Modified antibody
09796787 · 2017-10-24
Assignee
Inventors
Cpc classification
A61P31/00
HUMAN NECESSITIES
C12Y207/07049
CHEMISTRY; METALLURGY
C12N2740/16022
CHEMISTRY; METALLURGY
C12N2740/16034
CHEMISTRY; METALLURGY
C12N9/1276
CHEMISTRY; METALLURGY
C07K2317/64
CHEMISTRY; METALLURGY
C07K2319/40
CHEMISTRY; METALLURGY
C07K16/28
CHEMISTRY; METALLURGY
C07K14/70578
CHEMISTRY; METALLURGY
C07K16/44
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C07K16/44
CHEMISTRY; METALLURGY
C07K14/715
CHEMISTRY; METALLURGY
C07K14/705
CHEMISTRY; METALLURGY
C12N9/12
CHEMISTRY; METALLURGY
Abstract
Recombinant antibody-based molecules that trigger both T-cell and B-cell immune responses are disclosed. The recombinant molecules are comprised by at least one targeting unit and at least one antigenic unit connected through a dimerization motif. Also disclosed are nucleic acid molecules encoding the recombinant antibody-based molecule and methods of treating multiple myeloma or lymphoma in a patient using the recombinant antibody-based molecules or the nucleic acid molecules.
Claims
1. A recombinant antibody-based dimeric molecule, wherein said antibody-based dimeric molecule comprises two monomer units connected through a dimerization motif, said dimerization motif comprising an Ig hinge region and a Cγ3 domain of each monomer unit, wherein each Ig hinge region contributes to dimerization via disulfide bridging to the other Ig hinge region and each Cγ3 domain contributes to dimerization via hydrophobic interactions to the other Cγ3 domain, and wherein each of said monomer units comprises a targeting unit for an antigen presenting cell and an antigenic unit, wherein said targeting unit and said antigenic unit in the monomer unit are separated by said dimerization motif and wherein said monomer units each lack a CH2 domain.
2. The recombinant molecule of claim 1, wherein at least one of said targeting units is a single chain fragment variable of Ig (scFv).
3. The recombinant molecule of claim 2, wherein said scFv is anti-HLA, anti-CD14, anti-CD40, or anti-toll-like receptor.
4. The recombinant molecule of claim 1, wherein at least one of said targeting units is a ligand.
5. The recombinant molecule of claim 4, wherein said ligand is soluble CD40 ligand or a chemokine.
6. The recombinant molecule of claim 5, wherein said ligand is a chemokine.
7. The recombinant molecule of claim 6, wherein said chemokine is RANTES or Macrophage Inflammatory Protein 1 alpha (MIP-1alpha).
8. The recombinant molecule of claim 7, wherein said chemokine is MIP-1alpha.
9. The recombinant molecule of claim 1, wherein at least one of said targeting units is a bacterial antigen.
10. The recombinant molecule of claim 1, wherein said targeting units have the ability to target CD14, CD40, a toll-like receptor, HLA or HLA-DP.
11. The recombinant molecule of claim 1, wherein said targeting units have the ability to target a chemokine receptor.
12. The recombinant molecule of claim 1, wherein at least one of said antigenic units is an antigenic scFv.
13. The recombinant molecule of claim 12, wherein said antigenic scFv has VL and VH chains from a monoclonal Ig produced by myeloma or lymphoma.
14. The recombinant molecule of claim 1, wherein at least one of said antigenic units is a telomerase or a functional part thereof.
15. The recombinant molecule of claim 1, wherein at least one of said antigenic units is derived from an infectious agent.
16. The recombinant molecule of claim 1, wherein at least one of said antigenic units is derived from a bacterium.
17. The recombinant molecule of claim 1, wherein at least one of said antigenic units is derived from a virus.
18. The recombinant molecule of claim 17, wherein said virus-derived antigenic unit is derived from HIV.
19. A composition comprising the recombinant molecule according to claim 1 in combination with a physiologically acceptable diluent or carrier.
20. A method for inducing an immune response against an antigen in an animal, including a human being, the method comprising administering to the animal an effective amount of the recombinant molecule of according to claim 1.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The present invention will become more fully understood from the detailed description and the accompanying drawings, wherein:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9) (
(10) (
(11) (
(12) (
(13)
(14)
(15)
(16) (
(17)
(18)
(19) (
(20)
(21)
(22)
(23)
(24)
(25)
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
(26) The following description of the preferred embodiment(s) is merely exemplary in nature and is in no way intended to limit the invention, its application, or uses.
(27) The present invention relates to a recombinant human antibody-based molecule, called Vaccibodies, comprising dimers of a monomeric unit that consist of a single chain fragment variable (scFv) of immunoglobulins (Ig) with specificity for surface molecules on Ag presenting cells (APC), connected through a hinge region and a Cγ3 domain to a scFv in the COOH-terminal end, the latter being derived from a myeloma protein (
(28) The crucial dimerization motifs in the Vaccibodies constructed in the examples so far, include hinge regions and Cγ3 domains. The hinge contributes to the dimerization through the formation of interchain disulfide bridges. In addition, it functions as a flexible spacer between the domains allowing the two scFvs with targeting tasks to bind simultaneously to two target molecules expressed with variable distances (
(29) The C-terminal scFv derived from the monoclonal Ig produced by myeloma or lymphoma cells, also called the myeloma/lymphoma M component, can be genetically exchanged with other scFvs or any antigen because the vector has been constructed with a Sfi I restriction site (
(30) Vaccibodies can be extended to a general medical treatment through induction of an immune response against any polypeptide of any origin. It is possible to replace the idiotypic scFv with other antigenic sequences of sufficient length to allow proper folding of the polypeptide. This sequence may be derived from other cancer proteins or infectious agents. Insertion of such a sequence in a Vaccibody format might also lead to activation of both arms of the immune response, similar to the Vaccibodies that are described herein, which comprise the idiotypic scFv. Immunization by means of Vaccibody protein, Vaccibody DNA, or Vaccibody RNA, the latter two executed e.g. by intramuscular injection followed by electroporation (See Examples), are all feasible methods.
(31) The scFvs on the NH2-terminal end of the Vaccibodies target the Vaccibodies to APC through binding to surface molecules (
(32) The Vaccibodies have been genetically assembled, and the DNA transfected into NSO cells, 293E cells and Cos-7 cells. Transfectants produce and secrete the recombinant Vaccibody molecules. The targeting scFvs at one end of the Vaccibodies exhibit binding to MHC class II (
(33) To determine if MM patients treated with ASCT achieve remission with a low serum myeloma protein concentration, ELISA should performed for each patient's myeloma protein because routine assays (agarose gel electrophoresis, combined with immunofixation) have only a sensitivity of about 0.2-1 mg/ml, which is far too insensitive. The kinetic data of the serum myeloma protein levels will indicate if and when Id-vaccination may best be performed post ASCT to avoid the problem of T cell tolerance of newly educated thymic emigrants. To achieve this, mice are immunized with DNA encoding patient specific Vaccibodies by in vivo electroporation of muscle cells. Sera from immunized mice are absorbed on anti human Ig-Sepharose to remove crossreactive antibodies and thereafter eluted to obtain purified highly Id-specific antibodies. Sandwich ELISAs specific for each patient's myeloma are performed as follows: The purified anti-Id Ab from mice is coated in wells. Serum from the patient in casu is added. Myeloma protein binding to anti-Id antibodies will be detected by use of Ab specific for human IgG or IgA. The sensitivity of such sandwich ELISAs is usually <1 ng/ml, which is >106 times more sensitive than routine assays. Furthermore, to monitor development of new T cells, profile of T cells in blood will be monitored by flow cytometry with Vβ-specific mAbs, in combination with other markers.
(34) The present invention relates to a pharmaceutical comprising the above described recombinant based antibody, DNA/RNA sequences, or expression vectors according to the invention. Where appropriate, this pharmaceutical additionally comprises a pharmaceutically compatible carrier. Suitable carriers and the formulation of such pharmaceuticals are known to a person skilled in the art. Suitable carriers are e.g. phosphate-buffered common salt solutions, water, emulsions, e.g. oil/water emulsions, wetting agents, sterile solutions etc. The pharmaceuticals may be administered orally or parenterally. The methods of parenteral administration comprise the topical, intra-arterial, intramuscular, subcutaneous, intramedullary, intrathekal, intraventricular, intravenous, intraperitoneal or intranasal administration. The suitable dose is determined by the attending physician and depends on different factors, e.g. the patient's age, sex and weight, the kind of administration etc. The present invention also relates to a kit comprising Vaccibody DNA, RNA, or protein for diagnostic, medical or scientific purposes.
(35) The above described nucleotide sequences may preferably be inserted into a vector suited for gene therapy, e.g. under the control of a specific promoter, and introduced into the cells. In a preferred embodiment the vector comprising said DNA sequence is a virus, e.g an adenovirus, vaccinia virus or an adeno-associated virus. Retroviruses are particularly preferred. Examples of suitable retroviruses are e.g. MoMuLV or HaMuSV. For the purpose of gene therapy, the DNA/RNA sequences according to the invention can also be transported to the target cells in the form of colloidal dispersions. They comprise e.g. liposomes or lipoplexes.
(36) In a preferred embodiment of the present invention naked Vaccibody DNA construct is injected intra-muscularly into mice, whereupon the site of injection is subject to in vivo electroporation. This DNA vaccination resulted in production of Vaccibody protein which conferred life-saving protective immunity on a majority of the mice.
MATERIALS AND METHODS
(37) Mice
(38) BALB/cABom were from Bomholtgaard (Ry, Denmark). The λ2315-specific TCR-transgenic mice on a BALB/c background (Bogen, Gleditsch et al. 1992) were bred in our animal facility.
(39) Cell Lines
(40) The 14-4-4S Hybridoma (Ozato, Mayer et al. 1980) and NSO cells were purchased from American Type Culture Collection (ATCC, Manassas, Va.). 293E cells, a variant of the 293 cell line expressing the Epstein-Barr virus EBNA1 protein.
(41) Construction of Vaccibodies
(42) The gene for the hIgG3 hinge and CH3 domain was cloned from the pUC19 vector containing hinge genetically combined with Cγ3 genes of the hIgG3 subclass (Olafsen, Rasmussen et al. 1998). Two variants of the hinge length in the humanized Vaccibodies were made; one with just the h4 exon connected to the CH3 domain (sh) and one with both exon h1 and h4 connected to the CH3 domain (Ih) (
(43) TABLE-US-00001 5′h4: (SEQ ID NO: 1) tag caa gct tgg cca gcg cag gga g; 3′CH3: (SEQ ID NO: 2) cag gcc acc gag gcc ttt acc cgg aga cag gga.
The h1 exon were introduced directly upstream of the h4 exon by QuickChange PCR using these primers Qh1a: ctccaatcttctctctgca gag ctc aaa acc cca ctt ggt gac aca act cac aca gag ccc aaa tct tgt gac ac (SEQ ID NO:3) and Qh1b: gt gtc aca aga ttt ggg ctc tgt gtg agt tgt gtc acc aag tgg ggt ttt gag ctc tgcagagagaagattgggag (SEQ ID NO:4).
(44) The murine Vaccibodies have a complete hinge and CH3 domain of the mIgG2b subclass picked up by PCR from a pUC18 vector containing the Cγ2b genes (
(45) TABLE-US-00002 5′hinge: (SEQ ID NO: 5) tagcaagctt ca gag ccc agc ggg ccc; 3′hinge: (SEQ ID NO: 6) 5′tcc acc tcc gct gct tcc acc gcc tgg gca ttt gtg aca ctc ctt g; 5′CH3: (SEQ ID NO: 7) gga agc agc gga ggt gga agt gga ggg cta gtc aga gct cca ca; 3′CH3: (SEQ ID NO: 8) cag gcc acc gag gcc acc cgg aga ccg gga gat g.
The hinge and the CH3 domain were then joined by PCR SOEing.
(46) The Antigenic V region genes were cloned from the plasmacytoma MOPC315.4 (Eisen, Simms et al. 1968). The V regions were obtained by extracting mRNA from the MOPC315.4 cell line with oligo (dT)-coated magnetic Dynabeads (Dynal). First strand cDNA were then made and used as template for PCR amplification of the V region genes using specific primers annealing to the exact ends of the M315 V region sequences. The primers included restriction enzyme sites (underlined) or linkers (bold) with the complementary sequences (italic). The primer sequences were:
(47) TABLE-US-00003 5′VH: (SEQ ID NO: 9) ggc ctc ggt ggc ctg gat gta cag ctt cag gag tca; 3′VH: (SEQ ID NO: 10) gcc aga gcc acc tcc gcc aga tcc gcc tcc acc tga gga gac tgt gag agt ggt; 5′VL: (SEQ ID NO: 11) ggc gga ggt ggc tct ggc ggt ggc gga tcg cag gct gtt gtg act cag gaa; 3′VL: (SEQ ID NO: 12) gacg tcgac tag gac agt gac ctt ggt tcc.
The VH and VL genes were then joined by PCR soeing to a scFv format (
(48) The complementary sequences in the tags 3′ of the Cγ3 coding region and 5′ of the M315 VH coding region enabled the M315 scFv to be combined with the three different hinge-CH3 genes by PCR SOEing (
(49) TABLE-US-00004 3′VL stop1: (SEQ ID NO: 17) gtc act gtc cta tga ggcctgcagggcc ggatcc gtcgactctag and 3′VL stop2: (SEQ ID NO: 18) cta gag tcg ac ggatcc ggccctgcaggcc tca tag gac agt gac,
were then performed to introduce a stop codon (bold), a SfiI and a BamHI restriction enzyme site (underlined) downstream of the coding region (
(50) The final construct is then digested with HindIII and BamHI and subcloned into the expression vector pLNOH.sub.2 (
(51) The V region genes providing specificity for MHC class II had previously been cloned from the 14-4-4S hybridoma (Lunde, Western et al. 2002), which produces an Ab specific for the Eα chain (determinant Ia.7) of the I-E MHC class II molecule (Ozato, Mayer et al. 1980). Specific primers annealing to the exact ends of the V region sequences with tags designed to include restriction enzyme sites (underlined) or linker sequences (bold) with the complementary sequences (italic). The primer sequences were: 5′VL: gac att caattg aca cag tct tct cct gct tcc (SEQ ID NO:19); 3′VL: gcc aga gcc acc tcc gcc aga tcc gcc tcc acc ttt gat ttc cag ctt ggt gcc (SEQ ID NO:20); 5′VH: ggc gga ggt ggc tct ggc ggt ggc gga tcg cag gtc cag ctg cag cag t (SEQ ID NO:21); 3′VH: ga cgtacg actcacc tga gga gac ggt gac tga gg (SEQ ID NO:22). The V region genes giving specificity for the hapten NIP (Neuberger 1983) were designed with the similar tag sequences except for the 5′VL primer: 5′VL: ggtg tgcattcc cag gct gtt gtg act cag gaa (SEQ ID NO:23); 3′VL: gcc aga gcc acc tcc gcc aga tcc gcc tcc acc tag gac agt cag ttt ggt acc t (SEQ ID NO:24); 5′VH: ggc gga ggt ggc tct ggc ggt ggc gga tcg cag gtc caa ctg cag cag cc SEQ ID NO:25); 3′VH: ga cgtacg a ctc acc tga gga gac tgt gag agt ggt (SEQ ID NO:26). The VL and VH were then joined by PCR SOEing (
(52) TABLE-US-00005 5′-VL, (SEQ ID NO: 27) ggtgtgcattccgacattgtgctcacc; 3′-VL, (SEQ ID NO: 28) cgtacgttctactcacgttttatttccagct; 5′-VH, (SEQ ID NO: 29) gtgcattccgaggtgcagctgcaggagtct; 3′-VH, (SEQ ID NO: 30) cgtacgactcacctgaggagaccgtagc.
Furthermore, scFV was generated by PCR SOEing using the following primers:
(53) TABLE-US-00006 5′VL, (SEQ ID NO: 31) g gtg tgcattc cga cat tgt gct cac c 3′VL: (SEQ ID NO: 32) gcc aga gcc acc tcc gcc aga tcc gcc tcc acc gtt tta ttt cca gct 5′VH: (SEQ ID NO: 33) ggc gga ggt ggc tct ggc ggt ggc gga tcg gag gtg cag ctg cag gag tct 3′VH, (SEQ ID NO: 34) cgtacg act cac ctg agg aga ccg tag c
(54) In 3′VL and 5′VH the sequences in bold+italics are complementary and antiparallel, thus hybridising to generate the gene fragment encoding the linker region. Anti CD14 V regions are cloned from the mouse hybridoma 3C10 (ATCC).
(55) The chemokine genes were cloned from thioglycolate stimulated peritoneal macrophages. 4 ml 2% thioglycolate were injected i.p. into Balb/c mice. 3 days later peritoneal macrophages were collected and mRNA was extracted with oligo (dT)-coated magnetic Dynabeads. First strand cDNA was made and used as template for PCR amplification of chemokine genes (RANTES and MIP-1α) using specific primers: 5′MIP-1α: ggtg tgcattc cgc gcc ata tgg agc tga cac (SEQ ID NO:35), 3′MIP-1α: ga cgtacg act cac ctg cat tca gtt cca ggt cag tg (SEQ ID NO:36) 5′RANTES: ggtg tgcattc c gcc tca cca tat ggc tcg g (SEQ ID NO:37) 3′RANTES: ga cgtacg a ctc acc tga cat ctc caa ata gtt gat gta ttc (SEQ ID NO:38). The different targeting unit genes were then digested with MunI and BsiWI or BsmI and BsiWI, respectively and subcloned into the V cassette pLNOH.sub.2 vector containing the hinge-CH3-scFvM315 genes (
(56) Production and Purification of Vaccibodies
(57) The pLNOH.sub.2 vector carrying the Vaccibody genes was transfected into NSO cells by electroporation, and supernatants from single colonies resistant to 800 μg/ml G418 were analyzed for Vaccibody secretion after 2-3 weeks, using ELISA. DNP-BSA was used as coat, and biotinylated rat-anti mouse Vλ1/2 (9A8-bio) was used for detection. The NIP-specific Vaccibodies were additionally screened in an ELISA using NIP-BSA as coat. The cells selected for high Vaccibody production were grown in Rollerbottles (VWR) and affinity purified from supernatant using a column made by DNP-lysine (Sigma) coupled to fast flow Sepharose. The Vaccibodies were eluted with 0.05M DNP-glycine (Sigma) and the flow-through was run on an ion-exchange CI-Dowex 1×8 resin column (Sigma). The eluted Vaccibodies were dialyzed against PBS/0.05% NaN3 and sterile PBS, before the vaccibody concentration were calculated from absorbance values at 280 nm.
(58) Ab and Flow Cytometry
(59) Ab and reagents used for flow cytometry were 9A8 biotin, FGK.45 biotin, streptavidin PerCP, anti-CD19 PE and anti-mIgG2a PE (BD Pharmingen). BALB/c spleen cells were double stained with anti-CD19 PE and Vaccibodies. Bound Vaccibodies were detected by 9A8-bio and streptavidin PerCP. Twenty thousand cells were run on FACSCalibur (BD Biosciences, Mountain View, Calif.) and analyzed using the WinMDI software.
(60) Metabolic Labelling and Immunoprecipitation
(61) 2×10.sup.6 cells were labelled for 6 h at 37° C. in RPMI lacking methionine, cysteine (BioWhittaker) containing 100 μCi .sup.35[S]-methionine, cysteine (Amersham). The SN was harvested and immunoprecipitated with rat anti-mouse Vλ1/2 (9A8) on a wheel ON at 4° C. 10 μl Dynabeads coated with sheep anti-rat IgG (Dynal AS, Oslo, Norway) were incubated with the precipitate for 1 h on a wheel and the Dynabeads were collected with a Dynal Magnetic Particle Concentrator rack (Dynal MPC). The beads were washed three times in ice cold PBS with 1% NP40 and resuspended in 10 μl 1× sample buffer. The proteins were eluted from the beads by incubating the samples at 95° C. for 3 minutes. The Vaccibodies were run on a 10% SDS-PAGE gel, with a 5% stacking gel, at 40 mA for 1 h, using a BIO RAD miniprotean II gel electrophoresis apparatus. The gels were subsequently fixed in 30% methanol and 10% acetic acid for 30 minutes prior to 30 min incubation with Amplify (Amersham), before drying and exposing to BIOMAX-MR film (Eastman Kodak Company, Utah, USA).
(62) T Cell Proliferation Assay
(63) Irradiated (2000 rad) BALB/c splenocytes (5×10.sup.5 cells/well) were used as a source of APC. Titrated amounts of different MHC CLASS II- and NIP-specific Vaccibodies were added to the splenocytes. A 91-107 λ2.sup.315 synthetic peptide were used as a positive control. The assays were put up in 150 μl cultures in 96-well flat-bottom microtiter wells and incubated for 4 h at 37° C. (Lunde, Western et al. 2002). The cultures were then washed three times before addition of 200 μl polarized λ2.sup.315-specific Th2 cells (2×10.sup.4) derived from TCR transgenic SCID mice. After 48 h, the cultures were pulsed for 16-24 h with 1 μCi .sup.3[H] dThd. The cultures were harvested and, and incorporated .sup.3[H] dThd was measured using a TopCount NXT scintillation counter (Packard, Meriden, Conn.).
(64) In Vivo Experiments
(65) BALB/c mice were injected subcutaneously (s.c) with 200 μg or 20 μg purified Vaccibody proteins in PBS on day 0, 14 and 28. Blood samples were taken on day 14 and 28 before revaccination and then on day 35, 42 and 49, before they were sacrificed according to the Humane End Point procedure.
(66) Measurement of Antibody Responses
(67) Anti-idiotypic Abs against M315 were measured by ELISA. The wells were coated with 2 μg/ml M315. Anti-Id Ab in the sera were detected by a biotinylated anti-mouse Vκ Ab (187.1 bio), anti-mouse IgG1 bio or anti-mouse IgG2a bio (both from BD Pharmingen). Ab2.1-4 (an anti-Id mAb that bind λ2.sup.315) was used as standard.
(68) Vaccination
(69) Protein vaccination: BALB/c mice were injected subcutaneously (s.c) in the right flank region with 20 μg or 200 μg purified class II- or NIP specific Vaccibodies (F.sub.v.sup.I-E F.sub.v.sup.315, F.sub.v.sup.NIP F.sub.v.sup.315) in PBS on day 0 and 14. PBS was injected as negative control. Blood samples were collected from the leg vein on different time points after the last immunization. Anti-idiotypic antibodies with specificity with specificity for F.sub.v.sup.315 were measured by ELISA. The wells were coated with 2 μg/ml M315. Anti-Id Ab in the sera were detected by a biotinylated anti-mouse κ mAb (187.1 bio). Ab2.1-4 (an anti-Id mAb binding F.sub.v.sup.315 (Kristoffersen, Hannestad et al. 1987) was used as standard.
(70) DNA Vaccination and Electroporation
(71) Five to ten weeks old Balb/c mice were purchased from Bomholtgaard (Ry, Denmark). The animals were anaesthetized by intraperitoneal injection with 9 g Pentobarbital/mice and the legs were shaved. Conductive gel was applied at the skin and 50 μl vector DNA diluted in 0.9% NaCl, was injected into the quadriceps. Following injection, electroporation was performed, by applying rod electrodes to the skin near the site of the injection and subjecting the site to an electrical potential comprising 10 trains of 1000 pulses each, with a pulse length at two times 200 Sec (positive 200 Sec and negative 200 Sec) with 600 s interval between each pulse and with a current limit of 50 mA (about 150-174 V/cm) (Tollefsen, Tjelle et al. 2002).
(72) Blood samples were collected from the leg vein on different time points and heart puncture was performed on the day they were sacrificed. Serum samples were analyzed for the presence of correctly folded Vaccibodies. The ELISA was performed with DNP-BSA as coat and 9A8-bio as detected Ab, as described above. In addition, serum samples were analyzed for anti-Id Abs by ELISA as described above.
(73) Tumor Challenge
(74) Protein Vaccibodies-MOPC315.4: BALB/c mice (6-10 weeks old) were injected s.c. with 160 μg class II- or NIP-specific Vaccibodies in PBS in the right flank region on day 0 and 14. On day 28, 1.6×10.sup.5 MOPC315.4 cells were injected s.c. on the right flank. Mice were inspected twice weekly. Tumor size development was monitored by palpation and use of a caliper. A tumor of 3 mm in diameter was scored as tumor take. Mice were killed when tumor size reached 20 mm with no sign of tumor necrosis.
(75) DNA Vaccibodies-MOPC315.4: DNA vaccination was performed at day 0 as described above. On day 14, 1.6×10.sup.5 MOPC315.4 cells were injected s.c. in the right flank region. Tumor size development was monitored by palpation and use of a caliper. The mice were sacrificed when the tumor size reached 20 mm. Blood samples were collected on different time points from the leg vein. Levels of M315 myeloma protein in sera were quantified in a sandwich ELISA with Ab2.1-4 as coat by biotinylated anti-Cα (8D2) mAb as detection Ab. Tumor size, tumor take, survival curves and statistical analyses were calculated by use of Graph Pad Prism 3.0 software (San Diego, Calif.).
EXAMPLES
(76) By way of example the following experiments demonstrate that Vaccibodies bind APC and are able to trigger both T cell and B cell immune response. Moreover, the following experiments show that Vaccibodies induce a strong immune response rendering adjuvants redundant. The experiments demonstrate that said molecule is capable of inducing an immune response against multiple myeloma and, further, the feasibility of treatment of mammals by immunization by means of Vaccibody DNA or Vaccibody protein. The experiments also demonstrate that another attractive approach is to target the Vaccibodies to surface molecules expressed exclusively on subsets of dendritic cells (DC), like e.g. chemokine receptors. The following examples are meant to illustrate how to make and use the invention. They are not intended to limit the scope of the invention in any manner or to any degree.
Example 1
(77) Vaccibodies are produced and secreted as functional dimerized molecules and is itself bound by the anti-Vλ1/2 antibody (9A8) (Bogen 1989) and the anti-idiotypic antibody Ab2.1-4 (Lauritzsen, Weiss et al. 1994).
(78) The M315 mAb binds the hapten di-nitro-phenyl (DNP) (Eisen, Simms et al. 1968). Therefore, to verify that Vaccibodies were produced, secreted and correctly folded as functional molecules, the antigenic units of Vaccibodies were tested in ELISA for their capability to bind DNP, 9A8 and Ab2.1-4 mAbs.
Example 2
(79) MHC Class II-Specific Vaccibodies Enhance λ2.sup.315-Specific Stimulation of CD4+ T Cells.
(80) Class II-specific and non-targeting NIP-specific Vaccibodies were mixed with antigen presenting cells (APC) and compared for their ability to induce specific T cell activation. Irradiated BALB/c splenocytes were used as APC. The BALB/c strain has the H-2.sup.d haplotype, hence they express I-E.sup.d molecules necessary for both targeting of the MHC II-specific Vaccibodies and presentation of the λ2.sup.315 epitope to specific CD4+ T cells.
(81) The APC were pulsed with the different Vaccibodies for 4 h and subsequently washed. Washing was performed to reduce the chance that I-E.sup.d-specific Vaccibodies in the culture medium could diminish T cell stimulation by blocking I-E.sup.d molecules (Lunde, Western et al. 2002). Polarized Th2 cells from mice transgenic for a λ2.sup.315-specific I-E.sup.d restricted TCR (Lauritzsen, Weiss et al. 1993) were added as responder T cells. The dose response curve in
Example 3
(82) Level of Anti-Idiotypic Antibodies in Sera of Mice that Received Vaccibodies as Proteins in Saline s.c. In the Absence of Adjuvant.
(83) In the protein vaccination protocol, BALB/c mice were immunized twice, spaced two weeks apart, with 20 or 200 μg MHC II-specific Vaccibodies or NIP-specific Vaccibodies in PBS. Note that no adjuvant was employed. Sera from immunized mice taken at various time points after the second vaccination were then analyzed for anti-idiotypic antibodies binding M315 in ELISA. The MHC II-specific Vaccibodies elicited significant higher anti-idiotypic antibody responses after 14 days after the second immunization than did NIP-specific Vaccibodies. Vaccibodies with a long human dimerization unit induced best anti-idiotypic Ab responses (
Example 4
(84) Protein Vaccibodies Detected in Serum after Injection of DNA Intramuscularly and In Vivo Electroporation.
(85) It has recently been described that skeletal muscle can produce antibodies after injection of Ig genes and electroporation (Tjelle 2004). We therefore investigated if functional Vaccibodies were produced by i.m. plasmid injection and electroporation. Since the F.sub.v.sup.I-E F.sub.v.sup.315 Vaccibodies are specific for I-E.sup.d molecules present in BALB/c (H-2d), these Vaccibodies should be rapidly absorbed by the I-E.sup.d positive cells in BALB/c. By contrast, the non-targeted FvNIP F.sub.v.sup.315 Vaccibodies should not be absorbed. Indeed, 14 days after a single injection of 50 μg Vaccibody plasmid in quadriceps and electroporation, F.sub.v.sup.NIP F.sub.v.sup.315 Vaccibody protein was detected in significant amounts in serum, while there was no detectable F.sub.v.sup.I-E F.sub.v.sup.315 (
Example 5
(86) Anti-Id Antibodies in Serum after Injection of Vaccibody DNA Intramuscularly and Electroporation.
(87) Analysis of the same day 14 sera samples for anti-idiotypic antibodies demonstrated that mice i.m. injected/electroporated with the MHC class II-targeted F.sub.v.sup.I-E F.sub.v.sup.315 Vaccibody DNA, had developed antibodies that bound idiotypic Fv from the MOPC315.4 tumor (
Example 6
(88) Induction of Protective Immunity Against the MOPC315.4 Myeloma: Vaccibody DNA Injection/Electroporation.
(89) Intramuscular vaccination with MHC class II-targeted F.sub.v.sup.I-E F.sub.v.sup.315 Vaccibody plasmids and subsequent electroporation induced strong protection against a challenge with MOPC315.4 myeloma cells, p<0.001, compared to control mice injected with 0.9% NaCl and electroporated (
Example 7
(90) Chemokines are Functional as Targeting Units in the Vaccibody Format
(91) Supernatant from cells transfected with Vaccibody construct with MIP-1α in the targeting unit, long human dimerization unit and M315 scFv in the antigenic unit, were collected and tested in ELISA for binding to an anti-mouse MIP-1α mAb and 9A8 bio. The Vaccibodies containing MIP-1α bound to anti-MIP-1α mAb, while the NIP-specific Vaccibodies did not (
Example 8
(92) The Chemokine RANTES is Functional as Targeting Unit in the Vaccibody Format
(93) In the same manner, a vector with a gene encoding Vaccibodies like those described in example 7 was produced, with the exception that the targeting unit was the mouse chemokine RANTES. Supernatant from cells transfected with this construct was collected and tested in ELISA for the presence of Vaccibodies. The experiment showed that this Vaccibody variant was expressed and exported as a functional molecule.
Example 9
(94) Flaggelin as Targeting Unit in the Vaccibody Format.
(95) In the same manner, a vector with a gene encoding Vaccibodies like those described in example 7 was produced, with the exception that the targeting unit was flaggelin. Supernatant from cells transfected with this construct will be collected and tested in ELISA for the presence of Vaccibodies.
Example 10
(96) Soluble CD40 Ligand as Targeting Unit in the Vaccibody Format
(97) In the same manner, a vector with a gene encoding Vaccibodies like those described in example 7 was produced, with the exception that the targeting unit was soluble CD 40 ligand from the mouse. Supernatant from cells transfected with this construct will be collected and tested in ELISA for the presence of Vaccibodies.
Example 11
(98) Anti-Toll-Like-Receptor 2 as Targeting Unit in the Vaccibody Format.
(99) In the same manner, a vector with a gene encoding Vaccibodies like those described in example 7 was produced, with the exception that the targeting unit was a scFv with specificity for toll-like-receptor 2 from the mouse. Supernatant from cells transfected with this construct will be collected and tested in ELISA for the presence of Vaccibodies.
Example 12
(100) Anti-CD14 is Functional as Targeting Units in the Vaccibody Format
(101) In the same manner, a vector with a gene encoding Vaccibodies like those described in example 7 was produced, with the exception that the targeting unit was scFv with specificity for human CD 14. Supernatant from cells transfected with this construct was collected and tested in ELISA for the presence of Vaccibodies. The results showed that this Vaccibody variant was expressed and exported as a functional molecule.
Example 13
(102) Anti-HLA-DP is Functional as Targeting Units in the Vaccibody Format.
(103) In the same manner, a vector with a gene encoding Vaccibodies like those described in example 7 was produced, with the exception that the targeting unit was scFv with specificity for HLA-DP. Supernatant from cells transfected with this construct was collected and tested in ELISA for the presence of Vaccibodies. The results showed that this Vaccibody variant was expressed and exported as a functional molecule.
Example 14
(104) Tuberculosis Antigen in the Vaccibody Antigenic Cassette.
(105) A nucleic acid encoding a tuberculosis antigen (cattle antigen) will be inserted into the antigenic unit of the Vaccibody construct.
Example 15
(106) Telomerase Antigen in the Vaccibody Antigenic Cassette
(107) hTERT, an antigenic region of the telomerase ribonucleoprotein, will be inserted into the antigenic unit of the Vaccibody construct.
Example 16
(108) HIV Gp120 Antigenic in the Vaccibody Antigenic Cassette
(109) A nucleic acid encoding a gp120 derived molecule will be inserted into the antigenic unit of the Vaccibody construct.
Example 17
(110) Vaccibodies with Patient Specific scFv of Myeloma Origin in the Antigenic Cassette.
(111) This study has been initiated, but has not yet been completed.
(112) Bone marrow aspirate from patients suffering from multiple myeloma can be collected. The mononuclear cells (MNC) can be separated using a density gradient solution of Ficoll-Isopaque (Lymphoprep™ from Axis-Shield PoC AS). Total RNA can be isolated using TRIZOL® phenol-guanidine isothiocyanate-ammonium thiocyanate (TRIzol® Reagent from Invitrogen™ Life Technologies) from MNC, and cDNA can be made from mRNA (First-Strand cDNA Synthesis Kit from Amersham Biosciences (Not I-d(T)18 bifunctional primer)). This cDNA can be used as template in PCR with primers that amplify the V genes of the heavy or light chain of the multiple myeloma Ig. The sense primers are family specific and localized in the leader regions (VH1-7, VK1-6 and VL1-10), and the anti-sense primers are localized in the first part of the C regions (one primer each for IgG, IgA, kappa and lambda). PCR products can be ligated into a pGEM®-T vector (pGEM®-T Easy Vector from Promega), and transformed into E. coli. DNA samples isolated from individual colonies can be sequenced. Getting the same sequence from three different colonies originating from three different PCRs confirms that the V regions from the myeloma Ig have been isolated. PCR SOEing can be performed and reamplification is done with primers including tags with sites for SfiI as described in
(113) TABLE-US-00007 5′TAVH (SEQ ID NO: 39) 5′ ACGTAGGCCTCGGTGGCCTGCAGATCACCTTGAAGGAGTCT 3′TAVK (SEQ ID NO: 40) 5′GATCCGGCCCTGCAGGCCTCATTTGATCTCCAGCTTGGTCCC
(114) The resulting vector can be transiently transfected into 293E cells. Supernatants can be tested in ELISA for the presence of such Vaccibodies. They can also be injected into BALB/c mice. The presence of anti-Idiotypic antibodies can be measured in ELISAs against serum from the mice and serum from the patients.
(115) All references cited herein are incorporated in their entireties by reference.
(116) The description of the invention is merely exemplary in nature and, thus, variations that do not depart from the gist of the invention are intended to be within the scope of the invention. Such variations are not to be regarded as a departure from the spirit and scope of the invention.
REFERENCES
(117) Bendandi, M., C. D. Gocke, et al. (1999). “Complete molecular remissions induced by patient-specific vaccination plus granulocyte-monocyte colony-stimulating factor against lymphoma.” Nat Med 5(10): 1171-7. Biragyn, A., P. A. Ruffini, et al. (2002). “Toll-like receptor 4-dependent activation of dendritic cells by beta-defensin 2.” Science 298(5595): 1025-9. Biragyn, A., K. Tani, et al. (1999). “Genetic fusion of chemokines to a self tumor antigen induces protective, T-cell dependent antitumor immunity.” Nat Biotechnol 17(3): 253-8. Bogen, B. (1989). “Monoclonal antibodies specific for variable and constant domains of murine lambda chains.” Scand J Immunol 29(3): 273-9. Bogen, B., Peripheral T cell tolerance as a tumor escape mechanism: deletion of CD4+ T cells specific for a monoclonal immunoglobulin idiotype secreted by a plasmacytoma. Eur J Immunol. 1996 November; 26(11):2671-9. Bogen, B., L. Gleditsch, et al. (1992). “Weak positive selection of transgenic T cell receptor-bearing thymocytes: importance of major histocompatibility complex class II, T cell receptor and CD4 surface molecule densities.” Eur J Immunol 22(3): 703-9. Bogen, B. and J. D. Lambris (1989). “Minimum length of an idiotypic peptide and a model for its binding to a major histocompatibility complex class II molecule.” Embo J 8(7): 1947-52. Bogen, B., B. Malissen, et al. (1986). “Idiotope-specific T cell clones that recognize syngeneic immunoglobulin fragments in the context of class II molecules.” Eur J Immunol 16(11): 1373-8. Casten, L. A. and S. K. Pierce (1988). “Receptor-mediated B cell antigen processing. Increased antigenicity of a globular protein covalently coupled to antibodies specific for B cell surface structures.” J Immunol 140(2): 404-10. Eisen, H. N., E. S. Simms, et al. (1968). “Mouse myeloma proteins with antihapten antibody activity. The protein produced by plasma cell tumor MOPC-315.” Biochemistry 7(11): 4126-34. Hakim, I., S. Levy, et al. (1996). “A nine-amino acid peptide from IL-1 beta augments antitumor immune responses induced by protein and DNA vaccines.” J Immunol 157(12): 5503-11. Hough, D. W., R. P. Eady, et al. (1976). “Anti-idiotype sera raised against surface immunoglobulin of human neoplastic lymphocytes.” J Exp Med 144(4): 960-9. Huang, H. I., P. Y. Wu, et al. (2004). “Improved immunogenicity of a self tumor antigen by covalent linkage to CD40 ligand.” Int J Cancer 108(5): 696-703. King, C. A., M. B. Spellerberg, et al. (1998). “DNA vaccines with single-chain Fv fused to fragment C of tetanus toxin induce protective immunity against lymphoma and myeloma.” Nat Med 4(11): 1281-6. Kristoffersen, G., K. Hannestad, et al. (1987). “Two M315 idiotopes defined by isologous monoclonal antibodies: one depends on germline and the other on mutated murine lambda 2 light chain sequences.” Scand J Immunol 26(5): 535-46. Lauritzsen, G. F., S. Weiss, et al. (1993). “Anti-tumour activity of idiotype-specific, MHC-restricted Th1 and Th2 clones in vitro and in vivo.” Scand J Immunol 37(1): 77-85. Lauritzsen, G. F., S. Weiss, et al. (1994). “Naive idiotype-specific CD4+ T cells and immunosurveillance of B-cell tumors.” Proc Natl Acad Sci USA 91(12): 5700-4. Lunde, E., L. A. Munthe, et al. (1999). “Antibodies engineered with IgD specificity efficiently deliver integrated T-cell epitopes for antigen presentation by B cells.” Nat Biotechnol 17(7): 670-5. Lunde, E., I. B. Rasmussen, et al. (2001). “‘Troy-bodies’: antibodies as vector proteins for T cell epitopes.” Biomol Eng 18(3): 109-16. Lunde, E., K. H. Western, et al. (2002). “Efficient delivery of T cell epitopes to APC by use of MHC class II-specific Troybodies.” J Immunol 168(5): 2154-62. Neuberger, M. S. (1983). “Expression and regulation of immunoglobulin heavy chain gene transfected into lymphoid cells.” Embo J 2(8): 1373-8. Norderhaug, L., T. Olafsen, et al. (1997). “Versatile vectors for transient and stable expression of recombinant antibody molecules in mammalian cells.” J Immunol Methods 204(1): 77-87. Olafsen, T., I. B. Rasmussen, et al. (1998). “IgM secretory tailpiece drives multimerisation of bivalent scFv fragments in eukaryotic cells.” Immunotechnology 4(2): 141-53. Ozato, K., N. Mayer, et al. (1980). “Hybridoma cell lines secreting monoclonal antibodies to mouse H-2 and Ia antigens.” J Immunol 124(2): 533-40. Ravetch, J. V. and S. Bolland (2001). “IgG Fc receptors.” Annu Rev Immunol 19: 275-90. Sirisinha, S. and H. N. Eisen (1971). “Autoimmune-like antibodies to the ligand-binding sites of myeloma proteins.” Proc Natl Acad Sci USA 68(12): 3130-5. Snider, D. P. and D. M. Segal (1987). “Targeted antigen presentation using crosslinked antibody heteroaggregates.” J Immunol 139(5): 1609-16. Tao, M. H. and R. Levy (1993). “Idiotype/granulocyte-macrophage colony-stimulating factor fusion protein as a vaccine for B-cell lymphoma.” Nature 362(6422): 755-8. Tjelle, T., Corthay, A., Lunde, E., Sandlie, I., Michaelsen, T E., Mathiesen, I and Bogen, B. (2004). “Monoclonal antibodies produced by muscle after plasmid injection and electroporation.” J Mol Ther. Tollefsen, S., T. Tjelle, et al. (2002). “Improved cellular and humoral immune responses against Mycobacterium tuberculosis antigens after intramuscular DNA immunisation combined with muscle electroporation.” Vaccine 20(27-28):3370-8.