Method For Delivering Gene In Cells
20220056479 · 2022-02-24
Inventors
- Pei Wang (Suzhou, CN)
- Luying Jia (Suzhou, CN)
- Yanni Lin (Suzhou, CN)
- Zhijie Niu (Suzhou, CN)
- Dan Xu (Suzhou, CN)
- Jiaolong Fang (Suzhou, CN)
- Hui Yuan (Suzhou, CN)
- Ting Liu (Suzhou, CN)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N2740/15043
CHEMISTRY; METALLURGY
A61K35/17
HUMAN NECESSITIES
C12N2740/16043
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
Abstract
Disclosed is a method for delivering a gene into target cells, wherein immune cells are used as a vector for virus packaging and transportation to complete the delivery of biomacromolecules among cells, and thus change original characteristics of the target cells or generate new characteristics in the target cells. The gene delivery system, on one hand, can kill target cells such as tumor cells by utilizing the specificity of immune cells; and on the other hand, can modify genes of cells in a lesion by gene delivery to target cells, to directly kill the target cells.
Claims
1. A method for delivering biomacromolecules to target cells, the method comprising the following steps: a) introducing biomacromolecules into immune cells to assemble a delivery system containing biomacromolecules; b) bringing the delivery system of step a) into contact with target cells; and c) the target cells receiving the biomacromolecules delivered by the delivery system.
2. The method as claimed in claim 1, wherein the immune cells are T cells, B cells or NK cells.
3. (canceled)
4. (canceled)
5. The method as claimed in claim 1, wherein with respect to the immune cells, the biomacromolecules are exogenous biomacromolecules.
6. The method as claimed in claim 1, wherein the biomacromolecules are selected from one or more of a polypeptide, a protein and a genetic material.
7. The method as claimed in claim 6, wherein the genetic material is DNA and/or RNA.
8. The method as claimed in claim 7, wherein the RNA is selected from one or more of mRNA, siRNA and gRNA.
9. (canceled)
10. (canceled)
11. The method as claimed in claim 7, wherein the gRNA and a coding gene encoding a Cas protein are delivered to the target cells.
12. The method as claimed in claim 7, wherein the DNA is selected from one or more of linear DNA, single-stranded DNA and plasmid DNA.
13. The method as claimed in claim 6, wherein the biomacromolecules are surface molecules, surface antigens, secreted molecules or cytokines.
14. (canceled)
15. The method as claimed in claim 1, wherein the method is performed in vitro or on ex-vivo cells.
16. The method as claimed in claim 1, wherein step a) is performed in vitro, and steps b) and c) are performed in vivo.
17. The method as claimed in claim 12, wherein the plasmid is a plasmid for assembling a virus.
18. The method as claimed in claim 1, wherein the delivery system is a viral system.
19. The method as claimed in claim 18, wherein the viral system is selected from one or more of an adeno-associated virus, an adenovirus, a retrovirus, a lentivirus, a rabies virus and a herpes virus.
20. The method as claimed in claim 19, wherein the viral system is a lentivirus.
21. The method as claimed in claim 1, wherein the delivery system is an exosome.
22. The method as claimed in claim 21, wherein the exosome, which encapsulates the polypeptide, protein and/or genetic material, is released to outside the immune cells and comes into contact with the target cells.
23. (canceled)
24. The method as claimed in claim 1, wherein the biomacromolecules of step a) are introduced into the immune cells by means of electrotransfection, or introduced into the immune cells by means of chemical reagents.
25. The method as claimed in claim 1, wherein the target cells are tumor cells, pathogens, stem cells or somatic cells.
26. The method as claimed in claim 11, wherein the Cas protein is selected from Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas12 and Cas13, and mutants of the above-mentioned proteins, and fusion proteins or protein complexes including these proteins or mutants thereof.
27. (canceled)
Description
DRAWINGS OF THE DESCRIPTION
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062] Control G/C represents a positive control in a kit, which proves the feasibility of the detection method; NC represents a negative control, which only amplifies a target gene fragment to indicate the position of an original fragment; and G3-1-S, G3-2-S, G3-1-A, G3-2-A, G3-3 and G3-0 indicate a detection result of the gene editing efficiency of cells in each experimental group.
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
DETAILED DESCRIPTION OF THE INVENTION
[0070] The present invention is described in detail herein with reference to the following definitions and examples. The content of all the patents and published documents referred to herein, comprising all the sequences disclosed in these patents and published documents, are expressly incorporated herein by way of reference.
[0071] Immune Cells
[0072] “Immune cells” are used as “donor cells” in the present invention.
[0073] The immune cells described herein refer to cells that can recognize antigens and produce specific immune responses, such as T cells, B cells, natural killer cells (NK) cells, macrophages, modified immune cells, etc.
[0074] In tumor immune response, cellular immunity mediated by T cells plays a major role. T cells recognize tumor antigens via T cell receptors (TCRs), thus activating themselves and killing tumor cells. The most common means for modifying T cells focuses on a transgenic T cell receptor (tTCR) and a chimeric antigen receptor (CAR). A tTCR is modified from the natural TCR on a T cell, so that the tTCR maintains the original structure while also having the characteristics of antigen selectivity and high affinity. The modified T cell is TCR-T. A CAR combines the characteristics of a B cell receptor recognizing an antigen and a T cell receptor responding upon stimulation, so that a modified T cell (CAR-T) can effectively attack cancer cells that express a corresponding antigen.
[0075] In a classic CAR, scFv fragments of monoclonal antibodies that specifically recognize tumor antigens are implanted on T cells or NK cells. For example, retroviral vectors can be used to introduce CAR-encoding nucleic acids into T cells, NK cells, or NKT cells. In this way, a large number of cancer-specific T cells, NK cells, or NKT cells can be produced for adoptive cell transfer. Early clinical studies of this method have shown efficacy in some cancers.
[0076] Target Cell
[0077] A “target cell” is also referred to as a “host cell” or a “receptor cell” in the present invention.
[0078] A target cell is a cell that can be specifically recognized by an immune cell, for example, the target cell can be a tumor cell, an allogeneic cell, and can also be a pathogen, or other immune cells that present alloantigens. The surfaces of the target cell all have antigen expression different from an autoantigen.
[0079] Any type of cells may become a target cell, for example, a stein cell, f such as an embryonic stein (ES) cell, an induced pluripotent stein (iPS) cell, and a germ cell; and a somatic cell, such as a fibroblast, a hematopoietic cell, a neuron, a muscle cell, a bone cell, a liver cell, and a pancreatic cell.
[0080] Biomacromolecule
[0081] In the present invention, biomacromolecules refer to a polypeptide, a protein and a genetic material.
[0082] The term “genetic material” refers to a polymerized form of nucleotides having any length, that is, a polynucleotide sequence, which is a polymerized form of deoxyribonucleotides or ribonucleotides, or analogs thereof. A polynucleotide can have any three-dimensional structure and can perform any known or unknown function. The following are non-limiting examples of a polynucleotide: a coding region or a non-coding region of a gene or a gene fragment, an exon, an intron, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short hairpin RNA (shRNA), micro-RNA (miRNA), silent RNA (siRNA), guide RNA (gRNA), a ribozyme, cDNA, a recombinant polynucleotide, a branched polynucleotide, a plasmid, a vector, isolated DNA of any sequence, isolated RNA of any sequence, a nucleic acid probe and a primer. A polynucleotide may contain one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modification of a nucleotide structure can be carried out before or after the assembly of a polymer. The sequence of a nucleotide can be interrupted by non-nucleotide components. Polynucleotides can be further modified after polymerization, for example, by conjugation with labeled components.
[0083] The protein, which acts as a biomacromolecule, of the present invention can be a surface molecule, a surface antigen (such as surface antigen CD19), a secreted molecule, and a cytokine, for example, CCL19, etc.
[0084] A surface molecule refers to a molecule located near the surface of a cell. Generally, a microscope combined with staining or other positioning techniques can be used to observe that the molecule is located on the cell membrane, or the molecule can be detected by means of flow cytometry when the cell membrane is intact. The surface molecule can be a membrane protein, and the membrane protein can be integrated on the cell membrane or interact/bind with the cell membrane. The membrane protein can be modified, e.g. by means of adding fatty acid chains or through prenylation. The membrane proteins are divided into several categories, including an integral membrane protein and a peripheral membrane protein. The integral membrane protein is a protein integrated on the membrane. Generally, surfactants (such as SDS) or other non-polar solvents need to be added before the protein can be separated from the membrane. A transmembrane protein belonging to the integral membrane protein can have a transmembrane domain, and a unidirectional integral membrane protein can be bound to the membrane from only one direction (outside or inside the membrane) and partially inserted into the membrane. The peripheral membrane protein is a protein that can temporarily bind to or interact with membrane or other membrane proteins. A class of common surface molecules are clusters of differentiation, also called population of differentiation or CD for short, which provides a target for immunophenotypic analysis/immunotyping. Many molecules in cluster of differentiation are ligands, receptors, or cell adhesion molecules. Surface antigen CD19 is one type of molecule in a cluster of differentiation.
[0085] A secreted molecule refers to a molecule secreted by a cell and can be secreted through different secretory pathways. A secreted molecule generally has the ability to leave a cell, and includes a cytokine, a hormone, a growth factor, etc. A secreted molecule can be located in a vesicle and transported via a vesicle. Cytokines are a class of important secreted molecules, and are usually a class of proteins that play a role in cell signal transduction. There are many types of cytokines, including chemokines, interferons, interleukins, lymphokines, tumor necrosis factors, etc. CCL19 is one type of cytokine. In the present invention, the biomacromolecule introduced into an immune cell can be a biomacromolecule different from those in the immune cell, i.e., an exogenous biomacromolecule; and the biomacromolecule can also be the same as the biomacromolecule produced and expressed by the immune cell itself.
[0086] Plasmid
[0087] The genetic material of the present invention can be directly introduced into an immune cell, for example, linear DNA can be directly introduced into an immune cell; or the genetic material of the present invention can be introduced into an immune cell via a constructed plasmid.
[0088] The plasmid contains the genetic material that needs to be delivered. The genetic material can be DNA or RNA, and the genetic material is used by an immune cell for the production or enhancement of a delivery system.
[0089] The plasmid may contain a helper plasmid required for virus packaging and a shuttle plasmid with a target molecule gene; the target molecule gene can be a tracer protein (such as GFP) or other effector molecules related to cell functions (such as cytokines), and can also be a gene editing system (such as a CRISPR system);
[0090] and the plasmid can also contain a helper plasmid needed to promote exosome packaging, secretion, and orientation, and a plasmid with a target molecule gene.
[0091] The plasmid may also contain one or more regulatory elements selected on the basis of a host cell to be used for expression. The regulatory elements are operably linked to a nucleic acid sequence to be expressed. In a recombinant plasmid, “operably linked” is intended to mean that a nucleotide sequence of interest is linked to the one or more regulatory elements in a manner that allows the expression of the nucleotide sequence (for example, in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).
[0092] Viral System
[0093] The viral system used as a delivery system in the present invention can be a lentivirus, an adeno-associated virus (AAV), an adenovirus, a retrovirus, a rabies virus and a herpes virus.
[0094] Viruses are infectious microorganisms that can generally only replicate in living cells or other biological organisms. Viruses have a wide and varied spectrum of infection, including animals, plants, and microorganisms. Different viruses have very different shapes and sizes. Generally, a complete virion will contain a long nucleic acid strand, which acts as genetic material thereof, and a protective protein shell called a capsid, wherein capsid protein is generally encoded by viral genetic material. In addition, viruses can generally also obtain a lipid envelope from the membrane of the infected host cell. This envelope contains a protein encoded by a viral genome or a host cell genome, and this envelope plays an important role in the infectivity of the virus.
[0095] The genetic material of viruses can be a DNA or RNA genome; therefore, viruses can be divided into DNA viruses and RNA viruses. Viral genomic DNA or RNA can be either single-stranded or double-stranded, and at the same time, can also be circular, linear or even fragmented. Adenoviruses are double-stranded DNA (dsDNA) viruses. In view of the infectivity thereof with regard to dividing and non-dividing cells and the ability thereof to carry a large number of exogenous genes, adenoviruses are often used as a viral vector in gene therapy. In addition, the use of oncolytic adenovirus in cancer treatment has been approved in China. Adeno-associated virus (AAV) is a single-stranded DNA (ssDNA) virus. The immune response induced thereby in the human body is very weak, and same has a variety of serological subtypes that are specifically infectious to different tissues and organs, and therefore, adeno-associated virus has obvious advantages in gene therapy. At present, AAV has been widely used in clinical trials of gene therapy, including hemophilia, spinal muscular atrophy, and Parkinson's disease, etc. Some common viruses such as herpes simplex virus (HSV) are also DNA viruses, and are considered to be useful for the potential treatment of cancers due to the oncolytic ability thereof.
[0096] In addition, there are also many types of RNA viruses, for example, rabies virus is a highly pathogenic and highly infectious RNA virus. The use of the virus with reduced toxicity as a vaccine can bring about immunity to the virus in the body. Retroviruses are common single-stranded RNA viruses. After invading a host cell, a retrovirus transcripts its own RNA genome in reverse to generate DNA, and integrates the DNA into the genome of the host cell. The genetic information of the virus will be transcribed and translated together with the genes of the host cell, and then assembled into a new virus. Retroviruses have been successfully used in gene delivery systems due to the high capacity and wide spectrum of infection thereof. Lentivirus is a genus of retrovirus. Lentivirus is named because lentivirus can lead to chronic fatal diseases after undergoing a long latent period. The most well-known lentivirus is human immunodeficiency virus (HIV). A lentivirus can integrate a large amount of genes into a host cell genome to obtain stable expression, and can efficiently infect a variety of cell types, and therefore, lentiviruses have become the most effective method for gene delivery.
[0097] Exosome
[0098] An exosome is an important constituent part of an extracellular vesicle, and is a membrane structure of 30-100 nanometers. An exosome originates from an endosome. In view of a membrane closed structure of the exosome and encapsulated cytoplasmic components, the exosome plays an important role in intercellular interactions.
[0099] Exosomes can be shed off from and produced by almost all cells in the human body, and exosomes have many functions under different physiological and pathological conditions. Compared with non-cancer cells, cancer cells will produce more exosomes. These exosomes can promote tumor generation and metastasis by regulating anti-tumor immune mechanisms, e.g. by inducing drug resistance, promoting angiogenesis, changing a tumor microenvironment to cause immunosuppression, autocrine to promote cell proliferation and metastasis, etc. In contrast, it has also been reported that exosomes use immunostimulatory effects to produce beneficial therapeutic effects, such as activating an anti-tumor innate immune response and promoting the presentation of tumor antigens to the immune system. Therefore, exosomes, as an important form of intercellular communication, and due to the special performance thereof with regard to tumor cells, are not only an important means for assisting treatment, but also a candidate as drug targets.
[0100] At present, there are many application studies about and clinical trials on exosomes, mainly including using same as vaccines or delivery tools. For example, exosomes carrying tumor-specific antigens can be produced by autoimmune cells (such as dendritic cells, DC) or tumor cells of patients by means of spontaneous secretion or secretion via stimulation, and these exosomes can be reintroduced into the patient to activate an immune response against the corresponding condition; in addition, exosomes, as an intercellular transport vector with extremely high biocompatibility, can be used to directionally package therapeutic drugs, including chemical small molecule drugs, therapeutic biomacromolecules and even therapeutic viral particles. There have been many studies on the packaging of specific biomacromolecules by means of exosomes, including the transfection of production cells using specific exogenous genes and the enhancement of the packaging directionality and secretion modification of exosomes, and the subsequent collection and purification of exosomes to further promote the application and evaluation thereof in disease treatment. The packaging of virions is based on using cells to produce virions, promoting the production, by cells, of exosomes that can encapsulate the virus and using a special process to collect the exosomes and verify the function thereof.
[0101] CRISPR/Cas System
[0102] The CRISPR/Cas system is a nuclease system formed by a clustered regularly interspaced short palindromic repeat (CRISPR) sequence and CRISPR-binding protein (i.e., a Cas protein), which system is capable of cleaving almost all genomic sequences adjacent to protospacer-adjacent motifs (PAM) in eukaryotic cells (Cong et al., Science, 2013, 339: 819-823). “CRISPR/Cas system” collectively refers to transcripts involved in CRISPR-associated (“Cas”) genes, and other elements involved in the expression of or directing the activity of CRISPR-associated genes, including sequences encoding a Cas gene, a tracr (trans-activated CRISPR) sequence (e.g. tracrRNA or active partial tracrRNA), a tracr mate sequence (encompassing a “direct repeat” and a processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence or other sequences and transcripts from a CRISPR locus. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system).
[0103] CAS proteins can be divided into four different functional modules: a target recognition module (interval acquisition), an expression module (crRNA processing and target binding), a interference module (target cleavage) and an auxiliary module (regulatory and other CRISPR-related functions). A CRISPR-associated endonuclease Cas protein can target specific genomic sequences through guide RNA (gRNA). The Cas protein of the present invention is a Cas protein with a DNA binding function, such as a natural Cas protein, a mutated Cas protein, such as a Cas protein in which, after mutation, nuclease is inactivated (dead Cas, dCas).
[0104] Non-limiting examples of Cas proteins include: Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Cas12, Cas13, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, and Csf4, homologous proteins in different species thereof, endonuclease-inactivated mutant proteins (dCas proteins), or modified versions thereof.
[0105] In some embodiments, the Cas protein is a Cas9 protein. A Cas9 variant can be a Cas9 endonuclease that does not naturally exist in nature and that is obtained by means of protein engineering or by means of random mutagenesis. Cas9 variants of the present invention can, for example, be obtained by means of mutations, i.e. the deletion of, or insertion of or substitution of at least one residue in the amino acid sequence of a Streptococcus Pyogenes Cas9 endonuclease (COG3513). In some embodiments, the Cas9 protein is Streptococcus pneumoniae, Streptococcus pyogenes, or Streptococcus thermophilus Cas9, and may include mutated Cas9 derived from these organisms, or variants with other amino acid sequences linked to Cas9, and these Cas9 are known; for example, the amino acid sequence of the Streptococcus pyogenes Cas9 protein may be found in the SwissProt database under the accession number Q99ZW2; the amino acid sequence of Neisseria meningitidis Cas9 protein may be found in the UniProt database under number A1IQ68; the amino acid sequence of the Streptococcus thermophilus Cas9 protein may be found in the UniProt database under number Q03LF7; and the amino acid sequence of Staphylococcus aureus Cas9 protein may be found in the UniProt database under number J7RUA5.
[0106] Nuclease-inactivated mutant proteins (dCas proteins) are a variant, obtained through mutation, of the Cas protein. The endonuclease activity of the mutant Cas protein is inactivated or substantially inactivated, so that the Cas protein loses or substantially loses endonuclease activity, and is thus unable to cleave a target sequence. The non-limiting examples of the Cas proteins listed above can all be modified, via mutation, into a dCas protein by means of the inactivation of endonuclease, said mutation comprising the insertion, deletion or substitution, etc. of one or more amino acid residues.
[0107] For example, certain Cas9 mutations can cause a Cas9 protein to lose or substantially lose endonuclease activity, thereby making the protein unable to cleave a target sequence. For Cas9 of a certain species, such as SpCas9, exemplary mutations that reduce or eliminate endonuclease activity comprise one or more mutations at the following positions: D10, G12, G17, E762, H840, N854, N863, H982, H983, A984, D986 or A987. The literature proves that guide RNA (gRNA)-mediated endonuclease-inactivated Cas9 (called dCas9) can lead to the inhibition of the expression of E. coli-specific endogenous genes and EGFP reporter genes in human cells (Qi et al. Cell, 2013, 152: 1173-1183). This study proves that the use of a gRNA-mediated dCas9 technology can accurately recognize and bind to the corresponding genome.
[0108] A dCas protein can be a variant that does not naturally exist in nature and that is obtained by means of protein engineering or by means of random mutagenesis, and the endonuclease activity thereof is inactivated or substantially inactivated. The corresponding dCas9 protein can, for example, be obtained by means of mutations, i.e. the deletion of, or insertion of or substitution of at least one residue in the amino acid sequence of an Streptococcus Pyogenes Cas9 endonuclease.
[0109] A Cas protein that acts on two strands of DNA generally has two endonuclease active sites. If there is only one site that is mutated or deleted to cause the enzymatic activity of the site to be deactivated, then Nickase, such as Cas9-nickase, that cleaves a single strand of DNA can be obtained, and is widely used because of the high fidelity rate thereof and the characteristics of cleaving a DNA single-strand.
[0110] In addition, a Cas protein variant which is screened by means of mutation having one or more point mutations is proved to be able to improve the specificity of the Cas protein variant, reduce the off-target rate of genome editing, or make the Cas protein variant compatible with more PAM sequences, such as eSpCas9, SpCas9-HF, HeFSpCas9 and HIFI-SpCas9, xCas9 (Christopher A. V et al., Nature Medicine, 2018(24), pp 1216-1224; Johnny H. H et al., Nature, 2018, 556 (7699), pp 57-63), etc.
[0111] Considering that a Cas protein contains multiple functional modules and the protein sequence thereof is relatively long, in order to facilitate packaging and transportation and function control, the protein sequence thereof will also be truncated by means of protein engineering research to form a Cas protein system, for example, a Split-SpCas9 system containing a complex formed by truncated proteins (Jana Murovec et al., Plant Biotechnology Journal, 2017, 15, pp. 917-926).
[0112] In some embodiments, the Cas protein is a fusion protein or a protein complex containing the above-mentioned proteins or mutants thereof, including but not limited to a variant in which other amino acid sequences are linked to Cas. Fusing other functional proteins on the basis of the above Cas proteins or the variants thereof can increase the specificity and effectiveness of the function of the Cas proteins, and can also produce effects other than cleavage of the genome. For example, the fusion of FokI to Cas or dCas can increase the specificity of the Cas9 protein for genome cleavage. Since FokI has cleavage activity only upon dimerization, a pair of recognition regions are required to complete the cleavage, thereby reducing the off-target rate. As another example, FokI is linked to a Cas protein from which some functional domains have been truncated but which retains the DNA binding ability thereof (Ma et al., ACS Synth. Biol., 2018, 7 (4), pp 978-985). As another example, the fusion of base modification enzymes (such as deaminase, cytosine deaminase and adenine deaminase) on Cas-nickase or dCas can efficiently perform targeted base modification on the target region of the genome (Komor et al., Sci. Adv. 2017, 3: eaao4774). As another example, the fusion of some protein domains that can regulate gene expression to dCas9 can effectively regulate the expression of target genes, for example, dCas9 fused with transcription activators such as VP64 and VPR can bind to nearby the target gene under the guidance of gRNA to activate expression; conversely, dCas9 fused with transcription inhibitors (such as SRDX) has a down-regulation effect on target genes. dSpCas9-Tet1 and dSpCas9-Dnmt3a can be used to modify epigenetic status, and regulate the methylation status of endogenous gene promoters to regulate protein expression.
[0113] Guide RNA (gRNA)
[0114] An RNA component included in the CRISPR is referred to as a guide RNA (gRNA). Guide RNA generally comprises a guide sequence and a backbone sequence, wherein the guide sequence and the backbone sequence may be in the same molecule or in different molecules. The role of the guide RNA is to direct the Cas protein to cleave a DNA site complementary to the guide sequence, i.e., the target sequence. In general, a guide sequence is any polynucleotide sequence having sufficient complementarity with a target sequence to hybridize with this target sequence and direct the specific binding of a CRISPR complex to the target sequence. The degree of complementarity between a guide sequence and its corresponding target sequence is about or more than about 50%, or more. In general, a guide sequence is about or more than about 12 nucleotides in length. The backbone sequence is necessary for guide RNA. The sequences other than the guide sequence generally comprise a tracr sequence and a tracr mate sequence, which generally do not vary with changes in the target sequence.
[0115] The guide RNA of the present invention includes single-stranded guide RNA (sgRNA) and double-stranded guide RNA composed of crRNA and tracrRNA. In certain embodiments, the guide RNA has a double-stranded structure composed of crRNA (CRISPR RNA) and tracrRNA (trans-activated crRNA). crRNA generally comprises a guide sequence and a tracr mate sequence, and tracrRNA generally comprises a tracr sequence. In some embodiments, the guide RNA is a single-stranded molecule that generally comprises a guide sequence, a tracr mate sequence, and a tracr sequence, and the single-stranded molecule is also referred to as chimeric single-stranded guide RNA (sgRNA). When the tracr sequence and tracr mate sequence are contained within a single transcript, hybridization between the two produces a transcript having a secondary structure (such as a hairpin). Preferred loop forming sequences for use in hairpin structures are four nucleotides in length, and most preferably have the sequence GAAA. However, longer or shorter loop sequences may be used, as may alternative sequences. The sequences preferably include a triplet (for example, AAA), and an additional nucleotide (for example, C or G). Examples of loop forming sequences include CAAA and AAAG. In one embodiment, the transcript or transcribed polynucleotide sequence has at least two or more hairpins. In preferred embodiments, the transcript has two, three, four or five hairpins. In a further embodiment, the transcript has at most five hairpins. In some embodiments, the transcript may contain one or more nucleic acid structures that bind to biomolecules other than the Cas protein. For example, certain RNA motifs can recruit specific protein domains, such as inserting MS2 RNA sequences into sgRNA sequences, and the RNA sequences can be used to recruit MCP proteins (MS2 bacteriophage coat protein) and proteins that fused or form complexes with MCP proteins (Zalatan et al., Cell, 2015, 160: 339-350). In some embodiments, the single transcript further includes a transcription termination sequence; preferably, this is a Poly-U sequence, for example six U nucleotides.
[0116] In some embodiments, one or more vectors driving the expression of one or more elements of a CRISPR system are introduced into a host cell, and the guide RNA enables expression of these elements of the CRISPR system to direct the formation of a CRISPR complex at one or more target sites.
[0117] Delivery Method
[0118] Firstly, an exogenous genetic material is introduced into an immune cell, assembling a delivery system for the genetic material. Any method known in the art can be considered for delivering genetic material into immune cells. Non-limiting examples include viral transduction, transfection by means of electroporation, liposome delivery, polymeric carriers, chemical carriers, lipid complexes, polymeric complexes, dendrimers, nanoparticles, emulsions, a natural endocytosis or phagocytosis pathway, a cell-penetrating peptide, microinjection, microneedle delivery, particle bombardment, etc.
[0119] A preferred embodiment is transfection means of by electroporation, and non-limiting examples of instruments which can be used in electroporation include: the Neon transfection system (Thermo Fisher Scientific), a Gemini instrument and an AgilePulse/CytoPulse instrument (BTX-Harvard apparatus), the 4D-Nucleofector system, Amaxa Nucleofector II, the Nucleofector 2b device (Lonza), CTX-1500A (Celetrix), MaxCyte GT or VLX (MaxCyte), and Gene Pulser Xcell (Biorad). Based on guidance from manufacturers, the duration and intensity of pulses, interval between pulses, number of pulses, and optimal conditions for high transfection efficiency with low mortality can be modified.
[0120] In another preferred embodiment, biological macromolecules are introduced into cells via chemical reagents. The chemical reagents may include liposomes, polymeric carriers, lipid complexes, polymeric complexes, dendrimers, nanoparticles, emulsions, polyethylenimine (PEI), calcium phosphate, etc.
[0121] Secondly, immune cells can spontaneously produce a delivery system or be affected by the environment or target cells to produce a delivery system Immune cells have been proven to be useful for spontaneously packaging virions or producing exosomes, which virions or exosomes act as a delivery system. At the same time, since immune cells are a type of cells that can recognize antigens and produce immune responses, the controllability of the delivery system produced by the immune cells can be increased according to the immune response mechanism of the immune cells. Receptors of immune cells can form diverse protein receptors through the free combination of coding genes, so that a variety of antigens can be recognized. These antigens can be membrane surface molecules of pathogens or allogeneic cells, can also be specific marker proteins on the surface of tumor cells, and can also be antigen polypeptides processed and presented by other immune cells for pathogen tag molecules. The specific recognition of antigens can activate immune cells, thereby achieving the regulation of gene expression and the synthesis and release of effector molecules through an intracellular signal pathway network, thus producing an immune killing effect on pathogens, allogeneic cells and pathological cells carrying the antigens. Therefore, immune cells can be recruited to a lesion area, and can also be modified to specifically recognize markers on target cells and thus be activated, so that the immune cells can be controlled to produce a delivery system in a specific area and a specific environment, and can directionally affect the target cells more efficiently.
[0122] Finally, the delivery system is brought into contact with the target cells, and the contact can be carried out directly in vivo, or in vitro or in ex-vivo cells. The delivery system is used to transfect the target cells, or fuse with the target cells. The target cells receive the genetic materials delivered by the delivery system, and these genetic materials can function by means of integrating or not integrating into the target cell genome. For example, the genetic material delivered by some integrated viruses will first be integrated into the genome of the target cell, and the exogenous gene carried by the genetic material will be transcribed and translated along with the genetic material of the target cell itself, such that same can be stably expressed in the target cell. The genetic material may be some tracer proteins that can track the state of the target cell; and may also be some functional molecules, such as siRNA, which can continuously inhibit the expression of specific genes in the target cell; or some regulatory protein molecules which can change or regulate the function of the target cell; and even some gene editing tools, which achieve the reconstruction or regulation of target cell function by editing the genome of the target cell. Genetic material delivered in the form of non-integrated viruses or exosomes will also have the above functional applications. The difference is that in addition to the long-lasting effect on target cell gene editing, the other effects on the function of target cells will gradually attenuate after a certain period of time.
EXAMPLES
[0123] The examples are merely illustrative and are not intended to limit the present invention in any way.
[0124] The meanings of the abbreviations are as follows: “H” refers to hours, “min” refers to minutes, “s” refers to seconds, “ins” refers to milliseconds, “d” refers to days, “μL” refers to microliters, “mL” refers to milliliters, “L” refers to liters, “bp” refers to base pairs, “mM” refers to millimoles, and “μM” refers to micromoles.
Example 1. Lentiviral Particles Packaged and Released by Immune T Cells Complete the Intercellular Delivery of Protein Tags
[0125] 1. Experimental Design and Results:
[0126] 1.1. Experimental Design
[0127] In this example, donor and receptor cells were selected, the donor cells were processed to make same able to produce a virus that delivers the green fluorescent protein (GFP) gene; by means of detecting whether the receptor cells express green fluorescent protein, virus infection was confirmed and material delivery in the form of a virus between cells was verified.
[0128] 1.2. Experimental Method
[0129] Step (1) Construction of a Receptor 293T-dsRed Cell Line:
[0130] a) construction of an sgRNA and Cas9 co-expression vector: DNA sequences SEQ ID No: 1 and SEQ ID NO: 2) were synthesized, two DNA strands were phosphorylated (NEB: M0201S) and annealed to form a double strand, a px330 vector (Addgene, #42230) was digested with BbsI (NEB: R3539S), and the digested product was recovered with a gel recovery kit (Qiagen, 28706). The phosphorylated DNA double-stranded chains were ligated (NEB: M0202L) to the digested px330. The ligated product was transformed into competence DH5α (purchased from GeneWiz), and a single clone was picked and verified by means of Sanger sequencing.
[0131] b) A donor DNA gene expressing dsRed was constructed into a plasmid: a PCR reaction was set up as shown in Table 1, wherein the plasmid templates used were a pEASY-T3 cloning plasmid (TransGen: CT301) and pCMV-N-DsRed (Beyotime: D2705), and a 293T cell genome was obtained by lysing a 293T cell (Shanghai Institutes for Biological Sciences: GNHu17). The amplified and purified fragments were constructed together using a Gibson assembly method (NEB, E2611L) to form a circular plasmid, which was transformed into competent DH5α, and a single clone was picked and verified by means of Sanger sequencing. The obtained clone was a plasmid containing dsRed DNA. The schematic diagram of the donor in
TABLE-US-00001 TABLE 1 Primers and templates for donor DNA construction Primer sequence Template PCR product SEQ ID NO: 3, SEQ ID NO: 4 pEASY-T3 clone plasmid Donor backbone SEQ ID NO: 5, SEQ ID NO: 6 pCMV-N-DsRed CMV-dsRed SEQ ID NO: 7, SEQ ID NO: 8 pCMV-N-DsRed PolyA SEQ ID NO: 9, SEQ ID NO: 10 293T cell genome HAL SEQ ID NO: 11, SEQ ID NO: 12 293T cell genome HAR Note: HAL stands for a left homologous arm, HAR stands for a right homologous arm, CMV-dsRed is a target gene and a promoter fragment thereof, PolyA is a polyadenosine tail, and a donor backbone provides the origin of replication required for plasmid replication, and a resistance gene element.
[0132] c) An sgRNA and Cas9 co-expression vector and donor DNA were delivered to a 293T cell using liposome lipofectamine 3000 (Thermo: L3000001). One week after transfection, a cell population was digested into single cells with trypsin (Gibco: 12605028) and counted. Cells with red fluorescence (DsRed positive) were sorted into single cells in a 96-well plate using a flow sorter (FACSAria II), 300 monoclones were obtained and placed in a 5% CO.sub.2 cell incubator at 37° C. and cultured for two weeks. The grown monoclonal cells were subjected to expanded culture, and genomic DNA was extracted from the monoclone with red fluorescence detected by a fluorescence microscope. A red-light-emitting monoclone was subjected to PCR, and the PCR product was subjected to Sanger sequencing. For sequencing primers, see primer lists (SEQ ID NO: 13-18). The sequencing results verified that the constructed cell line had an exogenous gene expression cassette inserted at the target site (in this example, the site AAVS1 was selected) (
[0133] Step (2) Preparation of Donor and Receptor Cells Before Electrotransfection
[0134] The receptor cell 293T-dsRed prepared in step (1) was cultured for 2-3 generations, and digested with trypsin, and the cells were counted. The cells were diluted to a concentration of 1×10.sup.5/mL with a DMEM medium (10% serum, 1% P/S), and added to a 24-well plate (0.5 mL/well), and placed in a cell incubator and cultured for 5-6 hours, and then, the medium was changed to a 1640 medium (10% serum, 1% P/S).
[0135] Donor Jurkat T cells (Cell Bank of Chinese Academy of Sciences (Shanghai) (TCHU123)) were resuscitated in a 1640 medium (10% serum, 1% P/S) and cultured for 2-3 generations. The cells were counted and centrifuged, and then resuspended to 5.6×10.sup.7/mL with OPTI MEM (Life technologies: 31985070).
[0136] Step (3) Electrotransfection and Infection of Receptor Cells by Means of Viruses after Electrotransfection
[0137] Electrotransfection and virus assembly: 9 μL of Jurkat T cell suspension in 2.1 was taken, and the amount of plasmid was as follows: 225 ng of pLenti-GFP (
[0138] Infection of receptor cells by means of viruses: after electrotransfection was completed, 70 μL of electrotransfected Jurkat T cells was taken each time and added to the 293 T-dsRed receptor cell culture system in step (2) and a blank medium so that the virus infected the receptor cells.
[0139] See Table 2 for the design of the experimental groups (G1-1 and G1-2) and various control groups.
TABLE-US-00002 TABLE 2 Groups Donor cell Electrotransfection plasmid Receptor cell G1-1 Jurkat T pLenti-GFP, psPAX2, pM2.G 293T-dsRed G1-2 Jurkat T pLenti-GFP, psPAX2, pM2.G 293T-dsRed G1-3 Jurkat T pLenti-GFP, psPAX2, pM2.G None G2-1 Jurkat T pLenti-GFP, psPAX2 293T-dsRed G2-2 Jurkat T pLenti-GFP, psPAX2 293T-dsRed G2-3 Jurkat T pLenti-GFP, psPAX2 None G1-0-N None None 293T G1-0 None None 293T-dsRed
[0140] 2. Detection and Analysis
[0141] After the cells were co-cultured in a cell incubator at 37 degrees Celsius under 5% CO.sub.2 for 66 hours, the 24-well plate was photographed (inverted fluorescence microscope Eclipse Ti-U (Nikon)). After taking a photograph, a supernatant cell suspension in each well was sucked out. After centrifugation, the pellet was resuspended with 500 μL PBS, wherein adherent cells were rinsed twice with PBS, then digested with trypsin, and resuspended with 500 μL PBS. The cells in the supernatant and especially the cell suspension were respectively analyzed by means of a flow cytometer (flow cytometer FACSCelesta (BD Biosciences)).
[0142] If viruses can be successfully packaged and released, cells successfully infected with the viruses express GFP.
[0143] 3. Experiment Results
[0144] Donor and receptor cells can be distinguished by means of growth and tag proteins, wherein 293T-dsRed cells grow adherently and show an red irregular shape in fluorescence photography (
[0145] Jurkat cells can receive electrotransfection plasmids and express exogenous genes. pLenti-GFP is used as a shuttle plasmid in virus packaging, carries a complete expression cassette for an exogenous target gene, and can be expressed independently. The plasmid enters Jurkat cells by means of electrotransfection, resulting in the expression of the target gene, GFP, in the Jurkat cells (
[0146] When the electrotransfection plasmid meets virus packaging conditions, Jurkat cells can produce effective virions to infect receptor cells. Only when virus plasmids are complete (three-plasmid system: pLenti-GFP, psPAX2, pM2.G) can Jurkat cells produce effective virions to infect the receptor cell, 293T-dsRed. After being infected by viruses produced by Jurkat cells, 293T-dsRed expressed exogenous gene GFP, green irregular cells were detected in fluorescence photography (
TABLE-US-00003 TABLE 3 Proportion of Proportion of Proportion of Proportion of red fluorescent green green fluorescent green fluorescent cells in total fluorescent cells signal in non-red signal in red Group number cells in total cells fluorescent cells fluorescent cells Note Single-cell G1-0-N 0.13% 0.00% 0.00% 0.00% 293T group G1-0 95.70% 0.00% 0.00% 0.00% 293T-dsRed G1-3 0.60% 19.60% 19.72% N/A Jurkat G2-3 0.30% 18.60% 18.66% N/A Jurkat Experimental G1-1-S 0.73% 0.16% 21.60% N/A Repetition group G1-2-S 8.08% 1.54% 19.10% N/A G1-1-A 77.70% 16.24% 18.80% 7.30% Repetition G1-2-A 80.70% 15.11% 17.00% 7.21% Control group G2-1-S 1.88% 0.40% 21.50% N/A Repetition G2-2-S 8.08% 1.62% 20.00% N/A G2-1-A 77.70% 14.53% 18.60% 0.35% Repetition G2-2-A 80.70% 15.96% 19.70% 0.30%
[0147] The proportion of receptor cells in each group receiving GFP genetic material delivered by donor cells is shown in
[0148] This example demonstrates that effective virions can be produced by immune T cells, and a tag protein packaged by the virus can be delivered to a target cell by means of the virus, so that the tag protein is expressed in the target cell.
Example 2. Lentiviral Particles Packaged and Released by Immune T Cells can Complete the Intercellular Delivery of a Gene Editing System
[0149] Donor and receptor cells were selected, after the donor cells were processed to make same able to produce viruses for the delivery of a gene editing material (sgRNA), and the intercellular delivery of the gene editing system was verified by detecting the gene editing in a 293T receptor cell containing a Cas9 gene.
[0150] 1. Experimental Method
[0151] Step (1) Preparation of Receptor Cells
[0152] Construction of a 293T-Cas9 cell line: A LentiCRISPRv2 plasmid (Addgene, 52961; see
[0153] Step (2) Preparation of Donor and Receptor Cells Before Electrotransfection
[0154] 293T-Cas9 cells were resuscitated and cultured for 2-3 generations, and digested with trypsin, and the cells were counted. The cells were diluted to a concentration of 1×10.sup.5/mL with a DMEM medium (10% serum, 1% P/S), added to a 24-well plate (0.5 mL/well), and placed in a cell incubator and cultured for 5-6 hours, and then, the medium was changed to a 1640 medium (10% serum, 1% P/S).
[0155] Jurkat T cells were resuscitated in a 1640 medium (10% serum, 1% P/S) and cultured for 2-3 generations. The cells were counted and centrifuged, and then resuspended to 5.6×10.sup.7/mL with OPTI MEM (Life technologies: 31985070).
[0156] Step (3) Electrotransfection and Infection of Receptor Cells by Means of Viruses after Electrotransfection
[0157] a U6 promoter-sgRNA-U6 terminator sequence of pLenti-sgRNA-GFP was added to the pLenti-GFP plasmid in Example 1; see
[0158] 9 μL of the Jurkat T cell suspension in step (2) was taken, and the amount of plasmid was as follows: pLenti-sgRNA-GFP (225 ng), psPAX2 (180 ng) and pM2.G (135 ng). The volume after mixing was 12 μL, and the remaining amount was made up with OPTI MEM. Electrotransfection was repeated twice with NEON electrotransfection (Neon Transfection System, ThermoFisher MPK5000, MPK1025) parameters (1500 V, 3 pulses, 10 ins) and the obtained product was added to 200 μL 1640 medium (10% serum, 1% P/S). After electrotransfection was completed, 70 μL of electrotransfected Jurkat T cells was taken each time and added to a 293T-Cas9 cell or a blank medium.
[0159] See Table 4 for the cells and plasmid usage of specific groups.
TABLE-US-00004 TABLE 4 Groups Donor cell Electrotransfection plasmid Receptor cell G3-1 Jurkat pLenti-sgRNA-GFP, psPAX2, pM2.G 293T-Cas9 G3-2 Jurkat pLenti-sgRNA-GFP, psPAX2, pM2.G 293T-Cas9 G3-3 Jurkat pLenti-sgRNA-GFP, psPAX2 None G3-0 None None 293T-Cas9
[0160] Step (4) Detection and Analysis
[0161] After the cells were co-cultured for 66 hours, the 24-well plate was photographed (inverted fluorescence microscope Eclipse Ti-U (Nikon)). After taking a photograph, a supernatant cell suspension in each well was sucked out. After centrifugation, the pellet was resuspended with 500 μL PBS, wherein adherent cells were rinsed twice with PBS, then digested with trypsin, and resuspended with 500 μL PBS. A precipitate was collected by centrifuging the cells in the supernatant and especially the cell suspension, 80 μL of a QE buffer was respectively added, and the cells were lysed at 80° C. for 10 minutes. The cell lysate was used as a template, and primers (SEQ ID NO: 20 and SEQ ID NO: 21) for target genes were used for fragment amplification. The above PCR products were purified and recovered, and 400 ng of each sample was taken for surveyor detection (IDT: 706020).
[0162] 2. Experiment Results
[0163] Donor and receptor cells can be distinguished according to the respective genotype and morphology. 293T-Cas9 cells are monoclonal adherent growth cell lines that can stably express Cas9. Direct sgRNA transfection is performed on the cell line, and the target gene sequence is analyzed, which verifies that there is obvious target gene editing (
[0164] In this example, Lenti-sgRNA-GFP is used as a shuttle plasmid in virus packaging, and contains a complete exogenous gene GFP expression cassette and a specific sgRNA expression cassette. The plasmid enters Jurkat cells by means of electrotransfection, resulting in the expression of the target gene, GFP, in the Jurkat cells (
[0165] For one electrophoresis channel, the calculation formula is as follows:
[0166] The editing effect can reach an efficiency of about 9% under existing conditions through quantification. This example demonstrates that effective virions can be produced by immune T cells, and a gene editing system can be delivered to a target cell by means of a virus, so that a target gene is edited in the target cell.
Example 3. Lentiviral Particles Packaged and Released by Immune T Cells Complete the Delivery of a Surface Antigen
[0167] 1. Experimental Design and Method
[0168] 1.1 Experimental Design
[0169] In this example, donor and receptor cells were selected, and the donor cells were processed to make same able to produce viruses that deliver a cell surface antigen (in this example, CD19 is taken as an example). Intercellular material delivery in which viruses are taken as media was confirmed by means of detecting whether the receptor cells express the surface antigen.
[0170] 1.2 Experimental Method
[0171] Step (1) Construction of a Receptor 293T-dsRed Cell Line: The Same as Step (1) of Example 1
[0172] Step (2) Construction of a Lentiviral Expression Plasmid:
[0173] A Plasmid, pELPs (sequence refers to GenBank ID MP123113.1), was obtained using a complete synthesis method. The synthesized CD19 sequence is as shown in GenBank ID BC006338.2 (45-1715). The CD19 was ligated downstream of the EF-1α promoter in pELPs to obtain the plasmid pELPs-CD19 as shown in
[0174] Step (3) Preparation of Donor and Receptor Cells Before Electrotransfection: the Same as Step (2) of Example 1
[0175] Step (4) Electrotransfection and Infection of Receptor Cells by Means of Viruses after Electrotransfection:
[0176] the same as step (3) of Example 1. The electrotransfection plasmid was shown in Table 5.
TABLE-US-00005 TABLE 5 Groups Donor cell Electrotransfection plasmid Receptor cell G 1-0-N None None 293T G 1-0 None None 293T-dsRed G 1-1 Jurkat T pELPs-CD19, pM2.G 293T-dsRed G 1-2 Jurkat T pELPs-CD19, pM2.G 293T-dsRed G 1-3 Jurkat T pELPs-CD19, pM2.G None G 2-1 Jurkat T pELPs-CD19, psPAX2 293T-dsRed G 2-2 Jurkat T pELPs-CD19, psPAX2 293T-dsRed G 2-3 Jurkat T pELPs-CD19, psPAX2 None G 3-1 Jurkat T pELPs-CD19, psPAX2, pM2.G 293T-dsRed G 3-2 Jurkat T pELPs-CD19, psPAX2, pM2.G 293T-dsRed G 3-3 Jurkat T pELPs-CD19, psPAX2, pM2.G None
[0177] 2. Detection and Analysis
[0178] The cells co-cultured in the 24-well plate were placed in a cell incubator at 37° C. under 5% CO.sub.2 for 66 hours. Then, the cells were gently shaken and a supernatant cell suspension was taken, centrifuged, and resuspended with 500 μL of PBS to form a suspension cell sample (such as G 1-1-S, etc.). Adherent cells were digested with trypsin and then resuspended with 500 μl of PBS to form an adherent cell sample (such as G 1-1-A, etc.). The suspension cell sample and the adherent cell sample were respectively analyzed with a flow cytometer (the flow cytometer model is Invitrogen Attune NxT). 1/10 of the adherent cell sample was taken and further cultured for one week, then digested with trypsin and analyzed with a flow cytometer. Receptor cell 293T had a dsRed fluorescent tag. If viruses were successfully packaged by and released from Jurkat T cells and infected receptor cells, it was also possible to detect the expression of the cell surface antigen CD19 in dsRed-positive cells.
[0179] 3. Experiment Results
[0180] The results of flow cytometer analysis are summarized in Table 6. Donor cells and receptor cells can be distinguished by means of a dsRed fluorescent tag in flow cytometry analysis. Comparing G 1-0-N (293T), G 1-0 (293T-dsRed), and G 1-3-S (Jurkat T), it can be seen that both 293T cells and Jurkat T cells have no dsRed fluorescence, and 293T-dsRed has no less than 99% dsRed-positive cells.
[0181] A pELPs-CD19 plasmid is expressed after entering Jurkat T cells by means of electrotransfection. When Jurkat T cells have both the expression plasmid pELPs-CD19 and the packaging plasmids psPAX2 and pM2.G, the Jurkat T cells produce effective virions and infect receptor cells. The three plasmids are indispensable for the production of virions. If the lentivirus-mediated delivery of cell surface antigen CD19 is completed, stable CD19 expression can be detected in 293T-dsRed cells infected by virions. Comparing the data in column 3 (dsRed− Jurkat T cells) and column 4 (dsRed+ 293T-dsRed cells), which relate to experimental groups G 3-1 and G 3-2 and control groups G 1-1, G 1-2, G 2-1 and G 2-2, which lack a packaging plasmid, in Table 6, it can be seen that, in a suspension cell sample (G x-x-S), dsRed− Jurkat T cells have substantially consistent CD19 expression efficiency upon electrotransfection. In adherent cell samples (G x-x-A), when a virus packaging plasmid is absent (G 1-1-A, G 1-2-A, G 2-1-A and G 2-2-A), a small amount of CD19 expression can be detected in dsRed+ cells, which may be caused by cytoplasmic communication produced by contact between cells. Only when the three plasmids are transfected at the same time (G 3-1, G 3-2) can CD19+ cells forming a cell population be detected.
[0182] The adherent cells are further cultured for one week before being subjected to detection (
TABLE-US-00006 TABLE 6 CD19+ % CD19+ % dsRed+ CD19+ % in dsRed+ in dsRed− in dsRed+ % after dsRed+ cells Groups % cells cells one week after one week G 1-0-N 0 0.00899 0 NA NA G 1-0 99.8 0 0 99.1 0 G 1-1-S 90.0 75.5 0.65 NA NA G 1-1-A 44.6 77.8 0.90 95.9 0.00845 G 1-2-S 5.91 74.9 0 NA NA G 1-2-A 47.6 79.1 0.88 90.6 0.063 G 1-3-S 0 78.0 0 NA NA G 2-1-S 3.62 71.3 0 NA NA G 2-1-A 49.7 71.3 0.77 92.9 0.066 G 2-2-S 4.9 70.8 0 NA NA G 2-2-A 47.8 70.4 0.80 96.5 0.033 G 2-3-S 0 68.8 0 NA NA G 3-1-S 5.71 78.8 1.56 NA NA G 3-1-A 58.0 82.0 1.95 96.4 1.46 G 3-2-S 7.84 78.5 0 NA NA G 3-2-A 55.7 81.8 1.76 96.9 1.09 G 3-3-S 0 81.8 0 NA NA
Example 4. Lentiviral Particles Packaged and Released by Immune T Cells Complete the Delivery of a Secreted Protein Such as a Cytokine
[0183] 1. Experimental Design and Method
[0184] 1.1 Experimental Design
[0185] In this example, donor and receptor cells were selected, and the donor cells were processed to make same able to produce viruses that deliver a secreted cytokine (in this example, CCL19 is taken as an example). Intercellular material delivery in which viruses are taken as media was confirmed by means of detecting whether the receptor cells express the cytokine.
[0186] 1.2 Experimental Method
[0187] Step (1) Construction of a Receptor 293T-dsRed Cell Line: The Same as Step (1) of Example 1
[0188] Step (2) Construction of a Lentiviral Expression Plasmid:
[0189] The CD19 in the pELPs-CD19 (
[0190] Step (3) Preparation of Donor and Receptor Cells Before Electrotransfection: the Same as Step (2) of Example 1
[0191] Step (4) Electrotransfection and Infection of Receptor Cells by Means of Viruses after Electrotransfection: The Same as Step (3) of Example 1. The Electrotransfection Plasmid is Shown in Table 7.
[0192] 12 hours before flow cytometer detection, the drug Brefeldin A (eBioscience, 00-4506-51), which inhibits the transportation of secreted proteins, was added to half of the experimental groups and the control groups, such as G 1-1-B.
TABLE-US-00007 TABLE 7 Donor Electrotransfection Groups cell plasmid Receptor cell Drug added G 1-0-N None None 293T None G 1-0 None None 293T-dsRed None G 1-1 Jurkat T pELPs-CCL19, pM2.G 293T-dsRed None G 1-1-B Jurkat T pELPs-CCL19, pM2.G 293T-dsRed Brefeldin A G 1-2 Jurkat T pELPs-CCL19, pM2.G 293T-dsRed None G 1-2-B Jurkat T pELPs-CCL19, pM2.G 293T-dsRed Brefeldin A G 2-1 Jurkat T pELPs-CCL19, psPAX2 293T-dsRed None G 2-1-B Jurkat T pELPs-CCL19, psPAX2 293T-dsRed Brefeldin A G 2-2 Jurkat T pELPs-CCL19, psPAX2 293T-dsRed None G 2-2-B Jurkat T pELPs-CCL19, psPAX2 293T-dsRed Brefeldin A G 3-1 Jurkat T pELPs-CCL19, psPAX2, 293T-dsRed None pM2.G G 3-1-B Jurkat T pELPs-CCL19, psPAX2, 293T-dsRed Brefeldin A pM2.G G 3-2 Jurkat T pELPs-CCL19, psPAX2, 293T-dsRed None pM2.G G 3-2-B Jurkat T pELPs-CCL19, psPAX2, 293T-dsRed Brefeldin A pM2.G
[0193] 2. Detection and Analysis
[0194] The cells co-cultured in a 24-well plate were placed in a cell incubator at 37° C. under 5% CO.sub.2 for 54 hours. The drug Brefeldin A, which inhibits the transportation of secreted proteins, was added to a G x-x-B sample. After further culturing for 12 hours, the cells were gently shaken and suspension cells were collected. Then, adherent cells were digested with trypsin, and 1/10 of same were taken for further culture. The remaining adherent cells were mixed with suspension cells and analyzed with a flow cytometer (the flow cytometer model was Invitrogen Attune NxT). After one week, the adherent cells that were further cultured were digested with trypsin and analyzed with a flow cytometer. Receptor cell 293T had a dsRed fluorescent tag. If viruses were successfully packaged by and released from Jurkat T cells and infected receptor cells, it was also possible to detect the expression of the cytokine CCL19 in dsRed-positive cells.
[0195] 3. Experimental Results
[0196] The results of flow cytometer analysis are summarized in Table 8. Donor cells and receptor cells can be distinguished by means of a dsRed fluorescent tag in flow cytometry analysis. Comparing data in column 2 (dsRed+%) of G 1-0-N (293T) and G 1-0 (293T-dsRed) in Table 8, it can be seen that 293T cells have no dsRed fluorescence, and 293T-dsRed has no less than 99% dsRed-positive cells.
[0197] A pELPs-CCL19 plasmid is expressed after entering Jurkat T cells by means of electrotransfection. When Jurkat T cells have both the expression plasmid pELPs-CCL19 and the packaging plasmids psPAX2 and pM2.G, the Jurkat T cells produce effective virions and infect receptor cells. The three plasmids are indispensable for the production of virions. If the lentivirus-mediated delivery of cytokine CCL19 is completed, CCL19 is stably expressed in 293T-dsRed cells infected by virions. Since CCL19 is secreted outside the cell, CCL19 staining can only be detected in samples to which Brefeldin A, which inhibits transportation, is added. Comparing column 3 (dsRed− Jurkat T cells) and column 4 (dsRed+ 293T-dsRed cells), which relate to experimental groups G 3-1, G 3-1-B, G 3-2 and G 3-2-B and control groups G 1-1, G 1-1-B, G 1-2, G 1-2-B, G 2-1, G 2-1-B, G 2-2 and G 2-2-B, which lack a packaging plasmid, in Table 8, it can be seen that obvious CCL19+ cells can be detected only in samples to which Brefeldin A has been added, and Jurkat T cells have a substantially consistent CCL19 expression efficiency. In 293T-dsRed cells, when a virus packaging plasmid is absent (the data in column 4, which relates to G 1-1, G 1-1-B, G 1-2, G 1-2-B, G 2-1, G 2-1-B, G 2-2 and G 2-2-B), CCL19 expression is almost undetectable in dsRed+ cells. Only when the three plasmids are transfected at the same time and Brefeldin A is added (the data in column 4 of G 3-1-B and G 3-2-B) can CCL19+ cells be detected.
[0198] The adherent cells are further cultured for one week before being subjected to detection (
TABLE-US-00008 TABLE 8 CCL19+ dsRed+ CCL19+ % CCL19+ % % in % after in dsRed+ dsRed+ in dsRed− dsRed+ one cells after Groups % cells cells week one week G 1-0-N 0.00479 0.00383 0 NA NA G 1-0 99.4 0.77 0.012 99.8 0.046 G 1-1 84.0 2.84 0.24 99.8 0.053 G 1-1-B 83.3 12.9 0.27 99.6 0.092 G 1-2 82.2 3.49 0.30 99.8 0.10 G 1-2-B 83.1 10.4 0.28 99.7 0.10 G 2-1 88.5 6.56 0.22 99.9 0.10 G 2-1-B 89.1 21.3 0.37 99.8 0.15 G 2-2 88.1 9.69 0.37 99.9 0.13 G 2-2-B 90.2 21.2 0.26 99.7 0.18 G 3-1 91.1 9.29 0.35 99.9 0.18 G 3-1-B 90.8 23.1 1.36 99.9 0.46 G 3-2 90.0 9.41 0.46 99.9 0.16 G 3-2-B 91.7 21.9 1.06 99.9 0.66
Example 5. Lentiviral Particles Packaged and Released by Immune T Cells Complete the Delivery of a CRISPR System
[0199] 1. Experimental Design and Method
[0200] 1.1 Experimental Design
[0201] In this example, donor and receptor cells were selected, and the donor cells were processed to make same able to produce viruses that deliver a CRISPR system (in this example, Cas9 and gRNA are taken as examples). Intercellular material delivery in which viruses are taken as media was confirmed by means of detecting whether the corresponding gene was knocked out in the receptor cells. Unlike Example 2, in this example, a Cas9 enzyme and gRNA were delivered at the same time, so there is no need for target cells to express Cas9.
[0202] 1.2 Experimental Method
[0203] Step (1) Construction of a Plasmid Expressing RQR8:
[0204] A protein tag RQR8 gene (SEQ ID No: 22) was synthesized, and the PuroR gene in pLenti SpBsmBI sgRNA Puro (Addgene #62207) was replaced with an RQR8 gene to obtain a pLenti-RQR8 plasmid.
[0205] Step (2) Construction of a Receptor 293T-dsRed−RQR8 Cell Line:
[0206] For the construction of a 293T-dsRed cell line, see Example 1. The pLenti-RQR8 plasmid obtained in step (1) was transfected into 293T-dsRed cells with liposome PEI (Polysciences, 24765-2). After 24 hours, single cells were divided into four 96-well plates using a gradient dilution method. After confirming a single-cell well under a microscope, the cells were subjected to expanded culture at 37° C. under 5% CO.sub.2. The expression of dsRed and RQR8 was detected via a flow cytometer (Invitrogen Attune NxT), and double-positive clones were selected as receptor cells of the experiment.
[0207] Step (3) Construction of a gRNA and Cas9 Co-Expression Vector:
[0208] The synthesized DNA sequence is as shown in Table 9. The two DNA strands a and b in each group were phosphorylated with a T4 nucleotide kinase (NEB, M0201S) and then annealed to form a double strand. After the vector LentiCRISPRv2GFP (Addgene #82416) was digested with BsmBI (NEB, R0580L) and recovered, the phosphorylated DNA double-stranded chain was ligated into the vector with a T4 DNA ligase (NEB, M0202L) to obtain a plasmid LentiCRISPR-RQR8 gRNA. The plasmid expressed both Cas9 and gRNA targeting the RQR8 protein.
TABLE-US-00009 TABLE 9 No. Sequence SEQ ID No: 1-a CACCTCCTCCGCCGCCAGAACAC 22 1-b AAACGTGTTCTGGCGGCGGAGGA 23 2-a CACCATCCTAGCCTGTGTAGCGG 24 2-b AAACCCGCTACACAGGCTAGGAT 25 3-a CACCGGATCTGAACTGCCTACAC 26 3-b AAACGTGTAGGCAGTTCAGATCC 27 4-a CACCCCAATCCTAGCCTGTGTAG 28 4-b AAACCTACACAGGCTAGGATTGG 29 5-a CACCGATCTGAACTGCCTACACA 30 5-b AAACTGTGTAGGCAGTTCAGATC 31 6-a CACCCAAGCGGTGGTGGTAGGCT 32 6-b AAACAGCCTACCACCACCGCTTG 33 7-a CACCTTGGTGGACACGTTGCTGA 34 7-b AAACTCAGCAACGTGTCCACCAA 35 8-a CACCCAGGGCCATCCAACACAGC 36 8-b AAACGCTGTGTTGGATGGCCCTG 37
[0209] Step (4) Preparation of Donor and Receptor Cells Before Electrotransfection:
[0210] the same as step (2) of Example 1, but the receptor cells were the 293T-dsRed−RQR8 cell line obtained in step (2) of this example.
[0211] Step (5) Electrotransfection and Infection of Receptor Cells by Means of Viruses after Electrotransfection
[0212] the same as step (3) of Example 1. The electrotransfection plasmid is as shown in Table 10, and the co-cultured receptor cells are 293T-dsRed−RQR8.
TABLE-US-00010 TABLE 10 Donor Groups cell Electrotransfection plasmid Receptor cell G 1-0-N Jurkat None None G 1-0 None None 293T-dsRed-RQR8 G 1-1 Jurkat T LentiCRISPR-RQR8 gRNA, 293T-dsRed-RQR8 pM2.G G 1-2 Jurkat T LentiCRISPR-RQR8 gRNA, 293T-dsRed-RQR8 pM2.G G 1-3 Jurkat T LentiCRISPR-RQR8 gRNA, None pM2.G G 2-1 Jurkat T LentiCRISPR-RQR8 gRNA, 293T-dsRed-RQR8 psPAX2 G 2-2 Jurkat T LentiCRISPR-RQR8 gRNA, 293T-dsRed-RQR8 psPAX2 G 2-3 Jurkat T LentiCRISPR-RQR8 gRNA, None psPAX2 G 3-1 Jurkat T LentiCRISPR-RQR8 gRNA, 293T-dsRed-RQR8 psPAX2, pM2.G G 3-2 Jurkat T LentiCRISPR-RQR8 gRNA, 293T-dsRed-RQR8 psPAX2, pM2.G G 3-3 Jurkat T LentiCRISPR-RQR8 gRNA, None psPAX2, pM2.G
[0213] 2. Detection and Analysis
[0214] The cells co-cultured in the 24-well plate were placed in a cell incubator at 37° C. under 5% CO.sub.2 for 66 hours. Then, the cells were gently shaken and suspension cells were collected. Then, adherent cells were digested with trypsin, and 1/10 of same were taken for further culture. The remaining adherent cells were mixed with suspension cells and analyzed with a flow cytometer (the flow cytometer model was Invitrogen Attune NxT). The adherent cells were further cultured for one week and then digested with trypsin and analyzed with a flow cytometer.
[0215] The receptor cell 293T-dsRed−RQR8 expresses both a dsRed tag and an RQR8 tag at the same time, but the donor cell Jurkat T does not express these two tags, so in this experiment, RQR8 gRNA was used to verify the delivery of the CRISPR system. The expression of Cas9 and RQR8 gRNA in Jurkat T cells does not lead to gene knockout, nor does it affect the detection of gene editing efficiency. Only when Jurkat T cells successfully package and release a virus and Cas9 and RQR8 gRNA are delivered to receptor cells is the RQR8 tag expressed in the receptor cell knocked out, which is reflected in the detection results of the flow cytometer, namely, dsRed-positive and RQR8-negative cell populations can be detected.
[0216] 3. Experimental Results
[0217] The results of flow cytometer analysis are summarized in Table 11. Donor cells and receptor cells can be distinguished by means of dsRed and RQR8 tags in flow cytometry analysis. Comparing the data in column 2 of G 1-0-N (Jurkat T) and G 1-0 (293T-dsRed−RQR8), it can be seen that dsRed and RQR8 are almost undetectable in Jurkat T cells, whereas in 293T-dsRed−RQR8, there is not less than 96% dsRed+RQR8+ cells. Since the experiment detects the RQR8 knockout efficiency in 293T-dsRed−RQR8, and LentiCRISPR-RQR8 gRNA has a GFP tag, in order to detect the transfection efficiency, the GFP expression efficiency in Jurkat T cells (dsRed−RQR8−) will be counted. The efficiency of the intercellular delivery of the CRISPR system is demonstrated by a GFP+RQR8− cell population in a dsRed+ cell population.
[0218] When the expression plasmid LentiCRISPR-RQR8 gRNA and the packaging plasmids psPAX2 and pM2.G are simultaneously transfected into Jurkat T cells, the cells produce effective virions and infect receptor cells. The three plasmids are indispensable for the production of virions. If the lentivirus-mediated delivery of a CRISPR system is completed, the knockout of the RQR8 gene can be detected in 293T-dsRed−RQR8 cells infected with virions. Comparing data in column 3 (percentage of GFP+ cells in dsRed−RQR8− Jurkat T cells) and column 4 (percentage of GFP+RQR8− cells in dsRed+ 293T-dsRed−RQR8 cells), which relate to experimental groups G 3-1 and G 3-2 and control groups G 1-1, G 1-2, G 2-1 and G 2-2, which lack a packaging plasmid, in Table 11, it can be seen that Jurkat T cells have substantially consistent electrotransfection and expression efficiency. In dsRed+ cells, when a virus packaging plasmid is absent (G 1-1, G 1-2, G 2-1, G 2-2), the proportion of GFP+RQR8− cells is less than that of three-plasmid groups (G 3-1, G 3-2). Since the expression plasmid in this experiment is relatively large, the intercellular delivery efficiency is relatively low, and the difference between the experimental group and the control group is relatively small.
[0219] Adherent cells were further cultured for one week before being subjected to detection (
TABLE-US-00011 TABLE 11 GFP+ % in GFP+RQR8− dsRed+RQR8− dsRed+ dsRed−RQR8− % in dsRed+ % after one Groups RQR8+ % cells cells week G1-0-N 0 0 0 NA G 1-0 96.6 0 0 0.89 G 1-1 25.1 31.2 0.12 0.86 G 1-2 24.4 31.3 0.098 0.96 G 1-3 0.00915 34.3 0 NA G 2-1 33.6 33.4 0.025 0.72 G 2-2 25.1 35.0 0.082 0.59 G 2-3 0.00885 43.1 0 NA G 3-1 18.3 32.4 0.21 1.85 G 3-2 16.5 33.1 0.20 2.43 G 3-3 0.00641 42.3 0 NA
Example 6. Production, by Means of 293T Cells, of Exosomes Packaging Specific Proteins
[0220] 1. Experimental Design and Method
[0221] 1.1 Experimental Design
[0222] In this example, exosomes secreted in a cell culture supernatant were collected and purified and analyzed. In order to facilitate the detection of exosomes, cells were transfected with a specific plasmid (pDB30). The target protein expressed by the plasmid is a CD63-Nluc fusion protein, wherein CD63 (NM_001267698.1) is an exosome-specific tag, and Nluc (JQ513379.1) is a luciferase reporter gene. The expression of the reporter gene can be quantified by catalyzing the reaction of a substrate via the fusion protein and detecting the amount of fluorescence produced, which can thus reflect the secretion of exosomes and the packaging of the target protein. At the same time, the exosomal booster plasmid (pDB60) in the literature report concerning cell co-transfection has been experimentally proven to increase the production and secretion of exosomes.
[0223] In this example, two types of cells, 293T and Jurkat, were used, and the ability of the two cells to produce exosomes was respectively investigated.
[0224] The extraction of exosomes is based on the different physical and chemical properties of exosomes and cells. Separation and purification were carried out via a differential centrifugation method and analysis of yield properties was carried out.
[0225] 1.2 Experimental Method
[0226] Step (1) Construction of Plasmids, Wherein the Map of Plenti-GFP is Described in
TABLE-US-00012 TABLE 12 Plasmid Plasmid name structure Use Plasmid source pDB30-CD63- PhCMV-CD63- Encoding exosomal Synthesized by Nluc (FIG. 18) nluc-pA marker and fluorescent GENEWIZ protein nluc,and assessing exosome yield pDB60-Booster PhCMV- Encoding three genes of Miaoling (FIG. 19) STEAP3-T2A- exosomal booster: Biotechnology SDC4-P2A-nad STEAP3-SDC4-NadB, Co., Ltd fragment-pA and increasing exosome (P2882) yield
[0227] Step (2) Cell Preparation and Plasmid Transfection
[0228] 293T was cultured for 2-3 generations, and digested with trypsin, and the cells were counted. The cells were diluted to a density of 2.5×10.sup.5/mL with a DMEM medium (10% serum, 1% P/S), and added to a 24-well plate (0.5 mL/well); and Jurkat was cultured for 2-3 generations, and the cells were counted. The cells were diluted to a cell density of 5×10.sup.5/ml with a 1640 medium (10% serum, 1% P/S) (0.5 mL/well). The 24-well plate was placed at 37° C. under 5% CO.sub.2 for culturing for 24 h. The plasmids were mixed according to the proportion in Table 13, and were allowed to stand for 5 min, and PEI (Polysciences, 24765-2) was added, and same were uniformly mixed, incubated for 15 min, and added to a culture plate. The mixture was shaken gently, and cultured at 37° C. under 5% CO.sub.2 for 16 h. The supernatant of 293T cells was sucked out, fresh DMEM (+10% FBS +1% P/S) was added, and the resulting mixture was further cultured for 24 h; and 300 g of the suspension of Jurkat cells was centrifuged for 5 min, the supernatant was sucked out, and the cells were resuspended with a fresh 1640 (+10% FBS +1% P/S) medium, re-added to the 24-well plate, and cultured at 37° C. under 5% CO.sub.2 for 24 h.
TABLE-US-00013 TABLE 13 Plasmid name 1 2 3 4 5 pDB60-Booster 375 ng 0 0 0 550 ng pDB30-CD63-Nluc 125 ng 125 ng 0 0 250 ng plenti-GFP 0 375 ng 500 ng 0 0 PEI 2.0 μg 2.0 μg 2.0 μg 2.0 μg 2.0 μg
[0229] Step (3): Extraction and Analysis of Exosomes
[0230] The supernatant (293T) or the cell suspension (Jurkat) was collected, and 300 g of same was centrifuged for 5 min to remove the cells; 2000 g of the supernatant was further centrifuged for 10 min through gradient centrifugation. The supernatant was taken and 10,000 g thereof was centrifuged for 30 min; and cells and cell debris were further removed, and the final supernatant was analyzed.
[0231] Fluorescence detection: The Nano-Glo® Dual-Luciferase® Reporter Assay system (Promega, N1610) luciferase reporter gene detection system was used to detect the expression level of a fluorescent protein in the supernatant and cell precipitate respectively. 80 μL of a sample to be detected was added to 96-well plates (white-well plates). After NanoDLR™ Stop & Glo Reagent: substrate:Stop& Glo Buffer=1:100 were prepared and uniformly mixed, the mixture was left to stand at room temperature. An equal amount (80 μL) of NanoDLR™ Stop & Glo Reagent was added, 600 rpm, and subjected to a reaction involving shaking for 15 min in the dark at room temperature; a multifunctional microplate reader (Varioskan Lux, Thermo) was used to detect fluorescence, with a wavelength range of 400-600 nm, and a highest absorption peak of 460 nm (see
[0232] 2. Experimental Results and Analysis
[0233] Experimental results (
Example 7. Production of Exosomes Through Cell Packaging to Complete the Intercellular Delivery of Materials
[0234] 1. Experimental Design and Method
[0235] 1.1 Experimental Design
[0236] In this example, donor and receptor cells were selected, the donor cells were processed to make same able to produce an exosome that delivers a green fluorescent protein (GFP), it being possible to carry out intercellular material delivery in the form of an exosome was confirmed by means of detecting whether the receptor cells express the green fluorescent protein.
[0237] 1.2 Experimental Method
[0238] Step (1): Construction of a Plasmid
[0239] The detection index was changed from Nluc to EGFP, which is convenient for detection, and the plasmid pDB30-CD63-EGFP was constructed. Since the plasmid pDB60-booster contains GFP, which interferes with the determination of target gene expression, a Booster gene was inserted into a vector pX330 (Addgene 92115) to construct a pX330-Booster plasmid.
[0240] Gene PCR amplification was performed: see Table 14 for the list of primers and templates.
TABLE-US-00014 TABLE 14 Template PCR Primer name Primer sequence name product PX330-Gibson-R tactgccaaaaccgcatcacggtacctctagagc PX330 pX330-L catttgtctgc (SEQ ID No: 39) plasmid (about PX330-Gibson-F cataaacagataaggatccgaattcctagagctc 3500 bp) gctgatcagc (SEQ ID No: 40) Booster-Gibson-F caaatggctctagaggtaccgtgatgcggttttg pDB60-Booster Booster gcagtacatc (SEQ ID No: 41) plasmid (about Booster-Gibson-R Cagcgagctctaggaattcggatccttatctgttt 4200 bp) atgtaatgattgcc (SEQ ID No: 42) KpnI-GFP-F Cggggtaccagagcccaggcccggcagccat plenti-GFP GFP ggtgagcaagggcgaggag (SEQ ID No: plasmid (about 43) 750 bp) BamHI-GFP-R cgcggatccttacttgtacagctcgtccatgccg (SEQ ID No: 44)
[0241] Construction and ligation of pDB30-CD63-GFP: a pDB30-CD63-Nluc plasmid and a GFP amplification product were subjected to double enzyme digestion with KpnI/BamHI (NEB R3142L, R3136L), and a gel was cut to obtain a fragment of about 7700 bp and a fragment of about 750 bp; the two fragments were ligated with a T4 ligase (NEB M0202L), the ligation product was transformed into bacteria, and the colony was sequenced and identified.
[0242] Construction and ligation of pX330-Booster: 1) PCR product pX330-L and a Booster amplification product were ligated by means of a Gibson ligation system (NEB E5510S), the product was transformed into bacteria, and the colony was sequenced and identified.
[0243] Step (2): Cell Preparation and Plasmid Transfection
[0244] Receptor Cells were 293T-dsRed Cells (See Example 1 for Cell Preparation), which were cultured for 2-3 generations, and digested with trypsin. The cells were counted, diluted to a cell concentration of 3×10.sup.5/mL with a DMEM medium (10% serum, 1% P/S), added to a 6-well plate (2 mL/well), and further cultured for 24 h at 37° C. under 5% CO.sub.2. At the same time, donor cells (293T) were prepared in the same way, added to a 24-well plate (0.5 mL/well), and cultured at 37° C. under 5% CO.sub.2 for 24 hours, and then, the donor cells were transfected with plasmids with reference to Table 15. The transfection method was the same as that in Example 6
TABLE-US-00015 TABLE 15 Plasmid name 1 2 3 4 5 6 pX330-Booster 375 ng 0 375 ng 550 ng 0 0 pDB30-CD63-GFP 150 ng 150 ng 0 250 ng 0 0 plenti-GFP 0 0 150 ng 0 0 0 PEI 2.0 μg 2.0 μg 2.0 μg 2.5 μg 2.0 μg 0 Donor 293T 3.0E5 3.0E5 3.0E5 3.0E5 3.0E5 0 Receptor 1.2E6 1.2E6 1.2E6 1.2E6 1.2E6 1.2E6 293T-dsRed
[0245] Step (3) Cell Co-Cultivation and Flow Analysis
[0246] 8 h after Transfection, the Old Medium was Removed from Donor Cells, and the cells were digested with trypsin. A fresh medium was added, and the cell suspension was completely transferred to a 6-well plate for culturing receptor cells 293T-dsRed, and further cultured at 37° C. under 5% CO.sub.2 for 48 h. The cells in the 6-well plate were digested for flow analysis (flow cytometer: Invitrogen Attune NxT). The cells with red fluorescence and the cells with green fluorescence were counted respectively.
[0247] 2. Experimental Results and Analysis
[0248] Since the receptor cells can stably express the red fluorescent protein, same can be obviously distinguished from the donor cells. When the receptor cells are cultured alone, almost all of the cells (99.55%, group 6 in Table 16) express the red fluorescent protein, but substantially do not express the green fluorescent protein. When the donor cells are introduced into the system, some donor cells that do not express the red fluorescent protein occur when the cell population is analyzed. The results show that the receptor cells account for a consistent proportion of the total cell population, about 75% to 80% (groups 1 to 5 in Table 16, dsRed.sup.+/total).
[0249] When the donor cells are not transfected with a GFP plasmid, the green fluorescent signal cannot be detected in the donor cells (Table 16, group 5, dsRed.sup.−GFP.sup.+/dsRed.sup.−). When the donor cells are transfected with a GFP-expressing plasmid, some of the donor cells express GFP (Table 16, groups 1 to 4, dsRed.sup.−GFP.sup.+/dsRed.sup.−), and at the same time, green fluorescent signals are also detected in the receptor cells. Experiments show that, under co-culture conditions, a green fluorescent protein is delivered to the receptor cells, and statistical results show that about 1.2% to 2% of the receptor cells receive the delivered material (groups 1 to 4 in Table 16, dsRed.sup.+GFP.sup.+/dsRed.sup.+). The low material delivery efficiency may be related to the low transfection efficiency of the donor cells, but compared with the control groups (about 0.3%, groups 5-6 in Table 16, dsRed.sup.+GFP.sup.+/dsRed.sup.+), there is obvious material delivery.
[0250] Similar to Example 6, an exosome enhancer does not have a significant enhancement effect (comparison between groups 1 and 2 in Table 16), and increasing the amount of plasmid transfection does not enhance delivery (comparison between groups 1 and 4 in Table 16), probably because there is no further optimization for the enhancer or plasmid dosage under the current experimental conditions. In addition, fusion GFP without an exosomal tag can also be delivered to the receptor cells (comparison between groups 1 and 3 in Table 16). This may be because exosomes do not have strict restrictions on the packaging and secretion of contents, and all the contents in cytoplasm may be packaged and secreted for delivery.
TABLE-US-00016 TABLE 16 1 2 3 4 5 6 dsRec.sup.+/total 80.57% 79.44% 76.55% 79.65% 75.71% 99.55% number dsRed.sup.−GFP.sup.+/ 19.61% 20.56% 25.47% 17.88% 0% 0% dsRed.sup.− dsRed.sup.+GFP.sup.+/ 1.20% 1.54% 2.02% 1.22% 0.37% 0.30% dsRed.sup.+