TH1/TH2 polarizing vaccines

Abstract

The present invention relates to recombinant chimeric molecules that are capable of providing T cell receptor (TCR) interaction and costimulation for activation and differentiation of pathogen-specific T cells toward effector T helper 1 (Th1) or T helper 2 (Th2) cells. The chimera may capable of elicit antibodies against pathogen-specific B cell epitope(s). The present invention also relates method of using these chimeric molecules in whole or as a component of a vaccine.

Claims

1. A malaria vaccine comprises a chimeric molecule, wherein said chimeric molecule comprising: a) an immunoglobulin scaffold, wherein said immunoglobulin scaffold comprising a domain specific for binding to a protein on an antigen presenting cell; b) a costimulatory domain linked to a heavy chain of said immunoglobulin scaffold; and c) a circumsporrozoite protein-specific (CSP-specific) T cell epitope linked to a c-terminus of a light chain of said immunoglobulin scaffold.

2. The malaria vaccine of claim 1, wherein said chimeric molecule further comprising at least one malaria-specific B cell epitope linked to the C-terminus of said heavy chain of said immunoglobulin scaffold.

3. The malaria vaccine of claim 1, wherein said immunoglobulin scaffold is a humanized immunoglobulin.

4. The malaria vaccine of claim 1, wherein said immunoglobulin scaffold comprising at least one domain of an immunoglobulin Ig.G.

5. The malaria vaccine of claim 4, wherein said immunoglobulin is IgG1, IgG2, IgG3, or IgG4.

6. The malaria vaccine of claim 1, wherein said antigen presenting cell is selected from the group consisting of dendritic cells, Langerhans cells, B cells, monocytes, macrophages, endothelial cells, and granulocytes.

7. The malaria vaccine of claim 1, wherein said antigen presenting cell is a dendritic cell.

8. The malaria vaccine of claim 7, wherein said protein on said antigen presenting cell is CD205.

9. The malaria vaccine of claim 1, wherein said costimulatory domain is linked to C-terminus of said heavy chain of said immunoglobulin.

10. The malaria vaccine of claim 1, wherein said costimulatory domain is selected from the group consisting of B7.1 (CD80), B7.2 (CD86), interleukin 2, and Interleukin 12.

11. The malaria vaccine of claim 1, wherein said costimulatory domain is B7.1.

12. The malaria vaccine of claim 1, wherein said costimulatory domain is selected from the group consisting of interleukin-4, interleukin-5, interleukin-6, interleukin-10, interleukin-13.

13. The malaria vaccine of claim 1, wherein said costimulatory domain comprising interleukin-4.

14. The malaria vaccine of claim 1, wherein said T cell epitope is a CD4 T cell epitope or a CD8 T cell epitope.

15. The malaria vaccine of claim 2, wherein said malaria-specific B cell epitope comprising at least one immunogenic polypeptide selected from antigens consisting of circumsporrozoite protein (CSP), thrombospondin related adhesive protein/sporozoites surface protein-2 (TRAP/SSP2), liver stage antigen-1 (LSA1), merozoite surface protein-1 (MSP1), apical membrane antigen-1 (AMA-1).

16. The malaria vaccine of claim 15, wherein said malaria-specific B cell epitope is linked to said C-terminus of said heavy chain of said immunoglobulin scaffold by a glycine linker.

17. The malaria vaccine of claim 16, wherein said costimulatory domain is linked to said malaria-specific B cell epitope.

18. An immunogenic composition, comprising the malaria vaccine of claim 1.

19. The malaria vaccine of claim 17, wherein said costimulatory domain is linked to said pathogen-specific B cell epitope by a glycine linker.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1. Genetic construction of chimeric Ig-H and Ig-kappa genes encoding for Th1/Th2-polarizing vaccines. Each vaccine, namely PyBTh1, PyTh1, PyBTh2, and PyTh2 are encoded by a specific Ig-H gene and a common Ig-kappa gene. Schematic representation of the chimeric genes is shown. Each genetic domain is represented by boxes. Flexible glycine linkers between domains are indicated by lines.

(2) FIG. 2A. Expression of the chimeric Th1/Th2 genes in stably transfected myeloma SP20 cells. mRNA extracted from plasmid-transfected SP20 cells was used as template for RT-PCR amplification of the chimeric Ig-H (left panel) and Ig-kappa genes (right panel).

(3) FIG. 2B. Expression of the chimeric Th1/Th2 genes in stably transfected myeloma SP20 cells. Expression of the chimeric Ig-H (right panel) and Ig-kappa (left panel) genes as measured by real-time RT-PCR. Expression of 18S RNA by transfected cells is also shown. Results indicate active transcription of the transfected genes encoding for the Th1/Th2 vaccines.

(4) FIG. 3A. Immunocharacterization of Th1/Th2-polarizing vaccines. Silver stain gels showing the molecular size of the Th1/Th2 vaccines in denaturing (left panel) and denaturing/reducing conditions (right panel).

(5) FIG. 3B. Immunocharacterization of Th1/Th2-polarizing vaccines. Western blotting of Th1/Th2-polarizing vaccines using anti-mouse IgG heavy chain.

(6) FIG. 3C. Immunocharacterization of Th1/Th2-polarizingvaccines. Western blotting of Th1/Th2-polarizing vaccines using anti-PyCSP B cell repeats (NSLY) mAb.

(7) FIG. 3D. Immunocharacterization of Th1/Th2-polarizing vaccines. Western blotting of Th1/Th2-polarizing vaccines using anti-mouse IL-4 (upper panel) and anti-mouse B7.1 (CD80) (lower panel) mAbs.

(8) FIG. 4. Binding of chimeric molecules to DEC205 receptor and to FcRs. Panel A, the plasmid DNA encoding for DEC25 receptor was stably transfected into A204 cells. Upper histogram shows expression of DEC205 receptor on transfected cells as revealed by staining with rat anti-mouse DEC205. Binding of PyTh1 vaccine to DEC205 receptor is shown in the lower histogram. Panel B, binding of PyTh1 to FcRs.

(9) FIG. 5. Function of B7.1 and IL-4 components of the malaria vaccine reagents.

(10) FIG. 6. Immunogenicity of the pyCSP B cell repeats expressed by PyBTh1 and PyBTh2 chimers.

(11) FIG. 7A. Immunogenicity of the PyCSP CD4 T cell epitope expressed by the chimera PyTh1.

(12) FIG. 7B Immunogenicity of the PyCSP CD4 T cell epitope expressed by the chimera PyTh 2.

(13) FIG. 7C Immunogenicity of the PyCSP CD4 T cell epitope expressed in non-immunized mice.

(14) FIG. 8. Percentage of liver stage parasites after (A) One immunization, (b) two immunizations with the PyTh1 or PyTh2 chimeras.

(15) FIG. 9A Schematic representation of the primer sets used to encode chimeric molecules PyBTh1 heavy chain.

(16) FIG. 9B Schematic representation of the primer sets used to encode chimeric molecules PyBTh2 heavy chain.

(17) FIG. 9C Schematic representation of the primer sets used to encode chimeric molecules Kappa chain.

(18) FIG. 10 Schematic representation of the chimeric molecules Th1 and Th2 polarizing chimera molecule.

(19) FIG. 11A Schematic representation of the chimeric molecules PyBTh1 and PyBTh2.

(20) FIG. 11B Schematic representation of the mechanism of action of chimeric molecules PyBTh1 and PyBTh2.

DETAILED DESCRIPTION OF THE INVENTION

(21) An aspect of this invention is chimeric molecules capable of providing TCR interaction and costimulation required for full activation and differentiation of pathogen-specific T cells. The chimeric molecules may also elicit antibodies against pathogen-specific B cell epitope(s).

(22) Another aspect of this invention is a vaccine platform that enables a subject's immune system to overcome T cell tolerance induced by malarial pathogens.

(23) Yet another aspect of this invention is a method of making a malaria vaccine comprising chimeric molecules enables a subject's immune system to overcome T cell tolerance induced by malarial pathogens.

(24) A further aspect of this invention is a method for inducing an immune response against malaria using genetically engineered chimeric molecules capable of providing TCR interaction and costimulation required for full activation and differentiation of pathogen-specific CD4 T cells.

(25) General Structure of Chimeric Molecules

(26) The chimeric molecule of this invention is referred to herein as a protein, however, such “chimeric proteins” as defined herein may comprise non-protein components, including but not limited to, carbohydrate residues, chemical crosslinking agents, lipids, etc.

(27) An embodiment of the present invention is a chimeric molecule comprising an immunoglobulin scaffold with specificity for an antigen presenting cell and expressing critical components for activation of a T cells and/or B cells. The use of so-called protein scaffolds or immunoglobulin scaffold has recently attracted considerable attention in biochemistry in the context of generating novel types of ligand receptors for various applications in research and medicine. This development started with the notion that immunoglobulins owe their function to the composition of a conserved framework region and a spatially well-defined antigen-binding site made of peptide segments that are hypervariable both in sequence and in conformation. Laboratories exploit different types of protein architectures for the construction of practically useful binding proteins. Properties like small size of the receptor protein, stability and ease of production were the focus of this work. Hence, among others, single domains of antibodies or of the immunoglobulin superfamily, protease inhibitors, helix-bundle proteins, disulphide-knotted peptides and lipocalins were investigated. In an embodiment of this invention, the chimeric molecule comprises a costimulatory domain linked to the heavy chain of an immunoglobulin scaffold and a pathogen-specific T cell epitope linked to the light chain of the immunoglobulin scaffold. A pathogen-specific B Cell epitope may also be linked to the heavy chain of the immunoglobulin scaffold.

(28) The immunoglobulin scaffold for the chimeric molecule may comprise domains of any immunoglobulin found in human, including but not limited to IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2 and IgE. For example, IgG antibodies are large tetrameric quaternary molecules of about 150 kDa, composed of four peptide chains, including two identical heavy chains of about 50 kDa and two identical light chains of about 25 kDa. The two heavy chains are linked to each other and to a light chain by disulfide bonds. The resulting tetramer has two identical halves, which together form the Y-like shape. Each end of the fork contains an identical antigen binding site.

(29) The immunoglobulin scaffold of this invention has specificity to bind to marker of an antigen presenting cell, such as a Dendritic cell, Langerhans cells, B cells, monocyte, macrophage, endothelial cells, or granulocytes. Examples of genes that encode an epitope for binding to an antigen-presenting cell may include but not limited to CD205, CD11b, CD11c, CD14, and CD19. In a non-limiting embodiment of this invention, the domain of the constant region of IgG2a is used for the construction of the immunoglobulin scaffold, wherein said immunoglobulin is humanized and has specificity for a dendritic cell marker, such as DEC205.

(30) The costimulatory domain of a chimeric molecule of this invention may include but not limited to B7.1 (CD80), B7.2 (CD86), Interleukin 2, Interleukin 12, interleukin 23, interleukin-6, which stimulate the CD4 T cells to differentiate into effector Th1 cells. The costimulatory domain, may also include but not limited to interleukin-4, interleukin-5, interleukin-10, interleukin-17 or interleukin-13, which stimulate the CD4 T cells to differentiate of effector Th2 cells.

(31) The pathogen-specific T cell epitope of a chimeric molecule of this invention may be a CD4 T cell epitope or a CD8 T cell epitope, and may comprise any epitope of a pathogenic antigen. In a non-limiting embodiment of this invention, malaria antigen including but not limited to circumsporrozoite protein (CSP), thrombospondin related adhesive protein/sporozoites surface protein-2 (TRAP/SSP2), liver stage antigen-1 (LSA1), merozoite surface protein-1 (MSP1), apical membrane antigen-1 (AMA-1). The chimera may also bear T cell epitopes from other infectious agents such as hepatitis B, influenza A or B, rabies, rotavirus, enteroviruses, HIV, enterobacterias, Strepcococcus, Staphylococcus, toxoplasma, Leishmania.

(32) One or more pathogen-specific B cell epitope may be also linked to the C-terminus of the Immunoglobulin heavy chain. The pathogen-specific B cell epitope may comprise any malaria antigens or an epitope of a malaria antigen, including but not limited to circumsporrozoite protein (CSP), thrombospondin related adhesive protein/sporozoites surface protein-2 (TRAP/SSP2), liver stage antigen-1 (LSAT), merozoite surface protein-1 (MSP1), apical membrane antigen-1 (AMA-1). The chimera may also bear B cell epitopes from other infectious agents such as hepatitis B, influenza A or B, rabies, rotavirus, enteroviruses, HIV, enterobacterias, Strepcococcus, Staphylococcus, toxoplasma, Leishmania.

(33) The chimeric molecules of this invention may be used alone or together with other pharmaceutical composition in a vaccine. An illustration of the mechanisms of action of such a chimeric vaccine is illustrated in FIG. 11. The different parts of the chimeric molecules may be linked via linker, such as a glycine linker.

Example 1: Genetic Construction of Chimeric Ig-H and Ig-Kappa Genes

(34) Four chimeric molecules were made using genetic engineering techniques, and are separately designated as PyTh1, PyBTh1, PyTh2 and PyBTh2. Each chimera vaccine molecule is encoded by two genes. One gene encodes a specific heavy chain of the immunoglobulin (Ig-H gene) of each vaccine molecule. A second gene encodes the Kappa light chain of the immunoglobulin, which is common among the four chimeric molecules (Ig-kappa gene). Genetic sequences encoding the Ig-H of each chimeric molecule were shown in Table 1.

(35) As shown in FIG. 1 (1) and (3), the chimeric Ig-H genes of PyBTh1 and PyBTh2 contain regions encode for the variable region of rat anti-mouse DEC205 (VH), mouse IgG2a components (CH1, hinge, CH2 and CH3), PyCSP B cell repeats [QGPGAP].sub.4[QQPP].sub.5 and a T cell costimulatory ligand. The T cell costimulatory ligand is B7.1 for chimeric molecule PyBTh1 or IL-4 for chimeric molecule PyBTh2.

(36) As shown in FIG. 1 (2) and (4), the chimeric Ig-H genes of PyTh1 and PyTh2 lack the sequence encoding for the PyCSP B cell repeats. The T cell costimulatory ligand for chimeric molecule PyTh1 is B7.1 and the T cell costimulatory ligand for chimeric molecule PyTh2 is IL-4.

(37) The chimeric Ig-kappa gene shown in FIG. 1 (5), encodes for the Ig-kappa variable region of rat anti-mouse DEC-205 (VL), mouse constant Ckappa domain, and the PyCSP.sub.59-79 immunodominant CD4 T cell epitope recognized by T cells in the context of H-2.sup.d class II molecules.

(38) The genes encoding for rat anti-DEC205 Ig-variable domain (VH+VL) were cloned by rapid amplification of cDNA ends (RACE) using mRNA from rat anti-mouse DEC205 hybridoma cells (ATCC). Genes encoding for the constant domains of mouse Fc gamma and Ckappa, and the mouse costimulatory ligands (B7.1 and IL-4) were cloned by RT-PCR from mRNA extracted from BALB/c splenic cells. Sequences encoding for the PyCSP CD4 T epitope (SEQ ID NO. 18) and PyCSP B cell repeats [[QGPGAP].sub.4[QQPP].sub.5] (SEQ ID NO. 19) were inserted into the chimeric genes by site directed mutagenesis. Primers used for the genetic construction are shown in Table 2. The chimeric Ig-H and Ig-kappa genes were cloned under the CMV promoter in pCDNA3/Zeo (INVITROGEN®, San Diego, Calif.) and pcDNA/Neo plasmids (INVITROGEN®, San Diego, Calif.), respectively. Nucleotide sequencing revealed that the various components of the chimeric genes were “in frame” and do not bear mutations.

(39) TABLE-US-00001 TABLE 1 Genes encoding the chimeric molecules Nucleotide Chimeric Molecule Subunit Sequences Phy-B-Th1(IgH) SEQ ID NO. 1 PhyTh1(IgH) SEQ ID NO. 2 Phy-B-Th1(IgH) SEQ ID NO. 3 PhyTh2(IgH) SEQ ID NO. 4 Ig-kappa SEQ ID NO. 5

Example 2: Expression of the Chimeric Th1/Th2 Genes in Stably Transfected Myeloma SP20 Cells

(40) The plasmids encoding for the chimeric Ig-H and Ig-k genes were doubly transfected into mouse myeloma SP20 cells. Stable transfectants were selected by resistance to G418 and zeocin. To rule out amplification of plasmid DNA, some samples were subjected to retrotranscription (RD and then amplified by PCR using specific primers set forth in table 2.

(41) TABLE-US-00002 TABLE 2 Primers SEQ ID Primers No. Th1-Fg1-F: GCACTGAAGCTTGTCCTGATTGCCTCAGCCTTC 6 Th1-Fg1-R: CAGTGGGTATACCGATGGGGCTGTTGTTTTGGCTGAGGAGACTGTGACCAT 7 Th1-Fg2-F: CCATCGGTATACCCACTGGCCCCTG 8 CH1-R: GATTGTGGGCCCTCTGGGCTCAATTTTC 9 IgG2aFc-F: CAGAGGGCCCACAATCAAGCCCTGTCCTCCA 10 PyB-F: AGGGCCCCGGGGCGCCCCAAGAGCCGCCACAGCAACCCCCACAACAGCCTCC 11 GCAACAACCACCGCAGCAGCCCCCTGGAGGTGGTGGATCCGGTGGAG PyB-1R: CCCCTGTGGTGCCCCTGGGCTTGACCGCCTCCCCCTCCACCACCTCCTTTAC 12 CCGGAGTCCGGGAG PyB-2R (new): GCGCCCCGGGTCCCTGAGGAGCACCCGGTCCTTGTGGGGCACCAGGCCCCTG 13 TGGTGCCCCT GGGCCTTGACCGCCTCC B7.1-F: GGTGGTGGATCCGGTGGAGGGGGAAGTGGAGGTGGAGGGTCTGTTGATGAA 14 CAACTGTC B7.1-R: TGCATCTAGATCACTIGCTATCAGGAGGGTC 15 IL-4-F: GGTGGTGGATCCGGTGGAGGGGGAAGTGGAGGTGGAGGGTCTCATATCCACG 16 GATGCGAC IL-4-R: CCTCCTCTAGACTACGAGTAATCCATTTGCATG 17

(42) The chimeric proteins were purified from the cell culture supernantants by affinity chromatography using anti-mouse IgG columns. The yield of protein production is approximately 1 mg per liter of supernatant. The SP20 stable transfectants were showed to express the chimeric Ig-H and Ig-k genes, as measured by real-time PCR (FIG. 2A). Expression of the chimeric Ig-H (FIG. 2B right panel) and Ig-kappa (FIG. 2B left panel) genes were measured by real-time RT-PCR. Expression of 18S RNA by transfected cells is also shown FIG. 2. Results indicate active transcription of the transfected genes encoding for the Th1/Th2 vaccines.

Example 3: Immunocharacterization of Th1/Th2-Polarizing Vaccines

(43) The plasmid of the TH1/Th2 chimeric vaccines were purified from cell culture supernatants of plasmid-transfected SP20 cells by affinity-chromatography using anti-mouse IgG columns. Silver stain gels show the molecular size of the Th1/Th2 vaccines in denaturing condition (FIG. 3A, left panel) are approximately 195 kDa. Upon reducing condition, the chimeric Ig-H and Ig-kappa components of the vaccines showed a molecular size of approximately 75 and 25 kDa, respectively (FIG. 3A, right panel). As reference, the molecular size of mouse IgM is also shown.

(44) The chimeric vaccines were recognized by antibodies specific for the Ig constant domain, PyCSP B cell repeats, and costimulatory ligands, as revealed by western blot analysis (FIG. 3 B-D). Western blotting result of the chimeric vaccine molecules using anti-mouse IgG heavy chain was shown in FIG. 3B. The integrity of the chimeric Ig-H component of the vaccines was observed. FIG. 3C shows the western blotting result of chimeric vaccines using anti-PyCSP B cell repeats (NSLY) mAb. Only the PyBTh1 and PyBTh2 vaccine molecules, which express the PyCSP B cell repeats were recognized by the NSLY Ab. The PyTh1 and PyTh2 vaccine molecules that lack PyCSP B cell repeats were not recognized. This result shows the structural integrity of the PyCSP B cell repeats in the PyBTh1 and PyBTh2 vaccines. FIG. 3D shows the western blotting results of the chimeric vaccines using anti-mouse. IL-4 (upper panel) and anti-mouse B7.1 (CD80) (lower panel) mAbs. Both PyTh1 and PyBTh1 vaccine molecules that express mouse B7.1 costimulatory molecule were recognized by anti-B7.1 Abs. Both PyTh2 and PyBTh2 vaccine molecules that express mouse IL-4 costimulatory molecule were recognized by anti-IL-4 Abs. These results demonstrate the structural integrity of the costimulatory ligand of the vaccines.

Example 4: Ability of Chimeric Vaccines to Bind to DEC205 Receptor and to FcRs

(45) The Th1/Th2-polarizing vaccines are made of a mouse IgG2a scaffold with specificity for DEC205 receptor. The constant domain of mouse IgG2a is also able to bind with high-affinity to Fc receptors (FcRs). The results shown in FIG. 4, indicate the structural integrity of the Ig-H component of the vaccines and its ability to bind to FcRs expressed on APCs. The gene encoding for mouse DEC205 receptor (5.5 Kb) was amplified by RT-PCR from total RNA extracted from spleen cells of BALB/c mice and cloned into pcDNA3 vector expressing “Zeocin” resistance gene. The plasmid DNA encoding for DEC25 receptor was stably transfected into A204 cells. Upper histogram of FIG. 4A shows expression of DEC205 receptor on transfected cells as revealed by staining with rat anti-mouse DEC205. Binding of PyTh1 vaccine to DEC205 receptor is shown in the lower histogram.

(46) Spleen cells from BALB/c mice were stimulated for 12 hour with 100 U/ml mouse IFNγ. Study has previously shown that IFNγ upregulates the expression of FcRs on monocytes/macrophages [13]. IFNγ-stimulated splenic cells were harvested and stained with the PyTh1 vaccine. Binding to FcRs was assessed by Fluorescence-activated cell sorting (FACS) (Becton Dickinson, Franklin Lakes, N.J.) in the FCS/SSC gated splenic monocyte cell population. The results were shown in FIG. 4B, which indicate the structural integrity of the Ig-H component of the vaccines and its ability to bind to FcRs expressed on APCs.

Example 5: Function of B7.1 and IL-4 Components of the Malaria Vaccine Reagents

(47) The costimulatory domains are also found to be fully functional as illustrated in FIG. 5. Negatively-sorted CD4 T-cells (20×10.sup.6 cells) from naïve CD28 or CD28 KO BALB/c mice were incubated for 10 minutes with the vaccines (5 μg), recombinant mouse B7.1 molecule (5 μg, positive control) generated in the lab, or recombinant mouse IL-4 (5 μg) in PBS at 37° C. Cells were washed in PBS, and lysed for 10 minutes in cold PBS containing 0.5% NP-40, a cocktail of protease inhibitors, and sodium vanadate. Cell lysates were immunoprecipitated for 2 hours at room temperature with CD28 mAb or IL-4Rα mAb (5 μg) followed by incubation for 10 minutes at room temperature with 50 μL of Agarose-Protein A conjugate and electrophoresis on 10% SDS-PAGE. Gels were electrotransferred on PVDF membranes, which were blocked in 5% milk and then probed overnight at 4° C. with phospho-PI-3K (p110) mAb-HRP or phosphor-STAT6 mAb-HRP conjugates. Membranes were washed 3 times and the HRP activity was developed in chemiluminiscence and recorded on a KODAK image system. FIG. 5A, left panel shows a schematic of the CD28-induced phosphorylation of PI-3K in T-cells, and the chemiluminiscence of CD28-induced phosphorylation of PI-3K p110 unit (MW=110 kDa) upon incubation of CD4 T-cells with rB7.1 molecule of the vaccine reagents was shown on the right. Phosphorylation of PI-3K p110 unit by rB7.1 molecules (positive control) was shown in lane 1 and phosphorylation of PI-3K p110 unit by Py-Th1 and PyB-Th1 reagents in CD28+ T-cells were shown in lanes 4 and 5. The lack of PI-3K p110 phosphorylation by the Py-Th2 and PyB-Th2 reagents and by rB7.1 in CD28 KO CD4 T-cells negative control were shown in lane 2 and 3 and lane 6, respectively. FIG. 5 B, left panel shows a schematic of the IL-4Rα-induced phosphorylation of STAT6 in T-cells. FIG. 5 B, right panel illustrates chemiluminiscence of IL-4Rα-induced phosphorylation of STAT6 (MW=119 kDa) upon incubation of CD28.sup.+ CD4 T-cells with rIL-4 (positive control) or with the vaccine reagents. The phosphorylation of STAT6 by rIL-4 (positive control) was shown in lane 3. The phosphorylation of STAT6 by Py-Th2 and PyB-Th2 reagents were shown in lanes 1 and 2. The lack of STAT6 phosphorylation by the Py-Th1 and PyB-Th1 reagents were shown in lanes 4 and 5. In summary, these results demonstrate the chimeric vaccines preserve the structural integrity and biological functions.

Example 6: Immunogenicity of Th1/Th2 Vaccines

(48) a) Immunogenicity of the pyCSP B Cell Repeats Expressed by PyBTh1 and PyBTh2 Chimeric Vaccines.

(49) C57BL/6 mice were injected intravenously with two doses of 100 micrograms of PyBTh1 or PyBTh2 chimeras administered two weeks apart. Mice were bled and sera was used to measure the titer of anti-CSP Abs by IFA using Plasmodium yoelii sporozoites dissected from salivary glands of infected Anopheles mosquitoes as described [14]. Data are expressed as mean±SD of three individual mice. The Py CSP B cell repeats expressed by the PyBTh1 and PyBTh2 chimeras are immunogenic, as revealed by their ability to elicit specific IgM and IgG antibodies upon immunization (FIG. 6).

(50) b) Immunogenicity of the PyCSP CD4 T Cell Epitope Expressed by the Chimeric Vaccines.

(51) BALB/c mice were injected intravenously with two doses of 100 micrograms of PyTh1 or PyTh2 chimeras administered two weeks apart. Non-immunized mice were used as control. Two weeks after the last immunization, mice were challenged intravenously with 50,000 infectious P. yoelii sporozoites and spleens were harvested 40 hours after the challenge. Splenic cells were stimulated in vitro for 3 days with 10 micrograms/ml of CSP peptide, 1 microgram/ml of Py-Th1 or Py-Th2 chimeras or left unstimulated. Data is expressed as cytokine concentration in cell culture supernatants as measured by Luminex (INVITROGEN®, San Diego, Calif.).

(52) The PyCSP CD4 T cell epitope expressed by the chimeras is immunogenic as revealed by their ability to stimulate CSP-specific T cells upon immunization as shown in FIG. 7. To address the role of PyTh1 and PyTh2 chimeras to drive polarization of CSP-specific T cells towards a Th1 (inflammatory) or Th2 (anti-inflammatory) phenotype, splenic T cells from PyTh1 or PyTh2-immunized mice were re-stimulated in vitro with PyTh1 or PyTh2 chimeras. As illustrated in FIG. 7, upper panels, re-stimulation with PyTh1 chimeras resulted in increase production of IFN γ (inflammatory) cytokine, whereas re-stimulation with PyTh2 chimera enhanced production of IL-10 (anti-inflammatory) cytokine. In contrast, splenic T cells from naïve (non-immunized) mice stimulated with the PyTh1 or PyTh2 chimeras did not result in cytokine secretion (FIG. 7, lower panel), which demonstrates the specificity of chimeras in stimulating selectively CSP-specific T cells.

Example 7: Immunization with PyTh1 or PyTh2 Chimeras Significantly Reduces the Burden of Liver Stage Parasites

(53) Malaria sporozoites infect and replicate in liver (hepatocytes) cells. Infected hepatocytes release hundreds of liver-stage merozoites, which then move forward to infect erythrocytes. A massive infection of erythrocytes leads to the onset of malaria [7].

(54) To investigate the efficacy of chimeric vaccines against liver stage parasites, BALB/c mice were injected intravenously with one or two doses (administered two weeks apart) of 100 micrograms of PyTh1 or PyTh2 chimeras. Non-immunized mice were used as control. Two weeks after the last immunization, mice were challenged intravenously with 50,000 infectious P. yoelii sporozoites and livers were harvested 40 hours after the challenge. Livers were used to isolate total RNA that was analyzed by real-time PCR using primers specific for the parasite 18S RNA. Data are expressed as the percentage of liver stage parasites in groups of three mice analyzed individually, relative to control (non-immunized) BALB/c mice.

(55) As illustrated in FIG. 8, immunization with a single dose of the vaccines significantly reduced the amount of live stage parasites, and mice vaccinated twice with the PyTh1 or PyTh2 chimera were able to eliminate more than 90% of the infected hepatocytes.

Prophetic Example 8: Immunization with PyBTh1 or PyBTh2 Chimeras

(56) Malaria sporozoites infect and replicate in liver (hepatocytes) cells. Infected hepatocytes release hundreds of liver-stage merozoites, which then move forward to infect erythrocytes. A massive infection of erythrocytes leads to the onset of malaria [7].

(57) To investigate the efficacy of chimeric vaccines against liver stage parasites, BALB/c mice were injected intravenously with one or two doses (administered two weeks apart) of 100 micrograms of PyBTh1 or PybTh2 chimeras. Non-immunized mice were used as control. Two weeks after the last immunization, mice were challenged intravenously with 50,000 infectious P. yoelii sporozoites and livers were harvested 40 hours after the challenge. Livers were used to isolate total RNA that was analyzed by real-time PCR using primers specific for the parasite 18S RNA. Data are expressed as the percentage of liver stage parasites in groups of three mice analyzed individually, relative to control (non-immunized) BALB/c mice.

Prophetic Example 9: Immunization with Chimerias as Human Malaria Vaccine

(58) To investigate the efficacy of chimeric vaccines against liver stage parasites in human, humanized mice (HLA-BR4) were injected intravenously with one or two doses (administered two weeks apart) of 100 micrograms of PyBTh1, PyTh1, PyBTh2 and PyTh2 chimeras. Non-immunized mice were used as control. Two weeks after the last immunization, mice were challenged intravenously with 50,000 infectious P. yoelii sporozoites and livers were harvested 40 hours after the challenge. Livers were used to isolate total RNA that was analyzed by real-time PCR using primers specific for the parasite 18S RNA. Data are expressed as the percentage of liver stage parasites in groups of three mice analyzed individually, relative to control (non-immunized) BALB/c mice.

REFERENCES

(59) 1. Adorini et al. Competition for antigen presentation in living cells involves exchange of peptides bound by class II WIC molecules. Nature 342: 800-803 (1989). 2. Arndt et al. Functional HLA-DM on the surface of B cells and immature dendritic cells. EMBO J. 19:1241-1251 (2000). 3. Bona, C. A., Casares, S. & Brumeanu, T-D. Towards the development of T cell vaccines. Immunol. Today 19:126-132 (1998). 4. Brumeanu, T., Casares, S., Harris, P., Dehazya, P., Wolf, I., von Boehmer, H. & Bona, C., Immunopotency of a viral peptide assembled on the carbohydrate moieties of self immunoglobulins. Nature Biotechnology 14: 722-725 (1996). 5. Brumeanu, T-D., Casares. S., Bot, A., Bot, S. & Bona, C. A. Immunogenicity of a contiguous T-B viral epitope from hemagglutinin of A/PR/8/34 influenza virus. J. Virol. 71: 5473-5480 (1997). 6. Casares, S., Bona, C. A. & Brumeanu, T-D. Engineering and characterization of a murine MHC-immunoglobulin chimera expressing an immunodominant CD4 T viral epitope. Protein Engineering 10:1295-1301 (1997). 7. Casares S, Richie T L. 2009. Immune evasion by malaria parasites: a challenge for vaccine development. Curr Opin Immunol. 21:321-30. 8. Casares, S., Bona, C. A. & Brumeanu, T. D. Enzymatically mediated engineering of multivalent MHC class II-peptide chimeras. Protein Engineering 14: 195-200 (2001). 9. Casares, S., Stan, A. C., Bona, C. A. & Brumeanu, T-D. Antigen-specific downregulation of T cells by doxorubicin delivered through a recombinant MHC II-peptide chimera. Nature Biotechnology 19:142-147 (2001). 10. Casares, S. Bona, C. A. & Brumeanu, T. D. Immunoregulation of antigen-specific T cells by MHC-peptide chimeras. Int. Rev. Immunol. 20:547-574 (2001). 11. Dolfi, D V & Katsikis, P D. CD28 and CD27 costimulation of CD8+ T cells: a story of survival. Adv Exp Med Biol. 590:149-70 (2007). 12. Loo, Y M. & Gale, M. Viral regulation and evasion of the host response. Curr Top Microbiol Immunol. 316:295-313 (2007). 13. Preda I, McEvoy R C, Lin M, Bona C A, Rapaport R, Brumeanu T D, Casares S. 2005. Soluble, dimeric HLA DR4-peptide chimeras: an approach for detection and immunoregulation of human type-1 diabetes. Eur. J. Immunol. 135:2762, 2005). 14. Sedegah M, Rogers W O, Belmonte A, Belmonte M, Banania G, Patterson N, Ferrari M, Kaslow D C, Carucci D J, Richie T L, Doolan D L. 2006. Vaxfectin enhances immunogenicity and protective efficacy of P. yoelii circumsporozoite DNA vaccines. Vaccine 24:1921-7. 15. Rudd C E, Taylor A, Schneider H. 2009. CD28 and CTLA-4 coreceptor expression and signal transduction. Immunol. Rev. 229:12-26. 16. Takeda K, Kishimoto T, Akira S. 1997. STAT6: its role in interleukin 4-mediated biological functions. J. Mol Med. 75:317-26.