Mussel-inspired bioactive surface coating composition generating silica nanoparticles

Abstract

The present invention relates to a fusion protein comprising a mussel adhesive protein and a silica-binding peptide linked to the mussel adhesive protein, a silica nanoparticle a silica connected to the fusion protein, a fusion protein-silica nanoparticle complex comprising the silica nanoparticle having bioactivity and adhesiveness for cell proliferation and accelerating the differentiation, a surface coating composition including the complex, its use, and a method of coating a surface using the surface coating composition.

Claims

1. A method for promoting osteoblast attachment, proliferation, spreading and differentiation including the steps of providing a substrate; coating the substrate with a substrate surface coating composition comprising a fusion protein comprising a mussel adhesive protein and a silica-binding peptide linked to the mussel adhesive protein; and providing osteoblast on the substrate surface coating composition so as to promote the attachment, proliferation, spreading and differentiation of the osteoblast.

2. The method according to claim 1, additionally including a step of linking silica to the substrate onto which the fusion protein is adhered so as to form a fusion protein-silica nanoparticle complex.

3. The method according to claim 1, wherein the substrate is polymer, metal or glass.

4. The method according to claim 1, wherein the substrate is a medical device selected from the group consisting of stents, artificial valves, implants, implant supports, and medical setscrews.

5. The method according to claim 1, wherein the mussel adhesive protein is a polypeptide selected from the group consisting of a peptide comprising 1 to 10 repeats of the amino acid sequence of SEQ ID NO: 1 and a peptide consisting of an amino acid sequence of SEQ ID NO: 2.

6. The method according to claim 1, wherein the mussel adhesive protein is a peptide consisting of an amino acid sequence of SEQ ID NO: 3.

7. The method according to claim 1, wherein the silica-binding peptide is one or more selected from the group consisting of amino acid sequences of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawing(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.

(2) FIG. 1 is a schematic illustration showing bioactive effects, in which the surface of titanium implant is coated with silica nanoparticles and osteoblasts are bound thereon according to an embodiment of the present invention;

(3) FIG. 2 is a schematic illustration showing a formation process of silica nanoparticles by coating a substrate surface with a mussel adhesive protein-based fusion protein according to an embodiment of the present invention;

(4) FIG. 3 is a schematic illustration of a vector for preparing an R5-MAP fusion protein according to an embodiment of the present invention;

(5) FIG. 4 shows the result of SDS-PAGE for examining expression of the R5-MAP fusion protein according to an embodiment of the present invention;

(6) FIG. 5 shows the shape of silica nanoparticles, examined by scanning electron microscopy (SEM) of a fusion protein-silica nanoparticle complex coated on the surface of a polymer according to an embodiment of the present invention;

(7) FIG. 6 shows a scanning electron microscopic image (SEM) of the fusion protein-silica nanoparticle complex coated on the surface of titanium according to an embodiment of the present invention;

(8) FIG. 7 shows a scanning electron microscopic image (SEM) of the fusion protein-silica nanoparticle complex coated on the surface of aluminium according to an embodiment of the present invention;

(9) FIG. 8 shows a scanning electron microscopic image (SEM) of the fusion protein-silica nanoparticle complex coated on the surface of stainless steel according to an embodiment of the present invention;

(10) FIG. 9 shows formation of silica nanoparticles, examined by energy dispersion X-ray spectroscopy (EDS) of the fusion protein-silica nanoparticle complex coated on the substrate surface according to an embodiment of the present invention;

(11) FIG. 10 is a graph showing adhesion of mouse osteoblasts onto the respective surfaces of a material coated with no fusion protein, a material coated with non-TMOS treated R5-MAP fusion protein, and a material coated with R5-MAP fusion protein-silica nanoparticle complex formed after treatment of TMOS solution;

(12) FIG. 11 is a graph showing proliferation of mouse osteoblasts on the respective surfaces of the material coated with no fusion protein, the material coated with non-TMOS treated R5-MAP fusion protein, and the material coated with R5-MAP fusion protein-silica nanoparticle complex formed after treatment of TMOS;

(13) FIG. 12 shows DAPI and FITC fluorescence images for analyzing spreading of mouse osteoblasts on the respective surfaces of the material coated with no fusion protein, the material coated with non-TMOS treated R5-MAP fusion protein, and the material coated with R5-MAP fusion protein-silica nanoparticle complex formed after treatment of TMOS;

(14) FIG. 13 shows alizarin-red S staining images for analyzing differentiation of mouse osteoblasts on the respective surfaces of the material coated with no fusion protein, the material coated with non-TMOS treated R5-MAP fusion protein, and the material coated with R5-MAP fusion protein-silica nanoparticle complex formed after treatment of TMOS;

(15) FIG. 14 shows the result of quantifying calcium deposition for analyzing intracellular calcium deposition ability as a result of differentiation of mouse osteoblasts on the respective surfaces of the material coated with no fusion protein, the material coated with non-TMOS treated R5-MAP fusion protein, and the material coated with TMOS-treated R5-MAP fusion protein-silica nanoparticle complex;

(16) FIG. 15 shows an R5-MAP fusion protein-based nanofiber (R5-MAP/PCL mixture, 50:50 (w/w));

(17) FIG. 16 shows formation of silica nanoparticles on the surface of the nanofiber after treatment of the R5-MAP fusion protein-based nanofiber (R5-MAP/PCL mixture, 50:50 (w/w)) with a TMOS solution; and

(18) FIG. 17 shows formation of silica nanoparticles on the surface of the nanofiber, examined by energy dispersion X-ray spectroscopy (EDS).

DETAILED DESCRIPTION OF THE EMBODIMENTS

(19) Hereinafter, the present invention will be described in detail with reference to Examples. However, these Examples are for illustrative purposes only, and the invention is not intended to be limited by these Examples.

Example 1. Preparation of Fusion Protein

(20) Primers (Table 3) for a silica-binding peptide sequence derived from the diatoms C. fusiformis were constructed. These primers were used to perform polymerase chain reaction, thereby preparing a fusion protein, in which the silica-binding peptide was linked to a mussel adhesive protein, fp-1 (SEQ ID NO. 1) or fp-151 (SEQ ID NO. 3).

(21) TABLE-US-00003 TABLE 3  SEQ ID NO. Primer Nucleotide sequence (5′.fwdarw.3′) 8 Forward GCGCCATATGAGCAGCAAAAAATCTGGCTCCTATT for R5 CAGGCTCGAAAGGTTCTAAACGTCGCATTCTGGGT GGCGGAGGGGCGAAACCGAGCTATCCGCCGACC 9 Reverse GCGCCTCGAGCTTGTACGTTGGAGGATAAGAAGG for MAP

(22) As in FIG. 3 showing the schematic illustration of fusion protein (R5-MAP) construction, an R5 peptide (SEQ ID NO. 5; SSKKSGSYSGSKGSKRRIL) was linked to a mussel adhesive protein (MAP), such as mussel adhesive protein fp-1 or fp-151. A pET-22b(+) vector containing T7 promoter was used as a plasmid vector, and transformed into an E. coli TOP10 strain. Further, for expression of the fusion protein, the cloned recombinant vector was further transformed into an E. coli BL21 (DE3) strain.

(23) E. coli transformed with the nucleotide sequence encoding the R5-MAP fusion protein was cultured in an LB liquid medium containing 50 μg/ml of ampicillin at 37° C., 300 rpm, and when optical density at 600 nm (OD600) reached 0.4 to 0.6, 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) was added thereto, followed by incubation for 8 hours under the same conditions. The cells thus cultured were centrifuged at 4° C., 18,000×g for 10 minutes, and a cell pellet was resuspended in an elution buffer (10 mM Tris-HCl, and 100 mM sodium phosphate, pH 8) and disrupted under 200 Kpsi. To obtain cell debris from the resulting cell lysate, centrifugation was performed at 4° C., 18,000×g for 20 minutes and a desired fusion protein was extracted using 25% (v/v) acetic acid. The fusion protein finally purified was freeze-dried and stored at −80° C.

(24) Production and purification of the respective proteins were analyzed by 12% (w/v) SDS-PAGE, and successful expression of the fusion proteins was examined by electrophoresis. The result of the electrophoresis is shown in FIG. 4. The concentrations of the fusion proteins were determined by Bradford assay (Bio-Rad).

Example 2. Preparation of Fusion Protein-Silica Nanoparticle Complex

(25) 2-1: Use of Polymer Substrate Surface

(26) To coat the surface of a coverslip made of polystyrene with the fusion protein-silica nanoparticle complex, 5% acetic acid solution containing 5 mg/ml of the fusion protein prepared in Example 1 was applied to the substrate surface, and left at room temperature for 12 hours to perform protein deposition. In this regard, to remove the fusion proteins which were not properly adhered to the surface, the substrate surface was washed with distilled water so as to obtain a fusion protein (R5-MAP)-coated substrate surface.

(27) The fusion protein-coated substrate surface was immersed in 1 M trimethylorthosilicate (TMOS) solution for 2 minutes so as to prepare a complex, in which the silica nanoparticles were linked to the fusion protein. To remove silica which was not properly adhered to the substrate surface, the substrate surface was washed with distilled water.

(28) To confirm formation of the fusion protein-silica nanoparticle complex (Si-R5-MAP) and to examine shape of the complex, scanning electron microscopy (SEM) was performed and the resulting SEM images are shown in FIG. 5.

(29) FIG. 5 shows scanning electron microscopic image (SEM) of the protein-silica nanoparticle complex coated on the surface of the polymer. As shown in FIG. 5, particles which were formed on the surface coated with R5-MAP fusion protein were found to have a size of about 100 nm and to be spherical silica particles.

(30) 2-2: Use of Metal Substrate Surface

(31) Titanium, aluminium, and stainless steel surfaces were coated with the fusion protein prepared in Example 1 in the substantially same manner as in Example 2-1, and each of the substrate surfaces coated with the fusion protein was linked with silica using 1 M trimethylorthosilicate (TMOS) solution to prepare a fusion protein-silica nanoparticle complex (Si-R5-MAP).

(32) The surfaces were analyzed by SEM photography. The result of forming the fusion protein-silica nanoparticle complex (Si-R5-MAP) on the titanium surface is shown in FIG. 6, the result of forming the fusion protein-silica nanoparticle complex (Si-R5-MAP) on the aluminium surface is shown in FIG. 7, and the result of forming the fusion protein-silica nanoparticle complex (Si-R5-MAP) on the stainless steel surface is shown in FIG. 8.

(33) As shown in FIGS. 6 to 8, it was found that after R5-MAP fusion proteins were successfully coated onto the titanium, aluminium, and stainless steel surfaces, silica nanoparticles were formed by TMOS solution.

(34) 2-3: Elementary Analysis of Silica on Coating Surface

(35) To analyze the structure of the coating surface of the substrate obtained in Example 2-1, energy dispersion X-ray spectroscopy (EDS) was performed, and the result is shown in FIG. 9.

(36) FIG. 9 shows formation of silica nanostructure, examined by energy dispersion X-ray spectroscopy (EDS). As shown in FIG. 9, the elemental composition of particles was examined by energy dispersion X-ray spectroscopy (EDS), and as a result, the element constituting the produced nanoparticles was found to be silica.

Example 3. In Vitro Cell Test of Surface Coating Composition

(37) 3-1: Cell Culture by Use of Surface Coating Composition

(38) A cell function-improving ability of the bioactive surface coating composition including the fusion protein-silica nanoparticle complex of Example 2 was examined in vitro.

(39) In the same manner as in Example 2-1, four types of the coated substrate surfaces were prepared by coating the surface of the polystyrene coverslip. In detail, the four types of the coated substrate surfaces include 1) the surface of polystyrene coverslip (NC) which was coated with none of the fusion protein and TMOS, 2) the surface (Si—NC) which was coated with TMOS, but without R5-MAP fusion protein, 3) the surface (R5-MAP) which was coated without TMOS, but with R5-MAP fusion protein, and 4) the surface (Si-R5-MAP) which was coated with R5-MAP fusion protein-silica nanoparticle complex formed after treatment of TMOS solution.

(40) 5×10.sup.4 mouse osteoblast MC3T3-E1 cells were cultured on the four surfaces thus prepared.

(41) 3-2: Test of Cell Adhesion and Proliferation by Optical Density

(42) As a result of cell culture, 3) the surface (R5-MAP) which was coated without TMOS, but with R5-MAP fusion protein, and 4) the surface (Si-R5-MAP) which was coated with R5-MAP fusion protein-silica nanoparticle complex formed after treatment of TMOS solution showed higher cell adhesion and proliferation than 1) the surface of polystyrene coverslip (NC) which was coated with none of the fusion protein and TMOS, 2) the surface (Si—NC) which was coated with TMOS, but without R5-MAP fusion protein, and 4) the surface (Si-R5-MAP) which was coated with R5-MAP fusion protein-silica nanoparticle complex formed after treatment of TMOS solution showed more excellent cell proliferation effects.

(43) Mouse osteoblasts were cultured on the four surfaces for 72 hours, and then optical density thereof was measured. The results are shown in FIGS. 10 and 11.

(44) FIG. 10 is a graph showing adhesion of mouse osteoblasts onto the respective surfaces of a material coated with no fusion protein, a material coated with non-TMOS treated R5-MAP fusion protein, and a material coated with R5-MAP fusion protein-silica nanoparticle complex formed after treatment of TMOS solution. FIG. 11 is a graph showing proliferation of mouse osteoblasts on the respective surfaces of the material coated with no fusion protein, the material coated with non-TMOS treated R5-MAP fusion protein, and the material coated with R5-MAP fusion protein-silica nanoparticle complex formed after treatment of TMOS.

(45) The R5-MAP protein itself and silica nanoparticle were found to slightly affect cell proliferation and adhesion (FIGS. 10 and 11).

(46) 3-3: Test of Cell Spreading by Fluorescence Staining

(47) Mouse osteoblasts were cultured on the four surfaces for 1 day, and then fluorescence staining was performed. The result is shown in FIG. 12. FIG. 12 shows DAPI and FITC fluorescence images for analyzing spreading of mouse osteoblasts on the respective surfaces of the material coated with no fusion protein, the material coated with non-TMOS treated R5-MAP fusion protein, and the material coated with R5-MAP fusion protein-silica nanoparticle complex formed after treatment of TMOS.

(48) As shown in FIG. 12, fluorescence staining was performed after culturing mouse osteoblasts for 1 day on the surface of polystyrene coverslip on which silica nanoparticles were formed by treatment of TMOS solution after coating with R5-MAP fusion protein. As a result, long cell spreading was observed on the surface on which silica was formed, and the R5-MAP coating surface on which no silica was formed due to non-treatment of TMOS solution, compared to a control surface, indicating that the R5-MAP protein itself and silica nanoparticle affect cell shape.

(49) 3-4: Test of Cell Proliferation by Alizarin Red S Staining

(50) To examine cell proliferation patterns, mouse osteoblasts were cultured on the four surfaces for 15 days, and then alizarin red S staining was performed. The result is shown in FIG. 13. The alizarin red S staining is one of the most frequently used methods to evaluate mineralization of bone matrix, and mineralization of bone matrix is known as an indicator of osteoblasts. In detail, the cultured osteoblasts were washed with phosphate buffered saline and fixed with 4% formaldehyde for 10 minutes. The cells were stained with 2% alizarin red S under gentle shaking for 5 minutes, and then washed with desalted water several times to remove the remaining staining solution. Staining patterns were observed.

(51) FIG. 13 shows alizarin-red S staining images for analyzing differentiation of mouse osteoblasts on the respective surfaces of the material coated with no fusion protein, the material coated with non-TMOS treated R5-MAP fusion protein, and the material coated with R5-MAP fusion protein-silica nanoparticle complex formed after treatment of TMOS.

(52) As shown in FIG. 13, to examine cell differentiation patterns on the surface of polystyrene coverslip on which silica nanoparticles were formed by treatment of TMOS solution after coating with R5-MAP fusion protein, mouse osteoblasts were cultured for 15 day and then alizarin red S staining was performed. As a result, the surface on which silica was formed was stained in red color, compared to the control surfaces (NC and Si—NC).

(53) 3-5: Test of Calcium Deposition

(54) The cells proliferated on the four surfaces were treated with 10% acetic acid to obtain calcium. The amount of calcium was measured and the result is shown in FIG. 14. FIG. 14 shows the result of quantifying calcium deposition for analyzing intracellular calcium deposition ability as a result of differentiation of mouse osteoblasts on the respective surfaces of the material coated with no fusion protein, the material coated with non-TMOS treated R5-MAP fusion protein, and the material coated with R5-MAP fusion protein-silica nanoparticle complex formed after treatment of TMOS.

(55) As shown in FIG. 14, calcium was eluted with 10% acetic acid and staining degree was quantified. As a result, higher production of calcium in the matrix was observed on the surface, on which silica was formed, compared to the control surface. 3) The surface (R5-MAP) which was coated without TMOS, but with R5-MAP fusion protein, and 4) the surface which was coated with R5-MAP fusion protein-silica nanoparticle complex formed after treatment of TMOS solution showed a large amount of calcium deposition in the matrix which is a late stage indicator of osteogenic differentiation, compared to the control groups, 1) the surface of polystyrene coverslip (NC) which was coated with none of the fusion protein and TMOS and 2) the surface (Si—NC) which was coated with TMOS, but without R5-MAP fusion protein. Further, 4) the surface which was coated with R5-MAP fusion protein-silica nanoparticle complex showed a better result than 3) the surface which was coated with only R5-MAP fusion protein. Consequently, it was confirmed that the R5-MAP protein itself and silica nanoparticle are effective for cell differentiation.

Example 4. Preparation of Surface Coating Composition by Use of Nanofiber

(56) 4-1: Coating Composition Using Nanofiber of Fusion Protein

(57) The R5-MAP fusion protein and a synthetic polymer PCL (polycaprolactone) solution were blended and used in an electrospinning process.

(58) In detail, for electrospinning, the fusion protein prepared in Example 1 and polycaprolactone (PCL) were dissolved in hexafluoroisopropanol (HFIP) at a concentration of 6.5 wt %, respectively. Thereafter, the polycaprolactone (PCL) solution and the R5-MAP fusion protein solution were mixed at a ratio of 5:5, and subjected to electrospinning in a 5 ml-syringe having a needle diameter of 0.4 mm at a mass flow rate of 0.3 ml/h. In this regard, while high voltage (8 to 10 kV) was applied to the tip of the needle of the syringe, a nanofiber was produced. The produced nanofiber was randomly collected on the aluminum foil which was set at 10 cm distance from the tip of the needle. The produced nanofiber was shown in FIG. 15.

(59) FIG. 15 shows an R5-MAP fusion protein-based nanofiber (R5-MAP/PCL mixture, 50:50 (w/w)).

(60) 4-2: Coating Composition Using Nanofiber of Fusion Protein-Silica Nanoparticle Complex

(61) The fusion protein (R5-MAP) nanofiber prepared in Example 4-1 was dried under vacuum for at least 3 days to remove the remaining solution.

(62) The dried R5-MAP nanofiber was treated in the TMOS solution for about 30 seconds to bind the silica nanoparticles on the fiber surface, thereby preparing a nanofiber of the fusion protein-silica nanoparticle complex. A photograph of the nanofiber of the fusion protein-silica nanoparticle complex thus obtained is shown in FIG. 15.

(63) FIG. 16 shows formation of silica nanoparticles on the surface of the nanofiber by treatment of the R5-MAP fusion protein-based nanofiber (R5-MAP/PCL mixture, 50:50 (w/w)) with TMOS solution.

(64) 4-3: Elementary Analysis of Silica on Coating Surface

(65) The complex nanofiber including silica nanoparticles bound to the fusion protein (R5-MAP) nanofiber in Example 4-1 was subjected to energy dispersion X-ray spectroscopy (EDS), and the result is shown in FIG. 17. FIG. 17 shows formation of silica nanostructure, examined by energy dispersion X-ray spectroscopy (EDS).

(66) As shown in FIG. 17, the surface elemental analysis by EDS showed that the formed silica occupied about 29% of the surface. Consequently, prepared was a nanofiber which was coated with the surface coating composition including the fusion protein-silica nanoparticle complex for promoting tissue regeneration of the present invention.