Detection of bacteria and fungi

09796997 · 2017-10-24

Assignee

Inventors

Cpc classification

International classification

Abstract

A method of detecting a ligase expressing micro-organism in a sample comprises steps of treating the sample under conditions that inhibit the activity of ATP-dependent ligase from mammalian cells but which do not inhibit the activity of the microbial ligases, contacting the sample or a portion of the sample with a nucleic acid molecule which acts as a substrate for ligase activity in the sample, incubating the thus contacted sample under conditions suitable for ligase activity; and specifically determining the presence and/or the amount of a ligated nucleic acid molecule resulting from the action of the ligase on the substrate nucleic acid molecule to indicate the presence of the ligase expressing micro-organism. The micro-organism may be a fungus or a bacterium or both. High pH conditions may be employed to inactivate mammalian ligases. Related kits are described.

Claims

1. A method of detecting a ligase expressing microorganism in a sample containing mammalian cells comprising: (a) selectively permeabilizing the cell membrane of the mammalian cells in the sample without lysing microorganisms in the sample; (b) treating the resultant sample of step (a) under high pH conditions that inhibit the activity of ATP-dependent ligase from mammalian cells but do not inhibit the activity of intracellular microbial ligases; (c) lysing microorganisms in the resultant sample of step (b) to release ATP and NAD-dependent ligase; (d) contacting the resultant sample of step (c) or a portion of the resultant sample of step (c) with a nucleic acid molecule which is a substrate for microbial ligase in the sample; (e) incubating the resultant sample of step (d) under conditions suitable for microbial ligase activity; and (f) determining the presence and/or the amount of a ligated nucleic acid molecule resulting from the action of the intracellular microbial ligase present in the resultant sample from step (e) on the microbial substrate nucleic acid molecule to indicate the presence of the ligase-expressing microorganism in the incubated sample resulting from step (e).

2. The method of claim 1, wherein said high pH conditions is at least pH 10.

3. The method of claim 1, wherein the ligase-expressing microorganism comprises fungal or bacterial cells or both.

4. The method of claim 1, wherein the ligase expressed by the microorganism comprises an ATP-dependent ligase, an NAD-dependent ligase or both.

5. The method of claim 4, wherein the presence of NAD-dependent ligase activity in the sample indicates the presence of bacterial cells.

6. The method of claim 1, wherein the high pH conditions that inhibit the activity of ATP-dependent ligase from mammalian cells but which do not inhibit the activity of the microbial ligases comprise treating the sample with sodium hydroxide (NaOH) or sodium carbonate (Na.sub.2CO.sub.3).

7. The method of claim 6, wherein: (a) the NaOH is around 5 mM NaOH; (b) the pH is around 12; (c) the treatment is carried out for around 20 minutes; or (d) a combination thereof.

8. The method of claim 1, wherein lysis of microorganisms in step (c) is performed mechanically.

9. The method of claim 1, wherein the high pH is at least pH 11.

10. The method of claim 1, wherein said method further comprises identifying the microorganism responsible for an infection or a disease associated with the presence of a microorganism.

11. The method claim 1, wherein the same nucleic acid molecule is used as a substrate for both NAD-dependent ligase activity and ATP-dependent ligase activity.

12. A method of detecting fungal or bacterial cells or both in a sample comprising: (a) selectively permeabilizing the cell membrane of mammalian cells in the sample without lysing microorganisms in the sample; (b) treating the resultant sample of step (a) under conditions that inhibit the background from mammalian ATP-dependent ligase but do not affect intracellular microbial ATP and NAD-dependent ligases; (c) lysing microorganisms in the resultant sample of step (b) to release the microbial ATP- and NAD-dependent ligases; (d) contacting a first portion of the resultant sample of step (c) with a nucleic acid molecule which is a substrate for microbial ATP-dependent ligase in the resultant sample of step (c); (e) incubating the resultant sample of step (d) under conditions suitable for microbial ATP-dependent ligase activity; (f) determining the presence, amount, or both of a ligated nucleic acid molecule in the resultant sample of step (e) resulting from the action of the microbial ATP-dependent ligase on the substrate nucleic acid molecule to indicate the presence of fungi and/or bacteria; (g) contacting the a second portion of the resultant sample of step (c) with a nucleic acid molecule which is a substrate for bacterial NAD-dependent ligase in the sample; (h) incubating the resultant sample of step (g) under conditions suitable for bacterial NAD-dependent ligase activity; and (i) determining the presence, amount, or both of a ligated nucleic acid molecule resulting from the action of the bacterial NAD-dependent ligase on the substrate nucleic acid molecule to indicate the presence of bacteria only.

13. The method of claim 12, wherein said high pH conditions is at least pH 10.

14. A method of detecting the microorganism responsible for an infection, or a disease associated with the presence of a bacterial or fungal cell in a sample obtained from a mammalian subject comprising: (a) selectively permeabilizing the cell membrane of mammalian cells in the sample without lysing microorganisms in the sample; (b) treating the resultant sample of step (a) under high pH conditions that inhibit the background from mammalian ATP-dependent ligase but which do not affect intracellular microbial ATP- and NAD-dependent ligases; (c) lysing microorganisms in the resultant sample of step (b) to release the microbial ATP- and NAD-dependent ligases; (d) contacting a first portion of the resultant sample of step (c) with a nucleic acid molecule which is a substrate for microbial ATP-dependent ligase activity in the sample; (e) incubating the contacted resultant sample of step (d) under conditions suitable for microbial ATP-dependent ligase activity; (f) determining the presence, amount, or both of a ligated nucleic acid molecule in the resultant sample of step (e) resulting from the action of the microbial ATP-dependent ligase on the substrate nucleic acid molecule to indicate the presence of fungi and/or bacteria causing the infection; (g) contacting a second portion of the resultant sample of step (c) with a nucleic acid molecule which acts as a substrate for bacterial NAD-dependent ligase present in the sample; (h) incubating the resultant sample of step (g) under conditions suitable for NAD-dependent ligase activity; and (i) determining the presence, amount, or both of a ligated nucleic acid molecule resulting from the action of the bacterial NAD-dependent ligase on the substrate nucleic acid molecule to indicate the presence of bacteria causing the infection.

15. The method of claim 14, wherein said high pH conditions is at least pH 10.

16. A method of detecting fungal cells in a sample comprising: (a) selectively permeabilizing the cell membrane of mammalian cells in the sample without lysing the fungi in the sample; (b) treating the resultant sample of step (a) under high pH conditions that inhibit the background signal from mammalian ATP-dependent ligase but do not affect intracellular fungal ATP dependent ligases; (c) lysing fungal cells in the resultant sample of step (b) to release the fungal ATP-dependent ligases; (d) contacting the resultant sample of step (c) or a portion of the resultant sample of step (c) with a nucleic acid molecule which is a substrate for fungal ATP-dependent ligase in the sample (e) incubating the resultant sample of step (d) under conditions suitable for fungal ATP-dependent ligase activity; (f) determining the presence, amount, or both of a ligated nucleic acid molecule resulting from the action of the fungal ATP-dependent ligase on the substrate nucleic acid molecule to indicate the presence of fungi.

17. The method of claim 16, wherein said high pH conditions is at least pH 10.

18. A method of determining whether a fungus is responsible for an infection, or a disease associated with the presence of a fungal cell in a sample obtained from a subject comprising: (a) selectively permeabilizing the cell membrane of mammalian cells in the sample without lysing the fungi in the sample; (b) treating the resultant sample of step (a) under conditions that inhibit the background from mammalian ATP-dependent ligase but do not affect fungal ATP-dependent ligases; (c) lysing any fungal cells in the resultant sample of step (b) to release the fungal ATP-dependent ligase; (d) contacting the resultant sample of step (c) with a nucleic acid molecule which is a substrate for fungal ATP-dependent ligase in the resultant sample from step (c); (e) incubating the resultant sample of step (d) under conditions suitable for fungal ATP-dependent ligase activity; and (f) determining the presence, amount, or both of a ligated nucleic acid molecule resulting from the action of the fungal ATP-dependent ligase on the substrate nucleic acid molecule in the resultant sample from step (e) to indicate the presence of fungi causing the infection or disease.

19. The method of claim 18, wherein said high pH conditions is at least pH 10.

Description

BRIEF DESCRIPTION OF THE DRAWING

(1) FIG. 1 shows real time assay results for the PCR assay. The curves shown are, from left to right: 24000 cells, 2400 cells, 240 cells, 0 cells, remaining traces are buffer controls.

EXPERIMENTAL SECTION

(2) The invention will be understood with respect to the following non-limiting examples:

Example 1

Blood Broth Assay for Yeast

(3) Preparation of Assay Solutions:

(4) TABLE-US-00001 10x T4 DNA ligase reaction buffer (NEB cat. # B0202S) 10% Triton-X-100 (Sigma cat. # T8532) 5% BSA (Sigma cat. # A7906) 1M Tris Cl pH 7.5 (from Tris HCl and Tris base, Sigma cat. # T3253, T1503) pH to 7.5 H2O (Sigma cat. # W4502) through 0.2 μm filter then autoclaved, use this H2O where - required in assay 25 DNA (sequences from MWG) 1M NaOH (Sigma cat. # 221465) DTT

(5) Ceramic lysis beads (1 mm diameter) supplied by Idexx Laboratories Inc. were blocked with 1 ml 5% BSA overnight and washed with 1× reaction buffer, 1 ml of B0202S

(6) Resuspend in 1× reaction buffer, 1 ml of B0202S.

(7) DNA components were dissolved (oligonucleotides supplied by MWG Eurofins) at a working concentration of 1 ng/μl in H2O via serial dilutions in 10 mM EDTA (sigma cat. # E7889).

(8) The sequences were:

(9) TABLE-US-00002 (SEQ ID NO: 1) S1 ACCAAAATCCCACCACAACAGAACTCACCAACCAAACACACACACAA CAAC (SEQ ID NO: 2) S2 CCACGCTCACCTCGGCTCCCTCTTCTCTGACTCCTTCC (SEQ ID NO: 3) AS GAGGTGAGCGTGGGTTGTTGTGTGTGTGTTTCC (SEQ ID NO: 4) F CCCACCACAACAGAACTCACCAACC (SEQ ID NO: 5) R GGAAGGAGTCAGAGAAGAGGGAGCC
where F and R refer to forward and reverse primers, S1, S2 and AS are the 3 components of the substrate.
Assay Protocol 1. Add 10 ml blood broth (diluted 1:4) to sterile 15 ml falcon tubes 2. Add 10 blocked and washed ceramic beads 3. Add 0.2 ml 10% Triton, invert to mix 4. Spin 4000 rpm for 20 min in bench centrifuge 5. Aspirate supernatant 6. Add 1 ml H2O 7. Resuspend pellet 8. Add 9 ml H2O 9. Add 0.5 ml 5% BSA 10. Add 50 μl 1M NaOH (giving 5 mM NaOH pH12), invert to mix 11. Spin 4000 rpm for 20 min 12. Aspirate supernatant, leaving dry beads, neutralise with 10 ml 50 mM TrisCl pH 7.5, mix by vortex for 20 sec 13. Spin 4000 rpm for 20 min, aspirate supernatant 14. Remove remaining solution 15. Resuspend beads and pelleted yeast cells in 100 μl mechanical lysis mix: 5% BSA 20 μl 1% Triton-X-100 10 μl 1% Tween 20 10 μl 10× T4 DNA ligase reaction buffer 10 μl AS1318 DNA1 ng/μl 10 μl 1M DTT 1 μl H2O 39 μl 16. Transfer to mechanical lysis tubes (Sarstedt 2 ml sterile tubes cat. #72. 694. 006) 17. Ribolyse power 5 m/sec for 45 sec, wait 2 mins, then repeat 18. Short centrifuge step (2 min) 19. Incubate 37 deg C for 30 min 20. 2 μl to PCR Thermal Cycle Programme 50 deg 2 min 95 deg 15 min 1× 94 deg 10 sec 72 deg 5 sec 30×

(10) The PCR mix contained 10 μl SYBR Green 2× (Eurogentec mix cat.# RT-SN2X-03+NR), F primer 10 μM 2.25 μl, R primer 10 μM 2.25 μl, H2O 3.5 μl

(11) Results

(12) The FIGURE shows real time assay results for the PCR assay, 10 curves are (left to right): 24000 cells, 2400 cells, 240 cells, 0 cells, remaining traces are buffer controls.

Example 2

Demonstration of the Inactivation of Host ATP-Dependent Ligase with NaOH

(13) Rationale. This experiment was performed in order to demonstrate the ability of alkali pH to inactivate host ATP-dependent ligase released from mammalian white blood cells.

(14) Method

(15) For Mammalian Cells

(16) 45 10 ml of blood was diluted to 50 ml with water to lyse the red cells.

(17) White cells were collected by centrifugation.

(18) The cells were resuspended in 50 mM hepes pH 7 and lysed by ribolysis as described in step 15 of example 1 above then diluted 100-fold in water.

(19) One aliquot of the lysed cells was treated with 5 mM NaOH pH 12 for 20 min whereas another aliquot remained untreated. After treatment with NaOH the lysed cells were diluted into ligase mix and tested for ligase activity as described above in example 1.

(20) For Bacteria

(21) Cultured E. coli was diluted in water and either treated with 5 mM NaOH, 5 mM NaOH and 50% (v/v) BPer (Fisher Cat. No. 78243) (to lyse the bacterial cells) or with Bper only.

(22) After treatment for 20 min, the cells were diluted into ligase mix and tested for ligase activity as described in example 1 except that E. coli DNA ligase buffer containing NAD was used.

(23) Results

(24) After PCR, the cycles at which the PCR became positive were recorded (see below). White cells+NaOH 28.3 White cells−NaOH 19.5 E. coli+NaOH 20.5 E. coli+NaOH+BPer 15.2 E. coli+BPer 15.2
Conclusion

(25) The treatment of the white cells with NaOH reduced the signal generated by PCR by 9 cycles compared to untreated white cells. This is due to inactivation of the host ligase by NaOH. In contrast, E. coli lysed with BPer yielded the same PCR signal whether the ligase was treated with NaOH or not. This demonstrates that the ligase present in the bacteria is much more resistant to NaOH alkali treatment. If the bacteria are treated with NaOH only, the signal is low because the bacteria remain intact and the ligase is not released into the assay.

Example 3

Blood Broth Assay for Yeast

(26) The purpose of this experiment is to show that yeast (Candida albicans as example) can be detected sensitively even in the presence of blood broth.

(27) Preparation of assays solutions and components of the substrate were as listed above in Example 1.

(28) Assay Protocol

(29) A Typical Assay Protocol is as Follows. 1. To 0.25 ml 10% (v/v) Triton X-100 in a 15 ml centrifuge tube, add 10 ml blood:broth and mix. Note: If spiking with bacteria or fungi, add them at this step. 2. Incubate for 5 min on the bench then centrifuge 3-4000×g for 20 min. 3. Pour off the supernatant and invert tube on a tissue to dry. 4. Add 1 ml H2O and pipette to resuspend. 5. Add 9 ml H2O and invert to mix. Add 1 ml 50 mM NaOH and invert to mix 6. Incubate 5 min on the bench then centrifuge 3-4000×g for 20 min. 7. Pour off supernatant and invert tube to dry. 8. Resuspend pellet in 1 ml 50 mM Tris pH 7.5, transfer to microfuge tube, spin 8,000 rpm 3 min, pipette off supernatant 9. Add 50 μl Ribomix and mix to resuspend pellet. 10. Transfer to a 2 ml ribolysis tube containing ribolysis beads. 11. Ribolyse at power 4 for 20 sec. 12. Place the tube at 37° C. for 30 min for ligation. 13. Spin 8 krpm 3 min 14. Remove 2 μl to PCR. Ribomix:

(30) TABLE-US-00003 5% BSA 10 μl 1% triton  5 μl 1% tween  5 μl 10 X rxn buffer  5 μl (containing ATP/NAD) DNA 0.1 pmol/μl/μl  5 μl H2O 20 μl
PCR mix:

(31) TABLE-US-00004 SYBR Stratagene mix  10 μl (# 600830) F primer 10 μM   2 μl R primer 10 μM   2 μl UDGase 0.4 μl Sample   2 μl Water 3.6 μl PCR PROG 55 deg 10 min 95 deg 10 min  1x 95 deg 10 sec 65 10 sec 72 10 sec 40x
DNA sequences (all read 5′-3′)

(32) TABLE-US-00005 (SEQ ID NO: 6) AS DNA: UAG UAC UUC GUG GGU UGU UGU CUC UCG CCU UCC CAG UUC GGC CGU UGU CCG AUA UCG GCU 3′ phosphate (SEQ ID NO: 7) S1: GCC GAT ATC GGA CAA CGG CCG AAC TGG GAA GGC GAG AGA CAA CAA C (SEQ ID NO: 8) S2: 5′ phosphate CC ACG AAG TAC TAG CTG GCC GTT TGT CAC CGA CGC CTA 3′ phosphate (SEQ ID NO: 9) F primer GGA CAA CGG CCG AAC TGG GAA GGC G (SEQ ID NO: 10) R primer TAG GCG TCG GTG ACA AAC GGC CAG C
Results

Experiment 1.a

(33) C. albicans in culture medium vs C. albicans in blood broth (NaOH treated).

(34) When C. albicans was measured using the above protocol, with an NaOH treatment step, the results were as shown in Table 1 below:

(35) TABLE-US-00006 TABLE 1 Culture medium Blood broth Numerical Numerical difference difference Ct from Ct from Number of differ- control differ- control C. albicans Ct ence (fold) Ct ence (fold) 390 CFU/mL  24.1 3.5 11.3 24.5 4.6 24.3 98 CFU/mL 26.1 1.5 2.8 27.0 2.1 4.3 25 CFU/mL 25.3 2.3 4.9 27.7 1.4 2.6 Control 27.6 0 29.1 0 Because each Ct difference represents a two-fold increase in the signal, the figures in the “numerical difference” column are given to show the actual difference. For example, 390 CFU/mL C albicans gave an 11.3-fold increase in signal over background or a 3.5 Ct difference in culture medium.
The Results Show: 1. C. albicans can be measured sensitively in blood broth. 2. The background signal in blood broth is very low when the NaOH treatment has been used.

Experiment 1b

Effect of High pH Exposure on Blood DNA Ligase Signal

(36) In blood broth that is not treated with NaOH, there is a very high signal even after the blood cells have been removed by the Triton lysis step (step 3 above). This appears to be due to a blood lysis residue containing white cells. An experiment was performed according to the above protocol using 10 mL of sterile human blood diluted to 50 mL in culture medium and measured with and without NaOH treatment, with no fungi present. The pellet at step 6 was diluted 100 fold to keep signals within a reasonable range

(37) TABLE-US-00007 TABLE 2 −NaOH +NaOH Blood lysis residue/100 19.5 26.7 control 29.5 29.5

(38) In the absence of NaOH the blood signal even when diluted 100-fold was 10 Ct, far higher than the level seen with small amounts of C. albicans. In the presence of NaOH this background signal is reduced to 2.8 Ct. This is a difference of 7.2 Ct or a 150-fold reduction.

Experiment 1c

Effect of High pH Exposure on C. albicans

(39) Does high pH lyse C. albicans or is the pH effect simply because the organism remains resistant to pH because it remains intact?

(40) C. albicans in culture medium were exposed to varying pH for 20 min before being tested for ligase activity as described above but without the lysis step (step 12). This was compared to a routine assay run at pH 7.5 with the lysis step. In this case the high pH was created by exposure to sodium carbonate rather than sodium hydroxide.

(41) TABLE-US-00008 TABLE 3 Signal change pH Ct Change in Ct (fold) 7.5 29 0 0 9.6 29.4 — — 10.2 28.9 0.1 0 11.2 26.8 2.2 4.6 7.5 (lysed) 26.8 2.2 4.6

(42) The results show that there is no significant signal from C. albicans in the absence of a lysis step, until pH 11.2. At this pH the yeast appear to be lysing and giving a signal as strong at that seen in lysed yeast.

(43) If the above experiment is repeated but all the test pH samples are lysed instead, the results are as shown in table 4:

(44) TABLE-US-00009 TABLE 4 Signal change pH Ct Change in Ct (fold) 7.5 26.2 3.6 12.1 9.6 27.2 2.6 6.1 10.2 27.1 2.7 6.5 11.2 26.5 3.3 9.8 control 29.8 0

(45) This demonstrates that when the lysed yeast are exposed to high pH they are still able to give a strong signal, with the signal at pH 11.2 almost as high as the signal at pH 7.5. This is in direct contrast to the results using blood.

Experiment 2

Effect of High pH on Saccharomyces cerevisiae

(46) The experiment to test the effect of high pH was repeated using lysed and unlysed Saccharomyces cerevisiae. The lysis step in the case was to expose the organism to YPER, a yeast lysis agent marketed by Pierce, instead of mechanical lysis.

(47) TABLE-US-00010 TABLE 5 Ct Numerical Ct difference difference (fold) S. cerevisiae + YPER 27.3 3.0 8 S. cerevisiae + NaOH 28.3 2.0 4 S. cerevisiae + YPER + NaOH 28.3 2.0 4 Control 30.3 0

(48) The experiment demonstrates that S. cerevisiae shows a good signal after exposure to high pH even though it has been lysed.

Experiment 3

Effect of High pH on E. coli

(49) The experiment to test the effect of high pH was repeated using lysed and unlysed E. coli. The lysis step in the case was to expose the organism to BPER, a bacterial lysis agent marketed by Pierce, instead of mechanical lysis.

(50) TABLE-US-00011 TABLE 6 Ct Numerical Ct difference difference (fold) E. coli + BPER 24.7 5.1 34 E. coli + NaOH 26.6 3.2 9.2 E. coli + BPER + NaOH 23.6 6.2 74 Control 29.8 0

(51) The experiment demonstrates that E. coli shows an excellent signal after exposure to high pH even though it has been lysed.

Experiment 4

Effect of High pH on Purified Bacterial DNA Ligase and Mammalian Ligase

(52) Recombinant E. coli DNA ligase (NEB catalogue number M0205) was exposed to pH 10.2 for 20 min and the signal compared to the unexposed enzyme. This was compared to exposure of blood ATP ligase activity after the same period of exposure to pH 10.2.

(53) TABLE-US-00012 TABLE 7 Numerical Ct Ct difference difference (fold) Bacterial DNA ligase − NaOH 12.0 16 63,000 E. coli + NaOH 11.5 16.5 93,000 Control Blood ATP ligase − NaOH 23.8 8.3 315 Blood ATP ligase + NaOH 33.4 — 0 Control 32.1

(54) The experiment shows the bacterial isolated enzyme (in the presence of NAD, its substrate) to be extremely robust toward exposure to high pH. By contrast the mammalian ligase activity in the presence of ATP was eliminated at the same pH.

(55) The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims. Moreover, all embodiments described herein are considered to be broadly applicable and combinable with any and all other consistent embodiments, as appropriate.

(56) Various publications are cited herein, the disclosures of which are incorporated by reference in their entireties.