating” mean both therapeutic treatment and prophylactic or preventative measures wherein the object is to prevent or slow down (lessen) an undesired physiological condition, disorder, or disease, or obtain beneficial or desired clinical results. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of a condition, disorder, or disease; stabilized (i.e., not worsening) state of condition, disorder, or disease; delay in onset or slowing of condition, disorder, or disease progression; amelioration of the condition, disorder, or disease state or remission (whether partial or total), whether detectable or undetectable; an amelioration of at least one measurable physical parameter, not necessarily discernible by the subject; or enhancement or improvement of condition, disorder, or disease. Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment.

    [0144] As used herein, the term “derivative” refers to naturally-occurring, synthetic, and semi-synthetic analogues of a compound, peptide, protein, or other substance described herein. A derivative of a compound, peptide, protein, or other substance described herein may retain or improve upon the biological activity of the original material.

    [0145] The details of one or more embodiments of the invention are set forth in the description below. Other features, objects, and advantages of the invention will be apparent from the description and from the claims.

    [0146] KCNT1 Related Disorders

    [0147] The present inventors have found that inhibition or depletion of KCNT1 level and/or activity in a cell is effective in the treatment of a KCNT1 related disorder. Accordingly, the invention features useful compositions and methods to treat KCNT1 related disorders, e.g., in a subject in need thereof. The invention features single-stranded oligonucleotides that include 18-22 (e.g., 18, 19, 20, 21, and 22) linked nucleosides in length having a region of at least 18 (e.g., 18, 19, 20, 21, and 22) contiguous nucleobases of any one of SEQ ID NOs: 1-3525 (e.g., SEQ ID NOs: 1-116 or 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525). Also featured are oligonucleotides that cross-hybridize between human and mouse, human and monkey, or, human, mouse, and monkey KCNT1. The sequence of human KCNT1 mRNA transcript (NCBI NM_020822.2) is provided as SEQ ID NO: 3526. The sequence of mouse KCNT1 mRNA transcript is provided as SEQ ID NO: 3533. The sequence of cynomolgous monkey (Macaca fascicularis) KCNT1 mRNA transcript is provided as SEQ ID NO: 3534. The oligonucleotides (e.g., chemically modified oligonucleotides) may be administered to a subject with a KCNT1 related disorder (e.g., epilepsy) in order to treat, reduce the symptoms of, or prevent the KCNT1 related disorder. The oligonucleotides are antisense (e.g., at least partially complementary) to a target region of KCNT1 (e.g., KCNT1 mRNA, including pre-mRNA and processed mRNA). Following administration, the oligonucleotides reduce the level, expression, and/or activity of KCNT1 (e.g., KCNT1 mRNA and/or protein), thereby providing a therapeutic effect to the subject with a KCNT1 related disorder.

    [0148] KCNT1 encodes an intracellular sodium-activated potassium channel (potassium sodium-activated channel subfamily T member 1 that is expressed in the central nervous system. Also known as Slack, KCNT1 is a member of the Slo-type family of potassium channel genes and can co-assemble with other Slo channel subunits. These channels can mediate a sodium-sensitive potassium current (IKNa), which is triggered by an influx of sodium channels ions through sodium channels or neurotransmitter receptors. Delayed outward current may be involved in regulating neuronal excitability. The amino acid sequence of wild type KCNT1 (UNIPROT ID Q5JUK3-3) is provided as SEQ ID NO: 3527. The amino acid sequence of G288S KCNT1 is provided as SEQ ID NO: 3528. The amino acid sequence of R398Q KCNT1 is provided as SEQ ID NO: 3529. The amino acid sequence of R428Q KCNT1 is provided as SEQ ID NO: 3530. The amino acid sequence of R928C KCNT1 is provided as SEQ ID NO: 3531. The amino acid sequence of A934T KCNT1 is provided as SEQ ID NO: 3532.

    [0149] Mutations in KCNT1 (e.g., gain-of-function mutations) have been associated with particular forms of epilepsy, including epilepsy of infancy with migrating focal seizures (EIMFS), autosomal dominant nocturnal frontal lobe epilepsy (ADNFLE), West syndrome, infantile spasms, epileptic encephalopathy, focal epilepsy, Ohtahara syndrome, developmental epileptic encephalopathy, and Lennox Gastaut syndrome.

    [0150] EIMFS is a rare and debilitating genetic condition characterized by an early onset (before 6 months of age) of almost continuous heterogeneous focal seizures, where seizures appear to migrate from one brain region and hemisphere to another. Subjects with EIMFS may be intellectually impaired, non-verbal and non-ambulatory. Subjects with EIMFS may have a mutation (e.g., gain-of-function mutation) in KCNT1, such as V271F, G288S, R428Q, R474Q, R474H, R474C, I760M, A934T and P924L.

    [0151] ADNFLE has a later onset than EIMFS, generally in mid-childhood, and is generally a less severe condition. It is characterized by nocturnal frontal lobe seizures and can result in psychiatric, behavioral and cognitive disabilities in subjects with the condition. Subjects with ADNFLE may have a mutation (e.g., gain-of-function mutation) in KCNT1, such as M896I, R398Q, Y796H and R928C.

    [0152] West syndrome is a severe form of epilepsy in which subjects exhibit one or more of infantile spasms, an interictal electroencephalogram (EEG) pattern termed hypsarrhythmia, and mental retardation. Subjects with West syndrome may have a mutation (e.g., gain-of-function mutation) in KCNT1, such as G652V and R474H.

    [0153] Any of the KCNT1 related disorders described herein may be treated by administering the oligonucleotides (e.g., chemically modified oligonucleotides) of any one of SEQ ID NOs: 1-3525 (e.g., SEQ ID NOs: 1-116 or 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525) or oligonucleotides that are 18-22 nucleosides in length and have a region of at least 18 contiguous nucleosides, at least 19 contiguous nucleosides, at least 20 contiguous nucleosides, at least 21 contiguous nucleosides, or at least 22 contiguous nucleosides from any one of SEQ ID NOs: 1-3525 (e.g., SEQ ID NOs: 1-116 or 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525). In some embodiments, any of the KCNT1 related disorders described herein may be treated by administering the oligonucleotides (e.g., chemically modified oligonucleotides) of any one of SEQ ID NOs: 4, 1046, 1071, 1388, 1551, 1546, or 2595.

    [0154] The subject to be treated may have a gain-of-function mutation in KCNT1. The gain-of-function mutation may be one or more of V271F, L274I, G288S, F346L, R398Q, R428Q, R474H, F502V, M516V, K629N, I760M, Y796H, E893K, M896I, M896K, P924L, R928C, F932I, A934T, A966T, H257D, R262Q, Q270E, V340M, C377S, P409S, L437F, R474C, A477T, R565H, K629E, G652V, I760F, Q906H, R933G, R950Q, R961H, R1106Q, K1154Q, R474Q, Y1903C, H469L, M896R, K946E, and R950L.

    [0155] Table 1 below shows single nucleotide polymorphisms (SNPs) in KCNT1 transcript and the position of each SNP in comparison to the KCNT1 transcript (e.g, SEQ ID NO: 3526). The phrase “KCNT1 transcript variant” or “KCNT1 mRNA transcript variant” refers to a KCNT1 transcript that differs from the wild type KCNT1 transcript (e.g., SEQ ID NO: 3526) by at least one nucleotide (e.g., two, three, four, or five nucleotides).

    TABLE-US-00001 TABLE 1 SNPs in KCNT1. Further shown is the corresponding Amino Acid Mutation due to each SNP. RS No. refers to the dbSNP ID reference number, if the SNP has been entered into the dbSNP database. Single Nucleotide Polymorphisms (SNPs) in KCNT1 transcript (e.g., KCNT1 transcript variant) and their positions in SEQ ID NO: 3526 Amino Position in SEQ ID Acid RS No. HGVS Nomenclature Polymorphism NO: 3526 Mutation rs397515403 NM_020822.2 c.2800 G > A G/A 2874 A934T rs397515402 NM_020822.2 c.1283 G > A G/A 1357 R428Q rs587777264 NM_020822.2 c.862 G > A  G/A 936 G288S rs397515404 NM_020822.2 c.1421 G > A G/A 1495 R474H rs866242631 NM_020822.2 c.1420 C > T C/T 1494 R474C rs886043455 NM_020822.2 c.2849 G > A G/A 2923 R950Q rs397515407 NM_020822.2 c.1193 G > A G/A 1267 R398Q rs397515406 NM_020822.2 c.2386 T > C T/C 2460 Y796H NM_020822.2 c.1038 C > G C/G 1112 F346L NM_020822.2 c.2771 C > T C/T 2845 P924L NM_020822.2 c.811 G > T  G/T 885 V271F

    [0156] Oligonucleotide Agents

    [0157] Agents described herein that reduce the level and/or activity of KCNT1 in a cell may be, for example, a polynucleotide, e.g., an oligonucleotide. These agents reduce the level of an activity related to KCNT1, or a related downstream effect, or reduce the level of KCNT1 in a cell or subject.

    [0158] In some embodiments, the agent that reduces the level and/or activity of KCNT1 is a polynucleotide. In some embodiments, the polynucleotide is a single-stranded oligonucleotide (e.g., SEQ ID NOs: 1-3525 (e.g., SEQ ID NOs: 1-116 or 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525)), e.g., that acts by way of an RNase H-mediated pathway. Oligonucleotides include DNA and DNA/RNA chimeric molecules, typically about 10 to 30 nucleotides in length, which recognize polynucleotide target sequences or sequence portions through hydrogen bonding interactions with the nucleotide bases of the target sequence (e.g., KCNT1 mRNA transcript or KCNT1 mRNA transcript variant). An oligonucleotide molecule can decrease the expression level (e.g., protein level or mRNA level) of KCNT1. For example, an oligonucleotide includes oligonucleotides that targets full-length KCNT1. In some embodiments, the oligonucleotide molecule recruits an RNase H enzyme, leading to target mRNA degradation. In various embodiments, the oligonucleotide may be at least 16 nucleobases in length. In various embodiments, the oligonucleotide may be 17, 18, 19, 20, 21, or 22 nucleobases in length. In various embodiments, the oligonucleotide may be at least 17, at least 18, at least 19, at least 20, at least 21, or at least 22 nucleobases in length. In various embodiments, the oligonucleotide may be between 17-22, 18-21, or 19-20 nucleobases in length.

    [0159] In some embodiments, the oligonucleotide decreases the level and/or activity of a positive regulator of function. In other embodiments, the oligonucleotide increases the level and/or activity of an inhibitor of a positive regulator of function. In some embodiments, the oligonucleotide increases the level and/or activity of a negative regulator of function.

    [0160] In some embodiments, the oligonucleotide (e.g., SEQ ID NOs: 1-3525 (e.g., SEQ ID NOs: 1-116 or 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525)) decreases the level and/or activity or function of KCNT1. In some embodiments, the oligonucleotide (e.g., SEQ ID NOs: 1-3525 (e.g., SEQ ID NOs: 1-116 or 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525)) inhibits expression of KCNT1. In other embodiments, the oligonucleotide (e.g., SEQ ID NOs: 1-3525 (e.g., SEQ ID NOs: 1-116 or 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525)) increases degradation of KCNT1 and/or decreases the stability (e.g., half-life) of KCNT1. In some embodiments, an oligonucleotide (e.g., SEQ ID NOs: 1-3525 (e.g., SEQ ID NOs: 1-116 or 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525)) can be chemically synthesized.

    [0161] In some embodiments, an oligonucleotide (e.g., SEQ ID NOs: 1-3525 (e.g., SEQ ID NOs: 1-116 or 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525)) includes an oligonucleotide having a region of complementarity (e.g., a contiguous nucleobase region) which is complementary to at least a part of an mRNA formed in the expression of a KCNT1 gene. In some embodiments, the region of complementarity may be about 30 nucleotides or less in length (e.g., about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, or 18 nucleotides or less in length). In some embodiments, upon contact with a cell expressing the KCNT1 gene, the oligonucleotide may inhibit the expression of the KCNT1 gene (e.g., a human, a primate, a non-primate, or a bird KCNT1 gene) by at least about 10% as assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by immunofluorescence analysis, using, for example, Western Blotting or flowcytometric techniques.

    [0162] In some embodiments, the region of complementarity to the target sequence may be between 10 and 30 linked nucleosides in length, e.g., between 10-29, 10-28, 10-27, 10-26, 10-25, 10-24, 10-23, 10-22, 10-21, 10-20, 10-19, 10-18, 10-17, 10-16, 10-15, 10-14, 10-13, 10-12, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 linked nucleosides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

    [0163] In some embodiments, an oligonucleotide can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc.

    [0164] In some embodiments, an oligonucleotide compound can be prepared using solution-phase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that the oligonucleotide comprising unnatural or alternative nucleotides can be easily prepared. Single-stranded oligonucleotides of the invention can be prepared using solution-phase or solid-phase organic synthesis or both.

    [0165] In some embodiments, an oligonucleotide of the invention includes a region of at least 10 contiguous nucleobases having at least 80% (e.g., at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) complementary to at least 10 contiguous nucleotides of a KCNT1 transcript (e.g., SEQ ID NO: 3526) or KCNT1 transcript variant. In one aspect, an oligonucleotide of the invention includes a region of at least 10 contiguous nucleobases that are complementary to 10 contiguous nucleotides of a KCNT1 transcript (e.g., SEQ ID NO: 3526) or KCNT1 transcript variant. In some embodiments, the oligonucleotide comprises a sequence complementary to at least 10 contiguous nucleotides, 11 contiguous nucleotides, 12 contiguous nucleotides, 13 contiguous nucleotides, 14 contiguous nucleotides, 15 contiguous nucleotides, 16 contiguous nucleotides, 17 contiguous nucleotides, 18 contiguous nucleotides, 19 contiguous nucleotides, or 20 contiguous nucleotides of a KCNT1 transcript (e.g., SEQ ID NO: 3526) or KCNT1 transcript variant. In some embodiments, the oligonucleotide comprises a sequence complementary to between 19-23 contiguous nucleotides, the oligonucleotide sequence may be selected from any one of SEQ ID NOs: 1-3525 (e.g., SEQ ID NOs: 1-116 or 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525). In some embodiments, an oligonucleotides (e.g., chemically modified oligonucleotide) is selected from any one of SEQ ID NOs: 4, 1046, 1071, 1388, 1551, 1546, and 2595. In this aspect, the sequence is substantially complementary to a sequence of an mRNA generated in the expression of a KCNT1 gene.

    [0166] In some embodiments, an oligonucleotide has a nucleic acid sequence with at least 50% (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to the nucleic acid sequence any one of SEQ ID NOs: 1-3525 (e.g., SEQ ID NOs: 1-116 or 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525). In some embodiments, an oligonucleotide has a nucleic acid sequence with at least 85% sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 1-3525 (e.g., SEQ ID NOs: 1-116 or 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525). In some embodiments, an oligonucleotide has a nucleic acid sequence of any one of SEQ ID NOs: 1-3525 (e.g., SEQ ID NOs: 1-116 or 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525).

    [0167] In some embodiments, an oligonucleotide has a nucleic acid sequence with at least 50% (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to the nucleic acid sequence any one of SEQ ID NOs: 4, 1046, 1071, 1388, 1551, 1546, or 2595.

    [0168] It will be understood that, although, in some embodiments, the sequences in SEQ ID NOs: 1-3525 (e.g., SEQ ID NOs: 1-116 or 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525) are described as unmodified and/or un-conjugated sequences, the nucleosides of the oligonucleotide of the invention e.g., an oligonucleotide of the invention, may comprise any one of the sequences set forth in any one of SEQ ID NOs: 1-3525 (e.g., SEQ ID NOs: 1-116 or 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525) that is an alternative nucleoside and/or conjugated as described in detail below. In some embodiments, an oligonucleotide comprising any of the sequences shown in SEQ ID NOs: 1-3525 (e.g., SEQ ID NOs: 1-116 or 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525) can be unmodified or modified ribonucleic acid (RNA), deoxyribonucleic acid (DNA), or a mixture of RNA and DNA.

    [0169] The skilled person is well aware that oligonucleotides having a structure of between about 18-20 base pairs may be particularly effective in inducing RNase H-mediated degradation. However, one can appreciate that shorter or longer oligonucleotides can also be effective. In the embodiments described above, by virtue of the nature of the oligonucleotide sequences provided herein, oligonucleotides described herein can include. It can be reasonably expected that shorter oligonucleotides minus only a few linked nucleosides on one or both ends can be similarly effective as compared to the oligonucleotides described above. Hence, oligonucleotides having a sequence of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more contiguous linked nucleosides derived from one of the sequences provided herein (e.g., SEQ ID NOs: 1-3525 (e.g., SEQ ID NOs: 1-116 or 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525)), and differing in their ability to inhibit the expression of a KCNT1 gene by not more than about 5, 10, 15, 20, 25, or 30% inhibition from an oligonucleotide comprising the full sequence, are contemplated to be within the scope of the present invention.

    [0170] In some embodiments, the oligonucleotides described herein may function via nuclease-mediated degradation of the target nucleic acid, where the oligonucleotides of the invention are capable of recruiting a nuclease, particularly and endonuclease, preferably endoribonuclease (RNase) such as RNase H. Examples of oligonucleotide designs which operate via nuclease-mediated mechanisms are oligonucleotides which typically comprise a region of at least 5 or 6 DNA nucleosides and are flanked on one side or both sides by affinity enhancing alternative nucleosides, for example gapmers, headmers, and tailmers.

    [0171] The RNase H activity of an oligonucleotide refers to its ability to recruit RNase H when in a duplex with a complementary RNA molecule. International application publication number WO 01/23613 (incorporated by reference herein) provides in vitro methods for determining RNase H activity, which may be used to determine the ability to recruit RNase H. Typically an oligonucleotide is deemed capable of recruiting RNase H if it, when provided with a complementary target nucleic acid sequence, has an initial rate, as measured in pmol/l/min, of at least 5%, such as at least 10% or more than 20% of the of the initial rate determined when using an oligonucleotide having the same base sequence as the modified oligonucleotide being tested, but containing only DNA monomers, with phosphorothioate linkages between all monomers in the oligonucleotide, and using the methodology provided by Example 91-95 of WO01/23613 (hereby incorporated by reference).

    [0172] In some embodiments, the oligonucleotides described herein (e.g., SEQ ID NOs: 1-3525 (e.g., SEQ ID NOs: 1-116 or 1, 4, 5, 6, 8, 10, 12, 13, 15, 17, 28, 29, 62, 625-649, 1046, 1071, 1195-1224, 1388, 1496-1567, 2591-2631, or 3395-3525)) identify a site(s) in a KCNT1 transcript that is susceptible to RNase H-mediated cleavage. As such, the present invention further features oligonucleotides that target within this site(s). As used herein, an oligonucleotide is said to target within a particular site of an RNA transcript if the oligonucleotide promotes cleavage of the transcript anywhere within that particular site. Such an oligonucleotide will generally include at least about 5-10 contiguous linked nucleosides from one of the sequences provided herein coupled to additional linked nucleoside sequences taken from the region contiguous to the selected sequence in a KCNT1 gene.

    [0173] Inhibitory oligonucleotides can be designed by methods well known in the art. While a target sequence is generally about 10-30 linked nucleosides in length, there is wide variation in the suitability of particular sequences in this range for directing cleavage of any given target RNA.

    [0174] Oligonucleotides with homology sufficient to provide sequence specificity required to uniquely degrade any RNA can be designed using programs known in the art

    [0175] Systematic testing of several designed species for optimization of the inhibitory oligonucleotide sequence can also be undertaken in accordance with the teachings provided herein. Considerations when designing interfering oligonucleotides include, but are not limited to, biophysical, thermodynamic, and structural considerations, base preferences at specific positions, and homology. The making and use of inhibitory therapeutic agents based on non-coding oligonucleotides are also known in the art.

    [0176] Various software packages and the guidelines set out herein provide guidance for the identification of optimal target sequences for any given gene target, but an empirical approach can also be taken in which a “window” or “mask” of a given size (as a non-limiting example, 21 nucleotides) is literally or figuratively (including, e.g., in silico) placed on the target RNA sequence to identify sequences in the size range that can serve as target sequences. By moving the sequence “window” progressively one nucleotide upstream or downstream of an initial target sequence location, the next potential target sequence can be identified, until the complete set of possible sequences is identified for any given target size selected. This process, coupled with systematic synthesis and testing of the identified sequences (using assays as described herein or as known in the art) to identify those sequences that perform optimally can identify those RNA sequences that, when targeted with an oligonucleotide agent, mediate the best inhibition of target gene expression. Thus, while the sequences identified herein represent effective target sequences, it is contemplated that further optimization of inhibition efficiency can be achieved by progressively “walking the window” one nucleotide upstream or downstream of the given sequences to identify sequences with equal or better inhibition characteristics.

    [0177] Further, it is contemplated that for any sequence identified herein, further optimization could be achieved by systematically either adding or removing linked nucleosides to generate longer or shorter sequences and testing those sequences generated by walking a window of the longer or shorter size up or down the target RNA from that point. Again, coupling this approach to generating new candidate targets with testing for effectiveness of oligonucleotides based on those target sequences in an inhibition assay as known in the art and/or as described herein can lead to further improvements in the efficiency of inhibition.

    [0178] Further still, such optimized sequences can be adjusted by, e.g., the introduction of alternative nucleosides, alternative sugar moieties, and/or alternative internucleosidic linkages as described herein or as known in the art, including alternative nucleosides, alternative sugar moieties, and/or alternative internucleosidic linkages as known in the art and/or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, increasing interaction with silencing pathway enzymes, increasing release from endosomes) as an expression inhibitor. An oligonucleotide agent as described herein can contain one or more mismatches to the target sequence. In one embodiment, an oligonucleotide as described herein contains no more than 3 mismatches. If the oligonucleotide contains mismatches to a target sequence, it is preferable that the area of mismatch is not located in the center of the region of complementarity. If the oligonucleotide contains mismatches to the target sequence, it is preferable that the mismatch be restricted to be within the last 5 nucleotides from either the 5′- or 3′-end of the region of complementarity. For example, for a 30-linked nucleoside oligonucleotide agent, the contiguous nucleobase region which is complementary to a region of a KCNT1 transcript (e.g., SEQ ID NO: 3526) or KCNT1 mRNA transcript variant, generally does not contain any mismatch within the central 5-10 linked nucleosides. The methods described herein or methods known in the art can be used to determine whether an oligonucleotide containing a mismatch to a target sequence is effective in inhibiting the expression of a KCNT1 gene. Consideration of the efficacy of oligonucleotides with mismatches in inhibiting expression of a KCNT1 gene is important, especially if the particular region of complementarity in a KCNT1 transcript (e.g., SEQ ID NO: 3526) or KCNT1 mRNA transcript variant is known to have polymorphic sequence variation within the population.

    [0179] Construction of vectors for expression of polynucleotides for use in the invention may be accomplished using conventional techniques which do not require detailed explanation to one of ordinary skill in the art. For generation of efficient expression vectors, it is necessary to have regulatory sequences that control the expression of the polynucleotide. These regulatory sequences include promoter and enhancer sequences and are influenced by specific cellular factors that interact with these sequences, and are well known in the art.

    Alternative Oligonucleosides

    [0180] In one embodiment, one or more of the linked nucleosides or internucleosidic linkages of the oligonucleotide of the invention, is naturally occurring, and does not comprise, e.g., chemical modifications and/or conjugations known in the art and described herein. In another embodiment, one or more of the linked nucleosides or internucleosidic linkages of an oligonucleotide of the invention, is chemically modified to enhance stability or other beneficial characteristics. Without being bound by theory, it is believed that certain modifications can increase nuclease resistance and/or serum stability or decrease immunogenicity. For example, oligonucleotides of the invention may contain nucleotides found to occur naturally in DNA or RNA (e.g., adenine, thymidine, guanosine, cytidine, uridine, or inosine) or may contain alternative nucleosides or internucleosidic linkages which have one or more chemical modifications to one or more components of the nucleotide (e.g., the nucleobase, sugar, or phospho-linker moiety). Oligonucleotides of the invention may be linked to one another through naturally occurring phosphodiester bonds, or may contain alternative linkages (e.g., covalently linked through phosphorothioate (e.g., Sp phosphorothioate or Rp phosphorothioate), 3′-methylenephosphonate, 5′-methylenephosphonate, 3′-phosphoamidate, 2′-5′ phosphodiester, guanidinium, S-methylthiourea, 2′-alkoxy, alkyl phosphate, or peptide bonds).

    [0181] In certain embodiments of the invention, substantially all of the nucleosides or internucleosidic linkages of an oligonucleotide of the invention are alternative nucleosides. In other embodiments of the invention, all of the nucleosides or internucleosidic linkages of an oligonucleotide of the invention are alternative nucleosides. Oligonucleotides of the invention in which “substantially all of the nucleosides are alternative nucleosides” are largely but not wholly modified and can include not more than five, four, three, two, or one naturally occurring nucleosides. In still other embodiments of the invention, oligonucleotides of the invention can include not more than five, four, three, two, or one alternative nucleosides.

    [0182] The nucleic acids featured in the invention can be synthesized and/or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, N.Y., USA, which is hereby incorporated herein by reference.

    [0183] Alternative nucleotides and nucleosides include those with modifications including, for example, end modifications, e.g., 5′-end modifications (phosphorylation, conjugation, inverted linkages) or 3′-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2′-position or 4′-position) or replacement of the sugar; and/or backbone modifications, including modification or replacement of the phosphodiester linkages. The nucleobase may also be an isonucleoside in which the nucleobase is moved from the C1 position of the sugar moiety to a different position (e.g. C2, C3, C4, or C5). Specific examples of oligonucleotide compounds useful in the embodiments described herein include, but are not limited to, alternative nucleosides containing modified backbones or no natural internucleoside linkages. Nucleotides and nucleosides having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, alternative RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In some embodiments, an oligonucleotide will have a phosphorus atom in its internucleoside backbone.

    [0184] Alternative Internucleoside Linkages

    [0185] Alternative internucleoside linkages, also referred to as modified internucleoside linkages, include, for example, phosphorothioates, chiral phosphorothioates, 2′-alkoxy internucleoside linkages, alkyl phosphate internucleoside linkages, methylphosphonates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates and chiral phosphonates, morpholinos, PNAs, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, alkylphosphonates, methylphosphonates, dimethylphosphonates, thionoalkylphosphonates, thionoalkylphosphotriesters, phosphorodiamidates, thiophosphoramidates, thiophosphates, selenophosphates, and boranophosphates having normal 3′-5′ linkages, 2′-5′-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′. Various salts, mixed salts, and free acid forms are also included.

    [0186] In various embodiments, oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.

    [0187] Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6,239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Pat. RE39464, the entire contents of each of which are hereby incorporated herein by reference.

    [0188] Alternative internucleoside linkages that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S, and CH.sub.2 component parts.

    [0189] In some embodiments, the oligonucleotide may be defined by its pattern of backbone chiral centers. For example, a phophorothioate internucleoside linkage may be an R or S enantiomer. Each internucleoside linkage may thus be defined as Rp or Sp such that the entire stereochemistry of the backbone is chirally defined, e.g., as described in the International Publication No. WO 2015/107425, which is hereby incorporated by reference in its entirety. In some embodiments, only specific internucleoside linkages of the oligonucleotide (e.g., a plurality of the oligonucleotides) contain a chiral center. In other embodiments, the oligonucleotide (e.g., a plurality of the oligonucleotides) includes a mix of stereorandom and stereospecific chiral centers.

    [0190] Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, the entire contents of each of which are hereby incorporated herein by reference.

    [0191] In other embodiments, suitable oligonucleotides include those in which both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, a mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar of a nucleoside is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the oligonucleotides of the invention are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

    [0192] Some embodiments featured in the invention include oligonucleotides with phosphorothioate backbones and oligonucleotides with heteroatom backbones, and in particular —CH.sub.2—NH—CH.sub.2—, —CH.sub.2—N(CH.sub.3)—O—CH.sub.2-[known as a methylene (methylimino) or MMI backbone], —CH.sub.2—O—N(CH.sub.3)—CH.sub.2—, —CH.sub.2—N(CH.sub.3)—N(CH.sub.3)—CH.sub.2— and —N(CH.sub.3)—CH.sub.2—CH.sub.2-[wherein the native phosphodiester backbone is represented as —O—P—O—CH.sub.2-] of the above-referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above-referenced U.S. Pat. No. 5,602,240. In some embodiments, the oligonucleotides featured herein have morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506. In other embodiments, the oligonucleotides described herein include phosphorodiamidate morpholino oligomers (PMO), in which the deoxyribose moiety is replaced by a morpholine ring, and the charged phosphodiester inter-subunit linkage is replaced by an uncharged phophorodiamidate linkage, as described in Summerton, et al., Antisense Nucleic Acid Drug Dev. 1997, 7:63-70.

    [0193] Alternative Sugar Moeities

    [0194] Alternative nucleosides and nucleotides can also contain one or more substituted and/or modified sugar moieties. In some embodiments, oligonucleotides comprise modified sugar moeities, such as any one of a 2′-O-methyl (2′OMe) moeity, a 2′-O-methoxyethyl moeity, a bicyclic sugar moeity, PNA (e.g., an oligonucleotide comprising one or more N-(2-aminoethyl)-glycine units linked by amide bonds or carbonyl methylene linkage as repeating units in place of a sugar-phosphate backbone), locked nucleoside (LNA) (e.g., an oligonucleotide comprising one or more locked ribose, and can be a mixture of 2′-deoxy nucleotides or 2′OMe nucleotides), c-ET (e.g., an oligonucleotide comprising one or more cET sugar), cMOE (e.g., an oligonucleotide comprising one or more cMOE sugar), morpholino oligomer (e.g., an oligonucleotide comprising a backbone comprising one or more phosphorodiamidate morpholiono oligomers), 2′-deoxy-2′-fluoro nucleoside (e.g., an oligonucleotide comprising one or more 2′-fluoro-β-D-arabinonucleoside), tcDNA (e.g., an oligonucleotide comprising one or more tcDNA modified sugar), constrained ethyl 2′-4′-bridged nucleic acid (cEt), S-cEt, ethylene bridged nucleic acid (ENA) (e.g., an oligonucleotide comprising one or more ENA modified sugar), hexitol nucleic acids (HNA) (e.g., an oligonucleotide comprising one or more HNA modified sugar), or tricyclic analog (tcDNA) (e.g., an oligonucloetide comprising one or more tcDNA modified sugar).

    [0195] The oligonucleotides, e.g., oligonucleotides, featured herein can include one of the following at the 2′-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C.sub.1 to C.sub.10 alkyl or C2 to C.sub.10 alkenyl and alkynyl. Exemplary suitable modifications include —O[(CH.sub.2).sub.nO].sub.mCH.sub.3, —O(CH.sub.2), OCH.sub.3, —O(CH.sub.2).sub.n—NH.sub.2, —O(CH.sub.2), CH.sub.3, —O(CH.sub.2).sub.n—ONH.sub.2, and —O(CH.sub.2).sub.n—ON[(CH.sub.2).sub.nCH.sub.3].sub.2, where n and m are from 1 to about 10. In other embodiments, oligonucleotides include one of the following at the 2′ position: C.sub.1 to C.sub.10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. In some embodiments, the modification includes a 2′-methoxyethoxy (2′-O—CH.sub.2CH.sub.2OCH.sub.3, also known as 2′-O-(2-methoxyethyl) or 2′-MOE) (Martin et al., Helv. Chin. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. MOE nucleosides confer several beneficial properties to oligonucleotides including, but not limited to, increased nuclease resistance, improved pharmacokinetics properties, reduced non-specific protein binding, reduced toxicity, reduced immunostimulatory properties, and enhanced target affinity as compared to unmodified oligonucleotides.

    [0196] Another exemplary alternative contains 2′-dimethylaminooxyethoxy, i.e., a —O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2′-DMAOE, as described in examples herein below, and 2′-dimethylaminoethoxyethoxy (also known in the art as 2′-O-dimethylaminoethoxyethyl or 2′-DMAEOE), i.e., 2′-O—(CH.sub.2).sub.2—O—(CH.sub.2).sub.2—N(CH.sub.3).sub.2. Further exemplary alternatives include: 5′-Me-2′-F nucleotides, 5′-Me-2′-OMe nucleotides, 5′-Me-2′-deoxynucleotides, (both R and S isomers in these three families); 2′-alkoxyalkyl; and 2′-NMA (N-methylacetamide).

    [0197] Other alternatives include 2′-methoxy (2′-OCH.sub.3), 2′-aminopropoxy (2′-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2) and 2′-fluoro (2′-F). Similar modifications can also be made at other positions on the nucleosides and nucleotides of an oligonucleotide, particularly the 3′ position of the sugar on the 3′ terminal nucleotide or in 2′-5′ linked oligonucleotides and the 5′ position of 5′ terminal nucleotide. Oligonucleotides can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application. The entire contents of each of the foregoing are hereby incorporated herein by reference.

    [0198] In some embodiments, the sugar moiety in the nucleotide may be a ribose molecule, optionally having a 2′-O-methyl, 2′-O-MOE, 2′-F, 2′-amino, 2′-O-propyl, 2′-aminopropyl, or 2′-OH modification.

    [0199] An oligonucleotide of the invention can include one or more bicyclic sugar moieties. A “bicyclic sugar” is a furanosyl ring modified by the bridging of two atoms. A “bicyclic nucleoside” (“BNA”) is a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4′-carbon and the 2′-carbon of the sugar ring. In some embodiments, the bicyclic sugar comprises a 4′-CH(R)—O-2′ bridge wherein R is, independently, H, C.sub.1-C.sub.12 alkyl, or a protecting group. In some embodiments, R is methyl. In some embodiments, R is H.

    [0200] In some embodiments an agent of the invention may include one or more locked nucleosides. A locked nucleoside is a nucleoside having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2′ and 4′ carbons. In other words, a locked nucleoside is a nucleoside comprising a bicyclic sugar moiety comprising a 4′-CH.sub.2—O-2′ bridge. This structure effectively “locks” the ribose in the 3′-endo structural conformation. The addition of locked nucleosides to oligonucleotides has been shown to increase oligonucleotide stability in serum, and to reduce off-target effects (Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Examples of bicyclic nucleosides for use in the polynucleotides of the invention include without limitation nucleosides comprising a bridge between the 4′ and the 2′ ribosyl ring atoms. In certain embodiments, the polynucleotide agents of the invention include one or more bicyclic nucleosides comprising a 4′ to 2′ bridge. Examples of such 4′ to 2′ bridged bicyclic nucleosides, include but are not limited to 4′-(CH.sub.2)—O-2′ (LNA); 4′-(CH.sub.2)—S-2′; 4′-(CH.sub.2).sub.2-O-2′ (ENA); 4′-CH(CH.sub.3)—O-2′ (also referred to as “constrained ethyl” or “cEt”) and 4′-CH(CH.sub.2OCH.sub.3)—O-2′ (and analogs thereof; see, e.g., U.S. Pat. No. 7,399,845); 4′-C(CH.sub.3)(CH.sub.3)—O-2′ (and analogs thereof; see e.g., U.S. Pat. No. 8,278,283); 4′-CH.sub.2—N(OCH.sub.3)-2′ (and analogs thereof; see e.g., U.S. Pat. No. 8,278,425); 4′-CH.sub.2—O—N(CH.sub.3).sub.2-2′ (see, e.g., U.S. Patent Publication No. 2004/0171570); 4′-CH.sub.2—N(R)—O-2′, wherein R is H, C.sub.1-C.sub.12 alkyl, or a protecting group (see, e.g., U.S. Pat. No. 7,427,672); 4′-CH.sub.2—C(H)(CH.sub.3)-2′ (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4′-CH.sub.2—C(═CH.sub.2)-2′ (and analogs thereof; see, e.g., U.S. Pat. No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference.

    [0201] Additional representative U.S. Patents and US Patent Publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Pat. Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008/0039618; and US 2009/0012281, the entire contents of each of which are hereby incorporated herein by reference.

    [0202] Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L-ribofuranose and 3-D-ribofuranose (see International Publication No. WO 99/14226, contents of which are incorporated by reference herein).

    [0203] An oligonucleotide of the invention can also be modified to include one or more constrained ethyl nucleosides. As used herein, a “constrained ethyl nucleoside” or “cEt” is a locked nucleoside comprising a bicyclic sugar moiety comprising a 4′-CH(CH.sub.3)—O-2′ bridge. In one embodiment, a constrained ethyl nucleoside is in the S conformation referred to herein as “S-cEt.”

    [0204] An oligonucleotide of the invention may also include one or more “conformationally restricted nucleosides” (“CRN”). CRN are nucleoside analogs with a linker connecting the C2′ and C4′ carbons of ribose or the C3 and —C5′ carbons of ribose. CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to mRNA. The linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering.

    [0205] Representative publications that teach the preparation of certain of the above noted CRN include, but are not limited to, US Patent Publication No. 2013/0190383; and PCT publication WO 2013/036868, the entire contents of each of which are hereby incorporated herein by reference.

    [0206] In some embodiments, an oligonucleotide of the invention comprises one or more monomers that are UNA (unlocked nucleoside) nucleosides. UNA is unlocked acyclic nucleoside, wherein any of the bonds of the sugar has been removed, forming an unlocked “sugar” residue. In one example, UNA also encompasses monomer with bonds between C1′-C4′ have been removed (i.e., the covalent carbon-oxygen-carbon bond between the C1′ and C4′ carbons). In another example, the C2′-C3′ bond (i.e., the covalent carbon-carbon bond between the C2′ and C3′ carbons) of the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039 hereby incorporated by reference).

    [0207] Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Pat. No. 8,314,227; and US Patent Publication Nos. 2013/0096289; 2013/0011922; and 2011/0313020, the entire contents of each of which are hereby incorporated herein by reference.

    [0208] The ribose molecule may also be modified with a cyclopropane ring to produce a tricyclodeoxynucleic acid (tricyclo DNA). The ribose moiety may be substituted for another sugar such as 1,5,-anhydrohexitol, threose to produce a threose nucleoside (TNA), or arabinose to produce an arabino nucleoside. The ribose molecule can also be replaced with non-sugars such as cyclohexene to produce cyclohexene nucleoside or glycol to produce glycol nucleosides.

    [0209] Potentially stabilizing modifications to the ends of nucleoside molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2′-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3″-phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in PCT Publication No. WO 2011/005861.

    [0210] Other alternatives chemistries of an oligonucleotide of the invention include a 5′ phosphate or 5′ phosphate mimic, e.g., a 5′-terminal phosphate or phosphate mimic of an oligonucleotide. Suitable phosphate mimics are disclosed in, for example US Patent Publication No. 2012/0157511, the entire contents of which are incorporated herein by reference.

    [0211] Alternative Nucleobases

    [0212] An oligonucleotide of the invention can also include nucleobase (often referred to in the art simply as “base”) alternatives (e.g., modifications or substitutions). Unmodified or natural nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Alternative nucleobases, also referred to as modified nucleobases, include other synthetic and natural nucleobases such as 5-methylcytosine, pseudouridine, 5-methoxyuridine, 5-methylcytidine, 5-hydroxymethylcytidine, 5-formylcytidine, 5-carboxycytidine, pyrrolocytidine, dideoxycytidine, uridine, 5-methoxyuridine, 5-hydroxydeoxyuridine, dihydrouridine, 4-thiourdine, pseudouridine, 1-methyl-pseudouridine, deoxyuridine, 5-hydroxybutynl-2′-deoxyuridine, xanthine, hypoxanthine, 7-deaza-xanthine, thienoguanine, 8-aza-7-deazaguanosine, 7-methylguanosine, 7-deazaguanosine, 6-aminomethyl-7-deazaguanosine, 8-aminoguanine, 2,2,7-trimethylguanosine, 8-methyladenine, 8-azidoadenine, 7-methyladenine, 7-deazaadenine, 3-deazaadenine, 2,6-diaminopurine, 2-aminopurine, 7-deaza-8-aza-adenine, 8-amino-adenine, thymine, dideoxythymine, 5-nitroindole, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouridine, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uridine and cytidine, 6-azo uridine, cytidine and thymine, 4-thiouridine, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uridines and cytidines, 8-azaguanine and 8-azaadenine, and 3-deazaguanine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed by Sanghvi, Y S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2′-O-methoxyethyl sugar modifications. Examples of 5-methylcytosine substitutions include 5-Methyl-2′-deoxycytosine (5-Methyl-dC) or 5-Methyl-2′-cytosine (5-Methyl-C).

    [0213] Representative U.S. patents that teach the preparation of certain of the above noted alternative nucleobases as well as other alternative nucleobases include, but are not limited to, the above noted U.S. Pat. Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference.

    Exemplary Oligonucleotides Embodiments

    [0214] Exemplary oligonucleotides of the invention comprise nucleosides with alternative sugar moieties and may also comprise DNA or RNA nucleosides. In some embodiments, the oligonucleotide comprises nucleosides comprising alternative sugar moieties and DNA nucleosides. Incorporation of alternative nucleosides into the oligonucleotide of the invention may enhance the affinity of the oligonucleotide for the target nucleic acid. In that case, the alternative nucleosides can be referred to as affinity enhancing alternative nucleotides.

    [0215] In some embodiments, the oligonucleotide comprises at least one alternative nucleoside, such as at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 alternative nucleosides. In other embodiments, the oligonucleotides comprise from one to ten alternative nucleosides, from two to nine alternative nucleosides, from three to eight alternative nucleosides, from four to seven alternative nucleosides (e.g., 6 or 7 alternative nucleosides). In an embodiment, the oligonucleotide of the invention may comprise alternatives, which are independently selected from these three types of alternative (alternative sugar moiety, alternative nucleobase, and alternative internucleoside linkage), or a combination thereof. In some embodiments, the oligonucleotide comprises one or more nucleosides comprising alternative sugar moieties, e.g., 2′ sugar alternative nucleosides. In some embodiments, the oligonucleotide of the invention comprise the one or more 2′ sugar alternative nucleoside independently selected from the group consisting of 2′-O-alkyl-RNA, 2′-O-methyl-RNA, 2′-alkoxy-RNA, 2′-O-methoxyethyl-RNA, 2′-amino-DNA, 2′-fluoro-DNA, arabino nucleic acid (ANA), 2′-fluoro-ANA, and BNA (e.g., LNA) nucleosides. In some embodiments, the one or more alternative nucleoside is a BNA.

    [0216] In some embodiments, at least one of the alternative nucleosides is a BNA (e.g., an LNA), such as at least two, such as at least three, at least four, at least five, at least six, at least seven, or at least eight of the alternative nucleosides are BNAs. In a still further embodiment, all the alternative nucleosides are BNAs.

    [0217] In a further embodiment the oligonucleotide comprises at least one alternative internucleoside linkage. In some embodiments, the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate or boranophosphate internucleoside linkages. In some embodiments, all the internucleotide linkages in the contiguous sequence of the oligonucleotide are phosphorothioate linkages. In some embodiments the phosphorothioate linkages are stereochemically pure phosphorothioate linkages. In some embodiments, the phosphorothioate linkages are Sp phosphorothioate linkages. In other embodiments, the phosphorothioate linkages are Rp phosphorothioate linkages.

    [0218] In some embodiments, the oligonucleotide of the invention comprises at least one alternative nucleoside which is a 2′-MOE-RNA, such as 2, 3, 4, 5, 6, 7, 8, 9, or 10 2′-MOE-RNA nucleoside units. In some embodiments, the 2′-MOE-RNA nucleoside units are connected by phosphorothioate linkages. In some embodiments, at least one of said alternative nucleoside is 2′-fluoro DNA, such as 2, 3, 4, 5, 6, 7, 8, 9, or 10 2′-fluoro-DNA nucleoside units. In some embodiments, the oligonucleotide of the invention comprises at least one BNA unit and at least one 2′ substituted modified nucleoside. In some embodiments of the invention, the oligonucleotide comprises both 2′ sugar modified nucleosides and DNA units. In some embodiments, the oligonucleotide of the invention or contiguous nucleotide region thereof is a gapmer oligonucleotide.

    Additional Gapmer Oligonucleotide Embodiments

    [0219] In some embodiments the oligonucleotide of the invention, or contiguous nucleotide region thereof, has a gapmer design or structure also referred herein merely as “gapmer.” In a gapmer structure the oligonucleotide comprises at least three distinct structural regions a 5′-wing, a gap and a 3′-wing, in ‘5->3’ orientation. In this design, the 5′ and 3′ wing regions (also termed flanking regions) comprise at least one alternative nucleoside which is adjacent to a gap region, and may in some embodiments comprise a contiguous stretch of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 alternative nucleosides, or a contiguous stretch of alternative and DNA nucleosides (mixed wings comprising both alternative and DNA nucleosides). The length of the 5′-wing region may be at least two nucleosides in length (e.g., at least at least 2, at least 3, at least 4, at least 5, or more nucleosides in length). The length of the 3′-wing region may be at least two nucleosides in length (e.g., at least 2, at least 3, at least at least 4, at least 5, or more nucleosides in length). The 5′ and 3′ wing regions may be symmetrical or asymmetrical with respect to the number of nucleosides they comprise. In some embodiments, the gap region comprises about 10 nucleosides flanked by a 5′ and a 3′ wing region each comprising about 5 nucleosides, also referred to as a 5-10-5 gapmer.

    [0220] Consequently, the nucleosides of the 5′ wing region and the 3′ wing region which are adjacent to the gap region are alternative nucleosides, such as 2′ alternative nucleosides. The gap region comprises a contiguous stretch of nucleotides which are capable of recruiting RNase H, when the oligonucleotide is in duplex with the KCNT1 target nucleic acid. In some embodiments, the gap segment comprising one or more of linked deoxyribonucleosides, 2′-Fluoro Arabino Nucleic Acids (FANA), and Fluoro Cyclohexenyl nucleic acid (F-CeNA). In some embodiments, the gap region comprises a contiguous stretch of 5-16 DNA nucleosides. In some embodiments, the gap region comprises a contiguous stretch of 6-15, 7-14, 8-13, or 9-11 DNA nucleosides. In some embodiments, the gap region comprises a contiguous stretch of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 DNA nucleosides. In some embodiments, the gap region comprises a region of at least at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases having at least 80% (e.g., at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) complementarity to a KCNT1 transcript (e.g., SEQ ID NO: 3526) or KCNT1 transcript variant. In some embodiments, the gapmer comprises a region complementary to at least 17 contiguous nucleotides, 19-23 contiguous nucleotides, or 19 contiguous nucleotides of a KCNT1 transcript (e.g., SEQ ID NO: 3526) or KCNT1 transcript variant. The gapmer is complementary to the KCNT1 target nucleic acid (KCNT1 transcript (e.g., SEQ ID NO: 3526) or KCNT1 transcript variant), and may therefore be the contiguous nucleoside region of the oligonucleotide. In some embodiments, the gap region comprises a region of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases having at least 80% (e.g., at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity to an equal length portion of any one of SEQ ID NOs: 1-3525.

    [0221] The 5′ and 3′ wing regions, flanking the 5′ and 3′ ends of the gap region, may comprise one or more affinity enhancing alternative nucleosides. In some embodiments, the 5′ and/or 3′ wing comprises at least one 2′-O-methoxyethyl (MOE) nucleoside, for example at least two MOE nucleosides. In some embodiments, the 5′ wing comprises at least one MOE nucleoside. In some embodiments both the 5′ and 3′ wing regions comprise a MOE nucleoside. In some embodiments all the nucleosides in the wing regions are MOE nucleosides. In other embodiments, the wing regions may comprise both MOE nucleosides and other nucleosides (mixed wings), such as DNA nucleosides and/or non-MOE alternative nucleosides, such as bicyclic nucleosides (BNAs) (e.g., LNA nucleosides or cET nucleosides), or other 2′ substituted nucleosides. In this case the gap is defined as a contiguous sequence of at least 5 RNase H recruiting nucleosides (such as 5-16 DNA nucleosides) flanked at the 5′ and 3′ end by an affinity enhancing alternative nucleoside, such as an MOE nucleoside.

    [0222] In other embodiments, the 5′ and/or 3′ wing comprises at least one BNA (e.g., at least one LNA nucleoside or cET nucleoside), for example at least 2 bicyclic nucleosides. In some embodiments, the 5′ wing comprises at least one BNA. In some embodiments both the 5′ and 3′ wing regions comprise a BNA. In some embodiments all the nucleosides in the wing regions are BNAs. In other embodiments, the wing regions may comprise both BNAs and other nucleosides (mixed wings), such as DNA nucleosides and/or non-BNA alternative nucleosides, such as 2′ substituted nucleosides. In this case the gap is defined as a contiguous sequence of at least five RNase H recruiting nucleosides (such as 5-16 DNA nucleosides) flanked at the 5′ and 3′ end by an affinity enhancing alternative nucleoside, such as a BNA, such as an LNA, such as beta-D-oxy-LNA.

    [0223] The 5′ flank or 5′ wing attached to the 5′ end of the gap region comprises, contains, or consists of at least one alternative sugar moiety (e.g., at least three, at least four, at least five, at least six, at least seven, or more alternative sugar moieties). In some embodiments the wing region comprises or consists of from 1 to 7 alternative nucleobases, such as from two to six alternative nucleobases, from two to five alternative nucleobases, from two to four alternative nucleobases, or from one to three alternative nucleobases (e.g., one, two, three or four alternative nucleobases). In some embodiments, the wing region comprises or consists of at least one alternative internucleoside linkage (e.g., at least three, at least four, at least five, at least six, at least seven, or more alternative internucleoside linkages).

    [0224] In some embodiments, the 3′ flank or 3′ wing attached to the 3′ end of the gap region comprises, contains, or consists of at least one alternative sugar moiety (e.g., at least three, at least four, at least five, at least six, at least seven, or more alternative sugar moieties). In some embodiments the wing region comprises or consists of from one to seven alternative nucleobases, such as from two to six alternative nucleobases, from two to five alternative nucleobases, from two to four alternative nucleobases, or from one to three alternative nucleobases (e.g., two, three, or four alternative nucleobases). In some embodiments, the wing region comprises or consists of at least one alternative internucleoside linkage (e.g., at least three, at least four, at least five, at least six, at least seven, or more alternative internucleoside linkages).

    [0225] In an embodiment, one or more or all of the alternative sugar moieties in the wing regions are 2′ alternative sugar moieties.

    [0226] In a further embodiment, one or more of the 2′ alternative sugar moieties in the wing regions are selected from 2′-O-alkyl-sugar moieties, 2′-O-methyl-sugar moieties, 2′-amino-sugar moieties, 2′-fluoro-sugar moieties, 2′-alkoxy-sugar moieties, MOE sugar moieties, LNA sugar moieties, arabino nucleic acid (ANA) sugar moieties, and 2′-fluoro-ANA sugar moieties.

    [0227] In one embodiment of the invention all the alternative nucleosides in the wing regions are bicyclic nucleosides. In a further embodiment the bicyclic nucleosides in the wing regions are independently selected from the group consisting of oxy-LNA, thio-LNA, amino-LNA, cET, and/or ENA, in either the beta-D or alpha-L configurations or combinations thereof.

    [0228] In some embodiments, the one or more alternative internucleoside linkages in the wing regions are phosphorothioate internucleoside linkages. In some embodiments, the phosphorothioate linkages are stereochemically pure phosphorothioate linkages. In some embodiments the phosphorothioate linkages are Sp phosphorothioate linkages. In other embodiments, the phosphorothioate linkages are Rp phosphorothioate linkages. In some embodiments the phosphorothioate linkages are mixed stero-enriched (e.g., Sp-Rp-Sp or Rp-Sp-Rp) phosphorothioate linkages. In some embodiments, the alternative internucleoside linkages are 2′-alkoxy internucleoside linkages. In other embodiments, the alternative internucleoside linkages are alkyl phosphate internucleoside linkages.

    [0229] The gap region may comprise, contain, or consist of at least 5-16 consecutive DNA nucleosides capable of recruiting RNase H. In some embodiments, all of the nucleosides of the gap region are DNA units. In further embodiments the gap region may consist of a mixture of DNA and other nucleosides capable of mediating RNase H cleavage. In some embodiments, at least 50% of the nucleosides of the gap region are DNA, such as at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% DNA.

    [0230] The oligonucleotide of the invention comprises a contiguous region which is complementary to the target nucleic acid. In some embodiments, the oligonucleotide may further comprise additional linked nucleosides positioned 5′ and/or 3′ to either the 5′ and 3′ wing regions. These additional linked nucleosides can be attached to the 5′ end of the 5′ wing region or the 3′ end of the 3′ wing region, respectively. The additional nucleosides may, in some embodiments, form part of the contiguous sequence, which is complementary to the target nucleic acid, or in other embodiments, may be non-complementary to the target nucleic acid.

    [0231] The inclusion of the additional nucleosides at either, or both of the 5′ and 3′ wing regions may independently comprise one, two, three, four, or five additional nucleotides, which may be complementary or non-complementary to the target nucleic acid. In this respect the oligonucleotide of the invention, may in some embodiments comprise a contiguous sequence capable of modulating the target which is flanked at the 5′ and/or 3′ end by additional nucleotides. Such additional nucleosides may serve as a nuclease susceptible biocleavable linker and may therefore be used to attach a functional group such as a conjugate moiety to the oligonucleotide of the invention. In some embodiments the additional 5′ and/or 3′ end nucleosides are linked with phosphodiester linkages and may be DNA or RNA. In another embodiment, the additional 5′ and/or 3′ end nucleosides are alternative nucleosides which may for example be included to enhance nuclease stability or for ease of synthesis.

    [0232] In other embodiments, the oligonucleotides of the invention utilize “altimer” design and comprise alternating 2′-fluoro-ANA and DNA regions that are alternated every three nucleosides. Altimer oligonucleotides are discussed in more detail in Min, et al., Bioorganic & Medicinal Chemistry Letters, 2002, 12(18): 2651-2654 and Kalota, et al., Nuc. Acid Res. 2006, 34(2): 451-61 (herein incorporated by reference).

    [0233] In other embodiments, the oligonucleotides of the invention utilize “hemimer” design and comprise a single 2′-modified wing segment adjacent to (on either side of the 5′ or the 3′ side of) a gap region. Hemimer oligonucleotides are discussed in more detail in Geary et al., 2001, J. Pharm. Exp. Therap., 296: 898-904 (herein incorporated by reference).

    [0234] In various embodiments, the oligonucleotide comprises a 5′ wing region, a 3′ wing region, and a gap region between the 5′ and 3′ wing regions. In some embodiments, the gap region comprises a contiguous stretch of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 DNA nucleosides. In some embodiments, the gap region comprises a contiguous stretch of 8, 10, or 12 DNA nucleosides. In various embodiments, the 5′ and 3′ wing regions comprise one or more affinity enhancing alternative nucleosides, such as one or more 2′-O-methoxyethyl (MOE) nucleosides. In some embodiments, the 5′ wing region comprises one, two, three, four, five, or six 2′-O-MOE nucleosides. In particular embodiments, the 5′ wing region comprises either two or five 2′-O-MOE nucleosides. In some embodiments, the 5′ wing region comprises one, two, three, four, five, or six locked nucleosides (LNAs). In particular embodiments, the 5′ wing region comprises two LNAs. In some embodiments, the 5′ wing region comprises two 2′-O-MOE nucleosides and two LNAs.

    [0235] In some embodiments, the 3′ wing region comprises one, two, three, four, five, or six 2′-O-MOE nucleosides. In particular embodiments, the 3′ wing region comprises either three or five MOE nucleosides. In some embodiments, the 3′ wing region comprises one, two, three, four, five, or six locked nucleosides (LNAs). In particular embodiments, the 3′ wing region comprises two LNAs. In some embodiments, the 3′ wing region comprises three MOE nucleosides and two LNAs.

    [0236] In various embodiments, one or more internucleoside linkages of the oligonucleotide are naturally occurring linkages (e.g., phosphodiester bonds). In some embodiments, all of the internucleoside linkages of the oligonucleotide are naturally occurring linkages (e.g., phosphodiester bonds). In various embodiments, one or more internucleoside linkages of the oligonucleotide are alternative linkages (e.g., phosphorothioate linkages). In some embodiments, at least one, two, three, four, five, six, seven, eight, nine, or ten internucleoside linkages are phosphorothioate linkages. In various embodiments, the oligonucleotide includes both phosphodiester bonds and phosphorothioate linkages. In some embodiments, the gap region of the oligonucleotide comprises phosphodiester bonds and the 5′ wing region and 3′ wing region each comprises one or more phosphorothioate linkages.

    [0237] In various embodiments, the oligonucleotide includes one or more unmodified cytosines. In some embodiments, all of the cytosines in the oligonucleotide are unmodified. In various embodiments, the oligonucleotide includes one or more modified cytosines. An example of a modified cytosine is a 5-Methyl-2′-deoxycytosine (5-Methyl-dC) or 5-Methyl-2′-cytosine (5-Methyl-C). In some embodiments, all cytosines of the oligonucleotide are 5-Methyl-2′-deoxycytosine. In some embodiments, all cytosines in the gap region of the oligonucleotide are 5-Methyl-2′-deoxycytosine and all cytosines in the 5′ wing region and 3′ wing region are 5-Methyl-C.

    [0238] In one embodiment, the oligonucleotide has a chemically modified nucleobase sequence of eeeee-d10-eeeee (where “e” denotes a 2′-O-MOE modified nucleoside and where “d10” denotes a contiguous 10 DNA nucleobase sequence). In this embodiment, the 5′ wing region includes five 2′-O-MOE modified nucleosides, the gap region includes 10 contiguous DNA nucleobases, and the 3′ wing region includes five 2′-O-MOE modified nucleosides. The internucleoside linkages connecting the nucleobases can be phosphodiester bonds. In one embodiment, the oligonucleotide includes unmodified cytidines. In another embodiment, the oligonucleotide includes modified cytidines (e.g., 5-Methyl-dC and/or 5-Methyl-C).

    [0239] In one embodiment, the oligonucleotide has a chemically modified nucleobase sequence of eeeee-d12-eeeee. In this embodiment, the 5′ wing region includes five 2′-O-MOE modified nucleosides, the gap region includes 12 contiguous DNA nucleobases, and the 3′ wing region includes five 2′-O-MOE modified nucleosides. The internucleoside linkages connecting the nucleobases can be phosphodiester bonds. The oligonucleotide includes unmodified cytidines.

    [0240] In one embodiment, the oligonucleotide has a chemically modified nucleobase sequence of eeeee-d8-eeeee. In this embodiment, the 5′ wing region includes five 2′-O-MOE modified nucleosides, the gap region includes 8 contiguous DNA nucleobases, and the 3′ wing region includes five 2′-O-MOE modified nucleosides. The internucleoside linkages connecting the nucleobases can be as follows: sooosssssssssooss (where “s” refers to a phoshphorothiorate bond and “o” refers to a phosphodiester bond). The oligonucleotide includes unmodified cytidines.

    [0241] In one embodiment, the oligonucleotide has a chemically modified nucleobase sequence of eekk-d8-kkeee (where “e” denotes a 2′-O-MOE modified nucleoside, “d8” denotes a contiguous 8 DNA nucleobase sequence, and “k” denotes a locked nucleic acid (LNA), constrained methoxyethyl (cMOE) nucleoside, constrained ethyl (cET) nucleoside, or peptide nucleic acid (PNA). In this embodiment, the 5′ wing region includes two 2′-O-MOE modified nucleosides and two LNAs, the gap region includes 8 contiguous DNA nucleobases, and the 3′ wing region includes two LNAs and three 2′-O-MOE modified nucleosides. The internucleoside linkages connecting the nucleobases can be as follows: soosssssssssooss (where “s” refers to a phoshphorothiorate bond and “o” refers to a phosphodiester bond). The oligonucleotide includes unmodified cytidines.

    [0242] Oligonucleotides Conjugated to Ligands

    [0243] Oligonucleotides of the invention may be chemically linked to one or more ligands, moieties, or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., (1989) Proc. Natl. Acid. Sci. USA, 86: 6553-6556), cholic acid (Manoharan et al., (1994) Biorg. Med. Chem. Let., 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., (1992) Ann. N.Y. Acad. Sci., 660:306-309; Manoharan et al., (1993) Biorg. Med. Chem. Let., 3:2765-2770), a thiocholesterol (Oberhauser et al., (1992) Nucl. Acids Res., 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., (1991) EMBO J, 10:1111-1118; Kabanov et al., (1990) FEBS Lett., 259:327-330; Svinarchuk et al., (1993) Biochimie, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654; Shea et al., (1990) Nucl. Acids Res., 18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., (1995) Nucleosides & Nucleotides, 14:969-973), or adamantane acetic acid (Manoharan et al., (1995) Tetrahedron Lett., 36:3651-3654), a palmityl moiety (Mishra et al., (1995) Biochim. Biophys. Acta, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., (1996) J. Pharmacol. Exp. Ther., 277:923-937).

    [0244] In one embodiment, a ligand alters the distribution, targeting, or lifetime of an oligonucleotide agent into which it is incorporated. In some embodiments, a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ, or region of the body, as, e.g., compared to a species absent such a ligand.

    [0245] Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine, or hyaluronic acid); or a lipid. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.

    [0246] Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.

    [0247] Other examples of ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid,O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG].sub.2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.

    [0248] Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a hepatic cell. Ligands can also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, or multivalent fucose.

    [0249] The ligand can be a substance, e.g., a drug, which can increase the uptake of the oligonucleotide agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, and/or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.

    [0250] In some embodiments, a ligand attached to an oligonucleotide as described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc. Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases, or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present invention as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind serum components (e.g. serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.

    [0251] Ligand-conjugated oligonucleotides of the invention may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below). This reactive oligonucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto.

    [0252] The oligonucleotides used in the conjugates of the present invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as the phosphorothioates and alkylated derivatives.

    [0253] In the ligand-conjugated oligonucleotides of the present invention, such as the ligand-molecule bearing sequence-specific linked nucleosides of the present invention, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside-conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand-bearing building blocks.

    [0254] When using conjugate precursors that already bear a linking moiety, the synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the present invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.

    [0255] Lipid Conjugates

    [0256] In one embodiment, the ligand or conjugate is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule may bind a serum protein, e.g., human serum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non-kidney target tissue of the body. A lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, and/or (c) can be used to adjust binding to a serum protein, e.g., HSA.

    [0257] In another aspect, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell. Exemplary vitamins include vitamin A, E, and K.

    [0258] Cell Permeation Agents

    [0259] In another aspect, the ligand is a cell-permeation agent, for example a helical cell-permeation agent. In some embodiments, the cell permeation agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. In some embodiments, the helical agent is an alpha-helical agent, which may have a lipophilic and a lipophobic phase.

    [0260] The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide. The attachment of peptide and peptidomimetics to oligonucleotide agents can affect pharmacokinetic distribution of the oligonucleotide, such as by enhancing cellular recognition and absorption. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.

    [0261] A peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., consisting primarily of Tyr, Trp, or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 3535). An RFGF analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO: 3536) containing a hydrophobic MTS can also be a targeting moiety. The peptide moiety can be a “delivery” peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ) (SEQ ID NO: 3537) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK) (SEQ ID NO: 3538) have been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Examples of a peptide or peptidomimetic tethered to an oligonucleotide agent via an incorporated monomer unit for cell targeting purposes is an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.

    [0262] An RGD peptide for use in the compositions and methods of the invention may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a specific tissue(s). RGD-containing peptides and peptidiomimemtics may include D-amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand. Some conjugates of this ligand target PECAM-1 or VEGF.

    [0263] A cell permeation peptide is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell-permeating peptide can be, for example, an α-helical linear peptide (e.g., LL-37 or Ceropin P1), a disulfide bond-containing peptide (e.g., α-defensin, β-defensin, or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin). A cell permeation peptide can also include a nuclear localization signal (NLS). For example, a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).

    [0264] Carbohydrate Conjugates

    [0265] In some embodiments of the compositions and methods of the invention, an oligonucleotide further comprises a carbohydrate. The carbohydrate conjugated oligonucleotides are advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein. As used herein, “carbohydrate” refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Representative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums. Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).

    [0266] In one embodiment, a carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide.

    [0267] In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator and/or a cell permeation peptide.

    [0268] Additional carbohydrate conjugates (and linkers) suitable for use in the present invention include those described in PCT Publication Nos. WO 2014/179620 and WO 2014/179627, the entire contents of each of which are incorporated herein by reference.

    [0269] Linkers

    [0270] In some embodiments, the conjugate or ligand described herein can be attached to an oligonucleotide with various linkers that can be cleavable or non-cleavable.

    [0271] Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR.sup.8, C(O), C(O)NH, SO, SO.sub.2, SO.sub.2NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), SO.sub.2, N(R.sup.8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where R.sup.8 is hydrogen, acyl, aliphatic or substituted aliphatic. In one embodiment, the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-17, or 8-16 atoms.

    [0272] A cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In a preferred embodiment, the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).

    [0273] Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential, or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selective for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.

    [0274] A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.

    [0275] A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted. For example, a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other cell-types rich in esterases include cells of the lung, renal cortex, and testis.

    [0276] Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.

    [0277] In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. In preferred embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

    [0278] Redox Cleavable Linking Groups

    [0279] In one embodiment, a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of reductively cleavable linking group is a disulphide linking group (—S—S—). To determine if a candidate cleavable linking group is a suitable “reductively cleavable linking group,” or for example is suitable for use with a particular oligonucleotide moiety and particular targeting agent one can look to methods described herein. For example, a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell. The candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions. In one embodiment, candidate compounds are cleaved by at most about 10% in the blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media.

    [0280] Phosphate-Based Cleavable Linking Groups

    [0281] In another embodiment, a cleavable linker comprises a phosphate-based cleavable linking group. A phosphate-based cleavable linking group is cleaved by agents that degrade or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate-based linking groups are —O—P(O)(OR.sup.k)—O—,

    [0282] —O—P(S)(OR.sup.k)—O—, —O—P(S)(SR.sup.k)—O—, —S—P(O)(OR.sup.k)—O—, —O—P(O)(OR.sup.k)—S—, —S—P(O)(OR.sup.k)—S—,

    [0283] —O—P(S)(OR.sup.k)—S—, —S—P(S)(OR.sup.k)—O—, —O—P(O)(R.sup.k)—O—, —O—P(S)(R.sup.k)—O—, —S—P(O)(R.sup.k)—O—, —S—P(S)(R.sup.k)—O—,

    [0284] —S—P(O)(R.sup.k)—S—, —O—P(S)(R.sup.k)—S—. These candidates can be evaluated using methods analogous to those described above.

    [0285] Acid Cleavable Linking Groups

    [0286] In another embodiment, a cleavable linker comprises an acid cleavable linking group. An acid cleavable linking group is a linking group that is cleaved under acidic conditions. In preferred embodiments acid cleavable linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0, or lower), or by agents such as enzymes that can act as a general acid. In a cell, specific low pH organelles, such as endosomes and lysosomes can provide a cleaving environment for acid cleavable linking groups. Examples of acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids. Acid cleavable groups can have the general formula —C═NN—, C(O)O, or —OC(O). A preferred embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above.

    [0287] Ester-Based Linking Groups

    [0288] In another embodiment, a cleavable linker comprises an ester-based cleavable linking group. An ester-based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable linking groups include but are not limited to esters of alkylene, alkenylene and alkynylene groups. Ester cleavable linking groups have the general formula —C(O)O—, or —OC(O)—. These candidates can be evaluated using methods analogous to those described above.

    [0289] Peptide-Based Cleaving Groups

    [0290] In yet another embodiment, a cleavable linker comprises a peptide-based cleavable linking group. A peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. Peptide-based cleavable groups do not include the amide group (—C(O)NH—). The amide group can be formed between any alkylene, alkenylene, or alkynelene. A peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. The peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptide-based cleavable linking groups have the general formula

    [0291] —NHCHR.sup.AC(O)NHCHR.sup.BC(O)—, where R.sup.A and R.sup.B are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.

    [0292] In one embodiment, an oligonucleotide of the invention is conjugated to a carbohydrate through a linker. Linkers include bivalent and trivalent branched linker groups. Linkers for oligonucleotide carbohydrate conjugates include, but are not limited to, those described in formulas 24-35 of PCT Publication No. WO 2018/195165.

    [0293] Representative U.S. patents that teach the preparation of oligonucleotide conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931; 6,900,297; 7,037,646; 8,106,022, the entire contents of each of which are hereby incorporated herein by reference.

    [0294] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications can be incorporated in a single compound or even at a single nucleoside within an oligonucleotide. The present invention also includes oligonucleotide compounds that are chimeric compounds. Chimeric oligonucleotides typically contain at least one region wherein the RNA is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the oligonucleotide can serve as a substrate for enzymes capable of cleaving RNA:DNA. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligonucleotides when chimeric oligonucleotides are used, compared to phosphorothioate deoxy oligonucleotides hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

    [0295] In certain instances, the nucleotides of an oligonucleotide can be modified by a non-ligand group. A number of non-ligand molecules have been conjugated to oligonucleotides in order to enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm, 2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative United States patents that teach the preparation of such oligonucleotide conjugates have been listed above. Typical conjugation protocols involve the synthesis of an oligonucleotide bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction can be performed either with the oligonucleotide still bound to the solid support or following cleavage of the oligonucleotide, in solution phase. Purification of the oligonucleotide conjugate by HPLC typically affords the pure conjugate.

    [0296] Pharmaceutical Uses

    [0297] The oligonucleotide compositions described herein are useful in the methods of the invention and, while not bound by theory, are believed to exert their desirable effects through their ability to modulate the level, status, and/or activity of KCNT1, e.g., by inhibiting the activity or level of the KCNT1 protein in a cell in a mammal.

    [0298] An aspect of the present invention relates to methods of treating disorders (e.g., epilepsy) related to KCNT1 in a subject in need thereof. Another aspect of the invention includes reducing the level of KCNT1 in a cell of a subject identified as having a KCNT1 related disorder. Still another aspect includes a method of inhibiting expression of KCNT1 in a cell in a subject. The methods may include contacting a cell with an oligonucleotide, in an amount effective to inhibit expression of KCNT1 in the cell, thereby inhibiting expression of KCNT1 in the cell.

    [0299] Based on the above methods, further aspects of the present invention include an oligonucleotide of the invention, or a composition comprising such an oligonucleotide, for use in therapy, or for use as a medicament, or for use in treating KCNT1 related disorders in a subject in need thereof, or for use in reducing the level of KCNT1 in a cell of a subject identified as having a KCNT1 related disorder, or for use in inhibiting expression of KCNT1 in a cell in a subject. The uses include the contacting of a cell with the oligonucleotide, in an amount effective to inhibit expression of KCNT1 in the cell, thereby inhibiting expression of KCNT1 in the cell. Embodiments described below in relation to the methods of the invention are also applicable to these further aspects.

    [0300] Contacting of a cell with an oligonucleotide may be done in vitro or in vivo. Contacting a cell in vivo with the oligonucleotide includes contacting a cell or group of cells within a subject, e.g., a human subject, with the oligonucleotide. Combinations of in vitro and in vivo methods of contacting a cell are also possible. Contacting a cell may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand, including any ligand described herein or known in the art. In some embodiments, the targeting ligand is a carbohydrate moiety, e.g., a GalNAc.sub.3 ligand, or any other ligand that directs the oligonucleotide to a site of interest. Cells can include those of the central nervous system, or muscle cells.

    [0301] Inhibiting expression of a KCNT1 gene includes any level of inhibition of a KCNT1 gene, e.g., at least partial suppression of the expression of a KCNT1 gene, such as an inhibition by at least about 20%. In certain embodiments, inhibition is by at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

    [0302] The expression of a KCNT1 gene may be assessed based on the level of any variable associated with KCNT1 gene expression, e.g., KCNT1 mRNA level or KCNT1 protein level.

    [0303] Inhibition may be assessed by a decrease in an absolute or relative level of one or more of these variables compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).

    [0304] In certain embodiments, surrogate markers can be used to detect inhibition of KCNT1. For example, effective treatment of a KCNT1 related disorder, as demonstrated by acceptable diagnostic and monitoring criteria with an agent to reduce KCNT1 expression can be understood to demonstrate a clinically relevant reduction in KCNT1.

    [0305] In some embodiments of the methods of the invention, expression of a KCNT1 gene is inhibited by at least 20%, a 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or to below the level of detection of the assay. In certain embodiments, the methods include a clinically relevant inhibition of expression of KCNT1, e.g. as demonstrated by a clinically relevant outcome after treatment of a subject with an agent to reduce the expression of KCNT1.

    [0306] Inhibition of the expression of a KCNT1 gene may be manifested by a reduction of the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which a KCNT1 gene is transcribed and which has or have been treated (e.g., by contacting the cell or cells with an oligonucleotide of the invention, or by administering an oligonucleotide of the invention to a subject in which the cells are or were present) such that the expression of a KCNT1 gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s) not treated with an oligonucleotide or not treated with an oligonucleotide targeted to the gene of interest). The degree of inhibition may be expressed in terms of:

    [00001] ( mRNA in control cells ) - ( mRNA in treated cells ) ( mRNA in control cells ) × 1 0 0 %

    [0307] In other embodiments, inhibition of the expression of a KCNT1 gene may be assessed in terms of a reduction of a parameter that is functionally linked to KCNT1 gene expression, e.g., KCNT1 protein expression or KCNT1 activity. KCNT1 gene silencing may be determined in any cell expressing KCNT1, either endogenous or heterologous from an expression construct, and by any assay known in the art.

    [0308] Inhibition of the expression of a KCNT1 protein may be manifested by a reduction in the level of the KCNT1 protein that is expressed by a cell or group of cells (e.g., the level of protein expressed in a sample derived from a subject). As explained above, for the assessment of mRNA suppression, the inhibition of protein expression levels in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells.

    [0309] A control cell or group of cells that may be used to assess the inhibition of the expression of a KCNT1 gene includes a cell or group of cells that has not yet been contacted with an oligonucleotide of the invention. For example, the control cell or group of cells may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an oligonucleotide.

    [0310] The level of KCNT1 mRNA that is expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of KCNT1 in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the KCNT1 gene. RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNEASY™ RNA preparation kits (Qiagen) or PAXgene (PreAnalytix, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays, northern blotting, in situ hybridization, and microarray analysis. Circulating KCNT1 mRNA may be detected using methods the described in PCT Publication WO 2012/177906, the entire contents of which are hereby incorporated herein by reference. In some embodiments, the level of expression of KCNT1 is determined using a nucleic acid probe. The term “probe,” as used herein, refers to any molecule that is capable of selectively binding to a specific KCNT1 sequence, e.g. to an mRNA or polypeptide. Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.

    [0311] Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or northern analyses, polymerase chain reaction (PCR) analyses, and probe arrays. One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to KCNT1 mRNA. In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an AFFYMETRIX gene chip array. A skilled artisan can readily adapt known mRNA detection methods for use in determining the level of KCNT1 mRNA.

    [0312] An alternative method for determining the level of expression of KCNT1 in a sample involves the process of nucleic acid amplification and/or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Pat. No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self-sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi et al. (1988) Bio/Technology 6:1197), rolling circle replication (Lizardi et al., U.S. Pat. No. 5,854,033) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. In particular aspects of the invention, the level of expression of KCNT1 is determined by quantitative fluorogenic RT-PCR (i.e., the TAQMAN™ System) or the DUAL-GLO® Luciferase assay.

    [0313] The expression levels of KCNT1 mRNA may be monitored using a membrane blot (such as used in hybridization analysis such as northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support comprising bound nucleic acids). See U.S. Pat. Nos. 5,770,722; 5,874,219; 5,744,305; 5,677,195; and 5,445,934, which are incorporated herein by reference. The determination of KCNT1 expression level may also comprise using nucleic acid probes in solution.

    [0314] In some embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR). The use of this PCR method is described and exemplified in the Examples presented herein. Such methods can also be used for the detection of KCNT1 nucleic acids.

    [0315] The level of KCNT1 protein expression may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), immunoelectrophoresis, western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like. Such assays can also be used for the detection of proteins indicative of the presence or replication of KCNT1 proteins.

    [0316] In some embodiments of the methods of the invention, the oligonucleotide is administered to a subject such that the oligonucleotide is delivered to a specific site within the subject. The inhibition of expression of KCNT1 may be assessed using measurements of the level or change in the level of KCNT1 mRNA or KCNT1 protein in a sample derived from a specific site within the subject. In certain embodiments, the methods include a clinically relevant inhibition of expression of KCNT1, e.g., as demonstrated by a clinically relevant outcome after treatment of a subject with an agent to reduce the expression of KCNT1.

    [0317] In other embodiments, the oligonucleotide is administered in an amount and for a time effective to result in reduction (e.g., by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) of one or more symptoms of a KCNT1 disorder. Such symptoms include, but are not limited to, prolonged seizures, frequent seizures, behavioral and developmental delays, movement and balance issues, orthopedic conditions, delayed language and speech issues, growth and nutrition issues, sleeping difficulties, chronic infection, sensory integration disorder, disruption of the autonomic nervous system, and sweating.

    [0318] Treating KCNT1 related disorders can result in an increase in average survival time of an individual or a population of subjects treated according to the present invention in comparison to a population of untreated subjects. For example, the survival time is of an individual or average survival time a of population is increased by more than 30 days (more than 60 days, 90 days, or 120 days). An increase in survival time of an individual or in average survival time of a population may be measured by any reproducible means. An increase in survival time of an individual may be measured, for example, by calculating for an individual the length of survival time following the initiation of treatment with the compound described herein. An increase in average survival time of a population may be measured, for example, by calculating for the average length of survival time following initiation of treatment with the compound described herein. An increase in survival time of an individual may also be measured, for example, by calculating for an individual length of survival time following completion of a first round of treatment with a compound or pharmaceutically acceptable salt of a compound described herein. An increase in average survival time of a population may also be measured, for example, by calculating for a population the average length of survival time following completion of a first round of treatment with a compound or pharmaceutically acceptable salt of a compound described herein.

    [0319] Treating KCNT1 related disorders can also result in a decrease in the mortality rate of a population of treated subjects in comparison to an untreated population. For example, the mortality rate is decreased by more than 2% (e.g., more than 5%, 10%, or 25%). A decrease in the mortality rate of a population of treated subjects may be measured by any reproducible means, for example, by calculating for a population the average number of disease-related deaths per unit time following initiation of treatment with a compound or pharmaceutically acceptable salt of a compound described herein. A decrease in the mortality rate of a population may also be measured, for example, by calculating for a population the average number of disease-related deaths per unit time following completion of a first round of treatment with a compound or pharmaceutically acceptable salt of a compound described herein.

    [0320] Delivery of Oligonucleotides

    [0321] The delivery of an oligonucleotide of the invention to a cell e.g., a cell within a subject, such as a human subject e.g., a subject in need thereof, such as a subject having a KCNT1 related disorder can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an oligonucleotide of the invention either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition comprising an oligonucleotide to a subject. These alternatives are discussed further below.

    [0322] In general, any method of delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with an oligonucleotide of the invention (see e.g., Akhtar S. and Julian R L., (1992) Trends Cell. Biol. 2(5):139-144 and WO 94/02595, which are incorporated herein by reference in their entireties). For in vivo delivery, factors to consider in order to deliver an oligonucleotide molecule include, for example, biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue. The non-specific effects of an oligonucleotide can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation. Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that can otherwise be harmed by the agent or that can degrade the agent, and permits a lower total dose of the oligonucleotide molecule to be administered.

    [0323] For administering an oligonucleotide systemically for the treatment of a disease, the oligonucleotide can include alternative nucleobases, alternative sugar moieties, and/or alternative internucleoside linkages, or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the oligonucleotide by endo- and exo-nucleases in vivo. Modification of the oligonucleotide or the pharmaceutical carrier can also permit targeting of the oligonucleotide composition to the target tissue and avoid undesirable off-target effects. Oligonucleotide molecules can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. In an alternative embodiment, the oligonucleotide can be delivered using drug delivery systems such as a nanoparticle, a lipid nanoparticle, a polyplex nanoparticle, a lipoplex nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of an oligonucleotide molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an oligonucleotide by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an oligonucleotide, or induced to form a vesicle or micelle that encases an oligonucleotide. The formation of vesicles or micelles further prevents degradation of the oligonucleotide when administered systemically. In general, any methods of delivery of nucleic acids known in the art may be adaptable to the delivery of the oligonucleotides of the invention. Methods for making and administering cationic oligonucleotide complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, D R., et al. (2003) J. Mol. Biol 327:761-766; Verma, U N. et al., (2003) Clin. Cancer Res. 9:1291-1300; Arnold, A S et al., (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of oligonucleotides include DOTAP (Sorensen, D R., et al (2003), supra; Verma, U N. et al., (2003), supra), Oligofectamine, “solid nucleic acid lipid particles” (Zimmermann, T S. et al., (2006) Nature 441:111-114), cardiolipin (Chien, P Y. et al., (2005) Cancer Gene Ther. 12:321-328; Pal, A. et al., (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet M E. et al., (2008) Pharm. Res. August 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, D A. et al., (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H. et al., (1999) Pharm. Res. 16:1799-1804). In some embodiments, an oligonucleotide forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of oligonucleotides and cyclodextrins can be found in U.S. Pat. No. 7,427,605, which is herein incorporated by reference in its entirety. In some embodiments the oligonucleotides of the invention are delivered by polyplex or lipoplex nanoparticles. Methods for administration and pharmaceutical compositions of oligonucleotides and polyplex nanoparticles and lipoplex nanoparticles can be found in U.S. Patent

    [0324] Application Nos. 2017/0121454; 2016/0369269; 2016/0279256; 2016/0251478; 2016/0230189; 2015/0335764; 2015/0307554; 2015/0174549; 2014/0342003; 2014/0135376; and 2013/0317086, which are herein incorporated by reference in their entirety.

    [0325] In some embodiments, the compounds described herein may be administered in combination with additional therapeutics. Examples of additional therapeutics include standard of care anti-epilepsy medications such as quinidine and/or sodium channel blockers. Additionally, the compounds described herein may be administered in combination with recommended lifestyle changes such as a ketogenic diet.

    [0326] Membranous Molecular Assembly Delivery Methods

    [0327] Oligonucleotides of the invention can also be delivered using a variety of membranous molecular assembly delivery methods including polymeric, biodegradable microparticle, or microcapsule delivery devices known in the art. For example, a colloidal dispersion system may be used for targeted delivery of an oligonucleotide agent described herein. Colloidal dispersion systems include macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. Liposomes are artificial membrane vesicles that are useful as delivery vehicles in vitro and in vivo. It has been shown that large unilamellar vesicles (LUV), which range in size from 0.2-4.0 μm can encapsulate a substantial percentage of an aqueous buffer containing large macromolecules. Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes. As the merging of the liposome and cell progresses, the internal aqueous contents that include the oligonucleotide are delivered into the cell where the oligonucleotide can specifically bind to a target RNA and can mediate RNase H-mediated gene silencing. In some cases, the liposomes are also specifically targeted, e.g., to direct the oligonucleotide to particular cell types. The composition of the liposome is usually a combination of phospholipids, usually in combination with steroids, especially cholesterol. Other phospholipids or other lipids may also be used. The physical characteristics of liposomes depend on pH, ionic strength, and the presence of divalent cations.

    [0328] A liposome containing an oligonucleotide can be prepared by a variety of methods. In one example, the lipid component of a liposome is dissolved in a detergent so that micelles are formed with the lipid component. For example, the lipid component can be an amphipathic cationic lipid or lipid conjugate. The detergent can have a high critical micelle concentration and may be nonionic. Exemplary detergents include cholate, CHAPS, octylglucoside, deoxycholate, and lauroyl sarcosine. The oligonucleotide preparation is then added to the micelles that include the lipid component. The cationic groups on the lipid interact with the oligonucleotide and condense around the oligonucleotide to form a liposome. After condensation, the detergent is removed, e.g., by dialysis, to yield a liposomal preparation of oligonucleotide.

    [0329] If necessary, a carrier compound that assists in condensation can be added during the condensation reaction, e.g., by controlled addition. For example, the carrier compound can be a polymer other than a nucleic acid (e.g., spermine or spermidine). The pH can also be adjusted to favor condensation.

    [0330] Methods for producing stable polynucleotide delivery vehicles, which incorporate a polynucleotide/cationic lipid complex as a structural component of the delivery vehicle, are further described in, e.g., WO 96/37194, the entire contents of which are incorporated herein by reference. Liposome formation can also include one or more aspects of exemplary methods described in Feigner, P. L. et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417; U.S. Pat. Nos. 4,897,355; 5,171,678; Bangham et al., (1965) M. Mol. Biol. 23:238; Olson et al., (1979) Biochim. Biophys. Acta 557:9; Szoka et al., (1978) Proc. Natl. Acad. Sci. 75: 4194; Mayhew et al., (1984) Biochim. Biophys. Acta 775:169; Kim et al., (1983) Biochim. Biophys. Acta 728:339; and Fukunaga et al., (1984) Endocrinol. 115:757. Commonly used techniques for preparing lipid aggregates of appropriate size for use as delivery vehicles include sonication and freeze-thaw plus extrusion (see, e.g., Mayer et al., (1986) Biochim. Biophys. Acta 858:161. Microfluidization can be used when consistently small (50 to 200 nm) and relatively uniform aggregates are desired (Mayhew et al., (1984) Biochim. Biophys. Acta 775:169). These methods are readily adapted to packaging oligonucleotide preparations into liposomes.

    [0331] Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged nucleic acid molecules to form a stable complex. The positively charged nucleic acid/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al. (1987) Biochem. Biophys. Res. Commun., 147:980-985).

    [0332] Liposomes, which are pH-sensitive or negatively charged, entrap nucleic acids rather than complex with them. Since both the nucleic acid and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some nucleic acid is entrapped within the aqueous interior of these liposomes. pH sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al. (1992) Journal of Controlled Release, 19:269-274).

    [0333] One major type of liposomal composition includes phospholipids other than naturally derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.

    [0334] Examples of other methods to introduce liposomes into cells in vitro and in vivo include U.S. Pat. Nos. 5,283,185; 5,171,678; WO 94/00569; WO 93/24640; WO 91/16024; Feigner, (1994) J. Biol. Chem. 269:2550; Nabel, (1993) Proc. Natl. Acad. Sci. 90:11307; Nabel, (1992) Human Gene Ther. 3:649; Gershon, (1993) Biochem. 32:7143; and Strauss, (1992) EMBO J. 11:417.

    [0335] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising NOVASOME™ I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and NOVASOME™ II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporine A into different layers of the skin (Hu et al., (1994) S.T.P.Pharma. Sci., 4(6):466).

    [0336] Liposomes may also be sterically stabilized liposomes, comprising one or more specialized lipids that result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside G.sub.M1, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., (1987) FEBS Letters, 223:42; Wu et al., (1993) Cancer Research, 53:3765).

    [0337] Various liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., (1987), 507:64) reported the ability of monosialoganglio side G.sup.M1, galactocerebroside sulfate, and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., (1988), 85:6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to Allen et al., disclose liposomes comprising (1) sphingomyelin and (2) the ganglioside G.sub.M1 or a galactocerebroside sulfate ester. U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al).

    [0338] In one embodiment, cationic liposomes are used. Cationic liposomes possess the advantage of being able to fuse to the cell membrane. Non-cationic liposomes, although not able to fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver oligonucleotides to macrophages.

    [0339] Further advantages of liposomes include: liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated oligonucleotides in their internal compartments from metabolism and degradation (Rosoff, in “Pharmaceutical Dosage Forms,” Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.

    [0340] A positively charged synthetic cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) can be used to form small liposomes that interact spontaneously with nucleic acid to form lipid-nucleic acid complexes which are capable of fusing with the negatively charged lipids of the cell membranes of tissue culture cells, resulting in delivery of oligonucleotide (see, e.g., Feigner, P. L. et al., (1987) Proc. Natl. Acad. Sci. USA 8:7413-7417, and U.S. Pat. No. 4,897,355 for a description of DOTMA and its use with DNA).

    [0341] A DOTMA analogue, 1,2-bis(oleoyloxy)-3-(trimethylammonia)propane (DOTAP) can be used in combination with a phospholipid to form DNA-complexing vesicles. LIPOFECTIN™ Bethesda Research Laboratories, Gaithersburg, Md.) is an effective agent for the delivery of highly anionic nucleic acids into living tissue culture cells that comprise positively charged DOTMA liposomes which interact spontaneously with negatively charged polynucleotides to form complexes. When enough positively charged liposomes are used, the net charge on the resulting complexes is also positive. Positively charged complexes prepared in this way spontaneously attach to negatively charged cell surfaces, fuse with the plasma membrane, and efficiently deliver functional nucleic acids into, for example, tissue culture cells. Another commercially available cationic lipid, 1,2-bis(oleoyloxy)-3,3-(trimethylammonia)propane (“DOTAP”) (Boehringer Mannheim, Indianapolis, Ind.) differs from DOTMA in that the oleoyl moieties are linked by ester, rather than ether linkages.

    [0342] Other reported cationic lipid compounds include those that have been conjugated to a variety of moieties including, for example, carboxyspermine which has been conjugated to one of two types of lipids and includes compounds such as 5-carboxyspermylglycine dioctaoleoylamide (“DOGS”) (TRANSFECTAM™, Promega, Madison, Wis.) and dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide (“DPPES”) (see, e.g., U.S. Pat. No. 5,171,678).

    [0343] Another cationic lipid conjugate includes derivatization of the lipid with cholesterol (“DC-Chol”) which has been formulated into liposomes in combination with DOPE (See, Gao, X. and Huang, L., (1991) Biochim. Biophys. Res. Commun. 179:280). Lipopolylysine, made by conjugating polylysine to DOPE, has been reported to be effective for transfection in the presence of serum (Zhou, X. et al., (1991) Biochim. Biophys. Acta 1065:8). For certain cell lines, these liposomes containing conjugated cationic lipids, are said to exhibit lower toxicity and provide more efficient transfection than the DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, Calif.) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, Md.). Other cationic lipids suitable for the delivery of oligonucleotides are described in WO 98/39359 and WO 96/37194.

    [0344] Liposomal formulations are particularly suited for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer oligonucleotide into the skin. In some implementations, liposomes are used for delivering oligonucleotide to epidermal cells and also to enhance the penetration of oligonucleotide into dermal tissues, e.g., into skin. For example, the liposomes can be applied topically. Topical delivery of drugs formulated as liposomes to the skin has been documented (see, e.g., Weiner et al., (1992) Journal of Drug Targeting, vol. 2,405-410 and du Plessis et al., (1992) Antiviral Research, 18:259-265; Mannino, R. J. and Fould-Fogerite, S., (1998) Biotechniques 6:682-690; Itani, T. et al., (1987) Gene 56:267-276; Nicolau, C. et al. (1987) Meth. Enzymol. 149:157-176; Straubinger, R. M. and Papahadjopoulos, D. (1983) Meth. Enzymol. 101:512-527; Wang, C. Y. and Huang, L., (1987) Proc. Natl. Acad. Sci. USA 84:7851-7855).

    [0345] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising NOVASOME I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and NOVASOME II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver a drug into the dermis of mouse skin. Such formulations with oligonucleotides are useful for treating a dermatological disorder.

    [0346] The targeting of liposomes is also possible based on, for example, organ-specificity, cell-specificity, and organelle-specificity and is known in the art. In the case of a liposomal targeted delivery system, lipid groups can be incorporated into the lipid bilayer of the liposome in order to maintain the targeting ligand in stable association with the liposomal bilayer. Various linking groups can be used for joining the lipid chains to the targeting ligand. Additional methods are known in the art and are described, for example in U.S. Patent Application Publication No. 20060058255, the linking groups of which are herein incorporated by reference.

    [0347] Liposomes that include oligonucleotides can be made highly deformable. Such deformability can enable the liposomes to penetrate through pore that are smaller than the average radius of the liposome. For example, transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes can be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes can be made by adding surface edge activators, usually surfactants, to a standard liposomal composition. Transfersomes that include oligonucleotides can be delivered, for example, subcutaneously by infection in order to deliver oligonucleotides to keratinocytes in the skin. In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. In addition, due to the lipid properties, these transfersomes can be self-optimizing (adaptive to the shape of pores, e.g., in the skin), self-repairing, and can frequently reach their targets without fragmenting, and often self-loading. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

    [0348] Other formulations amenable to the present invention are described in PCT Publication Nos. WO 2009/088891, WO 2009/132131, and WO 2008/042973, which are hereby incorporated by reference in their entirety.

    [0349] Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic group (also known as the “head”) provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

    [0350] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general, their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.

    [0351] If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.

    [0352] If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.

    [0353] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines, and phosphatides.

    [0354] The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

    [0355] The oligonucleotides for use in the methods of the invention can also be provided as micellar formulations. Micelles are a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic portions of the molecules are directed inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The converse arrangement exists if the environment is hydrophobic.

    [0356] Lipid Nanoparticle-Based Delivery Methods

    [0357] Oligonucleotides of in the invention may be fully encapsulated in a lipid formulation, e.g., a lipid nanoparticle (LNP), or other nucleic acid-lipid particle. LNPs are extremely useful for systemic applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the administration site). LNPs include “pSPLP,” which include an encapsulated condensing agent-nucleic acid complex as set forth in PCT Publication No. WO 00/03683. The particles of the present invention typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic. In addition, the nucleic acids when present in the nucleic acid-lipid particles of the present invention are resistant in aqueous solution to degradation with a nuclease. Nucleic acid-lipid particles and their method of preparation are disclosed in, e.g., U.S. Pat. Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; U.S. Publication No. 2010/0324120 and PCT Publication No. WO 96/40964.

    [0358] In one embodiment, the lipid to drug ratio (mass/mass ratio) (e.g., lipid to oligonucleotide ratio) will be in the range of from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1. Ranges intermediate to the above recited ranges are also contemplated to be part of the invention.

    [0359] Non-limiting examples of cationic lipids include N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N—(I-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N—(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyoxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-Dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-Dioleylamino)-1,2-propanedio (DOAP), 1,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)—N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyetetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl4-(dimethylamino)bu-tanoate (MC3), 1,1′-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)ami-no)ethyl)piperazin-1-yeethylazanediyedidodecan-2-ol (Tech G1), or a mixture thereof. The cationic lipid can comprise, for example, from about 20 mol % to about 50 mol % or about 40 mol % of the total lipid present in the particle.

    [0360] The ionizable/non-cationic lipid can be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol, or a mixture thereof. The non-cationic lipid can be, for example, from about 5 mol % to about 90 mol %, about 10 mol %, or about 60 mol % if cholesterol is included, of the total lipid present in the particle.

    [0361] The conjugated lipid that inhibits aggregation of particles can be, for example, a polyethyleneglycol (PEG)-lipid including, without limitation, a PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture thereof. The PEG-DAA conjugate can be, for example, a PEG-dilauryloxypropyl (C.sub.12), a PEG-dimyristyloxypropyl (C.sub.14), a PEG-dipalmityloxypropyl (C.sub.16), or a PEG-distearyloxypropyl (C.sub.18). The conjugated lipid that prevents aggregation of particles can be, for example, from 0 mol % to about 20 mol % or about 2 mol % of the total lipid present in the particle.

    [0362] In some embodiments, the nucleic acid-lipid particle further includes cholesterol at, e.g., about 10 mol % to about 60 mol % or about 50 mol % of the total lipid present in the particle.

    [0363] Combination Therapies

    [0364] A method of the invention can be used alone or in combination with an additional therapeutic agent, e.g., other agents that treat KCNT1 related disorders or symptoms associated therewith, or in combination with other types of therapies to treat KCNT1 related disorders. In combination treatments, the dosages of one or more of the therapeutic compounds may be reduced from standard dosages when administered alone. For example, doses may be determined empirically from drug combinations and permutations or may be deduced by isobolographic analysis (e.g., Black et al., Neurology 65:S3-S6 (2005)). In this case, dosages of the compounds when combined should provide a therapeutic effect.

    [0365] In some embodiments, the oligonucleotide agents described herein may be used in combination with an additional therapeutic agent to treat a KCNT1 related disorder. In some embodiments, the additional therapeutic agent may be an oligonucleotide (e.g., an ASO) that hybridizes with the mRNA of gene associated with a KCNT1 related disorder.

    [0366] In some embodiments, the second therapeutic agent is a chemotherapeutic agent (e.g., a cytotoxic agent or other chemical compound useful in the treatment of a KCNT1 related disorder).

    [0367] The second agent may be a therapeutic agent which is a non-drug treatment. For example, the second therapeutic agent is physical therapy.

    [0368] In any of the combination embodiments described herein, the first and second therapeutic agents may be administered simultaneously or sequentially, in either order. The first therapeutic agent may be administered immediately, up to 1 hour, up to 2 hours, up to 3 hours, up to 4 hours, up to 5 hours, up to 6 hours, up to 7 hours, up to, 8 hours, up to 9 hours, up to 10 hours, up to 11 hours, up to 12 hours, up to 13 hours, 14 hours, up to hours 16, up to 17 hours, up 18 hours, up to 19 hours up to 20 hours, up to 21 hours, up to 22 hours, up to 23 hours up to 24 hours or up to 1-7, 1-14, 1-21 or 1-30 days before or after the second therapeutic agent.

    [0369] Pharmaceutical Compositions

    [0370] In some embodiments, the oligonucleotides described herein are formulated into pharmaceutical compositions for administration to human subjects in a biologically compatible form suitable for administration in vivo.

    [0371] The compounds described herein may be used in the form of the free base, in the form of salts, solvates, and as prodrugs. All forms are within the methods described herein. In accordance with the methods of the invention, the described compounds or salts, solvates, or prodrugs thereof may be administered to a subject in a variety of forms depending on the selected route of administration, as will be understood by those skilled in the art. The compounds described herein may be administered, for example, by oral, parenteral, intrathecal, intracerebroventricular, intraparenchymal, buccal, sublingual, nasal, rectal, patch, pump, or transdermal administration and the pharmaceutical compositions formulated accordingly. Parenteral administration includes intravenous, intraperitoneal, subcutaneous, intramuscular, transepithelial, nasal, intrapulmonary, intrathecal, intracerebroventricular, intraparenchymal, rectal, and topical modes of administration. Parenteral administration may be by continuous infusion over a selected period of time.

    [0372] A compound described herein may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard or soft shell gelatin capsules, or it may be compressed into tablets, or it may be incorporated directly with the food of the diet. For oral therapeutic administration, a compound described herein may be incorporated with an excipient and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, and wafers. A compound described herein may also be administered parenterally. Solutions of a compound described herein can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, DMSO, and mixtures thereof with or without alcohol, and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms. Conventional procedures and ingredients for the selection and preparation of suitable formulations are described, for example, in Remington's Pharmaceutical Sciences (2012, 22nd ed.) and in The United States Pharmacopeia: The National Formulary (USP 41 NF 36), published in 2018. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that may be easily administered via syringe. Compositions for nasal administration may conveniently be formulated as aerosols, drops, gels, and powders. Aerosol formulations typically include a solution or fine suspension of the active substance in a physiologically acceptable aqueous or non-aqueous solvent and are usually presented in single or multidose quantities in sterile form in a sealed container, which can take the form of a cartridge or refill for use with an atomizing device. Alternatively, the sealed container may be a unitary dispensing device, such as a single dose nasal inhaler or an aerosol dispenser fitted with a metering valve which is intended for disposal after use. Where the dosage form includes an aerosol dispenser, it will contain a propellant, which can be a compressed gas, such as compressed air or an organic propellant, such as fluorochlorohydrocarbon. The aerosol dosage forms can also take the form of a pump-atomizer. Compositions suitable for buccal or sublingual administration include tablets, lozenges, and pastilles, where the active ingredient is formulated with a carrier, such as sugar, acacia, tragacanth, gelatin, and glycerine. Compositions for rectal administration are conveniently in the form of suppositories containing a conventional suppository base, such as cocoa butter

    [0373] The compounds described herein may be administered to an animal, e.g., a human, alone or in combination with pharmaceutically acceptable carriers, as noted herein, the proportion of which is determined by the solubility and chemical nature of the compound, chosen route of administration, and standard pharmaceutical practice.

    [0374] Dosages

    [0375] The dosage of the compositions (e.g., a composition including an oligonucleotide) described herein, can vary depending on many factors, such as the pharmacodynamic properties of the compound; the mode of administration; the age, health, and weight of the recipient; the nature and extent of the symptoms; the frequency of the treatment, and the type of concurrent treatment, if any; and the clearance rate of the compound in the animal to be treated. The compositions described herein may be administered initially in a suitable dosage that may be adjusted as required, depending on the clinical response. In some embodiments, the dosage of a composition (e.g., a composition including an oligonucleotide) is a prophylactically or a therapeutically effective amount.

    [0376] Kits

    [0377] The invention also features kits including (a) a pharmaceutical composition including an oligonucleotide agent that reduces the level and/or activity of KCNT1 in a cell or subject described herein, and (b) a package insert with instructions to perform any of the methods described herein. In some embodiments, the kit includes (a) a pharmaceutical composition including an oligonucleotide agent that reduces the level and/or activity of KCNT1 in a cell or subject described herein, (b) an additional therapeutic agent, and (c) a package insert with instructions to perform any of the methods described herein.

    [0378] Methods of Selecting ASOs

    [0379] Oligonucleotides suitable for use in ASO treatment may be selected using bionformatic methods. Oligonucleotides may be from 18-22 nucleotides in length. The oligonucleotides may have a GC content of from about 40% to about 70% (e.g., 45%, 50%, 55%, 60%, 65%, or 70%). The oligonucleotides may include 3 or fewer (e.g., 2, 1, or 0) mismatches to human KCNT1. In some embodiments, the oligonucleotide may include at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an equal length target of mouse KCNT1. In some embodiments, the oligonculeotide may include a sequence with 100% sequence identity to an equal length target of mouse KCNT1. In some embodiments, the oligonucleotide may include at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an equal length target of cynomolgus monkey KCNT1. In some embodiments, the oligonculeotide may include a sequence with 100% sequence identity to an equal length target of cynomolgus monkey KCNT1. The oligonucleotide may include 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an equal length target of mouse and cynomolgus monkey KCNT1. In some embodiments, the oligonculeotide may include a sequence with 100% sequence identity to an equal length target of mouse and cynomolgus monkey KCNT1. The oligonucleotides may include at least 3 (e.g., 4, 5, 6, 7, 8, 9, 10, or more) mismatches to non KCNT1 transcripts. The oligonucleotides may not form dimers. The oligonucleotides may not form hairpins. The oligonucleotides may lack polyG runs, such as GGGG.

    [0380] In some embodiments, an oligonucleotide comprises at least 10 contiguous nucleobases which is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of nucleobases within a 10 nucleobase range of any one of positions 1-4770 or SED ID NO: 3526. In some embodiments, an oligonucleotide comprises at least 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases which is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of nucleobases within a nucleobase range of any one of positions 1-4770 or SED ID NO: 3526. In some embodiments, an oligonucleotide comprises at least 10 contiguous nucleobases which is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99 complementary to an equal length portion of nucleobases within a 10 nucleobase range of any one of positions 374, 661, 655-680, 765, 837, 1347, 1340-1370, 1629, 1760, 1752, 1795, 1775, 1740-1815, 2879, 3008, 3168, or 3110-3171 of SEQ ID NO: 3526. In some embodiments, an oligonucleotide comprises at least 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases which are at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of nucleobases of any one of positions 374, 661, 655-680, 765, 837, 1347, 1340-1370, 1629, 1760, 1752, 1795, 1775, 1740-1815, 2879, 3008, 3168, or 3110-3171 of SEQ ID NO: 3526. In some embodiments, the oligonucleotide comprises at least 10 contiguous nucleobases that are at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of nucleobases within any one of positions 655-680, 1340-137, 1740-1815, or 3110-3175 of SEQ ID NO: 3526. In some embodiments, an oligonucleotide comprises at least 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases that are at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of nucleobases within any one of positions 655-680, 1340-137, 1740-1815, or 3110-3175 of SEQ ID NO: 3526. In some embodiments, the oligonucleotide comprises at least 10 contiguous nucleobases that are complementary to an equal length portion of nucleobases within any one of positions 655-665, 660-670, 665-675, 670-680, 1340-1350, 1345-1355, 1350-1360, 1355-1365, 1360-1370, 1740-1750, 1745-1755, 1750-1760, 1755-1765, 1760-1770, 1765-1775, 1770-1780, 1775-1785, 1780-1790, 1785-1795, 1790-1800, 1795-1805, 1800-1810, 1805-1815, 3110-3120, 3115-3125, 3120-3130, 3125-3135, 3130-3140, 3135-3145, 3140-3150, 3145-3155, 3150-3160, 3155-3165, 3160-3170, 3165-3175, or 3170-3180 of SEQ ID NO: 3526. In some embodiments, an oligonucleotide comprises at least 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases that are complementary to an equal length portion of nucleobases within any one of positions 655-665, 660-670, 665-675, 670-680, 1340-1350, 1345-1355, 1350-1360, 1355-1365, 1360-1370, 1740-1750, 1745-1755, 1750-1760, 1755-1765, 1760-1770, 1765-1775, 1770-1780, 1775-1785, 1780-1790, 1785-1795, 1790-1800, 1795-1805, 1800-1810, 1805-1815, 3110-3120, 3115-3125, 3120-3130, 3125-3135, 3130-3140, 3135-3145, 3140-3150, 3145-3155, 3150-3160, 3155-3165, 3160-3170, 3165-3175, or 3170-3180 of SEQ ID NO: 3526.

    [0381] The position of SEQ ID NO: 3526 refers to the nucleotide position of the KCNT1 transcript. For instance, the nucleotide at position 1261 of KCNT1 transcript (SEQ ID NO: 3526) is an adenine. Any of the antisense oligonucleotides described herein can bind to at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 contiguous nucleobases of any position of KCNT1 transcript or KCNT1 transcript variant. The oligonucleotide can comprise at least 10 contiguous nucleobases which are at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to an equal length portion of nucleobases within a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleobase range of any position of KCNT1 transcript or KCNT1 transcript variant. In some embodiments, the oligonucleotide comprises at least 10 contiguous nucleobases, at least 11 contiguous nucleobases, at least 12 contiguous nucleobases, at least 13 contiguous nucleobases, at least 14 contiguous nucleobases, at least 15 contiguous nucleobases, at least 16 contiguous nucleobases, at least 17 contiguous nucleobases, at least 18 contiguous nucleobases, at least 19 contiguous nucleobases, or at least 20 contiguous nucleobases, which are at least 90% complementary to an equal length portion of nucleobases within a 10 nucleobase range of any position of KCNT1 transcript or KCNT1 transcript variant. For example, a 20 nucleobase oligonucleotide that is at least 90% complementary to the 10 nucleobases at position 220-230 of KCNT1 transcript or transcript variant is within a 10 nucleobase range of positions 211-239 of KCNT1 transcript or KCNT1 transcript variant. In some embodiments, the oligonucleotide binding overlaps with the KCNT1 transcript or KCNT1 transcript variant nucleobase position. For example, a 20 nucleobase oligonucleotide that is complementary to position 500 of KCNT1 transcript or KCNT1 transcript variant can hybridize to the nucleobases 481-500, 483-503, 490-510, 497-517, or 500-519, or any range therein of the KCNT1 transcript or KCNT1 transcript variant nucleotide positions.

    [0382] Assessment of ASOs

    [0383] The activity of the antisense oligonucleotides of the present disclosure can be assessed and confirmed using various techniques known in the art. For example, the ability of the antisense oligonucleotides to inhibit KCNT1 expression and/or whole cell current can be assessed in in vitro assays to confirm that the antisense oligonucleotides are suitable for use in treating a disease or condition associated with a gain-of-function mutation in KCNT1 and/or excessive neuronal excitability. Mouse models can be used to not only assess the ability of the antisense oligonucleotides to inhibit KCNT1 expression or whole cell current, but to also ameliorate symptoms associated with gain-of-function KCNT1 mutations and/or excessive neuronal excitability.

    [0384] In one example, cells such as mammalian cells (e.g. CHO cells) that are transfected with KCNT1 and express this gene are also transfected with an antisense oligonucleotide of the present disclosure. Typically, the KCNT1 contains a gain-of-function mutation. In another example, a human neuronal cell line (e.g. SH-SY5Y) that naturally expresses native wild type KCNT1 is used. Optionally, the genome of this cell is edited so as to contain a gain-of-function mutation, such that the resulting KCNT1 is a disease-causing variant. The levels of KCNT1 mRNA can be assessed using qRT-PCR or Northern blot as is well known in the art. The level of expression of protein from KCNT1 can be assessed by Western blot on total cell lysates or fractions as described in Rizzo et al. (Mol Cell Neurosci. 72:54-63, 2016). Residual function of the KCNT1-encoded channels can also be assessed using electrophysiology or ion flux assay.

    [0385] In a particular examples, the activity of the antisense oligonucleotides of the present disclosure are assessed and confirmed using stem cell modelling (for review, see e.g. Tidball and Parent Stem Cells 34:27-33, 2016; Parent and Anderson Nature Neuroscience 18:360-366, 2015). For example, human induced pluripotent stem cells (iPSCs) can be produced from somatic cells (e.g. dermal fibroblasts or blood-derived hematopoietic cells) derived from a patient with a KCNT1 gain-of-function mutation and presenting with an associated disease or condition (e.g. EIMFS, ADNFLE or West syndrome). Optionally, genome editing can be used to revert the gain-of-function mutation to wild-type to produce an isogenic control cell line (Gaj et al. Trends Biotechnol 31, 397-405, 2013), which can also be used to determine desirable wild-type levels of activity for subsequent assessment and comparison of oligonucleotides. Alternatively, genome editing can be used to introduce a gain-of-function mutation into the KCNT1 gene of wild-type, control iPSCs (e.g. a reference iPSC line). The iPSCs containing the gain-of-function mutation, and optionally the isogenic control, can then be differentiated into neurons, including excitatory neurons, using known techniques (see e.g. Kim et al. Front Cell Neurosci 8:109, 2014; Zhang et al. 2013, Chambers et al. Nat Biotechnol 27, 275-280, 2009). The effect of the antisense oligonucleotides of the present invention on KCNT1 expression (as assessed by KCNT1 mRNA or protein levels) and/or activity (as assessed by ion flux assay and/or electrophysiology, e.g. using the whole cell patch clamp technique, the single electrode voltage clamp technique or the two-electrode voltage clamp (TEVC) technique) can then be assessed following exposure of the iPSCs to the antisense oligonucleotides of the present invention.

    [0386] The levels of KCNT1 expression (mRNA or protein) or whole cell current observed when cells expressing KCNT1 are exposed to an antisense oligonucleotide of the present disclosure are compared to the respective levels observed when cells expressing KCNT1 are exposed with a negative control antisense oligonucleotide, so as to determine the level of inhibition resulting from the antisense oligonucleotide of the present disclosure. Typically, expression levels of KCIVT1 or whole cell current levels are reduced by at least or about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or more. Accordingly, the antisense oligonucleotides of the present disclosure can be used for treating a disease or condition associated with a gain-of-function mutation in KCNT1.

    [0387] Mouse models can also be used to assess and confirm the activity of the antisense oligonucleotides of the present disclosure. For example, knock-in or transgenic mouse models can be generated using KCNT1 genes containing a gain-of-function mutation in a similar manner to that described for SCN1A and SCN2A knock-in and transgenic mouse models (see e.g. Kearney et al. Neuroscience 102, 307-317, 2001; Ogiwara et al. J Neurosci 27:5903-5914, 2007; Yu et al. Nat Neurosci 9:1142-1149, 2006). In particular examples, a KCNT1 gene that matches the particular antisense oligonucleotide (e.g. an allele-specific oligonucleotide) is used to produce the knock-in or transgenic mouse. The gain-of-function KCNT1 knock-in or transgenic mice may present with a phenotype similar to EIMFS, ADNFLE and/or West syndrome, including, for example, increased neuronal activity, spontaneous seizures, and heterogeneous focal seizure activity on electroencephalogram (EEG). In other examples, SCN1A and SCN2A knock-in and transgenic mouse models may be used for models exhibiting excessive neuronal excitability. The ability of the antisense oligonucleotides of the present invention to inhibit expression of KCNT1 in these mice and to ameliorate any symptoms associated with the gain-of-function KCNT1 mutations and/or excessive neuronal excitability in the mice, can then be assessed.

    [0388] For example, the levels of KCNT1 mRNA and/or protein can be assessed following administration of an antisense oligonucleotide of the present disclosure or a negative control antisense oligonucleotide to the mice. In a particular example, KCNT1 mRNA and/or protein levels in the brain, and in particular the neurons, are assessed. The levels of KCNT1 expression following administration of an antisense oligonucleotide of the present disclosure are compared to the respective levels observed when a negative control antisense oligonucleotide is administered, so as to determine the level of inhibition resulting from the antisense oligonucleotide of the present disclosure. Typically, expression levels of KCNT1 in the mice (e.g. in the brains of the mice) are reduced by at least or about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or more.

    [0389] In another example, the functional effect of administration of an antisense oligonucleotide of the present disclosure is assessed. For example, the number, severity and/or type of seizures can be assessed visually and/or by EEG. Neuronal excitability can also be assessed, such as by excising brain slices from mice administered an antisense oligonucleotide of the present disclosure or a negative control antisense oligonucleotide and assessing whole cell current (e.g. using the whole cell patch clamp technique). Similar neuronal excitability analyses can be performed using neurons isolated from the mice and then cultured. Additionally, mouse behavior, including gait characteristics, can be assessed to determine the functional effect of administration of an antisense oligonucleotide of the present disclosure.

    Additional Embodiments

    [0390] Disclosed herein is a single-stranded oligonucleotide of 18-22 linked nucleosides in length comprising a GC content from 40% to 70% and having at least 85% sequence identity to an equal length portion of H. sapiens KCNT1 and M. musculus KCNT1.

    [0391] Additionally disclosed herein is a single-stranded oligonucleotide of 18-22 linked nucleosides in length comprising a GC content from 40% to 70% and having at least 85% sequence identity to an equal length portion of H. sapiens KCNT1 and M. cynomolgus KCNT1.

    [0392] Additionally disclosed herein is a single-stranded oligonucleotide of 18-22 linked nucleosides in length comprising a GC content from 40% to 70% and having at least 85% sequence identity to an equal length portion of H. sapiens KCNT1, M. musculus KCNT1, and M. cynomolgus KCNT1.

    [0393] In one aspect, the oligonucleotide comprises no more than 2 mismatches to H. sapiens KCNT1. In one aspect, the oligonucleotide comprises at least 3 mismatches to any non KCNT1 transcript. In one aspect, the oligonucleotide lacks a GGGG tetrad.

    [0394] Additionally disclosed herein is a single-stranded oligonucleotide of 18-22 linked nucleosides in length comprising a region of at least 18 contiguous nucleobases of any one of SEQ ID NOs: 1-3409. In one aspect, the region of at least 10 nucleobases has at least 90% complementary to an equal length portion of any one of SEQ ID NOs: 1-3409. In one aspect, the region of at least 10 nucleobases has at least 95% complementary to an equal length portion of any one of SEQ ID NOs: 1-3409. In one aspect, the oligonucleotide comprises the nucleobase sequence of any one of SEQ ID NOs: 1-3409. In one aspect, the nucleobase sequence of the oligonucleotide consists of any one of SEQ ID NOs: 1-3409.

    [0395] In one aspect, the oligonucleotide comprises: (a) a gap segment comprising linked deoxyribonucleosides; (b) a 5′ wing segment comprising linked nucleosides; and (c) a 3′ wing segment comprising linked nucleosides; wherein the gap segment comprises a region of at least 10 contiguous nucleobases having at least 80% complementarity to an equal length portion of any one of SEQ ID NOs: 1-3409 positioned between the 5′ wing segment and the 3′ wing segment; wherein the 5′ wing segment and the 3′ wing segment each comprises at least two linked nucleosides; and wherein at least one nucleoside of each wing segment comprises an alternative nucleoside.

    [0396] In one aspect, the oligonucleotide comprises at least one alternative internucleoside linkage. In one aspect, the at least one alternative internucleoside linkage is a phosphorothioate internucleoside linkage. In one aspect, the at least one alternative internucleoside linkage is a 2′-alkoxy internucleoside linkage. In one aspect, the at least one alternative internucleoside linkage is an alkyl phosphate internucleoside linkage. In one aspect, the oligonucleotide comprises at least one alternative nucleobase. In one aspect, the alternative nucleobase is 5′-methylcytosine, pseudouridine, or 5-methoxyuridine. In one aspect, the oligonucleotide comprises at least one alternative sugar moiety. In one aspect, the alternative sugar moiety is 2′-OMe or a bicyclic nucleic acid. In one aspect, the oligonucleotide further comprises a ligand conjugated to the 5′ end or the 3′ end of the oligonucleotide through a monovalent or branched bivalent or trivalent linker.

    [0397] In one aspect, the oligonucleotide comprises a region complementary to at least 17 contiguous nucleotides of a KCNT1 gene. In one aspect, the oligonucleotide comprises a region complementary to at least 19 contiguous nucleotides of a KCNT1 gene. In one aspect, the oligonucleotide comprises a region of at least 18 contiguous nucleobases of any one of SEQ ID NOs: 1-17 and 19-50. In one aspect, the oligonucleotide comprises a region of at least 18 contiguous nucleobases of SEQ ID NO: 18. In one aspect, the oligonucleotide comprises a region of at least 18 contiguous nucleobases of any one of SEQ ID NOs: 51-81, 83-86, and 88-96. In one aspect, the oligonucleotide comprises a region of at least 18 contiguous nucleobases of any one of SEQ ID NOs: 82 and 87. In one aspect, the oligonucleotide comprises a region of at least 18 contiguous nucleobases of any one of SEQ ID NOs: 97-116.

    [0398] Additionally disclosed herein is a pharmaceutical composition comprising the oligonucleotide and a pharmaceutically acceptable carrier or excipient. Additionally disclosed herein is a composition comprising the oligonucleotide of any one of claims 1-28 and a lipid nanoparticle, a polyplex nanoparticle, a lipoplex nanoparticle, or a liposome. Additionally disclosed herein is a method of treating, preventing, or delaying the progression of a KCNT1 related disorder in a subject in need thereof, the method comprising administering to the subject the oligonucleotide, the pharmaceutical composition, or the composition in an amount and for a duration sufficient to treat, prevent, or delay the progression of the KCNT1 related disorder.

    [0399] Additionally disclosed herein is a method of treating, preventing, or delaying the progression of a KCNT1 related disorder in a subject comprising: (a) selecting a single-stranded oligonucleotide of 18-22 linked nucleosides in length comprising a GC content from 40% to 70%, wherein the oligonucleotide: (i) has at least 85% sequence identity to an equal length portion of H. sapiens KCNT1 and M. musculus KCNT1; (ii) has at least 85% sequence identity to an equal length portion of H. sapiens KCNT1 and M. cynomolgus KCNT1; or (iii) has at least 85% sequence identity to an equal length portion of H. sapiens KCNT1, M. musculus KCNT1, and M. cynomolgus KCNT1; and (b) administering the oligonucleotide to the subject in an amount and for a duration sufficient to treat, prevent, or delay the progression of the KCNT1 related disorder.

    [0400] In one aspect, the oligonucleotide comprises no more than 2 mismatches to H. sapiens KCNT1. In one aspect, the oligonucleotide comprises at least 3 mismatches to any non KCNT1 transcript. In one aspect, the oligonucleotide lacks a GGGG tetrad.

    [0401] Additionally disclosed herein is a method of inhibiting transcription of KCNT1 in a cell, the method comprising contacting the cell with the oligonucleotide, the pharmaceutical composition, or the composition in an amount and for a duration sufficient to obtain degradation of an mRNA transcript of the KCNT1 gene, wherein the oligonucleotide inhibits expression of the KCNT1 gene in the cell.

    [0402] Additionally disclosed herein is a method of reducing a level and/or activity of KCNT1 in a cell of a subject having a KCNT1 related disorder, the method comprising contacting the cell with the oligonucleotide, the pharmaceutical composition, or the composition in an amount and for a duration sufficient to reduce the level and/or activity of KCNT1 in the cell. In one aspect, the subject is a human. In one aspect, the cell is a cell of the central nervous system. In one aspect, the KCNT1 related disorder is selected from the group consisting of epilepsy of infancy with migrating focal seizures, autosomal dominant nocturnal frontal lobe epilepsy, West syndrome, infantile spasms, epileptic encephalopathy, focal epilepsy, Ohtahara syndrome, developmental epileptic encephalopathy, and Lennox Gastaut syndrome. In one aspect, the subject has a gain-of-function mutation in KCNT1. In one aspect, the gain-of-function mutation is selected from the group consisting of V271F, L274I, G288S, F346L, R398Q, R428Q, R474H, F502V, M516V, K629N, I760M, Y796H, E893K, M896I, M896K, P924L, R928C, F932I, A934T, A966T, H257D, R262Q, Q270E, V340M, C377S, P409S, L437F, R474C, A477T, R565H, K629E, G652V, I760F, Q906H, R933G, R950Q, R961H, R1106Q, K1154Q, R474Q, Y1903C, H469L, M896R, K946E, and R950L. In one aspect, the method reduces one or more symptoms of the KCNT1 related disorder. In one aspect, the one or more symptoms of the KCNT1 related disorder is selected from the group consisting of prolonged seizures, frequent seizures, behavioral and developmental delays, movement and balance issues, orthopedic conditions, delayed language and speech issues, growth and nutrition issues, sleeping difficulties, chronic infection, sensory integration disorder, disruption of the autonomic nervous system, and sweating.

    [0403] Additionally disclosed herein is a single-stranded oligonucleotide of 18-22 linked nucleosides in length comprising a GC content from 40% to 70% and having at least 85% sequence identity to an equal length portion of H. sapiens KCNT1 and M. musculus KCNT1. Additionally disclosed herein is a single-stranded oligonucleotide of 18-22 linked nucleosides in length comprising a GC content from 40% to 70% and having at least 85% sequence identity to an equal length portion of H. sapiens KCNT1 and M. cynomolgus KCNT1. Additionally disclosed herein is a single-stranded oligonucleotide of 18-22 linked nucleosides in length comprising a GC content from 40% to 70% and having at least 85% sequence identity to an equal length portion of H. sapiens KCNT1, M. musculus KCNT1, and M. cynomolgus KCNT1.

    [0404] Additionally disclosed herein is a single-stranded oligonucleotide of 18-22 linked nucleosides in length comprising a GC content from 40% to 70% and having at least 85% sequence identity to an equal length portion of H. sapiens KCNT1 and M. musculus KCNT1. Additionally disclosed herein is a single-stranded oligonucleotide of 18-22 linked nucleosides in length comprising a GC content from 40% to 70% and having at least 85% sequence identity to an equal length portion of H. sapiens KCNT1 and M. cynomolgus KCNT1. Additionally disclosed herein is a single-stranded oligonucleotide of 18-22 linked nucleosides in length comprising a GC content from 40% to 70% and having at least 85% sequence identity to an equal length portion of H. sapiens KCNT1, M. musculus KCNT1, and M. cynomolgus KCNT1.

    [0405] In one aspect, the invention features a single-stranded oligonucleotide of 18-22 linked nucleosides in length including a GC content from 40% to 70% and having at least 85% sequence identity to an equal length portion of both H. sapiens KCNT1 and M. musculus KCNT1.

    [0406] In another aspect, the invention features a single-stranded oligonucleotide of 18-22 linked nucleosides in length including a GC content from 40% to 70% and having at least 85% sequence identity to an equal length portion of H. sapiens KCNT1 and M. cynomolgus KCNT1.

    [0407] In another aspect, the invention features a single-stranded oligonucleotide of 18-22 linked nucleosides in length including a GC content from 40% to 70% and having at least 85% sequence identity to an equal length portion of H. sapiens KCNT1, M. musculus KCNT1, and M. cynomolgus KCNT1.

    [0408] In some embodiments, the oligonucleotide includes no more than 2 mismatches to H. sapiens KCNT1.

    [0409] In some embodiments, the oligonucleotide includes at least 3 mismatches to any non KCNT1 transcript.

    [0410] In some embodiments, the oligonucleotide lacks a GGGG tetrad.

    [0411] In another aspect, the invention features a single-stranded oligonucleotide of 18-22 linked nucleosides in length including a region of at least 18 contiguous nucleobases of any one of SEQ ID NOs: 1-3409 (e.g., SEQ ID NOs: 1-116 or 1-3384).

    [0412] In some embodiments, the oligonucleotide includes a region having at least 85%, 90%, or 95% sequence identity to at least 18 contiguous nucleobases of any one of SEQ ID NOs: 1-3409 (e.g., SEQ ID NOs: 1-116 or 1-3384).

    [0413] In some embodiments, the oligonucleotide includes a gap segment including linked deoxyribonucleosides; a 5′ wing segment including linked nucleosides; and a 3′ wing segment including linked nucleosides. The gap segment may include a region of at least 10 contiguous nucleobases having at least 80% complementarity to an equal length portion of any one of SEQ ID NOs: 1-3409 (e.g., SEQ ID NOs: 1-116 or 1-3384) positioned between the 5′ wing segment and the 3′ wing segment. The 5′ wing segment and the 3′ wing segment may each include at least two linked nucleosides, and at least one nucleoside of each wing segment may include an alternative nucleoside.

    [0414] In some embodiments, the region of at least 10 nucleobases has at least 90% (e.g., 91%, 92% 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) complementary to an equal length portion of any one of SEQ ID NOs: 1-3409 (e.g., SEQ ID NOs: 1-116 or 1-3384).

    [0415] In some embodiments, the oligonucleotide includes the nucleobase sequence of any one of SEQ ID NOs: 1-3409 (e.g., SEQ ID NOs: 1-116 or 1-3384).

    [0416] In some embodiments, the nucleobase sequence of the oligonucleotide consists of any one of SEQ ID NOs: 1-3409 (e.g., SEQ ID NOs: 1-116 or 1-3384).

    [0417] In some embodiments, the oligonucleotide includes at least one alternative internucleoside linkage.

    [0418] In some embodiments, the at least one alternative internucleoside linkage is a phosphorothioate internucleoside linkage.

    [0419] In some embodiments, the at least one alternative internucleoside linkage is a 2′-alkoxy internucleoside linkage.

    [0420] In some embodiments, the at least one alternative internucleoside linkage is an alkyl phosphate internucleoside linkage.

    [0421] In some embodiments, the oligonucleotide includes at least one alternative nucleobase.

    [0422] In some embodiments, the alternative nucleobase is 5′-methylcytosine, pseudouridine, or 5-methoxyuridine.

    [0423] In some embodiments, the oligonucleotide includes at least one alternative sugar moiety.

    [0424] In some embodiments, the alternative sugar moiety is 2′-OMe or a bicyclic nucleic acid.

    [0425] In some embodiments, the oligonucleotide further includes a ligand conjugated to the 5′ end or the 3′ end of the oligonucleotide through a monovalent or branched bivalent or trivalent linker.

    [0426] In some embodiments, the oligonucleotide includes a region complementary to at least 17 contiguous nucleotides of a KCNT1 gene.

    [0427] In some embodiments, the oligonucleotide includes a region complementary to at least 19 contiguous nucleotides of a KCNT1 gene.

    [0428] In some embodiments, the oligonucleotide includes a region of at least 18 contiguous nucleobases of any one of SEQ ID NOs: 1-116.

    [0429] In some embodiments, the oligonucleotide includes a region of at least 18 contiguous nucleobases of any one of SEQ ID NOs: 1-17 and 19-50.

    [0430] In some embodiments, the oligonucleotide includes a region of at least 18 contiguous nucleobases of SEQ ID NO: 18.

    [0431] In some embodiments, the oligonucleotide includes a region of at least 18 contiguous nucleobases of any one of SEQ ID NOs: 51-81, 83-86, and 88-96.

    [0432] In some embodiments, the oligonucleotide includes a region of at least 18 contiguous nucleobases of any one of SEQ ID NOs: 82 and 87.

    [0433] In some embodiments, the oligonucleotide includes a region of at least 18 contiguous nucleobases of any one of SEQ ID NOs: 97-116.

    [0434] In another aspect, the invention features a pharmaceutical composition including the oligonucleotide of any of the above embodiments and a pharmaceutically acceptable carrier or excipient.

    [0435] In another aspect, the invention features a composition including the oligonucleotide of any of the above aspects and a lipid nanoparticle, a polyplex nanoparticle, a lipoplex nanoparticle, or a liposome.

    [0436] In another aspect, the invention features method of treating, preventing, or delaying the progression of a KCNT1 related disorder in a subject in need thereof, by administering to the subject the oligonucleotide, the pharmaceutical composition, or the composition any of the above aspects in an amount and for a duration sufficient to treat, prevent, or delay the progression of the KCNT1 related disorder.

    [0437] In another aspect, the invention features method of treating, preventing, or delaying the progression of a KCNT1 related disorder in a subject by:

    [0438] (a) selecting a single-stranded oligonucleotide of 18-22 linked nucleosides in length including a GC content from 40% to 70%, wherein the oligonucleotide:

    [0439] (i) has at least 85% sequence identity to an equal length portion of H. sapiens KCNT1 and M. musculus KCNT1;

    [0440] (ii) has at least 85% sequence identity to an equal length portion of H. sapiens KCNT1 and M. cynomolgus KCNT1; or

    [0441] (iii) has at least 85% sequence identity to an equal length portion of H. sapiens KCNT1, M. musculus KCNT1, and M. cynomolgus KCNT1; and

    [0442] (b) administering the oligonucleotide to the subject in an amount and for a duration sufficient to treat, prevent, or delay the progression of the KCNT1 related disorder.

    [0443] In some embodiment, the oligonucleotide includes no more than 2 mismatches to H. sapiens KCNT1.

    [0444] In some embodiment, the oligonucleotide includes at least 3 mismatches to any non KCNT1 transcript.

    [0445] In some embodiment, the oligonucleotide lacks a GGGG tetrad.

    [0446] In another aspect, the invention features a method of inhibiting transcription of KCNT1 in a cell, by contacting the cell with the oligonucleotide, the pharmaceutical composition, or the composition of any of the above aspects in an amount and for a duration sufficient to obtain degradation of an mRNA transcript of the KCNT1 gene, wherein the oligonucleotide inhibits expression of the KCNT1 gene in the cell.

    [0447] In another aspect, the invention features a method of reducing a level and/or activity of KCNT1 in a cell of a subject having a KCNT1 related disorder, by contacting the cell with the oligonucleotide, the pharmaceutical composition, or the composition of any of the above aspects in an amount and for a duration sufficient to reduce the level and/or activity of KCNT1 in the cell.

    [0448] In some embodiments, the subject is a human.

    [0449] In some embodiments, the cell is a cell of the central nervous system.

    [0450] In some embodiments, the KCNT1 related disorder is selected from the group consisting of epilepsy of infancy with migrating focal seizures, autosomal dominant nocturnal frontal lobe epilepsy, West syndrome, infantile spasms, epileptic encephalopathy, focal epilepsy, Ohtahara syndrome, developmental epileptic encephalopathy, and Lennox Gastaut syndrome.

    [0451] In some embodiments, the subject has a gain-of-function mutation in KCNT1.

    [0452] In some embodiments, the gain-of-function mutation is selected from the group consisting of V271F, L274I, G288S, F346L, R398Q, R428Q, R474H, F502V, M516V, K629N, I760M, Y796H, E893K, M896I, M896K, P924L, R928C, F932I, A934T, A966T, H257D, R262Q, Q270E, V340M, C377S, P409S, L437F, R474C, A477T, R565H, K629E, G652V, I760F, Q906H, R933G, R950Q, R961H, R1106Q, K1154Q, R474Q, Y1903C, H469L, M896R, K946E, and R950L.

    [0453] In some embodiments, the method reduces one or more symptoms of the KCNT1 related disorder.

    [0454] In some embodiments, the one or more symptoms of the KCNT1 related disorder is selected from the group consisting of prolonged seizures, frequent seizures, behavioral and developmental delays, movement and balance issues, orthopedic conditions, delayed language and speech issues, growth and nutrition issues, sleeping difficulties, chronic infection, sensory integration disorder, disruption of the autonomic nervous system, and sweating.

    EXAMPLES

    Example 1. Design, Selection, and Testing of Antisense Oligonucleotides

    [0455] A bioinformatic analysis was performed to identify regions of human, mouse, and monkey KCNT1 genes with 20 base pair regions having pairwise homology. For example, 20 bp regions having at least 17 bp overlap between human and monkey KCNT1, human and mouse KCNT1, or human, monkey, and mouse KCNT1 were identified. Target sequences that only bind human KCNT1 were also identified. The ASO sequences, positions in the specified human transcript, and number of mismatches are shown in Table 1 of U.S. Provisional Application 62/782,877 filed Dec. 20, 2018, hereby incorporated by reference in its entirety. Furthermore, intronic target sequences in the human KCNT1 gene were identified. These ASO sequences are in Table 2 of U.S. Provisional Application 62/782,877. MM indicates the number of mismatches to either NM_020822.2 or NG_033070.1, for exonic or intronic directed ASOs, respectively.

    [0456] For the ASO sequences, homology to non-KCNT1 spliced (secondary) mRNA transcripts was also determined using the NCBI RefSeq R92 (January 2019) and Ensemble R94 (October 2018) databases. Table 3 of U.S. Provisional Application 62/862,328 filed filed Jun. 17, 2019, hereby incorporated by reference in its entirety, lists the number of non-KCNT1 transcripts identified with increasing number of mismatches (MM) from 0MM to 4MM.

    [0457] For the ASO sequences, homology to non-KCNT1 non-spliced (primary) pre-mRNA transcripts was also determined using the Ensemble R94 (October 2018) databases. Table 4 of U.S. Provisional Application 62/862,328 filed on Jun. 17, 2019, lists the number of non-KCNT1 transcripts identified with increasing number of mismatches (MM) from 0MM to 4MM.

    [0458] For the ASO sequences, the position of reported single nucleotide polymorphisms (SNPs) within the ASO sequence was also determined using the NCBI dbSNP Build 151 (October 2017, downloaded January 2019). Table 5 of U.S. Provisional Application 62/862,328 filed on Jun. 17, 2019, lists the position of each SNP and the associated SNP ID.

    [0459] Table 2 shows the SEQ ID NOs of the ASO sequences, the position in the specified human transcript of those ASO sequences, and the number of mismatches (MM). Of note, number of mismatches for SEQ ID NOs: 1-96 and 117-3525 was determined in comparison to NM_020822.2 (SEQ ID NO: 3526). The number of mismatches for SEQ ID NOs: 97-116 is determined in comparison to NG_033070.1.

    TABLE-US-00002 TABLE 2 Exemplary ASOs, KCNT1 positions, and mismatches SEQ ID NO: Position MM 1 374 0 2 420 0 3 497 0 4 661 0 5 765 0 6 837 0 7 979 0 8 1347 0 9 1399 0 10 1629 0 11 1667 0 12 2879 0 13 3008 0 14 3029 0 15 3168 0 16 2417 0 17 1760 0 18 2068 0 19 332 0 20 391 0 21 790 0 22 1032 0 23 1185 0 24 1232 0 25 1271 0 26 1440 0 27 1532 0 28 1752 0 29 1795 0 30 1933 0 31 2457 0 32 2777 0 33 2796 0 34 2835 0 35 2859 0 36 3241 0 37 1864 0 38 2758 0 39 579 0 40 702 0 41 731 0 42 877 0 43 903 0 44 1879 0 45 1954 0 46 1983 0 47 2322 0 48 3087 0 49 3520 0 50 3654 0 51 631 0 52 1718 0 53 625 0 54 1207 0 55 1595 0 56 1826 0 57 2433 0 58 539 0 59 999 0 60 1107 0 61 1324 0 62 1775 0 63 2480 0 64 2541 0 65 3107 0 66 3277 0 67 1074 0 68 2904 0 69 3190 0 70 3595 0 71 519 0 72 964 0 73 1476 0 74 3210 0 75 3908 0 76 3974 0 77 1601 0 78 3847 0 79 4360 0 80 1449 0 81 1988 0 82 4429 0 83 4499 0 84 3876 0 85 2442 0 86 2026 0 87 1012 0 88 496 0 89 4183 0 90 4434 0 91 4524 0 92 4581 0 93 4630 0 94 4680 0 95 4747 0 96 312 0 97 3527 0 98 8995 0 99 671 0 100 1379 0 101 5358 0 102 9844 0 103 8176 0 104 2942 0 105 3523 0 106 4677 0 107 18797 0 108 18207 0 109 28183 0 110 14791 0 111 34987 0 112 16368 0 113 35212 0 114 45235 0 115 40062 0 116 27111 0 117 1 0 118 2 0 119 3 0 120 4 0 121 5 0 122 6 0 123 7 0 124 8 0 125 9 0 126 10 0 127 11 0 128 12 0 129 13 0 130 14 0 131 15 0 132 16 0 133 17 0 134 18 0 135 19 0 136 20 0 137 21 0 138 22 0 139 23 0 140 24 0 141 25 0 142 26 0 143 27 0 144 28 0 145 29 0 146 30 0 147 31 0 148 32 0 149 33 0 150 34 0 151 35 0 152 36 0 153 37 0 154 38 0 155 39 0 156 40 0 157 41 0 158 42 0 159 43 0 160 45 0 161 46 0 162 47 0 163 49 0 164 50 0 165 51 0 166 52 0 167 56 0 168 57 0 169 58 0 170 59 0 171 60 0 172 61 0 173 62 0 174 63 0 175 64 0 176 65 0 177 66 0 178 67 0 179 68 0 180 69 0 181 70 0 182 71 0 183 72 0 184 73 0 185 74 0 186 75 0 187 76 0 188 80 0 189 126 0 190 127 0 191 128 0 192 129 0 193 130 0 194 131 0 195 132 0 196 133 0 197 134 0 198 135 0 199 136 0 200 137 0 201 138 0 202 139 0 203 140 0 204 141 0 205 142 0 206 143 0 207 144 0 208 145 0 209 146 0 210 147 0 211 148 0 212 149 0 213 150 0 214 151 0 215 152 0 216 153 0 217 154 0 218 155 0 219 156 0 220 157 0 221 158 0 222 159 0 223 160 0 224 161 0 225 223 0 226 224 0 227 225 0 228 226 0 229 227 0 230 228 0 231 229 0 232 230 0 233 231 0 234 232 0 235 233 0 236 234 0 237 235 0 238 236 0 239 237 0 240 238 0 241 239 0 242 240 0 243 241 0 244 242 0 245 243 0 246 244 0 247 245 0 248 246 0 249 247 0 250 248 0 251 249 0 252 250 0 253 251 0 254 252 0 255 253 0 256 258 0 257 259 0 258 263 0 259 264 0 260 265 0 261 270 0 262 271 0 263 272 0 264 273 0 265 274 0 266 275 0 267 276 0 268 277 0 269 278 0 270 279 0 271 280 0 272 281 0 273 282 0 274 283 0 275 285 0 276 286 0 277 287 0 278 288 0 279 289 0 280 290 0 281 291 0 282 292 0 283 293 0 284 294 0 285 295 0 286 296 0 287 297 0 288 298 0 289 299 0 290 300 0 291 301 0 292 302 0 293 303 0 294 304 0 295 305 0 296 306 0 297 307 0 298 308 0 299 309 0 300 310 0 301 311 0 302 313 0 303 314 0 304 315 0 305 316 0 306 317 0 307 318 0 308 319 0 309 320 0 310 321 0 311 322 0 312 323 0 313 324 0 314 325 0 315 326 0 316 327 0 317 328 0 318 329 0 319 330 0 320 331 0 321 333 0 322 334 0 323 335 0 324 336 0 325 337 0 326 338 0 327 339 0 328 340 0 329 341 0 330 342 0 331 343 0 332 344 0 333 345 0 334 346 0 335 347 0 336 348 0 337 349 0 338 350 0 339 351 0 340 352 0 341 353 0 342 354 0 343 355 0 344 356 0 345 357 0 346 358 0 347 359 0 348 360 0 349 361 0 350 362 0 351 363 0 352 364 0 353 365 0 354 366 0 355 367 0 356 368 0 357 369 0 358 370 0 359 371 0 360 372 0 361 373 0 362 375 0 363 376 0 364 377 0 365 379 0 366 380 0 367 381 0 368 388 0 369 389 0 370 390 0 371 392 0 372 393 0 373 394 0 374 395 0 375 396 0 376 397 0 377 398 0 378 399 0 379 400 0 380 401 0 381 402 0 382 403 0 383 404 0 384 405 0 385 406 0 386 407 0 387 408 0 388 409 0 389 410 0 390 411 0 391 412 0 392 413 0 393 414 0 394 415 0 395 416 0 396 417 0 397 418 0 398 419 0 399 421 0 400 422 0 401 423 0 402 424 0 403 425 0 404 426 0 405 427 0 406 428 0 407 429 0 408 430 0 409 431 0 410 432 0 411 433 0 412 434 0 413 435 0 414 436 0 415 437 0 416 438 0 417 439 0 418 440 0 419 441 0 420 442 0 421 443 0 422 444 0 423 445 0 424 446 0 425 447 0 426 448 0 427 449 0 428 450 0 429 451 0 430 452 0 431 453 0 432 454 0 433 455 0 434 456 0 435 457 0 436 458 0 437 459 0 438 460 0 439 461 0 440 462 0 441 463 0 442 464 0 443 465 0 444 466 0 445 467 0 446 468 0 447 469 0 448 470 0 449 471 0 450 472 0 451 473 0 452 474 0 453 475 0 454 476 0 455 477 0 456 478 0 457 479 0 458 480 0 459 481 0 460 482 0 461 483 0 462 484 0 463 485 0 464 487 0 465 488 0 466 489 0 467 490 0 468 491 0 469 492 0 470 493 0 471 494 0 472 495 0 473 498 0 474 499 0 475 500 0 476 501 0 477 502 0 478 503 0 479 504 0 480 505 0 481 506 0 482 507 0 483 508 0 484 509 0 485 510 0 486 511 0 487 512 0 488 513 0 489 514 0 490 515 0 491 516 0 492 517 0 493 518 0 494 520 0 495 521 0 496 522 0 497 523 0 498 524 0 499 525 0 500 526 0 501 527 0 502 528 0 503 529 0 504 530 0 505 531 0 506 532 0 507 533 0 508 534 0 509 535 0 510 536 0 511 537 0 512 538 0 513 540 0 514 541 0 515 542 0 516 543 0 517 544 0 518 545 0 519 546 0 520 547 0 521 548 0 522 549 0 523 550 0 524 551 0 525 552 0 526 553 0 527 554 0 528 555 0 529 556 0 530 557 0 531 558 0 532 559 0 533 560 0 534 561 0 535 562 0 536 563 0 537 564 0 538 565 0 539 566 0 540 567 0 541 568 0 542 569 0 543 570 0 544 571 0 545 572 0 546 573 0 547 574 0 548 575 0 549 576 0 550 577 0 551 578 0 552 580 0 553 581 0 554 582 0 555 583 0 556 584 0 557 585 0 558 586 0 559 587 0 560 588 0 561 589 0 562 590 0 563 591 0 564 592 0 565 593 0 566 594 0 567 595 0 568 596 0 569 597 0 570 598 0 571 599 0 572 600 0 573 601 0 574 602 0 575 603 0 576 604 0 577 605 0 578 606 0 579 607 0 580 608 0 581 609 0 582 610 0 583 611 0 584 612 0 585 613 0 586 614 0 587 615 0 588 616 0 589 617 0 590 618 0 591 619 0 592 620 0 593 621 0 594 622 0 595 623 0 596 624 0 597 626 0 598 627 0 599 628 0 600 629 0 601 630 0 602 632 0 603 633 0 604 634 0 605 635 0 606 636 0 607 637 0 608 638 0 609 639 0 610 640 0 611 641 0 612 642 0 613 643 0 614 644 0 615 645 0 616 646 0 617 647 0 618 648 0 619 649 0 620 650 0 621 651 0 622 652 0 623 653 0 624 654 0 625 655 0 626 656 0 627 657 0 628 658 0 629 659 0 630 660 0 631 662 0 632 663 0 633 664 0 634 665 0 635 666 0 636 667 0 637 668 0 638 669 0 639 670 0 640 671 0 641 672 0 642 673 0 643 674 0 644 675 0 645 676 0 646 677 0 647 678 0 648 679 0 649 680 0 650 681 0 651 682 0 652 683 0 653 684 0 654 685 0 655 686 0 656 687 0 657 688 0 658 689 0 659 690 0 660 691 0 661 692 0 662 693 0 663 694 0 664 695 0 665 696 0 666 697 0 667 698 0 668 699 0 669 700 0 670 701 0 671 703 0 672 704 0 673 705 0 674 706 0 675 707 0 676 708 0 677 709 0 678 710 0 679 711 0 680 712 0 681 713 0 682 714 0 683 715 0 684 716 0 685 717 0 686 718 0 687 719 0 688 720 0 689 721 0 690 722 0 691 723 0 692 724 0 693 725 0 694 726 0 695 727 0 696 728 0 697 729 0 698 730 0 699 732 0 700 733 0 701 734 0 702 735 0 703 736 0 704 737 0 705 738 0 706 739 0 707 740 0 708 741 0 709 742 0 710 743 0 711 744 0 712 745 0 713 746 0 714 747 0 715 748 0 716 749 0 717 750 0 718 751 0 719 752 0 720 753 0 721 754 0 722 756 0 723 758 0 724 759 0 725 760 0 726 761 0 727 762 0 728 763 0 729 764 0 730 783 0 731 784 0 732 785 0 733 786 0 734 787 0 735 788 0 736 789 0 737 791 0 738 792 0 739 793 0 740 794 0 741 795 0 742 796 0 743 797 0 744 798 0 745 799 0 746 800 0 747 801 0 748 802 0 749 803 0 750 804 0 751 805 0 752 806 0 753 807 0 754 808 0 755 809 0 756 810 0 757 811 0 758 812 0 759 813 0 760 814 0 761 815 0 762 816 0 763 817 0 764 818 0 765 826 0 766 827 0 767 828 0 768 829 0 769 830 0 770 831 0 771 832 0 772 833 0 773 834 0 774 835 0 775 836 0 776 838 0 777 839 0 778 840 0 779 841 0 780 842 0 781 843 0 782 844 0 783 845 0 784 846 0 785 847 0 786 848 0 787 849 0 788 850 0 789 851 0 790 852 0 791 853 0 792 854 0 793 855 0 794 856 0 795 857 0 796 858 0 797 859 0 798 860 0 799 861 0 800 862 0 801 863 0 802 864 0 803 865 0 804 866 0 805 867 0 806 868 0 807 869 0 808 870 0 809 871 0 810 872 0 811 873 0 812 874 0 813 875 0 814 876 0 815 878 0 816 879 0 817 880 0 818 881 0 819 882 0 820 883 0 821 884 0 822 885 0 823 886 0 824 887 0 825 888 0 826 889 0 827 890 0 828 891 0 829 892 0 830 893 0 831 894 0 832 895 0 833 896 0 834 897 0 835 898 0 836 899 0 837 900 0 838 901 0 839 902 0 840 904 0 841 905 0 842 906 0 843 907 0 844 908 0 845 909 0 846 910 0 847 911 0 848 912 0 849 913 0 850 914 0 851 915 0 852 916 0 853 917 0 854 918 0 855 919 0 856 920 0 857 921 0 858 922 0 859 923 0 860 924 0 861 925 0 862 926 0 863 927 0 864 928 0 865 929 0 866 930 0 867 931 0 868 932 0 869 933 0 870 934 0 871 935 0 872 936 0 873 937 0 874 938 0 875 939 0 876 940 0 877 948 0 878 949 0 879 951 0 880 952 0 881 953 0 882 954 0 883 955 0 884 956 0 885 957 0 886 958 0 887 959 0 888 960 0 889 961 0 890 962 0 891 963 0 892 965 0 893 966 0 894 967 0 895 968 0 896 969 0 897 970 0 898 971 0 899 972 0 900 973 0 901 974 0 902 975 0 903 976 0 904 977 0 905 978 0 906 980 0 907 981 0 908 982 0 909 983 0 910 984 0 911 985 0 912 986 0 913 987 0 914 988 0 915 989 0 916 990 0 917 991 0 918 992 0 919 993 0 920 994 0 921 995 0 922 996 0 923 997 0 924 998 0 925 1000 0 926 1001 0 927 1002 0 928 1003 0 929 1004 0 930 1005 0 931 1006 0 932 1007 0 933 1008 0 934 1009 0 935 1010 0 936 1011 0 937 1013 0 938 1014 0 939 1015 0 940 1016 0 941 1028 0 942 1029 0 943 1030 0 944 1031 0 945 1033 0 946 1034 0 947 1035 0 948 1036 0 949 1037 0 950 1038 0 951 1039 0 952 1040 0 953 1041 0 954 1042 0 955 1056 0 956 1057 0 957 1058 0 958 1059 0 959 1060 0 960 1061 0 961 1062 0 962 1063 0 963 1064 0 964 1065 0 965 1066 0 966 1067 0 967 1068 0 968 1069 0 969 1070 0 970 1071 0 971 1072 0 972 1073 0 973 1075 0 974 1076 0 975 1077 0 976 1078 0 977 1079 0 978 1080 0 979 1081 0 980 1082 0 981 1083 0 982 1084 0 983 1085 0 984 1086 0 985 1087 0 986 1088 0 987 1089 0 988 1090 0 989 1091 0 990 1092 0 991 1093 0 992 1094 0 993 1095 0 994 1096 0 995 1097 0 996 1098 0 997 1099 0 998 1100 0 999 1101 0 1000 1102 0 1001 1103 0 1002 1104 0 1003 1105 0 1004 1106 0 1005 1108 0 1006 1109 0 1007 1110 0 1008 1111 0 1009 1112 0 1010 1113 0 1011 1114 0 1012 1115 0 1013 1116 0 1014 1117 0 1015 1118 0 1016 1119 0 1017 1120 0 1018 1121 0 1019 1122 0 1020 1123 0 1021 1124 0 1022 1125 0 1023 1126 0 1024 1127 0 1025 1128 0 1026 1129 0 1027 1130 0 1028 1131 0 1029 1132 0 1030 1133 0 1031 1134 0 1032 1135 0 1033 1136 0 1034 1137 0 1035 1138 0 1036 1139 0 1037 1140 0 1038 1141 0 1039 1142 0 1040 1143 0 1041 1144 0 1042 1145 0 1043 1146 0 1044 1147 0 1045 1148 0 1046 1149 0 1047 1150 0 1048 1151 0 1049 1152 0 1050 1153 0 1051 1154 0 1052 1155 0 1053 1156 0 1054 1157 0 1055 1158 0 1056 1159 0 1057 1160 0 1058 1161 0 1059 1162 0 1060 1163 0 1061 1164 0 1062 1167 0 1063 1168 0 1064 1169 0 1065 1170 0 1066 1171 0 1067 1172 0 1068 1173 0 1069 1174 0 1070 1175 0 1071 1176 0 1072 1177 0 1073 1178 0 1074 1179 0 1075 1180 0 1076 1181 0 1077 1182 0 1078 1183 0 1079 1184 0 1080 1186 0 1081 1187 0 1082 1188 0 1083 1189 0 1084 1190 0 1085 1191 0 1086 1192 0 1087 1193 0 1088 1194 0 1089 1195 0 1090 1196 0 1091 1197 0 1092 1198 0 1093 1199 0 1094 1200 0 1095 1201 0 1096 1202 0 1097 1203 0 1098 1204 0 1099 1205 0 1100 1206 0 1101 1208 0 1102 1209 0 1103 1210 0 1104 1211 0 1105 1212 0 1106 1213 0 1107 1214 0 1108 1215 0 1109 1216 0 1110 1217 0 1111 1218 0 1112 1219 0 1113 1220 0 1114 1221 0 1115 1222 0 1116 1223 0 1117 1224 0 1118 1225 0 1119 1226 0 1120 1227 0 1121 1228 0 1122 1229 0 1123 1230 0 1124 1231 0 1125 1233 0 1126 1234 0 1127 1235 0 1128 1236 0 1129 1237 0 1130 1238 0 1131 1239 0 1132 1240 0 1133 1241 0 1134 1242 0 1135 1243 0 1136 1244 0 1137 1245 0 1138 1264 0 1139 1265 0 1140 1266 0 1141 1267 0 1142 1268 0 1143 1269 0 1144 1270 0 1145 1272 0 1146 1273 0 1147 1274 0 1148 1275 0 1149 1276 0 1150 1277 0 1151 1278 0 1152 1279 0 1153 1280 0 1154 1281 0 1155 1299 0 1156 1300 0 1157 1301 0 1158 1302 0 1159 1303 0 1160 1304 0 1161 1305 0 1162 1306 0 1163 1307 0 1164 1308 0 1165 1309 0 1166 1310 0 1167 1311 0 1168 1312 0 1169 1313 0 1170 1314 0 1171 1315 0 1172 1316 0 1173 1317 0 1174 1318 0 1175 1319 0 1176 1320 0 1177 1321 0 1178 1322 0 1179 1323 0 1180 1325 0 1181 1326 0 1182 1327 0 1183 1328 0 1184 1329 0 1185 1330 0 1186 1331 0 1187 1332 0 1188 1333 0 1189 1334 0 1190 1335 0 1191 1336 0 1192 1337 0 1193 1338 0 1194 1339 0 1195 1340 0 1196 1341 0 1197 1342 0 1198 1343 0 1199 1344 0 1200 1345 0 1201 1346 0 1202 1348 0 1203 1349 0 1204 1350 0 1205 1351 0 1206 1352 0 1207 1353 0 1208 1354 0 1209 1355 0 1210 1356 0 1211 1357 0 1212 1358 0 1213 1359 0 1214 1360 0 1215 1361 0 1216 1362 0 1217 1363 0 1218 1364 0 1219 1365 0 1220 1366 0 1221 1367 0 1222 1368 0 1223 1369 0 1224 1370 0 1225 1371 0 1226 1372 0 1227 1373 0 1228 1374 0 1229 1375 0 1230 1376 0 1231 1377 0 1232 1378 0 1233 1379 0 1234 1380 0 1235 1381 0 1236 1382 0 1237 1383 0 1238 1384 0 1239 1385 0 1240 1386 0 1241 1387 0 1242 1388 0 1243 1389 0 1244 1390 0 1245 1391 0 1246 1392 0 1247 1393 0 1248 1394 0 1249 1395 0 1250 1396 0 1251 1397 0 1252 1398 0 1253 1400 0 1254 1401 0 1255 1402 0 1256 1403 0 1257 1404 0 1258 1405 0 1259 1406 0 1260 1407 0 1261 1408 0 1262 1409 0 1263 1410 0 1264 1411 0 1265 1412 0 1266 1413 0 1267 1414 0 1268 1415 0 1269 1416 0 1270 1417 0 1271 1418 0 1272 1419 0 1273 1420 0 1274 1421 0 1275 1422 0 1276 1423 0 1277 1424 0 1278 1425 0 1279 1426 0 1280 1427 0 1281 1428 0 1282 1429 0 1283 1430 0 1284 1431 0 1285 1432 0 1286 1433 0 1287 1434 0 1288 1435 0 1289 1436 0 1290 1437 0 1291 1438 0 1292 1439 0 1293 1441 0 1294 1442 0 1295 1443 0 1296 1444 0 1297 1445 0 1298 1446 0 1299 1447 0 1300 1448 0 1301 1450 0 1302 1451 0 1303 1452 0 1304 1453 0 1305 1454 0 1306 1455 0 1307 1456 0 1308 1457 0 1309 1458 0 1310 1459 0 1311 1460 0 1312 1461 0 1313 1462 0 1314 1463 0 1315 1464 0 1316 1465 0 1317 1466 0 1318 1467 0 1319 1468 0 1320 1469 0 1321 1470 0 1322 1471 0 1323 1472 0 1324 1473 0 1325 1474 0 1326 1475 0 1327 1477 0 1328 1478 0 1329 1494 0 1330 1495 0 1331 1496 0 1332 1497 0 1333 1498 0 1334 1499 0 1335 1500 0 1336 1501 0 1337 1502 0 1338 1531 0 1339 1533 0 1340 1534 0 1341 1535 0 1342 1536 0 1343 1537 0 1344 1538 0 1345 1539 0 1346 1540 0 1347 1541 0 1348 1542 0 1349 1543 0 1350 1544 0 1351 1545 0 1352 1546 0 1353 1547 0 1354 1548 0 1355 1550 0 1356 1552 0 1357 1553 0 1358 1554 0 1359 1555 0 1360 1556 0 1361 1557 0 1362 1558 0 1363 1559 0 1364 1560 0 1365 1561 0 1366 1562 0 1367 1563 0 1368 1564 0 1369 1565 0 1370 1566 0 1371 1567 0 1372 1568 0 1373 1569 0 1374 1570 0 1375 1571 0 1376 1572 0 1377 1573 0 1378 1587 0 1379 1588 0 1380 1589 0 1381 1590 0 1382 1591 0 1383 1592 0 1384 1593 0 1385 1594 0 1386 1596 0 1387 1597 0 1388 1598 0 1389 1599 0 1390 1600 0 1391 1602 0 1392 1603 0 1393 1604 0 1394 1605 0 1395 1606 0 1396 1607 0 1397 1608 0 1398 1609 0 1399 1610 0 1400 1611 0 1401 1612 0 1402 1613 0 1403 1614 0 1404 1615 0 1405 1616 0 1406 1617 0 1407 1618 0 1408 1619 0 1409 1620 0 1410 1621 0 1411 1622 0 1412 1623 0 1413 1624 0 1414 1625 0 1415 1626 0 1416 1627 0 1417 1628 0 1418 1630 0 1419 1631 0 1420 1632 0 1421 1633 0 1422 1634 0 1423 1635 0 1424 1636 0 1425 1637 0 1426 1638 0 1427 1639 0 1428 1641 0 1429 1643 0 1430 1644 0 1431 1645 0 1432 1646 0 1433 1647 0 1434 1648 0 1435 1649 0 1436 1650 0 1437 1651 0 1438 1652 0 1439 1653 0 1440 1654 0 1441 1655 0 1442 1656 0 1443 1657 0 1444 1658 0 1445 1659 0 1446 1660 0 1447 1661 0 1448 1662 0 1449 1663 0 1450 1664 0 1451 1665 0 1452 1666 0 1453 1668 0 1454 1669 0 1455 1670 0 1456 1686 0 1457 1687 0 1458 1688 0 1459 1689 0 1460 1690 0 1461 1691 0 1462 1692 0 1463 1693 0 1464 1694 0 1465 1695 0 1466 1709 0 1467 1710 0 1468 1711 0 1469 1712 0 1470 1713 0 1471 1714 0 1472 1715 0 1473 1716 0 1474 1717 0 1475 1719 0 1476 1720 0 1477 1721 0 1478 1722 0 1479 1723 0 1480 1724 0 1481 1725 0 1482 1726 0 1483 1727 0 1484 1728 0 1485 1729 0 1486 1730 0 1487 1731 0 1488 1732 0 1489 1733 0 1490 1734 0 1491 1735 0 1492 1736 0 1493 1737 0 1494 1738 0 1495 1739 0 1496 1740 0 1497 1741 0 1498 1742 0 1499 1743 0 1500 1744 0 1501 1745 0 1502 1746 0 1503 1747 0 1504 1748 0 1505 1749 0 1506 1750 0 1507 1751 0 1508 1753 0 1509 1754 0 1510 1755 0 1511 1756 0 1512 1757 0 1513 1758 0 1514 1759 0 1515 1761 0 1516 1762 0 1517 1763 0 1518 1764 0 1519 1765 0 1520 1766 0 1521 1767 0 1522 1768 0 1523 1769 0 1524 1770 0 1525 1771 0 1526 1772 0 1527 1773 0 1528 1774 0 1529 1776 0 1530 1777 0 1531 1778 0 1532 1779 0 1533 1780 0 1534 1781 0 1535 1782 0 1536 1783 0 1537 1784 0 1538 1785 0 1539 1786 0 1540 1787 0 1541 1788 0 1542 1789 0 1543 1790 0 1544 1791 0 1545 1792 0 1546 1793 0 1547 1794 0 1548 1796 0 1549 1797 0 1550 1798 0 1551 1799 0 1552 1800 0 1553 1801 0 1554 1802 0 1555 1803 0 1556 1804 0 1557 1805 0 1558 1806 0 1559 1807 0 1560 1808 0 1561 1809 0 1562 1810 0 1563 1811 0 1564 1812 0 1565 1813 0 1566 1814 0 1567 1815 0 1568 1816 0 1569 1817 0 1570 1818 0 1571 1819 0 1572 1820 0 1573 1821 0 1574 1822 0 1575 1823 0 1576 1824 0 1577 1825 0 1578 1827 0 1579 1828 0 1580 1829 0 1581 1830 0 1582 1831 0 1583 1832 0 1584 1833 0 1585 1834 0 1586 1835 0 1587 1836 0 1588 1837 0 1589 1838 0 1590 1839 0 1591 1840 0 1592 1841 0 1593 1842 0 1594 1843 0 1595 1844 0 1596 1845 0 1597 1846 0 1598 1847 0 1599 1848 0 1600 1849 0 1601 1850 0 1602 1851 0 1603 1852 0 1604 1853 0 1605 1854 0 1606 1855 0 1607 1856 0 1608 1857 0 1609 1858 0 1610 1859 0 1611 1860 0 1612 1861 0 1613 1862 0 1614 1863 0 1615 1865 0 1616 1866 0 1617 1867 0 1618 1868 0 1619 1869 0 1620 1870 0 1621 1871 0 1622 1872 0 1623 1873 0 1624 1874 0 1625 1875 0 1626 1876 0 1627 1877 0 1628 1878 0 1629 1880 0 1630 1881 0 1631 1882 0 1632 1883 0 1633 1884 0 1634 1885 0 1635 1886 0 1636 1910 0 1637 1911 0 1638 1912 0 1639 1913 0 1640 1914 0 1641 1915 0 1642 1916 0 1643 1917 0 1644 1918 0 1645 1919 0 1646 1920 0 1647 1921 0 1648 1922 0 1649 1923 0 1650 1924 0 1651 1925 0 1652 1926 0 1653 1927 0 1654 1928 0 1655 1929 0 1656 1930 0 1657 1931 0 1658 1932 0 1659 1934 0 1660 1935 0 1661 1936 0 1662 1937 0 1663 1938 0 1664 1939 0 1665 1940 0 1666 1941 0 1667 1942 0 1668 1943 0 1669 1944 0 1670 1945 0 1671 1946 0 1672 1947 0 1673 1948 0 1674 1949 0 1675 1950 0 1676 1951 0 1677 1952 0 1678 1953 0 1679 1955 0 1680 1956 0 1681 1957 0 1682 1958 0 1683 1959 0 1684 1960 0 1685 1961 0 1686 1962 0 1687 1963 0 1688 1964 0 1689 1965 0 1690 1966 0 1691 1967 0 1692 1968 0 1693 1969 0 1694 1970 0 1695 1971 0 1696 1972 0 1697 1973 0 1698 1974 0 1699 1975 0 1700 1976 0 1701 1977 0 1702 1978 0 1703 1979 0 1704 1980 0 1705 1981 0 1706 1982 0 1707 1984 0 1708 1985 0 1709 1986 0 1710 1987 0 1711 1989 0 1712 1990 0 1713 1991 0 1714 1992 0 1715 1993 0 1716 1994 0 1717 1995 0 1718 1996 0 1719 1997 0 1720 1998 0 1721 1999 0 1722 2000 0 1723 2001 0 1724 2002 0 1725 2003 0 1726 2004 0 1727 2005 0 1728 2006 0 1729 2007 0 1730 2008 0 1731 2009 0 1732 2010 0 1733 2013 0 1734 2014 0 1735 2015 0 1736 2016 0 1737 2017 0 1738 2019 0 1739 2023 0 1740 2024 0 1741 2025 0 1742 2048 0 1743 2049 0 1744 2050 0 1745 2051 0 1746 2052 0 1747 2053 0 1748 2054 0 1749 2055 0 1750 2056 0 1751 2057 0 1752 2058 0 1753 2059 0 1754 2060 0 1755 2061 0 1756 2062 0 1757 2063 0 1758 2064 0 1759 2065 0 1760 2066 0 1761 2067 0 1762 2069 0 1763 2070 0 1764 2071 0 1765 2072 0 1766 2073 0 1767 2074 0 1768 2075 0 1769 2076 0 1770 2077 0 1771 2078 0 1772 2079 0 1773 2080 0 1774 2081 0 1775 2082 0 1776 2083 0 1777 2084 0 1778 2085 0 1779 2086 0 1780 2100 0 1781 2101 0 1782 2102 0 1783 2103 0 1784 2104 0 1785 2105 0 1786 2106 0 1787 2107 0 1788 2108 0 1789 2109 0 1790 2110 0 1791 2111 0 1792 2112 0 1793 2113 0 1794 2114 0 1795 2115 0 1796 2116 0 1797 2119 0 1798 2120 0 1799 2121 0 1800 2122 0 1801 2123 0 1802 2143 0 1803 2144 0 1804 2145 0 1805 2146 0 1806 2147 0 1807 2148 0 1808 2149 0 1809 2150 0 1810 2151 0 1811 2152 0 1812 2153 0 1813 2154 0 1814 2155 0 1815 2156 0 1816 2157 0 1817 2158 0 1818 2159 0 1819 2160 0 1820 2161 0 1821 2162 0 1822 2163 0 1823 2164 0 1824 2165 0 1825 2166 0 1826 2167 0 1827 2168 0 1828 2169 0 1829 2170 0 1830 2171 0 1831 2172 0 1832 2173 0 1833 2196 0 1834 2197 0 1835 2198 0 1836 2199 0 1837 2200 0 1838 2201 0 1839 2202 0 1840 2203 0 1841 2204 0 1842 2205 0 1843 2206 0 1844 2207 0 1845 2208 0 1846 2209 0 1847 2210 0 1848 2211 0 1849 2212 0 1850 2213 0 1851 2214 0 1852 2215 0 1853 2216 0 1854 2217 0 1855 2218 0 1856 2219 0 1857 2220 0 1858 2221 0 1859 2222 0 1860 2223 0 1861 2224 0 1862 2225 0 1863 2226 0 1864 2227 0 1865 2228 0 1866 2229 0 1867 2230 0 1868 2231 0 1869 2232 0 1870 2233 0 1871 2234 0 1872 2235 0 1873 2236 0 1874 2237 0 1875 2238 0 1876 2239 0 1877 2240 0 1878 2241 0 1879 2242 0 1880 2243 0 1881 2244 0 1882 2245 0 1883 2246 0 1884 2247 0 1885 2248 0 1886 2249 0 1887 2250 0 1888 2251 0 1889 2252 0 1890 2253 0 1891 2254 0 1892 2255 0 1893 2256 0 1894 2257 0 1895 2258 0 1896 2259 0 1897 2260 0 1898 2261 0 1899 2262 0 1900 2263 0 1901 2264 0 1902 2265 0 1903 2266 0 1904 2267 0 1905 2268 0 1906 2269 0 1907 2270 0 1908 2271 0 1909 2272 0 1910 2273 0 1911 2274 0 1912 2275 0 1913 2276 0 1914 2277 0 1915 2278 0 1916 2279 0 1917 2280 0 1918 2281 0 1919 2282 0 1920 2283 0 1921 2286 0 1922 2287 0 1923 2288 0 1924 2289 0 1925 2290 0 1926 2291 0 1927 2292 0 1928 2293 0 1929 2294 0 1930 2295 0 1931 2296 0 1932 2297 0 1933 2298 0 1934 2299 0 1935 2300 0 1936 2301 0 1937 2302 0 1938 2303 0 1939 2304 0 1940 2305 0 1941 2306 0 1942 2307 0 1943 2308 0 1944 2309 0 1945 2310 0 1946 2311 0 1947 2312 0 1948 2313 0 1949 2314 0 1950 2315 0 1951 2316 0 1952 2317 0 1953 2318 0 1954 2319 0 1955 2320 0 1956 2321 0 1957 2323 0 1958 2324 0 1959 2325 0 1960 2326 0 1961 2327 0 1962 2328 0 1963 2329 0 1964 2330 0 1965 2331 0 1966 2332 0 1967 2333 0 1968 2334 0 1969 2335 0 1970 2336 0 1971 2337 0 1972 2338 0 1973 2339 0 1974 2340 0 1975 2341 0 1976 2342 0 1977 2343 0 1978 2344 0 1979 2345 0 1980 2363 0 1981 2364 0 1982 2365 0 1983 2366 0 1984 2367 0 1985 2368 0 1986 2369 0 1987 2370 0 1988 2371 0 1989 2372 0 1990 2373 0 1991 2374 0 1992 2375 0 1993 2376 0 1994 2377 0 1995 2378 0 1996 2397 0 1997 2398 0 1998 2399 0 1999 2400 0 2000 2401 0 2001 2402 0 2002 2403 0 2003 2404 0 2004 2405 0 2005 2406 0 2006 2407 0 2007 2408 0 2008 2409 0 2009 2410 0 2010 2411 0 2011 2412 0 2012 2413 0 2013 2414 0 2014 2415 0 2015 2416 0 2016 2418 0 2017 2419 0 2018 2420 0 2019 2421 0 2020 2422 0 2021 2423 0 2022 2424 0 2023 2425 0 2024 2426 0 2025 2427 0 2026 2428 0 2027 2429 0 2028 2430 0 2029 2431 0 2030 2432 0 2031 2434 0 2032 2435 0 2033 2436 0 2034 2437 0 2035 2438 0 2036 2439 0 2037 2440 0 2038 2441 0 2039 2443 0 2040 2444 0 2041 2445 0 2042 2446 0 2043 2447 0 2044 2448 0 2045 2449 0 2046 2450 0 2047 2451 0 2048 2452 0 2049 2453 0 2050 2454 0 2051 2455 0 2052 2456 0 2053 2458 0 2054 2459 0 2055 2460 0 2056 2461 0 2057 2462 0 2058 2463 0 2059 2464 0 2060 2465 0 2061 2466 0 2062 2467 0 2063 2468 0 2064 2469 0 2065 2470 0 2066 2471 0 2067 2472 0 2068 2473 0 2069 2474 0 2070 2475 0 2071 2476 0 2072 2477 0 2073 2478 0 2074 2479 0 2075 2481 0 2076 2482 0 2077 2483 0 2078 2484 0 2079 2485 0 2080 2503 0 2081 2504 0 2082 2505 0 2083 2506 0 2084 2507 0 2085 2508 0 2086 2509 0 2087 2510 0 2088 2511 0 2089 2512 0 2090 2513 0 2091 2514 0 2092 2515 0 2093 2516 0 2094 2517 0 2095 2518 0 2096 2519 0 2097 2520 0 2098 2521 0 2099 2522 0 2100 2523 0 2101 2524 0 2102 2525 0 2103 2526 0 2104 2527 0 2105 2528 0 2106 2529 0 2107 2530 0 2108 2531 0 2109 2532 0 2110 2533 0 2111 2534 0 2112 2535 0 2113 2536 0 2114 2537 0 2115 2538 0 2116 2539 0 2117 2540 0 2118 2542 0 2119 2543 0 2120 2544 0 2121 2545 0 2122 2546 0 2123 2547 0 2124 2548 0 2125 2549 0 2126 2550 0 2127 2551 0 2128 2552 0 2129 2553 0 2130 2571 0 2131 2572 0 2132 2573 0 2133 2574 0 2134 2575 0 2135 2576 0 2136 2577 0 2137 2578 0 2138 2579 0 2139 2580 0 2140 2581 0 2141 2582 0 2142 2583 0 2143 2584 0 2144 2585 0 2145 2586 0 2146 2587 0 2147 2588 0 2148 2589 0 2149 2590 0 2150 2591 0 2151 2592 0 2152 2593 0 2153 2594 0 2154 2595 0 2155 2596 0 2156 2597 0 2157 2598 0 2158 2599 0 2159 2600 0 2160 2601 0 2161 2602 0 2162 2603 0 2163 2604 0 2164 2605 0 2165 2606 0 2166 2607 0 2167 2608 0 2168 2609 0 2169 2610 0 2170 2611 0 2171 2612 0 2172 2613 0 2173 2614 0 2174 2615 0 2175 2616 0 2176 2634 0 2177 2635 0 2178 2636 0 2179 2637 0 2180 2638 0 2181 2639 0 2182 2640 0 2183 2641 0 2184 2642 0 2185 2643 0 2186 2644 0 2187 2645 0 2188 2646 0 2189 2647 0 2190 2648 0 2191 2649 0 2192 2650 0 2193 2651 0 2194 2652 0 2195 2653 0 2196 2654 0 2197 2655 0 2198 2656 0 2199 2657 0 2200 2658 0 2201 2659 0 2202 2660 0 2203 2661 0 2204 2662 0 2205 2663 0 2206 2664 0 2207 2665 0 2208 2666 0 2209 2667 0 2210 2668 0 2211 2669 0 2212 2670 0 2213 2671 0 2214 2672 0 2215 2673 0 2216 2674 0 2217 2675 0 2218 2676 0 2219 2677 0 2220 2678 0 2221 2679 0 2222 2680 0 2223 2681 0 2224 2682 0 2225 2683 0 2226 2684 0 2227 2685 0 2228 2686 0 2229 2687 0 2230 2688 0 2231 2689 0 2232 2690 0 2233 2691 0 2234 2692 0 2235 2693 0 2236 2694 0 2237 2695 0 2238 2696 0 2239 2697 0 2240 2698 0 2241 2699 0 2242 2700 0 2243 2701 0 2244 2702 0 2245 2703 0 2246 2704 0 2247 2705 0 2248 2706 0 2249 2707 0 2250 2708 0 2251 2709 0 2252 2710 0 2253 2711 0 2254 2712 0 2255 2713 0 2256 2714 0 2257 2715 0 2258 2716 0 2259 2717 0 2260 2718 0 2261 2719 0 2262 2720 0 2263 2721 0 2264 2722 0 2265 2723 0 2266 2724 0 2267 2725 0 2268 2726 0 2269 2727 0 2270 2728 0 2271 2729 0 2272 2730 0 2273 2731 0 2274 2732 0 2275 2733 0 2276 2734 0 2277 2735 0 2278 2736 0 2279 2737 0 2280 2738 0 2281 2739 0 2282 2740 0 2283 2741 0 2284 2742 0 2285 2743 0 2286 2744 0 2287 2745 0 2288 2746 0 2289 2747 0 2290 2748 0 2291 2749 0 2292 2750 0 2293 2751 0 2294 2752 0 2295 2753 0 2296 2754 0 2297 2755 0 2298 2756 0 2299 2757 0 2300 2759 0 2301 2760 0 2302 2761 0 2303 2762 0 2304 2763 0 2305 2764 0 2306 2765 0 2307 2766 0 2308 2767 0 2309 2768 0 2310 2769 0 2311 2770 0 2312 2771 0 2313 2772 0 2314 2773 0 2315 2774 0 2316 2775 0 2317 2776 0 2318 2778 0 2319 2779 0 2320 2780 0 2321 2781 0 2322 2782 0 2323 2783 0 2324 2784 0 2325 2785 0 2326 2786 0 2327 2787 0 2328 2788 0 2329 2789 0 2330 2790 0 2331 2791 0 2332 2792 0 2333 2793 0 2334 2811 0 2335 2812 0 2336 2813 0 2337 2814 0 2338 2815 0 2339 2816 0 2340 2817 0 2341 2818 0 2342 2819 0 2343 2820 0 2344 2821 0 2345 2822 0 2346 2823 0 2347 2824 0 2348 2825 0 2349 2826 0 2350 2827 0 2351 2828 0 2352 2829 0 2353 2830 0 2354 2831 0 2355 2832 0 2356 2833 0 2357 2834 0 2358 2836 0 2359 2837 0 2360 2838 0 2361 2839 0 2362 2840 0 2363 2841 0 2364 2842 0 2365 2843 0 2366 2844 0 2367 2845 0 2368 2846 0 2369 2847 0 2370 2848 0 2371 2849 0 2372 2850 0 2373 2851 0 2374 2852 0 2375 2853 0 2376 2854 0 2377 2855 0 2378 2856 0 2379 2857 0 2380 2858 0 2381 2860 0 2382 2861 0 2383 2862 0 2384 2863 0 2385 2864 0 2386 2865 0 2387 2866 0 2388 2867 0 2389 2868 0 2390 2869 0 2391 2870 0 2392 2871 0 2393 2872 0 2394 2873 0 2395 2874 0 2396 2875 0 2397 2876 0 2398 2877 0 2399 2878 0 2400 2880 0 2401 2881 0 2402 2882 0 2403 2883 0 2404 2884 0 2405 2885 0 2406 2886 0 2407 2887 0 2408 2888 0 2409 2889 0 2410 2890 0 2411 2891 0 2412 2892 0 2413 2893 0 2414 2894 0 2415 2895 0 2416 2896 0 2417 2898 0 2418 2899 0 2419 2900 0 2420 2901 0 2421 2902 0 2422 2903 0 2423 2905 0 2424 2906 0 2425 2907 0 2426 2908 0 2427 2909 0 2428 2910 0 2429 2911 0 2430 2912 0 2431 2913 0 2432 2914 0 2433 2915 0 2434 2916 0 2435 2917 0 2436 2918 0 2437 2919 0 2438 2920 0 2439 2921 0 2440 2922 0 2441 2923 0 2442 2924 0 2443 2925 0 2444 2926 0 2445 2927 0 2446 2928 0 2447 2929 0 2448 2930 0 2449 2931 0 2450 2932 0 2451 2933 0 2452 2934 0 2453 2935 0 2454 2936 0 2455 2937 0 2456 2938 0 2457 2939 0 2458 2940 0 2459 2941 0 2460 2942 0 2461 2943 0 2462 2944 0 2463 2945 0 2464 2946 0 2465 2947 0 2466 2948 0 2467 2949 0 2468 2950 0 2469 2951 0 2470 2952 0 2471 2973 0 2472 2974 0 2473 2975 0 2474 2976 0 2475 2977 0 2476 2978 0 2477 2979 0 2478 2980 0 2479 2981 0 2480 2982 0 2481 2983 0 2482 2984 0 2483 2985 0 2484 2986 0 2485 2987 0 2486 2988 0 2487 2989 0 2488 2990 0 2489 2991 0 2490 2992 0 2491 2993 0 2492 2994 0 2493 2995 0 2494 2996 0 2495 2997 0 2496 2998 0 2497 2999 0 2498 3000 0 2499 3001 0 2500 3002 0 2501 3003 0 2502 3004 0 2503 3005 0 2504 3006 0 2505 3007 0 2506 3009 0 2507 3010 0 2508 3011 0 2509 3012 0 2510 3013 0 2511 3014 0 2512 3015 0 2513 3016 0 2514 3017 0 2515 3018 0 2516 3019 0 2517 3020 0 2518 3021 0 2519 3022 0 2520 3023 0 2521 3024 0 2522 3025 0 2523 3026 0 2524 3027 0 2525 3028 0 2526 3030 0 2527 3031 0 2528 3032 0 2529 3033 0 2530 3034 0 2531 3035 0 2532 3036 0 2533 3037 0 2534 3038 0 2535 3039 0 2536 3040 0 2537 3041 0 2538 3042 0 2539 3043 0 2540 3044 0 2541 3045 0 2542 3046 0 2543 3048 0 2544 3051 0 2545 3052 0 2546 3053 0 2547 3054 0 2548 3055 0 2549 3056 0 2550 3057 0 2551 3058 0 2552 3059 0 2553 3060 0 2554 3061 0 2555 3065 0 2556 3066 0 2557 3067 0 2558 3072 0 2559 3075 0 2560 3077 0 2561 3078 0 2562 3079 0 2563 3080 0 2564 3081 0 2565 3082 0 2566 3083 0 2567 3084 0 2568 3085 0 2569 3086 0 2570 3088 0 2571 3089 0 2572 3090 0 2573 3091 0 2574 3092 0 2575 3093 0 2576 3094 0 2577 3095 0 2578 3096 0 2579 3097 0 2580 3098 0 2581 3099 0 2582 3100 0 2583 3101 0 2584 3102 0 2585 3103 0 2586 3104 0 2587 3105 0 2588 3106 0 2589 3108 0 2590 3109 0 2591 3110 0 2592 3111 0 2593 3112 0 2594 3113 0 2595 3114 0 2596 3115 0 2597 3116 0 2598 3117 0 2599 3118 0 2600 3119 0 2601 3120 0 2602 3121 0 2603 3122 0 2604 3123 0 2605 3124 0 2606 3125 0 2607 3141 0 2608 3142 0 2609 3143 0 2610 3144 0 2611 3145 0 2612 3146 0 2613 3147 0 2614 3148 0 2615 3149 0 2616 3150 0 2617 3151 0 2618 3152 0 2619 3153 0 2620 3154 0 2621 3155 0 2622 3156 0 2623 3157 0 2624 3158 0 2625 3159 0 2626 3160 0 2627 3161 0 2628 3162 0 2629 3163 0 2630 3164 0 2631 3165 0 2632 3183 0 2633 3184 0 2634 3185 0 2635 3186 0 2636 3187 0 2637 3188 0 2638 3189 0 2639 3191 0 2640 3192 0 2641 3193 0 2642 3194 0 2643 3195 0 2644 3196 0 2645 3197 0 2646 3198 0 2647 3199 0 2648 3200 0 2649 3201 0 2650 3202 0 2651 3203 0 2652 3204 0 2653 3205 0 2654 3206 0 2655 3207 0 2656 3208 0 2657 3209 0 2658 3211 0 2659 3212 0 2660 3213 0 2661 3214 0 2662 3232 0 2663 3233 0 2664 3234 0 2665 3235 0 2666 3236 0 2667 3237 0 2668 3238 0 2669 3239 0 2670 3240 0 2671 3242 0 2672 3243 0 2673 3244 0 2674 3245 0 2675 3246 0 2676 3247 0 2677 3248 0 2678 3249 0 2679 3250 0 2680 3251 0 2681 3252 0 2682 3253 0 2683 3254 0 2684 3255 0 2685 3256 0 2686 3257 0 2687 3258 0 2688 3259 0 2689 3260 0 2690 3261 0 2691 3262 0 2692 3263 0 2693 3264 0 2694 3265 0 2695 3266 0 2696 3267 0 2697 3268 0 2698 3269 0 2699 3270 0 2700 3271 0 2701 3272 0 2702 3273 0 2703 3274 0 2704 3275 0 2705 3276 0 2706 3278 0 2707 3279 0 2708 3280 0 2709 3281 0 2710 3282 0 2711 3283 0 2712 3284 0 2713 3285 0 2714 3286 0 2715 3287 0 2716 3288 0 2717 3320 0 2718 3321 0 2719 3322 0 2720 3323 0 2721 3324 0 2722 3325 0 2723 3326 0 2724 3327 0 2725 3335 0 2726 3336 0 2727 3369 0 2728 3370 0 2729 3371 0 2730 3372 0 2731 3373 0 2732 3374 0 2733 3375 0 2734 3376 0 2735 3377 0 2736 3378 0 2737 3379 0 2738 3380 0 2739 3381 0 2740 3382 0 2741 3383 0 2742 3384 0 2743 3385 0 2744 3386 0 2745 3387 0 2746 3388 0 2747 3389 0 2748 3390 0 2749 3391 0 2750 3392 0 2751 3393 0 2752 3394 0 2753 3411 0 2754 3412 0 2755 3413 0 2756 3414 0 2757 3415 0 2758 3416 0 2759 3461 0 2760 3462 0 2761 3463 0 2762 3464 0 2763 3465 0 2764 3466 0 2765 3467 0 2766 3468 0 2767 3469 0 2768 3470 0 2769 3471 0 2770 3472 0 2771 3473 0 2772 3474 0 2773 3475 0 2774 3476 0 2775 3477 0 2776 3478 0 2777 3479 0 2778 3480 0 2779 3481 0 2780 3482 0 2781 3483 0 2782 3484 0 2783 3485 0 2784 3486 0 2785 3487 0 2786 3488 0 2787 3489 0 2788 3490 0 2789 3491 0 2790 3492 0 2791 3493 0 2792 3500 0 2793 3501 0 2794 3502 0 2795 3503 0 2796 3504 0 2797 3505 0 2798 3506 0 2799 3507 0 2800 3508 0 2801 3509 0 2802 3510 0 2803 3511 0 2804 3512 0 2805 3513 0 2806 3514 0 2807 3515 0 2808 3516 0 2809 3517 0 2810 3518 0 2811 3519 0 2812 3521 0 2813 3522 0 2814 3523 0 2815 3524 0 2816 3525 0 2817 3526 0 2818 3527 0 2819 3528 0 2820 3529 0 2821 3530 0 2822 3531 0 2823 3532 0 2824 3533 0 2825 3534 0 2826 3535 0 2827 3536 0 2828 3537 0 2829 3538 0 2830 3539 0 2831 3540 0 2832 3541 0 2833 3542 0 2834 3543 0 2835 3544 0 2836 3545 0 2837 3546 0 2838 3547 0 2839 3548 0 2840 3549 0 2841 3550 0 2842 3555 0 2843 3556 0 2844 3557 0 2845 3558 0 2846 3559 0 2847 3560 0 2848 3561 0 2849 3562 0 2850 3563 0 2851 3564 0 2852 3565 0 2853 3566 0 2854 3567 0 2855 3568 0 2856 3569 0 2857 3570 0 2858 3571 0 2859 3572 0 2860 3573 0 2861 3574 0 2862 3575 0 2863 3576 0 2864 3577 0 2865 3578 0 2866 3579 0 2867 3580 0 2868 3581 0 2869 3582 0 2870 3583 0 2871 3584 0 2872 3585 0 2873 3586 0 2874 3587 0 2875 3588 0 2876 3589 0 2877 3590 0 2878 3591 0 2879 3592 0 2880 3593 0 2881 3594 0 2882 3596 0 2883 3597 0 2884 3598 0 2885 3599 0 2886 3600 0 2887 3601 0 2888 3602 0 2889 3603 0 2890 3604 0 2891 3605 0 2892 3606 0 2893 3607 0 2894 3608 0 2895 3609 0 2896 3610 0 2897 3611 0 2898 3612 0 2899 3613 0 2900 3614 0 2901 3615 0 2902 3616 0 2903 3617 0 2904 3618 0 2905 3619 0 2906 3620 0 2907 3621 0 2908 3622 0 2909 3624 0 2910 3625 0 2911 3626 0 2912 3627 0 2913 3628 0 2914 3629 0 2915 3630 0 2916 3631 0 2917 3632 0 2918 3633 0 2919 3634 0 2920 3635 0 2921 3636 0 2922 3637 0 2923 3638 0 2924 3639 0 2925 3640 0 2926 3641 0 2927 3642 0 2928 3643 0 2929 3644 0 2930 3645 0 2931 3646 0 2932 3647 0 2933 3648 0 2934 3649 0 2935 3650 0 2936 3651 0 2937 3652 0 2938 3653 0 2939 3655 0 2940 3656 0 2941 3657 0 2942 3658 0 2943 3659 0 2944 3660 0 2945 3661 0 2946 3662 0 2947 3663 0 2948 3682 0 2949 3683 0 2950 3684 0 2951 3685 0 2952 3686 0 2953 3687 0 2954 3688 0 2955 3689 0 2956 3690 0 2957 3691 0 2958 3692 0 2959 3693 0 2960 3694 0 2961 3695 0 2962 3696 0 2963 3697 0 2964 3698 0 2965 3699 0 2966 3700 0 2967 3701 0 2968 3702 0 2969 3703 0 2970 3704 0 2971 3705 0 2972 3706 0 2973 3707 0 2974 3708 0 2975 3725 0 2976 3726 0 2977 3727 0 2978 3728 0 2979 3729 0 2980 3730 0 2981 3731 0 2982 3732 0 2983 3733 0 2984 3734 0 2985 3735 0 2986 3753 0 2987 3754 0 2988 3755 0 2989 3756 0 2990 3757 0 2991 3758 0 2992 3759 0 2993 3760 0 2994 3761 0 2995 3762 0 2996 3763 0 2997 3764 0 2998 3765 0 2999 3766 0 3000 3767 0 3001 3768 0 3002 3769 0 3003 3770 0 3004 3771 0 3005 3772 0 3006 3773 0 3007 3774 0 3008 3775 0 3009 3776 0 3010 3777 0 3011 3778 0 3012 3779 0 3013 3780 0 3014 3781 0 3015 3782 0 3016 3783 0 3017 3784 0 3018 3785 0 3019 3786 0 3020 3787 0 3021 3788 0 3022 3789 0 3023 3790 0 3024 3791 0 3025 3792 0 3026 3793 0 3027 3794 0 3028 3795 0 3029 3796 0 3030 3797 0 3031 3798 0 3032 3799 0 3033 3815 0 3034 3816 0 3035 3817 0 3036 3818 0 3037 3819 0 3038 3820 0 3039 3821 0 3040 3822 0 3041 3823 0 3042 3824 0 3043 3825 0 3044 3826 0 3045 3827 0 3046 3828 0 3047 3829 0 3048 3830 0 3049 3831 0 3050 3832 0 3051 3833 0 3052 3834 0 3053 3835 0 3054 3836 0 3055 3837 0 3056 3838 0 3057 3839 0 3058 3840 0 3059 3841 0 3060 3842 0 3061 3843 0 3062 3844 0 3063 3845 0 3064 3846 0 3065 3848 0 3066 3849 0 3067 3850 0 3068 3851 0 3069 3852 0 3070 3853 0 3071 3854 0 3072 3855 0 3073 3856 0 3074 3857 0 3075 3858 0 3076 3859 0 3077 3860 0 3078 3861 0 3079 3862 0 3080 3863 0 3081 3864 0 3082 3865 0 3083 3866 0 3084 3867 0 3085 3868 0 3086 3869 0 3087 3870 0 3088 3871 0 3089 3872 0 3090 3873 0 3091 3874 0 3092 3875 0 3093 3877 0 3094 3878 0 3095 3879 0 3096 3880 0 3097 3881 0 3098 3882 0 3099 3883 0 3100 3884 0 3101 3885 0 3102 3886 0 3103 3887 0 3104 3888 0 3105 3889 0 3106 3890 0 3107 3891 0 3108 3892 0 3109 3893 0 3110 3894 0 3111 3895 0 3112 3896 0 3113 3897 0 3114 3898 0 3115 3899 0 3116 3900 0 3117 3901 0 3118 3902 0 3119 3903 0 3120 3904 0 3121 3905 0 3122 3906 0 3123 3907 0 3124 3909 0 3125 3910 0 3126 3911 0 3127 3912 0 3128 3913 0 3129 3914 0 3130 3934 0 3131 3935 0 3132 3937 0 3133 3970 0 3134 3971 0 3135 3972 0 3136 3973 0 3137 3975 0 3138 3976 0 3139 3977 0 3140 3979 0 3141 3980 0 3142 3981 0 3143 3982 0 3144 3995 0 3145 3996 0 3146 3997 0 3147 3998 0 3148 3999 0 3149 4000 0 3150 4001 0 3151 4002 0 3152 4003 0 3153 4004 0 3154 4005 0 3155 4006 0 3156 4007 0 3157 4008 0 3158 4009 0 3159 4010 0 3160 4011 0 3161 4012 0 3162 4013 0 3163 4014 0 3164 4015 0 3165 4016 0 3166 4017 0 3167 4018 0 3168 4019 0 3169 4020 0 3170 4021 0 3171 4022 0 3172 4023 0 3173 4024 0 3174 4025 0 3175 4026 0 3176 4027 0 3177 4028 0 3178 4029 0 3179 4030 0 3180 4031 0 3181 4032 0 3182 4033 0 3183 4034 0 3184 4035 0 3185 4036 0 3186 4037 0 3187 4038 0 3188 4039 0 3189 4040 0 3190 4041 0 3191 4042 0 3192 4043 0 3193 4044 0 3194 4045 0 3195 4046 0 3196 4047 0 3197 4048 0 3198 4049 0 3199 4050 0 3200 4051 0 3201 4052 0 3202 4053 0 3203 4054 0 3204 4055 0 3205 4056 0 3206 4057 0 3207 4059 0 3208 4060 0 3209 4061 0 3210 4062 0 3211 4063 0 3212 4064 0 3213 4065 0 3214 4066 0 3215 4067 0 3216 4068 0 3217 4069 0 3218 4070 0 3219 4071 0 3220 4072 0 3221 4073 0 3222 4074 0 3223 4075 0 3224 4076 0 3225 4077 0 3226 4078 0 3227 4079 0 3228 4080 0 3229 4081 0 3230 4082 0 3231 4083 0 3232 4084 0 3233 4085 0 3234 4086 0 3235 4087 0 3236 4088 0 3237 4089 0 3238 4090 0 3239 4091 0 3240 4092 0 3241 4094 0 3242 4095 0 3243 4096 0 3244 4097 0 3245 4098 0 3246 4099 0 3247 4100 0 3248 4101 0 3249 4103 0 3250 4104 0 3251 4105 0 3252 4106 0 3253 4107 0 3254 4108 0 3255 4109 0 3256 4110 0 3257 4111 0 3258 4112 0 3259 4113 0 3260 4114 0 3261 4115 0 3262 4116 0 3263 4117 0 3264 4118 0 3265 4119 0 3266 4121 0 3267 4122 0 3268 4124 0 3269 4125 0 3270 4126 0 3271 4127 0 3272 4128 0 3273 4129 0 3274 4130 0 3275 4131 0 3276 4132 0 3277 4133 0 3278 4134 0 3279 4135 0 3280 4136 0 3281 4137 0 3282 4138 0 3283 4139 0 3284 4140 0 3285 4141 0 3286 4142 0 3287 4143 0 3288 4144 0 3289 4145 0 3290 4146 0 3291 4147 0 3292 4148 0 3293 4149 0 3294 4150 0 3295 4151 0 3296 4152 0 3297 4153 0 3298 4154 0 3299 4155 0 3300 4156 0 3301 4157 0 3302 4158 0 3303 4159 0 3304 4177 0 3305 4178 0 3306 4179 0 3307 4180 0 3308 4181 0 3309 4182 0 3310 4184 0 3311 4185 0 3312 4186 0 3313 4187 0 3314 4188 0 3315 4204 0 3316 4205 0 3317 4206 0 3318 4207 0 3319 4208 0 3320 4209 0 3321 4210 0 3322 4211 0 3323 4212 0 3324 4213 0 3325 4214 0 3326 4215 0 3327 4216 0 3328 4217 0 3329 4218 0 3330 4219 0 3331 4220 0 3332 4221 0 3333 4222 0 3334 4223 0 3335 4224 0 3336 4225 0 3337 4226 0 3338 4227 0 3339 4228 0 3340 4229 0 3341 4230 0 3342 4231 0 3343 4232 0 3344 4233 0 3345 4234 0 3346 4235 0 3347 4236 0 3348 4237 0 3349 4238 0 3350 4239 0 3351 4240 0 3352 4241 0 3353 4242 0 3354 4244 0 3355 4245 0 3356 4249 0 3357 4254 0 3358 4255 0 3359 4256 0 3360 4257 0 3361 4258 0 3362 4259 0 3363 4260 0 3364 4261 0 3365 4262 0 3366 4263 0 3367 4264 0 3368 4265 0 3369 4266 0 3370 4267 0 3371 4268 0 3372 4269 0 3373 4270 0 3374 4271 0 3375 4272 0 3376 4273 0 3377 4274 0 3378 4275 0 3379 4276 0 3380 4277 0 3381 4278 0 3382 4279 0 3383 4280 0 3384 4281 0 3385 1248 0 3386 1249 0 3387 1503 0 3388 1504 0 3389 1505 0 3390 1506 0 3391 1511 0 3392 1512 0 3393 1530 0 3394 2629 0 3395 3126 0 3396 3127 0 3397 3128 0 3398 3129 0 3399 3130 0 3400 3131 0 3401 3132 0 3402 3171 0 3403 3172 0 3404 3173 0 3405 3174 0 3406 3175 0 3407 3182 0 3408 3664 0 3409 3665 0 3410 374 0 3411 661 0 3412 765 0 3413 837 0 3414 979 0 3415 1347 0 3416 1629 0 3417 2879 0 3418 3008 0 3419 3168 0 3420 661 0 3421 666 0 3422 1347 0 3423 1349 0 3424 1352 0 3425 1354 0 3426 1746 0 3427 1751 0 3428 1755 0 3429 1793 0 3430 1799 0 3431 1803 0 3432 1807 0 3433 1809 0 3434 3112 0 3435 3114 0 3436 3125 0 3437 3127 0 3438 3162 0 3439 3171 0 3440 3133 0 3441 3134 0 3442 3135 0 3443 3136 0 3444 3137 0 3445 3138 0 3446 3139 0 3447 3140 0 3448 3166 0 3449 3167 0 3450 3169 0 3451 3170 0 3452 661 0 3453 666 0 3454 1347 0 3455 1349 0 3456 1352 0 3457 1354 0 3458 1746 0 3459 1751 0 3460 1755 0 3461 1793 0 3462 1799 0 3463 1803 0 3464 1807 0 3465 1809 0 3466 3112 0 3467 3114 0 3468 3125 0 3469 3127 0 3470 3162 0 3471 3171 0 3472 661 0 3473 666 0 3474 1347 0 3475 1349 0 3476 1352 0 3477 1354 0 3478 1746 0 3479 1751 0 3480 1755 0 3481 1793 0 3482 1799 0 3483 1803 0 3484 1807 0 3485 1809 0 3486 3112 0 3487 3114 0 3488 3125 0 3489 3127 0 3490 3162 0 3491 3171 0 3492 661 0 3493 666 0 3494 1347 0 3495 1349 0 3496 1352 0 3497 1354 0 3498 1746 0 3499 1751 0 3500 1755 0 3501 1793 0 3502 1799 0 3503 1803 0 3504 1807 0 3505 1809 0 3506 3112 0 3507 3114 0 3508 3125 0 3509 3127 0 3510 3162 0 3511 3171 0 3512 661 4 3513 661 10 3514 979 4 3515 979 18 3516 661 4 3517 1349 4 3518 1352 4 3519 1746 4 3520 1755 4 3521 1803 4 3522 1807 4 3523 3127 4 3524 3162 4 3525 3171 4

    [0460] For select ASOs, the degree of KCNT1 mRNA knock-down was determined using a taqman quantitative polymerase chain reaction (qPCR assay). Human (BE(2)-M17) or mouse (Neuro2a) neuronal cell lines were grown in 96 well plates and transfected with either 30 nM or 300 nM ASO using RNAiMAX transfection reagent (ThermoFisher Scientific). After 48 hour incubation at 37° C., cDNA was prepared from each well using the Cell-to-Ct Kit (ThermoFisher Scientific). The expression level of KCNT1 was determined using taqman qPCR assays for either KCNT1 (human Hs01063050_m1 or mouse Mm01330638_g1) or the housekeeping gene HPRT1 (human Hs02800695_m1 or mouse Mm00446968_m1). All taqman assays were predesigned by ThermoFisher Scientific. Human KCNT1 and HPRT1 detection were multiplexed in a single well. Mouse KCNT1 and HPRT1 detection were singleplexed in paired wells. The fold change in KCNT1 was calculated using the ΔΔCp method whereby the expression of KCNT1 is first normalized to HPRT1 (2.sup.−(Cp_KCNT1-Cp_HPRT1)) in the same well followed by a secondary normalization to the vehicle, non-non-transfected control (2.sup.−(Cp_ASO-Cp_vehicle)). The assay was performed in biological duplicates and technical triplicates. Table 3 lists the percent knock down of KCNT1 expressed in human (BE(2)-M17) or mouse (Neuro2a) cells.

    [0461] Sequences with high homology to human KCNT1 and lower homology to cyno and mouse KCNT1 were identified. The ASO sequences, positions in the specified human transcript, and number of mismatches are shown in Table 7 of U.S. Provisional Application 62/862,328 and Table 11 of U.S. Provisional Application 62/884,567 filed Aug. 8, 2019, hereby incorporated by reference in its entirety. MM indicates the number of mismatches.

    [0462] For the ASO sequences, homology to non-KCNT1 spliced (secondary) mRNA transcripts were also determined using the NCBI RefSeq R92 (January 2019) and Ensemble R94 (October 2018) databases. Table 8 of U.S. Provisional Application 62/862,328, and Table 12 of U.S. Provisional Application 62/884,567 list the number of non-KCNT1 transcripts identified with increasing number of mismatches from 0MM to 4MM.

    [0463] For the ASO sequences, homology to non-KCNT1 non-spliced (primary) pre-mRNA transcripts were also determined using the Ensemble R94 (October 2018) databases. Table 9 of U.S. Provisional Application 62/862,328 and Table 13 of U.S. Provisional Application 62/884,567 list the number of non-KCNT1 transcripts identified with increasing number of mismatches from 0MM to 4MM.

    [0464] For the ASO sequences, the position of reported single nucleotide polymorphisms (SNPs) within the ASO sequence were also determined using the NCBI dbSNP Build 151 (October 2017, downloaded January 2019). Table 10 of U.S. Provisional Application 62/862,328 and Table 14 of U.S. Provisional Application 62/884,567 list the position of each SNP and the associated SNP ID.

    [0465] For the ASO sequences, the level of KCNT1 knock-down were also determined using human (BE(2)-M17) or mouse (Neuro2a) neuronal cell lines. Table 4 lists the data expressed as percent knock-down.

    TABLE-US-00003 TABLE 3 Exemplary ASOs - Percent Knock down of KCNT1 expressed in human (BE(2)-M17) or mouse (Neuro2a) cells BE(2)-M17 BE(2)-M17 Neuro2a Neuro2a SEQ 3 nM ASO 30 nM ASO 3 nM ASO 30 nM ASO ID NO: Mean Mean Mean Mean 1 4 25 3 35 4 7 50 24 62 5 7 47 19 57 6 20 53 5 62 7 3 41 14 56 8 15 43 9 53 10 23 45 27 61 12 9 49 12 54 13 −1 25 −16 8 15 6 37 −2 37

    TABLE-US-00004 TABLE 4 Exemplary ASOs - Percent Knock down of KCNT1 expressed in human (BE(2)-M17) or mouse (Neuro2a) cells Neuro2a BE(2)-M17 30 nM ASO 30 nM ASO SEQ ID NO: Mean Mean 1 34.5 4 69.5 5 68 28 6 75 7 61 28.5 8 61.5 9 38.5 10 69 12 64 13 8 14 41 15 50 25 46 26 43 28 70.5 35 45.5 38 67 50 28.5 77 67.5 80 47.5 584 22.5 587 5 588 52.5 672 23 675 47 751 69 33 753 34 756 39.5 758 70.5 759 76 43 988 77.5 1017 49.5 1018 53.5 1019 58 1021 50 1028 57 1045 58 1046 67.5 29 1047 66.5 27 1071 73.5 48 1100 44.5 1130 6 1131 19.5 1132 39 1133 21 1134 4 1145 31.5 1146 24 1154 65.5 1201 66 1202 65.5 1203 71.5 1205 60 1206 75 32.5 1207 59 1208 66.5 1209 66 1210 54.5 1243 59 1253 35 1255 25 1302 58.5 1303 52.5 1304 37.5 1335 80.5 48.5 1337 70 1338 46 1339 20.5 1364 22.5 1368 15.5 1388 77 39 1392 72.5 1402 67 1416 59.5 1473 46 1502 71 30.5 1504 74.5 1505 72 1507 75 1510 78 1538 31.5 1541 49 1542 61 1543 68.5 1544 62 1546 76.5 53.5 1548 69 1551 81.5 41 1554 69.5 1555 75.5 37 1556 76.5 1558 76.5 1559 89.5 41.5 1560 80.5 1561 73.5 1562 52 1563 48 1564 35.5 1565 61.5 1566 51.5 1570 50.5 1573 27.5 1574 58.5 1601 59.5 1602 55 1968 37 1973 38 1974 30.5 1975 35 1976 33 1977 34.5 2002 41.5 2044 66.5 2046 60 2050 72 2052 76.5 2053 71 2054 74.5 2055 72.5 2236 29 2294 51 2303 57 2304 54 2305 53 2307 3.5 2310 56.5 2311 50 2319 26 2320 24 2324 44.5 2327 64 2329 39 2346 61 2367 28 2375 69 2377 60.5 2378 66.5 2379 67.5 2382 79.5 2383 70.5 2384 66 2392 71 2393 67 2394 64.5 2505 9.5 2525 54 2529 54 2530 80 15 2533 66.5 7 2534 49.5 2592 32 2593 52.5 2594 30.5 2595 67.5 29.5 2596 64.5 29 2597 54 2598 52.5 2606 74.5 2628 54 2679 64.5 2680 63 2681 65 39.5 2784 39.5 2813 47 2901 40.5 2902 34.5 2903 36.5 2947 44 3385 30 3386 36 3387 53 3388 37 3389 42.5 3390 41 3391 25 3392 30 3393 52.5 3394 65 3395 75 42 3396 87.5 37.5 3397 79.5 3398 68.5 3399 70.5 3400 72.5 3401 59 3402 81.5 40 3403 32.5 3404 18.5 3405 24.5 3406 27.5 3407 32.5 3408 35 3409 35

    Example 2. Antisense Inhibition of KCNT1

    [0466] Inhibition or knockdown of KCNT1 can be demonstrated using a cell-based assay. For example, neurons derived from iPSCs, SH-SY5Y cells, or another available mammalian cell line (e.g., CHO cells) can be tested with oligonucleotides targeting KCNT1 identified above in Example 1 using at least five different dose levels, using transfection reagents such as lipofectamine 2000 (Invitrogen) following the manufacturer's instructions. Cells are harvested at multiple time points up to 7 days post transfection for either mRNA or protein analyses. Knockdown of mRNA and protein are determined by RT-qPCR or western blot analyses respectively, using standard molecular biology techniques as previously described (see, for example, as described in Drouet et al., 2014, PLOS One 9(6): e99341). The relative levels of the KCNT1 mRNA and protein at the different oligonucleotide levels are compared with a mock oligonucleotide control. The most potent oligonucleotides (for example, those which are capable of at least 90% reduction, for example, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% at least 97%, at least 98%, at least 99% or 100%, in protein levels when compared with controls) are selected for subsequent studies.

    Example 3. Design, Selection, and Testing of Antisense Oligonucleotides with Modified Chemistries

    [0467] Selected ASOs in tested in Example 1 were synthesized with the sugar and linkage chemistries as shown in Tables 4 and 5.

    [0468] For select ASOs, the degree of KCNT1 mRNA knock-down was determined using a taqman quantitative polymerase chain reaction (qPCR assay). Human (BE(2)-M17) neuronal cells line were grown in 96 well plates and transfected with 100 nM ASO using RNAiMAX transfection reagent (ThermoFisher Scientific). After 48 hour incubation at 37° C., cDNA was prepared from each well using the Cell-to-Ct Kit (ThermoFisher Scientific). The expression level of KCNT1 was determined using taqman qPCR assays for either KCNT1 (human Hs01063050_m1 or mouse Mm01330638_g1) or the housekeeping gene HPRT1 (human Hs02800695_m1 or mouse Mm00446968_m1). All taqman assays were predesigned by ThermoFisher Scientific. KCNT1 and HPRT1 detection were multiplexed in a single well. The fold change in KCNT1 was calculated using the ΔΔCp method whereby the expression of KCNT1 is first normalized to HPRT1 (2.sup.−(CP_KCNT1-Cp_HPRT1)) in the same well (multiplexed reaction) followed by a secondary normalization to the vehicle, non-transfected control (2.sup.−(Cp_ASO-Cp_vehicle)). The assay was performed in biological duplicates and technical triplicates.

    [0469] Table 5 provides the oligonucleotide ASO sequences, positions in the KCNT1 transcript (NCBI NM_020822.2 (SEQ ID NO: 3526)), and chemistries used to modify the ASO. In the ASO Gap column, “d” is DNA, “e” indicates that ribonucleoside comprising a 2′-modified (e.g., a 2′-O-(2-methoxyethyl) (2′MOE) modified) ribose, and “k” indicates a bicyclic sugar (e.g., locked nucleoside (LNAs), or cET). In the ASO Linkages column, “s” indicates a phosphorothiate linkage and “o” indicates a phosphodiester linkage. In the “ASO Cytosines” column, “None” indicates that all cytosines are unmodified, while “Modified” indicates that all cytosines are 5-Methyl-2′-deoxycytosine (5-Methyl-dC). To create ASO specific negative controls, select ASOs (SEQ ID NOs: 3512-3525) were synthesized using either engineered mismatches (MM) at positions 5, 9, 13, 17 or a scrambled (SC) strategy whereby the original sequences were reordered in blocks of 5. These negative controls are organized by the original binding position on the NM_020822.2.

    TABLE-US-00005 TABLE 5 Gap design, linkage chemistry and cytosine modification of sequences. Mis- matches SEQ to ID Sequence Posi- NM_020 ASO Gap ASO ASO NO: (5′ to 3′) tion 822.2 Design Linkages Cytosines 1 TGATGAAGAACAGCTTGAGC 374 0 eeeee-d10- ssssssssssssss None eeeee sssss 4 GTTGCCTTTGTAGCTGAGGT 661 0 eeeee-d10- ssssssssssssss None eeeee sssss 5 GGGATGAACAGGTTCCGCAG 765 0 eeeee-d10- ssssssssssssss None eeeee sssss 6 AGGATGGCACGGTGGAAGTC 837 0 eeeee-d10- ssssssssssssss None eeeee sssss 7 GCAGAAGTAGAAGGAGGTCA 979 0 eeeee-d10- ssssssssssssss None eeeee sssssss 8 TAGATGACCCGCTGGGACCA 1347 0 eeeee-d10- ssssssssssssss None eeeee sssss 9 GTCCATCTTGGCTCGCATGA 1399 0 eeeee-d10- ssssssssssssss None eeeee sssss 10 GCCGGGCAGATGCAGTTCAG 1629 0 eeeee-d10- ssssssssssssss None eeeee sssss 12 GAGCCAGAGAGTAGCTGTCC 2879 0 eeeee-d10- ssssssssssssss None eeeee sssss 13 TCACGAAGGACTGGTAGAGC 3008 0 eeeee-d10- ssssssssssssss None eeeee sssss 14 TGATGGTGATCATGTAGTCC 3029 0 eeeee-d10- ssssssssssssss None eeeee sssss 15 ATGGGGATCTCGGCGCTGGA 3168 0 eeeee-d10- ssssssssssssss None eeeee sssss 17 TGTCACCCATGCGGATGTGG 1760 0 eeeee-d10- ssssssssssssss None eeeee sssss 25 TGACCACGTAATAGTCCTGG 1271 0 eeeee-d10- ssssssssssssss None eeeee sssss 26 ACCTCGTTCCTGCTGCTGAG 1440 0 eeeee-d10- ssssssssssssss None eeeee sssss 28 ATGCGGATGTGGTACACCTC 1752 0 eeeee-d10- ssssssssssssss None eeeee sssss 29 GAAGCTCTTGCCCTCGTACT 1795 0 eeeee-d10- ssssssssssssss None eeeee sssss 35 TTGGCGCGGAACTGCATGAA 2859 0 eeeee-d10- ssssssssssssss None eeeee sssss 38 GGTCTTGGCGTCCGCCATGT 2758 0 eeeee-d10- ssssssssssssss None eeeee sssss 50 CGGATGAGATAGACAATGTC 3654 0 eeeee-d10- ssssssssssssss None eeeee sssss 62 CGCGGAAGAACTTGCTGTCA 1775 0 eeeee-d10- ssssssssssssss None eeeee sssss 77 TGGCGTACTTGCACTCCTCC 1601 0 eeeee-d10- ssssssssssssss None eeeee sssss 80 GTGCGGTCCACCTCGTTCCT 1449 0 eeeee-d10- ssssssssssssss None eeeee sssss 584 ATTATGGCCACGATGACCTG 612 0 eeeee-d10- ssssssssssssss None eeeee sssss 587 CTTATTATGGCCACGATGAC 615 0 eeeee-d10- ssssssssssssss None eeeee sssss 588 GCTTATTATGGCCACGATGA 616 0 eeeee-d10- ssssssssssssss None eeeee sssss 625 TTTGTAGCTGAGGTAGATGA 655 0 eeeee-d10- ssssssssssssss None eeeee sssss 626 CTTTGTAGCTGAGGTAGATG 656 0 eeeee-d10- ssssssssssssss None eeeee sssss 627 CCTTTGTAGCTGAGGTAGAT 657 0 eeeee-d10- ssssssssssssss None eeeee sssss 628 GCCTTTGTAGCTGAGGTAGA 658 0 eeeee-d10- ssssssssssssss None eeeee sssss 629 TGCCTTTGTAGCTGAGGTAG 659 0 eeeee-d10- ssssssssssssss None eeeee sssss 630 TTGCCTTTGTAGCTGAGGTA 660 0 eeeee-d10- ssssssssssssss None eeeee sssss 631 TGTTGCCTTTGTAGCTGAGG 662 0 eeeee-d10- ssssssssssssss None eeeee sssss 632 ATGTTGCCTTTGTAGCTGAG 663 0 eeeee-d10- ssssssssssssss None eeeee sssss 633 GATGTTGCCTTTGTAGCTGA 664 0 eeeee-d10- ssssssssssssss None eeeee sssss 634 AGATGTTGCCTTTGTAGCTG 665 0 eeeee-d10- ssssssssssssss None eeeee sssss 635 CAGATGTTGCCTTTGTAGCT 666 0 eeeee-d10- ssssssssssssss None eeeee sssss 636 CCAGATGTTGCCTTTGTAGC 667 0 eeeee-d10- ssssssssssssss None eeeee sssss 637 CCCAGATGTTGCCTTTGTAG 668 0 eeeee-d10- ssssssssssssss None eeeee sssss 638 TCCCAGATGTTGCCTTTGTA 669 0 eeeee-d10- ssssssssssssss None eeeee sssss 639 CTCCCAGATGTTGCCTTTGT 670 0 eeeee-d10- ssssssssssssss None eeeee sssss 640 GCTCCCAGATGTTGCCTTTG 671 0 eeeee-d10- ssssssssssssss None eeeee sssss 641 TGCTCCCAGATGTTGCCTTT 672 0 eeeee-d10- ssssssssssssss None eeeee sssss 642 CTGCTCCCAGATGTTGCCTT 673 0 eeeee-d10- ssssssssssssss None eeeee sssss 643 TCTGCTCCCAGATGTTGCCT 674 0 eeeee-d10- ssssssssssssss None eeeee sssss 644 ATCTGCTCCCAGATGTTGCC 675 0 eeeee-d10- ssssssssssssss None eeeee sssss 645 GATCTGCTCCCAGATGTTGC 676 0 eeeee-d10- ssssssssssssss None eeeee sssss 646 AGATCTGCTCCCAGATGTTG 677 0 eeeee-d10- ssssssssssssss None eeeee sssss 647 AAGATCTGCTCCCAGATGTT 678 0 eeeee-d10- ssssssssssssss None eeeee sssss 648 GAAGATCTGCTCCCAGATGT 679 0 eeeee-d10- ssssssssssssss None eeeee sssss 649 GGAAGATCTGCTCCCAGATG 680 0 eeeee-d10- ssssssssssssss None eeeee sssss 672 TCATCTCCAGGACGAAGGAC 704 0 eeeee-d10- ssssssssssssss None eeeee sssss 675 TGATCATCTCCAGGACGAAG 707 0 eeeee-d10- ssssssssssssss None eeeee sssss 751 TTCCAGCGCGTGCTTGGCCA 805 0 eeeee-d10- ssssssssssssss None eeeee sssssss 753 TTTTCCAGCGCGTGCTTGGC 807 0 eeeee-d10- ssssssssssssss None eeeee sssssss 756 ATGTTTTCCAGCGCGTGCTT 810 0 eeeee-d10- ssssssssssssss None eeeee sssssss 758 TCATGTTTTCCAGCGCGTGC 812 0 eeeee-d10- ssssssssssssss None eeeee sssssss 759 ATCATGTTTTCCAGCGCGTG 813 0 eeeee-d10- ssssssssssssss None eeeee sssssss 988 CTGCAGTGGGAGCACCACGA 1090 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1017 CTCCATCCAGAGGTAGACGA 1120 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1018 GCTCCATCCAGAGGTAGACG 1121 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1019 CGCTCCATCCAGAGGTAGAC 1122 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1021 GCCGCTCCATCCAGAGGTAG 1124 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1028 GACTTCTGCCGCTCCATCCA 1131 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1045 GGCTGTAGTTGCCCCCTGAC 1148 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1046 CGGCTGTAGTTGCCCCCTGA 1149 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1047 GCGGCTGTAGTTGCCCCCTG 1150 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1071 ACGTGCTTCTCCGTCTGCGC 1176 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1100 TCGATCTTGAGGGAGCTGAC 1206 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1130 CGTAGAACTCGTTCAGGAAG 1238 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1131 GCGTAGAACTCGTTCAGGAA 1239 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1132 GGCGTAGAACTCGTTCAGGA 1240 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1133 GGGCGTAGAACTCGTTCAGG 1241 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1134 TGGGCGTAGAACTCGTTCAG 1242 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1145 ATGACCACGTAATAGTCCTG 1272 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1146 GATGACCACGTAATAGTCCT 1273 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1154 GGGCACAGGATGACCACGTA 1281 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1195 CCCGCTGGGACCACAGAGGG 1340 0 eeeee-d10- ssssssssssssss None eeeee sssss 1196 ACCCGCTGGGACCACAGAGG 1341 0 eeeee-d10- ssssssssssssss None eeeee sssss 1197 GACCCGCTGGGACCACAGAG 1342 0 eeeee-d10- ssssssssssssss None eeeee sssss 1198 TGACCCGCTGGGACCACAGA 1343 0 eeeee-d10- ssssssssssssss None eeeee sssss 1199 ATGACCCGCTGGGACCACAG 1344 0 eeeee-d10- ssssssssssssss None eeeee sssss 1200 GATGACCCGCTGGGACCACA 1345 0 eeeee-d10- ssssssssssssss None eeeee sssss 1201 AGATGACCCGCTGGGACCAC 1346 0 eeeee-d10- ssssssssssssss None eeeee sssss 1202 GTAGATGACCCGCTGGGACC 1348 0 eeeee-d10- ssssssssssssss None eeeee sssss 1203 GGTAGATGACCCGCTGGGAC 1349 0 eeeee-d10- ssssssssssssss None eeeee sssss 1204 AGGTAGATGACCCGCTGGGA 1350 0 eeeee-d10- ssssssssssssss None eeeee sssss 1205 GAGGTAGATGACCCGCTGGG 1351 0 eeeee-d10- ssssssssssssss None eeeee sssss 1206 GGAGGTAGATGACCCGCTGG 1352 0 eeeee-d10- ssssssssssssss None eeeee sssss 1207 TGGAGGTAGATGACCCGCTG 1353 0 eeeee-d10- ssssssssssssss None eeeee sssss 1208 CTGGAGGTAGATGACCCGCT 1354 0 eeeee-d10- ssssssssssssss None eeeee sssss 1209 CCTGGAGGTAGATGACCCGC 1355 0 eeeee-d10- ssssssssssssss None eeeee sssss 1210 CCCTGGAGGTAGATGACCCG 1356 0 eeeee-d10- ssssssssssssss None eeeee sssss 1211 GCCCTGGAGGTAGATGACCC 1357 0 eeeee-d10- ssssssssssssss None eeeee sssss 1212 AGCCCTGGAGGTAGATGACC 1358 0 eeeee-d10- ssssssssssssss None eeeee sssss 1213 GAGCCCTGGAGGTAGATGAC 1359 0 eeeee-d10- ssssssssssssss None eeeee sssss 1214 AGAGCCCTGGAGGTAGATGA 1360 0 eeeee-d10- ssssssssssssss None eeeee sssss 1215 CAGAGCCCTGGAGGTAGATG 1361 0 eeeee-d10- ssssssssssssss None eeeee sssss 1216 GCAGAGCCCTGGAGGTAGAT 1362 0 eeeee-d10- ssssssssssssss None eeeee sssss 1217 TGCAGAGCCCTGGAGGTAGA 1363 0 eeeee-d10- ssssssssssssss None eeeee sssss 1218 GTGCAGAGCCCTGGAGGTAG 1364 0 eeeee-d10- ssssssssssssss None eeeee sssss 1219 AGTGCAGAGCCCTGGAGGTA 1365 0 eeeee-d10- ssssssssssssss None eeeee sssss 1220 GAGTGCAGAGCCCTGGAGGT 1366 0 eeeee-d10- ssssssssssssss None eeeee sssss 1221 TGAGTGCAGAGCCCTGGAGG 1367 0 eeeee-d10- ssssssssssssss None eeeee sssss 1222 TTGAGTGCAGAGCCCTGGAG 1368 0 eeeee-d10- ssssssssssssss None eeeee sssss 1223 TTTGAGTGCAGAGCCCTGGA 1369 0 eeeee-d10- ssssssssssssss None eeeee sssss 1224 CTTTGAGTGCAGAGCCCTGG 1370 0 eeeee-d10- ssssssssssssss None eeeee sssss 1243 GCTCGCATGAGGTCCTGGTC 1389 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1253 TGTCCATCTTGGCTCGCATG 1400 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1255 ATTGTCCATCTTGGCTCGCA 1402 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1302 CCGTGCGGTCCACCTCGTTC 1451 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1303 GCCGTGCGGTCCACCTCGTT 1452 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1304 AGCCGTGCGGTCCACCTCGT 1453 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1335 GCGAAGTCCTTCACGGCCCA 1500 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1337 GGGCGAAGTCCTTCACGGCC 1502 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1338 GAGGATCTGGACGTAGAGGG 1531 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1339 TTGAGGATCTGGACGTAGAG 1533 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1364 AACTTGACGTGAAACTTGTT 1560 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1368 AGCAAACTTGACGTGAAACT 1564 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1388 CGTACTTGCACTCCTCCTCA 1598 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1392 CATGGCGTACTTGCACTCCT 1603 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1402 TCAGCGCCAGCATGGCGTAC 1613 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1416 CGGGCAGATGCAGTTCAGCG 1627 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1473 CCATACATGCGCTGCCACTG 1716 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1496 TACACCTCGTTGCCGGAGCA 1740 0 eeeee-d10- ssssssssssssss None eeeee sssss 1497 GTACACCTCGTTGCCGGAGC 1741 0 eeeee-d10- ssssssssssssss None eeeee sssss 1498 GGTACACCTCGTTGCCGGAG 1742 0 eeeee-d10- ssssssssssssss None eeeee sssss 1499 TGGTACACCTCGTTGCCGGA 1743 0 eeeee-d10- ssssssssssssss None eeeee sssss 1500 GTGGTACACCTCGTTGCCGG 1744 0 eeeee-d10- ssssssssssssss None eeeee sssss 1501 TGTGGTACACCTCGTTGCCG 1745 0 eeeee-d10- ssssssssssssss None eeeee sssss 1502 ATGTGGTACACCTCGTTGCC 1746 0 eeeee-d10- ssssssssssssss None eeeee sssss 1503 GATGTGGTACACCTCGTTGC 1747 0 eeeee-d10- ssssssssssssss None eeeee sssss 1504 GGATGTGGTACACCTCGTTG 1748 0 eeeee-d10- ssssssssssssss None eeeee sssss 1505 CGGATGTGGTACACCTCGTT 1749 0 eeeee-d10- ssssssssssssss None eeeee sssss 1506 GCGGATGTGGTACACCTCGT 1750 0 eeeee-d10- ssssssssssssss None eeeee sssss 1507 TGCGGATGTGGTACACCTCG 1751 0 eeeee-d10- ssssssssssssss None eeeee sssss 1508 CATGCGGATGTGGTACACCT 1753 0 eeeee-d10- ssssssssssssss None eeeee sssss 1509 CCATGCGGATGTGGTACACC 1754 0 eeeee-d10- ssssssssssssss None eeeee sssss 1510 CCCATGCGGATGTGGTACAC 1755 0 eeeee-d10- ssssssssssssss None eeeee sssss 1511 ACCCATGCGGATGTGGTACA 1756 0 eeeee-d10- ssssssssssssss None eeeee sssss 1512 CACCCATGCGGATGTGGTAC 1757 0 eeeee-d10- ssssssssssssss None eeeee sssss 1513 TCACCCATGCGGATGTGGTA 1758 0 eeeee-d10- ssssssssssssss None eeeee sssss 1514 GTCACCCATGCGGATGTGGT 1759 0 eeeee-d10- ssssssssssssss None eeeee sssss 1515 CTGTCACCCATGCGGATGTG 1761 0 eeeee-d10- ssssssssssssss None eeeee sssss 1516 GCTGTCACCCATGCGGATGT 1762 0 eeeee-d10- ssssssssssssss None eeeee sssss 1517 TGCTGTCACCCATGCGGATG 1763 0 eeeee-d10- ssssssssssssss None eeeee sssss 1518 TTGCTGTCACCCATGCGGAT 1764 0 eeeee-d10- ssssssssssssss None eeeee sssss 1519 CTTGCTGTCACCCATGCGGA 1765 0 eeeee-d10- ssssssssssssss None eeeee sssss 1520 ACTTGCTGTCACCCATGCGG 1766 0 eeeee-d10- ssssssssssssss None eeeee sssss 1521 AACTTGCTGTCACCCATGCG 1767 0 eeeee-d10- ssssssssssssss None eeeee sssss 1522 GAACTTGCTGTCACCCATGC 1768 0 eeeee-d10- ssssssssssssss None eeeee sssss 1523 AGAACTTGCTGTCACCCATG 1769 0 eeeee-d10- ssssssssssssss None eeeee sssss 1524 AAGAACTTGCTGTCACCCAT 1770 0 eeeee-d10- ssssssssssssss None eeeee sssss 1525 GAAGAACTTGCTGTCACCCA 1771 0 eeeee-d10- ssssssssssssss None eeeee sssss 1526 GGAAGAACTTGCTGTCACCC 1772 0 eeeee-d10- ssssssssssssss None eeeee sssss 1527 CGGAAGAACTTGCTGTCACC 1773 0 eeeee-d10- ssssssssssssss None eeeee sssss 1528 GCGGAAGAACTTGCTGTCAC 1774 0 eeeee-d10- ssssssssssssss None eeeee sssss 1529 TCGCGGAAGAACTTGCTGTC 1776 0 eeeee-d10- ssssssssssssss None eeeee sssss 1530 CTCGCGGAAGAACTTGCTGT 1777 0 eeeee-d10- ssssssssssssss None eeeee sssss 1531 ACTCGCGGAAGAACTTGCTG 1778 0 eeeee-d10- ssssssssssssss None eeeee sssss 1532 TACTCGCGGAAGAACTTGCT 1779 0 eeeee-d10- ssssssssssssss None eeeee sssss 1533 GTACTCGCGGAAGAACTTGC 1780 0 eeeee-d10- ssssssssssssss None eeeee sssss 1534 CGTACTCGCGGAAGAACTTG 1781 0 eeeee-d10- ssssssssssssss None eeeee sssss 1535 TCGTACTCGCGGAAGAACTT 1782 0 eeeee-d10- ssssssssssssss None eeeee sssss 1536 CTCGTACTCGCGGAAGAACT 1783 0 eeeee-d10- ssssssssssssss None eeeee sssss 1537 CCTCGTACTCGCGGAAGAAC 1784 0 eeeee-d10- ssssssssssssss None eeeee sssss 1538 CCCTCGTACTCGCGGAAGAA 1785 0 eeeee-d10- ssssssssssssss None eeeee sssss 1539 GCCCTCGTACTCGCGGAAGA 1786 0 eeeee-d10- ssssssssssssss None eeeee sssss 1540 TGCCCTCGTACTCGCGGAAG 1787 0 eeeee-d10- ssssssssssssss None eeeee sssss 1541 TTGCCCTCGTACTCGCGGAA 1788 0 eeeee-d10- ssssssssssssss None eeeee sssss 1542 CTTGCCCTCGTACTCGCGGA 1789 0 eeeee-d10- ssssssssssssss None eeeee sssss 1543 TCTTGCCCTCGTACTCGCGG 1790 0 eeeee-d10- ssssssssssssss None eeeee sssss 1544 CTCTTGCCCTCGTACTCGCG 1791 0 eeeee-d10- ssssssssssssss None eeeee sssss 1545 GCTCTTGCCCTCGTACTCGC 1792 0 eeeee-d10- ssssssssssssss None eeeee sssss 1546 AGCTCTTGCCCTCGTACTCG 1793 0 eeeee-d10- ssssssssssssss None eeeee sssss 1547 AAGCTCTTGCCCTCGTACTC 1794 0 eeeee-d10- ssssssssssssss None eeeee sssss 1548 TGAAGCTCTTGCCCTCGTAC 1796 0 eeeee-d10- ssssssssssssss None eeeee sssss 1549 GTGAAGCTCTTGCCCTCGTA 1797 0 eeeee-d10- ssssssssssssss None eeeee sssss 1550 GGTGAAGCTCTTGCCCTCGT 1798 0 eeeee-d10- ssssssssssssss None eeeee sssss 1551 AGGTGAAGCTCTTGCCCTCG 1799 0 eeeee-d10- ssssssssssssss None eeeee sssss 1552 TAGGTGAAGCTCTTGCCCTC 1800 0 eeeee-d10- ssssssssssssss None eeeee sssss 1553 GTAGGTGAAGCTCTTGCCCT 1801 0 eeeee-d10- ssssssssssssss None eeeee sssss 1554 CGTAGGTGAAGCTCTTGCCC 1802 0 eeeee-d10- ssssssssssssss None eeeee sssss 1555 GCGTAGGTGAAGCTCTTGCC 1803 0 eeeee-d10- ssssssssssssss None eeeee sssss 1556 CGCGTAGGTGAAGCTCTTGC 1804 0 eeeee-d10- ssssssssssssss None eeeee sssss 1557 CCGCGTAGGTGAAGCTCTTG 1805 0 eeeee-d10- ssssssssssssss None eeeee sssss 1558 GCCGCGTAGGTGAAGCTCTT 1806 0 eeeee-d10- ssssssssssssss None eeeee sssss 1559 GGCCGCGTAGGTGAAGCTCT 1807 0 eeeee-d10- ssssssssssssss None eeeee sssss 1560 AGGCCGCGTAGGTGAAGCTC 1808 0 eeeee-d10- ssssssssssssss None eeeee sssss 1561 AAGGCCGCGTAGGTGAAGCT 1809 0 eeeee-d10- ssssssssssssss None eeeee sssss 1562 GAAGGCCGCGTAGGTGAAGC 1810 0 eeeee-d10- ssssssssssssss None eeeee sssss 1563 GGAAGGCCGCGTAGGTGAAG 1811 0 eeeee-d10- ssssssssssssss None eeeee sssss 1564 TGGAAGGCCGCGTAGGTGAA 1812 0 eeeee-d10- ssssssssssssss None eeeee sssss 1565 GTGGAAGGCCGCGTAGGTGA 1813 0 eeeee-d10- ssssssssssssss None eeeee sssss 1566 CGTGGAAGGCCGCGTAGGTG 1814 0 eeeee-d10- ssssssssssssss None eeeee sssss 1567 GCGTGGAAGGCCGCGTAGGT 1815 0 eeeee-d10- ssssssssssssss None eeeee sssss 1570 TGGGCGTGGAAGGCCGCGTA 1818 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1573 TTGTGGGCGTGGAAGGCCGC 1821 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1574 CTTGTGGGCGTGGAAGGCCG 1822 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1601 TCAGCCCGATGAGGCACACG 1850 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1602 TTCAGCCCGATGAGGCACAC 1851 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1968 ATGTAGGGCGAGTTGGGAGG 2334 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1973 TGCCGATGTAGGGCGAGTTG 2339 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1974 CTGCCGATGTAGGGCGAGTT 2340 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1975 GCTGCCGATGTAGGGCGAGT 2341 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1976 AGCTGCCGATGTAGGGCGAG 2342 0 eeeee-d10- ssssssssssssss None eeeee sssssss 1977 GAGCTGCCGATGTAGGGCGA 2343 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2002 TTGTCCAGCCGCAGGCAGCA 2403 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2044 AACCCGTAGGCCTTGGCGTC 2448 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2046 TGAACCCGTAGGCCTTGGCG 2450 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2050 TTCTTGAACCCGTAGGCCTT 2454 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2052 TGTTCTTGAACCCGTAGGCC 2456 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2053 CTTGTTCTTGAACCCGTAGG 2458 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2054 GCTTGTTCTTGAACCCGTAG 2459 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2055 AGCTTGTTCTTGAACCCGTA 2460 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2236 AGGTTGTCCGCATAGATGAT 2694 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2294 GGCGTCCGCCATGTAGTCCT 2752 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2303 CGATGGTCTTGGCGTCCGCC 2762 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2304 ACGATGGTCTTGGCGTCCGC 2763 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2305 GACGATGGTCTTGGCGTCCG 2764 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2307 TTGACGATGGTCTTGGCGTC 2766 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2310 ACGTTGACGATGGTCTTGGC 2769 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2311 CACGTTGACGATGGTCTTGG 2770 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2319 CATGGTCTGCACGTTGACGA 2779 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2320 ACATGGTCTGCACGTTGACG 2780 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2324 CGGAACATGGTCTGCACGTT 2784 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2327 AGCCGGAACATGGTCTGCAC 2787 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2329 AGAGCCGGAACATGGTCTGC 2789 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2346 TGGGTGAGCTCCGTGGTGAT 2823 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2367 CATGAAGCGCATGTTGGAAG 2845 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2375 CGGAACTGCATGAAGCGCAT 2853 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2377 CGCGGAACTGCATGAAGCGC 2855 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2378 GCGCGGAACTGCATGAAGCG 2856 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2379 GGCGCGGAACTGCATGAAGC 2857 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2382 CCTTGGCGCGGAACTGCATG 2861 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2383 TCCTTGGCGCGGAACTGCAT 2862 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2384 GTCCTTGGCGCGGAACTGCA 2863 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2392 GAGTAGCTGTCCTTGGCGCG 2871 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2393 AGAGTAGCTGTCCTTGGCGC 2872 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2394 GAGAGTAGCTGTCCTTGGCG 2873 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2505 CACGAAGGACTGGTAGAGCA 3007 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2525 GATGGTGATCATGTAGTCCT 3028 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2529 CGGGTGATGGTGATCATGTA 3033 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2530 CCGGGTGATGGTGATCATGT 3034 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2533 CAGCCGGGTGATGGTGATCA 3037 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2534 GCAGCCGGGTGATGGTGATC 3038 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2591 TCCACAGGTCGCCCTCGGTG 3110 0 eeeee-d10- ssssssssssssss None eeeee sssss 2592 ATCCACAGGTCGCCCTCGGT 3111 0 eeeee-d10- ssssssssssssss None eeeee sssss 2593 GATCCACAGGTCGCCCTCGG 3112 0 eeeee-d10- ssssssssssssss None eeeee sssss 2594 GGATCCACAGGTCGCCCTCG 3113 0 eeeee-d10- ssssssssssssss None eeeee sssss 2595 CGGATCCACAGGTCGCCCTC 3114 0 eeeee-d10- ssssssssssssss None eeeee sssss 2596 GCGGATCCACAGGTCGCCCT 3115 0 eeeee-d10- ssssssssssssss None eeeee sssss 2597 TGCGGATCCACAGGTCGCCC 3116 0 eeeee-d10- ssssssssssssss None eeeee sssss 2598 GTGCGGATCCACAGGTCGCC 3117 0 eeeee-d10- ssssssssssssss None eeeee sssss 2599 CGTGCGGATCCACAGGTCGC 3118 0 eeeee-d10- ssssssssssssss None eeeee sssss 2600 ACGTGCGGATCCACAGGTCG 3119 0 eeeee-d10- ssssssssssssss None eeeee sssss 2601 TACGTGCGGATCCACAGGTC 3120 0 eeeee-d10- ssssssssssssss None eeeee sssss 2602 GTACGTGCGGATCCACAGGT 3121 0 eeeee-d10- ssssssssssssss None eeeee sssss 2603 CGTACGTGCGGATCCACAGG 3122 0 eeeee-d10- ssssssssssssss None eeeee sssss 2604 CCGTACGTGCGGATCCACAG 3123 0 eeeee-d10- ssssssssssssss None eeeee sssss 2605 GCCGTACGTGCGGATCCACA 3124 0 eeeee-d10- ssssssssssssss None eeeee sssss 2606 GGCCGTACGTGCGGATCCAC 3125 0 eeeee-d10- ssssssssssssss None eeeee sssss 2607 AGCTTCTGGAAGAGGCGGCC 3141 0 eeeee-d10- ssssssssssssss None eeeee sssss 2608 GAGCTTCTGGAAGAGGCGGC 3142 0 eeeee-d10- ssssssssssssss None eeeee sssss 2609 AGAGCTTCTGGAAGAGGCGG 3143 0 eeeee-d10- ssssssssssssss None eeeee sssss 2610 CAGAGCTTCTGGAAGAGGCG 3144 0 eeeee-d10- ssssssssssssss None eeeee sssss 2611 GCAGAGCTTCTGGAAGAGGC 3145 0 eeeee-d10- ssssssssssssss None eeeee sssss 2612 AGCAGAGCTTCTGGAAGAGG 3146 0 eeeee-d10- ssssssssssssss None eeeee sssss 2613 GAGCAGAGCTTCTGGAAGAG 3147 0 eeeee-d10- ssssssssssssss None eeeee sssss 2614 GGAGCAGAGCTTCTGGAAGA 3148 0 eeeee-d10- ssssssssssssss None eeeee sssss 2615 AGGAGCAGAGCTTCTGGAAG 3149 0 eeeee-d10- ssssssssssssss None eeeee sssss 2616 GAGGAGCAGAGCTTCTGGAA 3150 0 eeeee-d10- ssssssssssssss None eeeee sssss 2617 GGAGGAGCAGAGCTTCTGGA 3151 0 eeeee-d10- ssssssssssssss None eeeee sssss 2618 TGGAGGAGCAGAGCTTCTGG 3152 0 eeeee-d10- ssssssssssssss None eeeee sssss 2619 CTGGAGGAGCAGAGCTTCTG 3153 0 eeeee-d10- ssssssssssssss None eeeee sssss 2620 GCTGGAGGAGCAGAGCTTCT 3154 0 eeeee-d10- ssssssssssssss None eeeee sssss 2621 CGCTGGAGGAGCAGAGCTTC 3155 0 eeeee-d10- ssssssssssssss None eeeee sssss 2622 GCGCTGGAGGAGCAGAGCTT 3156 0 eeeee-d10- ssssssssssssss None eeeee sssss 2623 GGCGCTGGAGGAGCAGAGCT 3157 0 eeeee-d10- ssssssssssssss None eeeee sssss 2624 CGGCGCTGGAGGAGCAGAGC 3158 0 eeeee-d10- ssssssssssssss None eeeee sssss 2625 TCGGCGCTGGAGGAGCAGAG 3159 0 eeeee-d10- ssssssssssssss None eeeee sssss 2626 CTCGGCGCTGGAGGAGCAGA 3160 0 eeeee-d10- ssssssssssssss None eeeee sssss 2627 TCTCGGCGCTGGAGGAGCAG 3161 0 eeeee-d10- ssssssssssssss None eeeee sssss 2628 ATCTCGGCGCTGGAGGAGCA 3162 0 eeeee-d10- ssssssssssssss None eeeee sssss 2629 GATCTCGGCGCTGGAGGAGC 3163 0 eeeee-d10- ssssssssssssss None eeeee sssss 2630 GGATCTCGGCGCTGGAGGAG 3164 0 eeeee-d10- ssssssssssssss None eeeee sssss 2631 GGGATCTCGGCGCTGGAGGA 3165 0 eeeee-d10- ssssssssssssss None eeeee sssss 2679 GTTCACCGAGATCTGGGACT 3250 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2680 CGTTCACCGAGATCTGGGAC 3251 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2681 ACGTTCACCGAGATCTGGGA 3252 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2784 GAGCGCCGGTACAGGCTGAG 3486 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2813 CGGTTCTTCACCAGCTCGGA 3522 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2901 TCGGGCGGAGGGTTGATGAG 3615 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2902 GTCGGGCGGAGGGTTGATGA 3616 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2903 TGTCGGGCGGAGGGTTGATG 3617 0 eeeee-d10- ssssssssssssss None eeeee sssssss 2947 GGGTCGGAGCGGATGAGATA 3663 0 eeeee-d10- ssssssssssssss None eeeee sssssss 3385 CGGGGGTGGGCGTAGAACTC 1248 0 eeeee-d10- ssssssssssssss None eeeee sssssss 3386 CCGGGGGTGGGCGTAGAACT 1249 0 eeeee-d10- ssssssssssssss None eeeee sssssss 3387 GGGGCGAAGTCCTTCACGGC 1503 0 eeeee-d10- ssssssssssssss None eeeee sssssss 3388 GGGGGCGAAGTCCTTCACGG 1504 0 eeeee-d10- ssssssssssssss None eeeee sssssss 3389 TGGGGGCGAAGTCCTTCACG 1505 0 eeeee-d10- ssssssssssssss None eeeee sssssss 3390 TTGGGGGCGAAGTCCTTCAC 1506 0 eeeee-d10- ssssssssssssss None eeeee sssssss 3391 GGCAGTTGGGGGCGAAGTCC 1511 0 eeeee-d10- ssssssssssssss None eeeee sssssss 3392 GGGCAGTTGGGGGCGAAGTC 1512 0 eeeee-d10- ssssssssssssss None eeeee sssssss 3393 AGGATCTGGACGTAGAGGGG 1530 0 eeeee-d10- ssssssssssssss None eeeee sssssss 3394 GTAGTAGACCATGGGGAAGC 2629 0 eeeee-d10- ssssssssssssss None eeeee sssssss 3395 CGGCCGTACGTGCGGATCCA 3126 0 eeeee-d10- ssssssssssssss None eeeee sssss 3396 GCGGCCGTACGTGCGGATCC 3127 0 eeeee-d10- ssssssssssssss None eeeee sssss 3397 GGCGGCCGTACGTGCGGATC 3128 0 eeeee-d10- ssssssssssssss None eeeee sssss 3398 AGGCGGCCGTACGTGCGGAT 3129 0 eeeee-d10- ssssssssssssss None eeeee sssss 3399 GAGGCGGCCGTACGTGCGGA 3130 0 eeeee-d10- ssssssssssssss None eeeee sssss 3400 AGAGGCGGCCGTACGTGCGG 3131 0 eeeee-d10- ssssssssssssss None eeeee sssss 3401 AAGAGGCGGCCGTACGTGCG 3132 0 eeeee-d10- ssssssssssssss None eeeee sssss 3402 CCAATGGGGATCTCGGCGCT 3171 0 eeeee-d10- ssssssssssssss None eeeee sssss 3403 GCCAATGGGGATCTCGGCGC 3172 0 eeeee-d10- ssssssssssssss None eeeee sssssss 3404 TGCCAATGGGGATCTCGGCG 3173 0 eeeee-d10- ssssssssssssss None eeeee sssssss 3405 ATGCCAATGGGGATCTCGGC 3174 0 eeeee-d10- ssssssssssssss None eeeee sssssss 3406 GATGCCAATGGGGATCTCGG 3175 0 eeeee-d10- ssssssssssssss None eeeee sssssss 3407 TCCGGTAGATGCCAATGGGG 3182 0 eeeee-d10- ssssssssssssss None eeeee sssssss 3408 GGGGTCGGAGCGGATGAGAT 3664 0 eeeee-d10- ssssssssssssss None eeeee sssssss 3409 GGGGGTCGGAGCGGATGAGA 3665 0 eeeee-d10- ssssssssssssss None eeeee sssssss 3410 TGATGAAGAACAGCTTGAGC 374 0 d20 ssssssssssssss None sssss 3411 GTTGCCTTTGTAGCTGAGGT 661 0 d20 ssssssssssssss None sssss 3412 GGGATGAACAGGTTCCGCAG 765 0 d20 ssssssssssssss None sssss 3413 AGGATGGCACGGTGGAAGTC 837 0 d20 ssssssssssssss None sssss 3414 GCAGAAGTAGAAGGAGGTCA 979 0 d20 ssssssssssssss None sssss 3415 TAGATGACCCGCTGGGACCA 1347 0 d20 ssssssssssssss None sssss 3416 GCCGGGCAGATGCAGTTCAG 1629 0 d20 ssssssssssssss None sssss 3417 GAGCCAGAGAGTAGCTGTCC 2879 0 d20 ssssssssssssss None sssss 3418 TCACGAAGGACTGGTAGAGC 3008 0 d20 ssssssssssssss None sssss 3419 ATGGGGATCTCGGCGCTGGA 3168 0 d20 ssssssssssssss None sssss 3420 GTTGCCTTTGTAGCTGAGGT 661 0 eeeee-d10- ssssssssssssss Modified eeeee sssss 3421 CAGATGTTGCCTTTGTAGCT 666 0 eeeee-d10- ssssssssssssss Modified eeeee sssss 3422 TAGATGACCCGCTGGGACCA 1347 0 eeeee-d10- ssssssssssssss Modified eeeee sssss 3423 GGTAGATGACCCGCTGGGAC 1349 0 eeeee-d10- ssssssssssssss Modified eeeee sssss 3424 GGAGGTAGATGACCCGCTGG 1352 0 eeeee-d10- ssssssssssssss Modified eeeee sssss 3425 CTGGAGGTAGATGACCCGCT 1354 0 eeeee-d10- ssssssssssssss Modified eeeee sssss 3426 ATGTGGTACACCTCGTTGCC 1746 0 eeeee-d10- ssssssssssssss Modified eeeee sssss 3427 TGCGGATGTGGTACACCTCG 1751 0 eeeee-d10- ssssssssssssss Modified eeeee sssss 3428 CCCATGCGGATGTGGTACAC 1755 0 eeeee-d10- ssssssssssssss Modified eeeee sssss 3429 AGCTCTTGCCCTCGTACTCG 1793 0 eeeee-d10- ssssssssssssss Modified eeeee sssss 3430 AGGTGAAGCTCTTGCCCTCG 1799 0 eeeee-d10- ssssssssssssss Modified eeeee sssss 3431 GCGTAGGTGAAGCTCTTGCC 1803 0 eeeee-d10- ssssssssssssss Modified eeeee sssss 3432 GGCCGCGTAGGTGAAGCTCT 1807 0 eeeee-d10- ssssssssssssss Modified eeeee sssss 3433 AAGGCCGCGTAGGTGAAGCT 1809 0 eeeee-d10- ssssssssssssss Modified eeeee sssss 3434 GATCCACAGGTCGCCCTCGG 3112 0 eeeee-d10- ssssssssssssss Modified eeeee sssss 3435 CGGATCCACAGGTCGCCCTC 3114 0 eeeee-d10- ssssssssssssss Modified eeeee sssss 3436 GGCCGTACGTGCGGATCCAC 3125 0 eeeee-d10- ssssssssssssss Modified eeeee sssss 3437 GCGGCCGTACGTGCGGATCC 3127 0 eeeee-d10- ssssssssssssss Modified eeeee sssss 3438 ATCTCGGCGCTGGAGGAGCA 3162 0 eeeee-d10- ssssssssssssss Modified eeeee sssss 3439 CCAATGGGGATCTCGGCGCT 3171 0 eeeee-d10- ssssssssssssss Modified eeeee sssss 3440 GAAGAGGCGGCCGTACGTGC 3133 0 eeeee-d10- ssssssssssssss None eeeee sssss 3441 GGAAGAGGCGGCCGTACGTG 3134 0 eeeee-d10- ssssssssssssss None eeeee sssss 3442 TGGAAGAGGCGGCCGTACGT 3135 0 eeeee-d10- ssssssssssssss None eeeee sssss 3443 CTGGAAGAGGCGGCCGTACG 3136 0 eeeee-d10- ssssssssssssss None eeeee sssss 3444 TCTGGAAGAGGCGGCCGTAC 3137 0 eeeee-d10- ssssssssssssss None eeeee sssss 3445 TTCTGGAAGAGGCGGCCGTA 3138 0 eeeee-d10- ssssssssssssss None eeeee sssss 3446 CTTCTGGAAGAGGCGGCCGT 3139 0 eeeee-d10- ssssssssssssss None eeeee sssss 3447 GCTTCTGGAAGAGGCGGCCG 3140 0 eeeee-d10- ssssssssssssss None eeeee sssss 3448 GGGGATCTCGGCGCTGGAGG 3166 0 eeeee-d10- ssssssssssssss None eeeee sssss 3449 TGGGGATCTCGGCGCTGGAG 3167 0 eeeee-d10- ssssssssssssss None eeeee sssss 3450 AATGGGGATCTCGGCGCTGG 3169 0 eeeee-d10- ssssssssssssss None eeeee sssss 3451 CAATGGGGATCTCGGCGCTG 3170 0 eeeee-d10- ssssssssssssss None eeeee sssss 3452 ATGTTGCCTTTGTAGCTGAGGT 661 0 eeeee-d12- ssssssssssssss None eeeee sssssss 3453 CCCAGATGTTGCCTTTGTAGCT 666 0 eeeee-d12- ssssssssssssss None eeeee sssssss 3454 GGTAGATGACCCGCTGGGACCA 1347 0 eeeee-d12- ssssssssssssss None eeeee sssssss 3455 GAGGTAGATGACCCGCTGGGAC 1349 0 eeeee-d12- ssssssssssssss None eeeee sssssss 3456 CTGGAGGTAGATGACCCGCTGG 1352 0 eeeee-d12- ssssssssssssss None eeeee sssssss 3457 CCCTGGAGGTAGATGACCCGCT 1354 0 eeeee-d12- ssssssssssssss None eeeee sssssss 3458 GGATGTGGTACACCTCGTTGCC 1746 0 eeeee-d12- ssssssssssssss None eeeee sssssss 3459 CATGCGGATGTGGTACACCTCG 1751 0 eeeee-d12- ssssssssssssss None eeeee sssssss 3460 CACCCATGCGGATGTGGTACAC 1755 0 eeeee-d12- ssssssssssssss None eeeee sssssss 3461 GAAGCTCTTGCCCTCGTACTCG 1793 0 eeeee-d12- ssssssssssssss None eeeee sssssss 3462 GTAGGTGAAGCTCTTGCCCTCG 1799 0 eeeee-d12- ssssssssssssss None eeeee sssssss 3463 CCGCGTAGGTGAAGCTCTTGCC 1803 0 eeeee-d12- ssssssssssssss None eeeee sssssss 3464 AAGGCCGCGTAGGTGAAGCTCT 1807 0 eeeee-d12- ssssssssssssss None eeeee sssssss 3465 GGAAGGCCGCGTAGGTGAAGCT 1809 0 eeeee-d12- ssssssssssssss None eeeee sssssss 3466 CGGATCCACAGGTCGCCCTCGG 3112 0 eeeee-d12- ssssssssssssss None eeeee sssssss 3467 TGCGGATCCACAGGTCGCCCTC 3114 0 eeeee-d12- ssssssssssssss None eeeee sssssss 3468 GCGGCCGTACGTGCGGATCCAC 3125 0 eeeee-d12- ssssssssssssss None eeeee sssssss 3469 AGGCGGCCGTACGTGCGGATCC 3127 0 eeeee-d12- ssssssssssssss None eeeee sssssss 3470 GGATCTCGGCGCTGGAGGAGCA 3162 0 eeeee-d12- ssssssssssssss None eeeee sssssss 3471 TGCCAATGGGGATCTCGGCGCT 3171 0 eeeee-d12- ssssssssssssss None eeeee sssssss 3472 GTTGCCTTTGTAGCTGAG 661 0 eeeee-d8- sooosssssssss None eeeee ooss 3473 CAGATGTTGCCTTTGTAG 666 0 eeeee-d8- sooosssssssss None eeeee ooss 3474 TAGATGACCCGCTGGGAC 1347 0 eeeee-d8- sooosssssssss None eeeee ooss 3475 GGTAGATGACCCGCTGGG 1349 0 eeeee-d8- sooosssssssss None eeeee ooss 3476 GGAGGTAGATGACCCGCT 1352 0 eeeee-d8- sooosssssssss None eeeee ooss 3477 CTGGAGGTAGATGACCCG 1354 0 eeeee-d8- sooosssssssss None eeeee ooss 3478 ATGTGGTACACCTCGTTG 1746 0 eeeee-d8- sooosssssssss None eeeee ooss 3479 TGCGGATGTGGTACACCT 1751 0 eeeee-d8- sooosssssssss None eeeee ooss 3480 CCCATGCGGATGTGGTAC 1755 0 eeeee-d8- sooosssssssss None eeeee ooss 3481 AGCTCTTGCCCTCGTACT 1793 0 eeeee-d8- sooosssssssss None eeeee ooss 3482 AGGTGAAGCTCTTGCCCT 1799 0 eeeee-d8- sooosssssssss None eeeee ooss 3483 GCGTAGGTGAAGCTCTTG 1803 0 eeeee-d8- sooosssssssss None eeeee ooss 3484 GGCCGCGTAGGTGAAGCT 1807 0 eeeee-d8- sooosssssssss None eeeee ooss 3485 AAGGCCGCGTAGGTGAAG 1809 0 eeeee-d8- sooosssssssss None eeeee ooss 3486 GATCCACAGGTCGCCCTC 3112 0 eeeee-d8- sooosssssssss None eeeee ooss 3487 CGGATCCACAGGTCGCCC 3114 0 eeeee-d8- sooosssssssss None eeeee ooss 3488 GGCCGTACGTGCGGATCC 3125 0 eeeee-d8- sooosssssssss None eeeee ooss 3489 GCGGCCGTACGTGCGGAT 3127 0 eeeee-d8- sooosssssssss None eeeee ooss 3490 ATCTCGGCGCTGGAGGAG 3162 0 eeeee-d8- sooosssssssss None eeeee ooss 3491 CCAATGGGGATCTCGGCG 3171 0 eeeee-d8- sooosssssssss None eeeee ooss 3492 GTTGCCTTTGTAGCTGA 661 0 eekk-d8- soossssssssso None kkeee oss 3493 CAGATGTTGCCTTTGTA 666 0 eekk-d8- soossssssssso None kkeee oss 3494 TAGATGACCCGCTGGGA 1347 0 eekk-d8- soossssssssso None kkeee oss 3495 GGTAGATGACCCGCTGG 1349 0 eekk-d8- soossssssssso None kkeee oss 3496 GGAGGTAGATGACCCGC 1352 0 eekk-d8- soossssssssso None kkeee oss 3497 CTGGAGGTAGATGACCC 1354 0 eekk-d8- soossssssssso None kkeee oss 3498 ATGTGGTACACCTCGTT 1746 0 eekk-d8- soossssssssso None kkeee oss 3499 TGCGGATGTGGTACACC 1751 0 eekk-d8- soossssssssso None kkeee oss 3500 CCCATGCGGATGTGGTA 1755 0 eekk-d8- soossssssssso None kkeee oss 3501 AGCTCTTGCCCTCGTAC 1793 0 eekk-d8- soossssssssso None kkeee oss 3502 AGGTGAAGCTCTTGCCC 1799 0 eekk-d8- soossssssssso None kkeee oss 3503 GCGTAGGTGAAGCTCTT 1803 0 eekk-d8- soossssssssso None kkeee oss 3504 GGCCGCGTAGGTGAAGC 1807 0 eekk-d8- soossssssssso None kkeee oss 3505 AAGGCCGCGTAGGTGAA 1809 0 eekk-d8- soossssssssso None kkeee oss 3506 GATCCACAGGTCGCCCT 3112 0 eekk-d8- soossssssssso None kkeee oss 3507 CGGATCCACAGGTCGCC 3114 0 eekk-d8- soossssssssso None kkeee oss 3508 GGCCGTACGTGCGGATC 3125 0 eekk-d8- soossssssssso None kkeee oss 3509 GCGGCCGTACGTGCGGA 3127 0 eekk-d8- soossssssssso None kkeee oss 3510 ATCTCGGCGCTGGAGGA 3162 0 eekk-d8- soossssssssso None kkeee oss 3511 CCAATGGGGATCTCGGC 3171 0 eekk-d8- soossssssssso None kkeee oss 3512 GTTGGCTTAGTACCTGTGGT 661 4 d20 ssssssssssssss None sssss 3513 CTTTGGTTGCGAGGTTAGCT 661 10 d20 ssssssssssssss None sssss 3514 GCAGGAGTGGAAAGAGATCA 979 4 d20 ssssssssssssss None sssss 3515 AGTAGGCAGAGGTCAAAGGA 979 18 d20 ssssssssssssss None sssss 3516 GTTGGCTTAGTACCTGTGGT 661 4 eeeee-d10- ssssssssssssss None eeeee sssss 3517 GGTACATGTCCCCCTGCGAC 1349 4 eeeee-d10- ssssssssssssss None eeeee sssss 3518 GGAGCTAGTTGAGCCGGTGG 1352 4 eeeee-d10- ssssssssssssss None eeeee sssss 3519 ATGTCGTAGACCACGTAGCC 1746 4 eeeee-d10- ssssssssssssss None eeeee sssss 3520 CCCAAGCGCATGAGGTTCAC 1755 4 eeeee-d10- ssssssssssssss None eeeee sssss 3521 GCGTTGGTCAAGGTCTAGCC 1803 4 eeeee-d10- ssssssssssssss None eeeee sssss 3522 GGCCCCGTTGGTCAAGGTCT 1807 4 eeeee-d10- ssssssssssssss None eeeee sssss 3523 GCGGGCGTTCGTCCGGTTCC 3127 4 eeeee-d10- ssssssssssssss None eeeee sssss 3524 ATCTGGGCCCTGCAGGTGCA 3162 4 eeeee-d10- ssssssssssssss None eeeee sssss 3525 CCAAAGGGCATCACGGGGCT 3171 4 eeeee-d10- ssssssssssssss None eeeee sssss

    [0470] Table 6 provides the oligonucelotide ASO sequences, positions in the KCNT1 transcript (NCBI NM_020822.2), chemistries used to modify the ASO, and percent knockdown of KCNT1 in BE(2)-M17 cells after treatment with the indicated ASO. Here, the data corresponding to different ASO sequences are organized according to the KCNT position, as denoted in the first column. In the ASO Gap column, “e” indicates a 2′-O-(2-methoxyethyl) (2′MOE) modified nucleoside, and “k” indicates a locked nucleoside (LNAs). In the ASO Linkages column, “s” indicates a phosphorothiate linkage and “o” indicates a phosphodiester linkage. In the “ASO Cytosines” column, “None” indicates that all cytosines are unmodified, while “Modified” indicates that all cytosines are 5-Methyl-2′-deoxycytosine (5-Methyl-dC).

    [0471] All ASO specific negative controls (SEQ ID NOs: 3512-3525) generated less KCNT1 knockdown in BE(2)-M17 cells compared to their matched targeted ASO. These data confirm the specificity of the assay and highlight the dependence of knockdown on sequence homology. There was generally good concordance between the knockdown obtained with the various chemistries. However, some ASO sequences demonstrated substantially different activity depending on the chemistry used (position 1354: SEQ ID NO: 1208 with 21% knockdown versus SEQ ID NO: 3457 with 59% knockdown). In addition, cytosine modified ASOs were consistently more potent for the majority of tested ASOs. Although activity was observed across each of the entire hotspots tested (NM_020822.2 (SEQ ID NO: 3526): 655 to 680, 1340 to 1370, 1740 to 1815, and 3110 to 3171), there were certain ASOs with greater activity which was not predicted by the sequence homology.

    TABLE-US-00006 TABLE 6 Percent Knock down of KCNT1 expressed in human (BE(2)-M17) neuronal cells. Sequences are organized according to KCNT1 position. BE(2)-M17 ASO 100 nM ASO Position SEQ ID NO ASO Gap ASO Linkages Cytosines Mean 374 1 eeeee-d10-eeeee sssssssssssssssssss None 7 3410 d20 sssssssssssssssssss None 14 655 625 eeeee-d10-eeeee sssssssssssssssssss None 11 656 626 eeeee-d10-eeeee sssssssssssssssssss None 34 657 627 eeeee-d10-eeeee sssssssssssssssssss None 37 658 628 eeeee-d10-eeeee sssssssssssssssssss None 51 659 629 eeeee-d10-eeeee sssssssssssssssssss None 44 660 630 eeeee-d10-eeeee sssssssssssssssssss None 43 661 4 eeeee-d10-eeeee sssssssssssssssssss None 44 3411 d20 sssssssssssssssssss None 39 3420 eeeee-d10-eeeee sssssssssssssssssss Modified 49 3452 eeeee-d12-eeeee sssssssssssssssssssss None 39 3472 eeeee-d8-eeeee sooosssssssssooss None 38 3492 eekk-d8-kkeee soosssssssssooss None 40 3512 d20 sssssssssssssssssss None 6 3513 d20 sssssssssssssssssss None 5 3516 eeeee-d10-eeeee sssssssssssssssssss None 11 662 631 eeeee-d10-eeeee sssssssssssssssssss None 33 663 632 eeeee-d10-eeeee sssssssssssssssssss None 5 664 633 eeeee-d10-eeeee sssssssssssssssssss None 34 665 634 eeeee-d10-eeeee sssssssssssssssssss None 37 666 635 eeeee-d10-eeeee sssssssssssssssssss None 35 666 3421 eeeee-d10-eeeee sssssssssssssssssss Modified 59 666 3453 eeeee-d12-eeeee sssssssssssssssssssss None 41 666 3473 eeeee-d8-eeeee sooosssssssssooss None 19 666 3493 eekk-d8-kkeee soosssssssssooss None 52 667 636 eeeee-d10-eeeee sssssssssssssssssss None 40 668 637 eeeee-d10-eeeee sssssssssssssssssss None 30 669 638 eeeee-d10-eeeee sssssssssssssssssss None 17 670 639 eeeee-d10-eeeee sssssssssssssssssss None 26 671 640 eeeee-d10-eeeee sssssssssssssssssss None 49 672 641 eeeee-d10-eeeee sssssssssssssssssss None 38 673 642 eeeee-d10-eeeee sssssssssssssssssss None 56 674 643 eeeee-d10-eeeee sssssssssssssssssss None 48 675 644 eeeee-d10-eeeee sssssssssssssssssss None 21 676 645 eeeee-d10-eeeee sssssssssssssssssss None 50 677 646 eeeee-d10-eeeee sssssssssssssssssss None 64 678 647 eeeee-d10-eeeee sssssssssssssssssss None 39 679 648 eeeee-d10-eeeee sssssssssssssssssss None 41 680 649 eeeee-d10-eeeee sssssssssssssssssss None 52 765 5 eeeee-d10-eeeee sssssssssssssssssss None 36 765 3412 d20 sssssssssssssssssss None 45 837 6 eeeee-d10-eeeee sssssssssssssssssss None 31 837 3413 d20 sssssssssssssssssss None 40 979 3414 d20 sssssssssssssssssss None 35 979 3514 d20 sssssssssssssssssss None 14 979 3515 d20 sssssssssssssssssss None 4 1340 1195 eeeee-d10-eeeee sssssssssssssssssss None 49 1341 1196 eeeee-d10-eeeee sssssssssssssssssss None 51 1342 1197 eeeee-d10-eeeee sssssssssssssssssss None 41 1343 1198 eeeee-d10-eeeee sssssssssssssssssss None 33 1344 1199 eeeee-d10-eeeee sssssssssssssssssss None 38 1345 1200 eeeee-d10-eeeee sssssssssssssssssss None 14 1346 1201 eeeee-d10-eeeee sssssssssssssssssss None 11 1347 8 eeeee-d10-eeeee sssssssssssssssssss None 25 1347 3415 d20 sssssssssssssssssss None 32 1347 3422 eeeee-d10-eeeee sssssssssssssssssss Modified 59 1347 3454 eeeee-d12-eeeee sssssssssssssssssssss None 37 1347 3474 eeeee-d8-eeeee sooosssssssssooss None 25 1347 3494 eekk-d8-kkeee soosssssssssooss None 26 1348 1202 eeeee-d10-eeeee sssssssssssssssssss None 24 1349 1203 eeeee-d10-eeeee sssssssssssssssssss None 41 1349 3423 eeeee-d10-eeeee sssssssssssssssssss Modified 60 1349 3455 eeeee-d12-eeeee sssssssssssssssssssss None 49 1349 3475 eeeee-d8-eeeee sooosssssssssooss None 51 1349 3495 eekk-d8-kkeee soosssssssssooss None 53 1349 3517 eeeee-d10-eeeee sssssssssssssssssss None 33 1350 1204 eeeee-d10-eeeee sssssssssssssssssss None 44 1351 1205 eeeee-d10-eeeee sssssssssssssssssss None 65 1352 1206 eeeee-d10-eeeee sssssssssssssssssss None 56 1352 3424 eeeee-d10-eeeee sssssssssssssssssss Modified 63 1352 3456 eeeee-d12-eeeee sssssssssssssssssssss None 43 1352 3476 eeeee-d8-eeeee sooosssssssssooss None 18 1352 3496 eekk-d8-kkeee soosssssssssooss None 50 1352 3518 eeeee-d10-eeeee sssssssssssssssssss None 39 1353 1207 eeeee-d10-eeeee sssssssssssssssssss None 55 1354 1208 eeeee-d10-eeeee sssssssssssssssssss None 21 1354 3425 eeeee-d10-eeeee sssssssssssssssssss Modified 62 1354 3457 eeeee-d12-eeeee sssssssssssssssssssss None 59 1354 3477 eeeee-d8-eeeee sooosssssssssooss None 34 1354 3497 eekk-d8-kkeee soosssssssssooss None 37 1355 1209 eeeee-d10-eeeee sssssssssssssssssss None 45 1356 1210 eeeee-d10-eeeee sssssssssssssssssss None 41 1357 1211 eeeee-d10-eeeee sssssssssssssssssss None 52 1358 1212 eeeee-d10-eeeee sssssssssssssssssss None 54 1359 1213 eeeee-d10-eeeee sssssssssssssssssss None 41 1360 1214 eeeee-d10-eeeee sssssssssssssssssss None 41 1361 1215 eeeee-d10-eeeee sssssssssssssssssss None 11 1362 1216 eeeee-d10-eeeee sssssssssssssssssss None 22 1363 1217 eeeee-d10-eeeee sssssssssssssssssss None 32 1364 1218 eeeee-d10-eeeee sssssssssssssssssss None 50 1365 1219 eeeee-d10-eeeee sssssssssssssssssss None 38 1366 1220 eeeee-d10-eeeee sssssssssssssssssss None 34 1367 1221 eeeee-d10-eeeee sssssssssssssssssss None 25 1368 1222 eeeee-d10-eeeee sssssssssssssssssss None 20 1369 1223 eeeee-d10-eeeee sssssssssssssssssss None −3 1370 1224 eeeee-d10-eeeee sssssssssssssssssss None 62 1629 10 eeeee-d10-eeeee sssssssssssssssssss None 53 1629 3416 d20 sssssssssssssssssss None 45 1740 1496 eeeee-d10-eeeee sssssssssssssssssss None 45 1741 1497 eeeee-d10-eeeee sssssssssssssssssss None 64 1742 1498 eeeee-d10-eeeee sssssssssssssssssss None 67 1743 1499 eeeee-d10-eeeee sssssssssssssssssss None 44 1744 1500 eeeee-d10-eeeee sssssssssssssssssss None 42 1745 1501 eeeee-d10-eeeee sssssssssssssssssss None 21 1746 1502 eeeee-d10-eeeee sssssssssssssssssss None 32 1746 3426 eeeee-d10-eeeee sssssssssssssssssss Modified 17 1746 3458 eeeee-d12-eeeee sssssssssssssssssssss None 44 1746 3478 eeeee-d8-eeeee sooosssssssssooss None 41 1746 3498 eekk-d8-kkeee soosssssssssooss None 26 1746 3519 eeeee-d10-eeeee sssssssssssssssssss None 15 1747 1503 eeeee-d10-eeeee sssssssssssssssssss None 30 1748 1504 eeeee-d10-eeeee sssssssssssssssssss None 46 1749 1505 eeeee-d10-eeeee sssssssssssssssssss None 54 1750 1506 eeeee-d10-eeeee sssssssssssssssssss None 46 1751 1507 eeeee-d10-eeeee sssssssssssssssssss None 47 1751 3427 eeeee-d10-eeeee sssssssssssssssssss Modified 39 1751 3459 eeeee-d12-eeeee sssssssssssssssssssss None 69 1751 3479 eeeee-d8-eeeee sooosssssssssooss None 41 1751 3499 eekk-d8-kkeee soosssssssssooss None 42 1752 28 eeeee-d10-eeeee sssssssssssssssssss None 49 1753 1508 eeeee-d10-eeeee sssssssssssssssssss None 54 1754 1509 eeeee-d10-eeeee sssssssssssssssssss None 43 1755 1510 eeeee-d10-eeeee sssssssssssssssssss None 72 1755 3428 eeeee-d10-eeeee sssssssssssssssssss Modified 79 1755 3460 eeeee-d12-eeeee sssssssssssssssssssss None 61 1755 3480 eeeee-d8-eeeee sooosssssssssooss None 49 1755 3500 eekk-d8-kkeee soosssssssssooss None 37 1755 3520 eeeee-d10-eeeee sssssssssssssssssss None −1 1756 1511 eeeee-d10-eeeee sssssssssssssssssss None 44 1757 1512 eeeee-d10-eeeee sssssssssssssssssss None 36 1758 1513 eeeee-d10-eeeee sssssssssssssssssss None 35 1759 1514 eeeee-d10-eeeee sssssssssssssssssss None 44 1760 17 eeeee-d10-eeeee sssssssssssssssssss None 32 1761 1515 eeeee-d10-eeeee sssssssssssssssssss None 11 1762 1516 eeeee-d10-eeeee sssssssssssssssssss None 28 1763 1517 eeeee-d10-eeeee sssssssssssssssssss None 28 1764 1518 eeeee-d10-eeeee sssssssssssssssssss None 26 1765 1519 eeeee-d10-eeeee sssssssssssssssssss None 35 1766 1520 eeeee-d10-eeeee sssssssssssssssssss None 46 1767 1521 eeeee-d10-eeeee sssssssssssssssssss None 31 1768 1522 eeeee-d10-eeeee sssssssssssssssssss None 42 1769 1523 eeeee-d10-eeeee sssssssssssssssssss None 21 1770 1524 eeeee-d10-eeeee sssssssssssssssssss None 12 1771 1525 eeeee-d10-eeeee sssssssssssssssssss None −4 1772 1526 eeeee-d10-eeeee sssssssssssssssssss None 31 1773 1527 eeeee-d10-eeeee sssssssssssssssssss None 25 1774 1528 eeeee-d10-eeeee sssssssssssssssssss None 36 1775 62 eeeee-d10-eeeee sssssssssssssssssss None 49 1776 1529 eeeee-d10-eeeee sssssssssssssssssss None 36 1777 1530 eeeee-d10-eeeee sssssssssssssssssss None 52 1778 1531 eeeee-d10-eeeee sssssssssssssssssss None 54 1779 1532 eeeee-d10-eeeee sssssssssssssssssss None 22 1780 1533 eeeee-d10-eeeee sssssssssssssssssss None 63 1781 1534 eeeee-d10-eeeee sssssssssssssssssss None 63 1782 1535 eeeee-d10-eeeee sssssssssssssssssss None 34 1783 1536 eeeee-d10-eeeee sssssssssssssssssss None 17 1784 1537 eeeee-d10-eeeee sssssssssssssssssss None 24 1785 1538 eeeee-d10-eeeee sssssssssssssssssss None 40 1786 1539 eeeee-d10-eeeee sssssssssssssssssss None 53 1787 1540 eeeee-d10-eeeee sssssssssssssssssss None 46 1788 1541 eeeee-d10-eeeee sssssssssssssssssss None 46 1789 1542 eeeee-d10-eeeee sssssssssssssssssss None 71 1790 1543 eeeee-d10-eeeee sssssssssssssssssss None 41 1791 1544 eeeee-d10-eeeee sssssssssssssssssss None 34 1792 1545 eeeee-d10-eeeee sssssssssssssssssss None 38 1793 1546 eeeee-d10-eeeee sssssssssssssssssss None 52 1793 3429 eeeee-d10-eeeee sssssssssssssssssss Modified 59 1793 3461 eeeee-d12-eeeee sssssssssssssssssssss None 25 1793 3481 eeeee-d8-eeeee sooosssssssssooss None 52 1793 3501 eekk-d8-kkeee soosssssssssooss None 42 1794 1547 eeeee-d10-eeeee sssssssssssssssssss None 58 1795 29 eeeee-d10-eeeee sssssssssssssssssss None 51 1796 1548 eeeee-d10-eeeee sssssssssssssssssss None 40 1797 1549 eeeee-d10-eeeee sssssssssssssssssss None 16 1798 1550 eeeee-d10-eeeee sssssssssssssssssss None 33 1799 1551 eeeee-d10-eeeee sssssssssssssssssss None 63 1799 3430 eeeee-d10-eeeee sssssssssssssssssss Modified 61 1799 3462 eeeee-d12-eeeee sssssssssssssssssssss None 39 1799 3482 eeeee-d8-eeeee sooosssssssssooss None 21 1799 3502 eekk-d8-kkeee soosssssssssooss None 52 1800 1552 eeeee-d10-eeeee sssssssssssssssssss None 22 1801 1553 eeeee-d10-eeeee sssssssssssssssssss None 16 1802 1554 eeeee-d10-eeeee sssssssssssssssssss None 33 1803 1555 eeeee-d10-eeeee sssssssssssssssssss None 60 1803 3431 eeeee-d10-eeeee sssssssssssssssssss Modified 60 1803 3463 eeeee-d12-eeeee sssssssssssssssssssss None 59 1803 3483 eeeee-d8-eeeee sooosssssssssooss None 52 1803 3503 eekk-d8-kkeee soosssssssssooss None 49 1803 3521 eeeee-d10-eeeee sssssssssssssssssss None 25 1804 1556 eeeee-d10-eeeee sssssssssssssssssss None 67 1805 1557 eeeee-d10-eeeee sssssssssssssssssss None 63 1806 1558 eeeee-d10-eeeee sssssssssssssssssss None 39 1807 1559 eeeee-d10-eeeee sssssssssssssssssss None 24 1807 3432 eeeee-d10-eeeee sssssssssssssssssss Modified 63 1807 3464 eeeee-d12-eeeee sssssssssssssssssssss None 59 1807 3484 eeeee-d8-eeeee sooosssssssssooss None 13 1807 3504 eekk-d8-kkeee soosssssssssooss None 41 1807 3522 eeeee-d10-eeeee sssssssssssssssssss None 1 1808 1560 eeeee-d10-eeeee sssssssssssssssssss None 24 1809 1561 eeeee-d10-eeeee sssssssssssssssssss None 9 1809 3433 eeeee-d10-eeeee sssssssssssssssssss Modified 64 1809 3465 eeeee-d12-eeeee sssssssssssssssssssss None 61 1809 3485 eeeee-d8-eeeee sooosssssssssooss None −17 1809 3505 eekk-d8-kkeee soosssssssssooss None 39 1810 1562 eeeee-d10-eeeee sssssssssssssssssss None 38 1811 1563 eeeee-d10-eeeee sssssssssssssssssss None 44 1812 1564 eeeee-d10-eeeee sssssssssssssssssss None −10 1813 1565 eeeee-d10-eeeee sssssssssssssssssss None 27 1814 1566 eeeee-d10-eeeee sssssssssssssssssss None 15 1815 1567 eeeee-d10-eeeee sssssssssssssssssss None 44 2879 12 eeeee-d10-eeeee sssssssssssssssssss None 40 2879 3417 d20 sssssssssssssssssss None 23 3008 13 eeeee-d10-eeeee sssssssssssssssssss None 24 3008 3418 d20 sssssssssssssssssss None 6 3110 2591 eeeee-d10-eeeee sssssssssssssssssss None 21 3111 2592 eeeee-d10-eeeee sssssssssssssssssss None 20 3112 2593 eeeee-d10-eeeee sssssssssssssssssss None 7 3112 3434 eeeee-d10-eeeee sssssssssssssssssss Modified 54 3112 3466 eeeee-d12-eeeee sssssssssssssssssssss None 58 3112 3486 eeeee-d8-eeeee sooosssssssssooss None 44 3112 3506 eekk-d8-kkeee soosssssssssooss None 51 3113 2594 eeeee-d10-eeeee sssssssssssssssssss None 46 3114 2595 eeeee-d10-eeeee sssssssssssssssssss None 29 3114 3435 eeeee-d10-eeeee sssssssssssssssssss Modified 70 3114 3467 eeeee-d12-eeeee sssssssssssssssssssss None 41 3114 3487 eeeee-d8-eeeee sooosssssssssooss None 45 3114 3507 eekk-d8-kkeee soosssssssssooss None 29 3115 2596 eeeee-d10-eeeee sssssssssssssssssss None 44 3116 2597 eeeee-d10-eeeee sssssssssssssssssss None 30 3117 2598 eeeee-d10-eeeee sssssssssssssssssss None 30 3118 2599 eeeee-d10-eeeee sssssssssssssssssss None 48 3119 2600 eeeee-d10-eeeee sssssssssssssssssss None 54 3120 2601 eeeee-d10-eeeee sssssssssssssssssss None 31 3121 2602 eeeee-d10-eeeee sssssssssssssssssss None 42 3122 2603 eeeee-d10-eeeee sssssssssssssssssss None 57 3123 2604 eeeee-d10-eeeee sssssssssssssssssss None 62 3124 2605 eeeee-d10-eeeee sssssssssssssssssss None 56 3125 2606 eeeee-d10-eeeee sssssssssssssssssss None −1 3125 3436 eeeee-d10-eeeee sssssssssssssssssss Modified 61 3125 3468 eeeee-d12-eeeee sssssssssssssssssssss None 55 3125 3488 eeeee-d8-eeeee sooosssssssssooss None 57 3125 3508 eekk-d8-kkeee soosssssssssooss None 60 3126 3395 eeeee-d10-eeeee sssssssssssssssssss None 46 3127 3396 eeeee-d10-eeeee sssssssssssssssssss None 55 3127 3437 eeeee-d10-eeeee sssssssssssssssssss Modified 77 3127 3469 eeeee-d12-eeeee sssssssssssssssssssss None 58 3127 3489 eeeee-d8-eeeee sooosssssssssooss None 54 3127 3509 eekk-d8-kkeee soosssssssssooss None 42 3127 3523 eeeee-d10-eeeee sssssssssssssssssss None 15 3128 3397 eeeee-d10-eeeee sssssssssssssssssss None 65 3129 3398 eeeee-d10-eeeee sssssssssssssssssss None 50 3130 3399 eeeee-d10-eeeee sssssssssssssssssss None 52 3131 3400 eeeee-d10-eeeee sssssssssssssssssss None 39 3132 3401 eeeee-d10-eeeee sssssssssssssssssss None 34 3133 3440 eeeee-d10-eeeee sssssssssssssssssss None 56 3134 3441 eeeee-d10-eeeee sssssssssssssssssss None 16 3135 3442 eeeee-d10-eeeee sssssssssssssssssss None 35 3136 3443 eeeee-d10-eeeee sssssssssssssssssss None 62 3137 3444 eeeee-d10-eeeee sssssssssssssssssss None 59 3138 3445 eeeee-d10-eeeee sssssssssssssssssss None 56 3139 3446 eeeee-d10-eeeee sssssssssssssssssss None 52 3140 3447 eeeee-d10-eeeee sssssssssssssssssss None 55 3141 2607 eeeee-d10-eeeee sssssssssssssssssss None 33 3142 2608 eeeee-d10-eeeee sssssssssssssssssss None 36 3143 2609 eeeee-d10-eeeee sssssssssssssssssss None 27 3144 2610 eeeee-d10-eeeee sssssssssssssssssss None 19 3145 2611 eeeee-d10-eeeee sssssssssssssssssss None 32 3146 2612 eeeee-d10-eeeee sssssssssssssssssss None 43 3147 2613 eeeee-d10-eeeee sssssssssssssssssss None 24 3148 2614 eeeee-d10-eeeee sssssssssssssssssss None 39 3149 2615 eeeee-d10-eeeee sssssssssssssssssss None 29 3150 2616 eeeee-d10-eeeee sssssssssssssssssss None 38 3151 2617 eeeee-d10-eeeee sssssssssssssssssss None 59 3152 2618 eeeee-d10-eeeee sssssssssssssssssss None 39 3153 2619 eeeee-d10-eeeee sssssssssssssssssss None 58 3154 2620 eeeee-d10-eeeee sssssssssssssssssss None 41 3155 2621 eeeee-d10-eeeee sssssssssssssssssss None 32 3156 2622 eeeee-d10-eeeee sssssssssssssssssss None 63 3157 2623 eeeee-d10-eeeee sssssssssssssssssss None 63 3158 2624 eeeee-d10-eeeee sssssssssssssssssss None 57 3159 2625 eeeee-d10-eeeee sssssssssssssssssss None 59 3160 2626 eeeee-d10-eeeee sssssssssssssssssss None 65 3161 2627 eeeee-d10-eeeee sssssssssssssssssss None 45 3162 2628 eeeee-d10-eeeee sssssssssssssssssss None 37 3162 3438 eeeee-d10-eeeee sssssssssssssssssss Modified 22 3162 3470 eeeee-d12-eeeee sssssssssssssssssssss None 48 3162 3490 eeeee-d8-eeeee sooosssssssssooss None 29 3162 3510 eekk-d8-kkeee soosssssssssooss None 35 3162 3524 eeeee-d10-eeeee sssssssssssssssssss None 7 3163 2629 eeeee-d10-eeeee sssssssssssssssssss None 60 3164 2630 eeeee-d10-eeeee sssssssssssssssssss None 52 3165 2631 eeeee-d10-eeeee sssssssssssssssssss None 52 3166 3448 eeeee-d10-eeeee sssssssssssssssssss None 31 3167 3449 eeeee-d10-eeeee sssssssssssssssssss None 49 3168 15 eeeee-d10-eeeee sssssssssssssssssss None 33 3168 3419 d20 sssssssssssssssssss None 22 3169 3450 eeeee-d10-eeeee sssssssssssssssssss None 26 3170 3451 eeeee-d10-eeeee sssssssssssssssssss None 34 3171 3402 eeeee-d10-eeeee sssssssssssssssssss None 54 3171 3439 eeeee-d10-eeeee sssssssssssssssssss Modified 69 3171 3471 eeeee-d12-eeeee sssssssssssssssssssss None 50 3171 3491 eeeee-d8-eeeee sooosssssssssooss None 41 3171 3511 eekk-d8-kkeee soosssssssssooss None 32 3171 3525 eeeee-d10-eeeee sssssssssssssssssss None 16

    [0472] Table 7 below shows the percent knockdown of KCNT1 in BE(2)-M17 cells after treatment with the ASO with the sequence of a corresponding SEQ ID NO.

    TABLE-US-00007 TABLE 7 Percent Knock down of KCNT1 expressed in human BE(2)-M17 cells organized according to SEQ ID NO. BE(2)-M17 100 nM ASO SED ID NO: Mean 1 7 4 44 5 36 6 31 8 25 10 53 12 40 13 24 15 33 17 32 28 49 29 51 62 49 625 11 626 34 627 37 628 51 629 44 630 43 631 33 632 5 633 34 634 37 635 35 636 40 637 30 638 17 639 26 640 49 641 38 642 56 643 48 644 21 645 50 646 64 647 39 648 41 649 52 1195 49 1196 51 1197 41 1198 33 1199 38 1200 14 1201 11 1202 24 1203 41 1204 44 1205 65 1206 56 1207 55 1208 21 1209 45 1210 41 1211 52 1212 54 1213 41 1214 41 1215 11 1216 22 1217 32 1218 50 1219 38 1220 34 1221 25 1222 20 1223 −3 1224 62 1496 45 1497 64 1498 67 1499 44 1500 42 1501 21 1502 32 1503 30 1504 46 1505 54 1506 46 1507 47 1508 54 1509 43 1510 72 1511 44 1512 36 1513 35 1514 44 1515 11 1516 28 1517 28 1518 26 1519 35 1520 46 1521 31 1522 42 1523 21 1524 12 1525 −4 1526 31 1527 25 1528 36 1529 36 1530 52 1531 54 1532 22 1533 63 1534 63 1535 34 1536 17 1537 24 1538 40 1539 53 1540 46 1541 46 1542 71 1543 41 1544 34 1545 38 1546 52 1547 58 1548 40 1549 16 1550 33 1551 63 1552 22 1553 16 1554 33 1555 60 1556 67 1557 63 1558 39 1559 24 1560 24 1561 9 1562 38 1563 44 1564 −10 1565 27 1566 15 1567 44 2591 21 2592 20 2593 7 2594 46 2595 29 2596 44 2597 30 2598 30 2599 48 2600 54 2601 31 2602 42 2603 57 2604 62 2605 56 2606 −1 2607 33 2608 36 2609 27 2610 19 2611 32 2612 43 2613 24 2614 39 2615 29 2616 38 2617 59 2618 39 2619 58 2620 41 2621 32 2622 63 2623 63 2624 57 2625 59 2626 65 2627 45 2628 37 2629 60 2630 52 2631 52 3395 46 3396 55 3397 65 3398 50 3399 52 3400 39 3401 34 3402 54 3410 14 3411 39 3412 45 3413 40 3414 35 3415 32 3416 45 3417 23 3418 6 3419 22 3420 49 3421 59 3422 59 3423 60 3424 63 3425 62 3426 17 3427 39 3428 79 3429 59 3430 61 3431 60 3432 63 3433 64 3434 54 3435 70 3436 61 3437 77 3438 22 3439 69 3440 56 3441 16 3442 35 3443 62 3444 59 3445 56 3446 52 3447 55 3448 31 3449 49 3450 26 3451 34 3452 39 3453 41 3454 37 3455 49 3456 43 3457 59 3458 44 3459 69 3460 61 3461 25 3462 39 3463 59 3464 59 3465 61 3466 58 3467 41 3468 55 3469 58 3470 48 3471 50 3472 38 3473 19 3474 25 3475 51 3476 18 3477 34 3478 41 3479 41 3480 49 3481 52 3482 21 3483 52 3484 13 3485 −17 3486 44 3487 45 3488 57 3489 54 3490 29 3491 41 3492 40 3493 52 3494 26 3495 53 3496 50 3497 37 3498 26 3499 42 3500 37 3501 42 3502 52 3503 49 3504 41 3505 39 3506 51 3507 29 3508 60 3509 42 3510 35 3511 32 3512 6 3513 5 3514 14 3515 4 3516 11 3517 33 3518 39 3519 15 3520 −1 3521 25 3522 1 3523 15 3524 7 3525 16

    Example 4. Evaluation of Select Antisense Oligonucleotides

    [0473] For select ASOs, the degree of KCNT1 mRNA knock-down was determined using a taqman quantitative polymerase chain reaction (qPCR assay). Human (SH-Sy5Y) neuronal cell lines were transfected with between 500 nM and 10,000 nM ASO using the Amaxa nucleofection (protocol CA137). After 48 hour incubation at 37° C., cDNA was prepared from each well using the Cell-to-Ct Kit (ThermoFisher Scientific). The expression level of KCNT1 was determined using taqman qPCR assays for either KCNT1 (human Hs.PT.58.19442766) or the housekeeping gene HPRT1 (human Hs.PT.58v.45621572). All taqman assays were predesigned by Integrated DNA Technologies. KCNT1 and HPRT1 detection were multiplexed in a single well. The fold change in KCNT1 was calculated using the ΔΔCp method whereby the expression of KCNT1 is first normalized to HPRT1 (2.sup.−(Cp_KCNT1-Cp_HPRT1)) in the same well (multiplexed reaction) followed by a secondary normalization to the vehicle, non-transfected control (2.sup.−(Cp_ASO-Cp_vehicle)). The assay was performed in biological duplicates and technical triplicates.

    [0474] FIG. 1 is a plot demonstrating percentage knockdown of hKCNT1 in response to different antisense oligonucleotide treatments (specifically, antisense oligonucleotides corresponding to SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 751, SEQ ID NO: 759, SEQ ID NO: 1206, and SEQ ID NO: 1546). The numerical percentage knockdown values are shown below in Table 8. The positive control is SEQ ID NO: 7. The negative control is an ASO with identical chemistry but with a sequence not found in the human genome.

    TABLE-US-00008 TABLE 8 Percent knockdown data expressed as average percent knock-down. % Knockdown SEQ ID NO Pos Neg ASO μM 4 5 751 759 1206 1546 Control Control 0.5 36.55 13.42 7.09 12.03 18.95 25.50 −27.31 −98.79 1 61.60 36.27 24.74 25.59 26.96 42.66 7.02 −98.58 2 85.97 55.76 42.84 43.51 46.64 69.39 27.66 −98.69 5 94.33 79.72 62.23 73.50 70.44 84.36 74.18 −98.69 10 98.61 84.89 76.00 87.23 84.34 94.51 88.02 −98.81 All ASO's tested exhibited a dose dependent knock down of the KCNT1 expression.
    ASOs as shown in SEQ ID NO. 4 and 1546 exhibited the most potent knockdown of the KCNT1 gene, with greater than 80% gene expression reduction when treated with 5 μM of the ASO oligonucleotide. The IC50 of each ASO is shown in Table 9.

    TABLE-US-00009 TABLE 9 IC50 of select ASOs in SH-SY5Y neuronal cells SH-SY5Y Cells SEQ ID NO. IC50 (uM) 4 0.716 5 1.733 7 3.218 751 3.041 759 2.342 1206 2.255 1546 1.177

    OTHER EMBODIMENTS

    [0475] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference in their entirety to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference in its entirety. Where a term in the present application is found to be defined differently in a document incorporated herein by reference, the definition provided herein is to serve as the definition for the term.

    [0476] While the invention has been described in connection with specific embodiments thereof, it will be understood that invention is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure that come within known or customary practice within the art to which the invention pertains and may be applied to the essential features hereinbefore set forth, and follows in the scope of the claimed.