Methods for transforming tarwi and for producing molecular farming products in transgenic tarwi seed
09796981 · 2017-10-24
Assignee
Inventors
- Ketan M. Doshi (Saskatoon, CA)
- Natalia N. Loukanina (Saskatoon, CA)
- Brent Pollock (Saskatoon, CA)
- Patricia Polowick (Saskatoon, CA)
- Larry Holbrook (Saskatoon, CA)
Cpc classification
C12N9/78
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure describes reproducible methods for the Agrobacterium-mediated production of stable, genetically transformed, fertile tarwi plants (Lupinus mutabilis Sweet) having seed-specific expression of human adenosine deaminase enzyme (hADA) or a functional variant thereof. The method involves slicing a tarwi seed embryo to produce an explant; infecting the explant in co-cultivation medium containing an agrobacterium having a polynucleotide sequence encoding hADA or variant; thereby generating a transformed explant; elongating a transformed shoot from the transformed explant; and regenerating a transformed tarwi plant from the elongated shoot. Seeds and plants so formed are also described herein. Further, methods for the recovery and purification of recombinant hADA, or functional variant from a transformed tarwi plant are described.
Claims
1. A method of producing transformed tarwi comprising a human adenosine deaminase (hADA) or a functional variant thereof, the method comprising: slicing at least one tarwi seed embryo to produce at least one explant comprising mature tarwi seed embryo tissue, wherein said slicing comprises longitudinally slicing the embryo; infecting the explant with Agrobacterium and incubating in a co-cultivation medium comprising acetosyringone, and being free of auxins and cytokinins; wherein the Agrobacterium comprises a polynucleotide sequence encoding the human adenosine deaminase (hADA) or functional variant thereof; thereby generating a transformed explant; inducing at least one transformed shoot by incubating the transformed explant in a shoot induction medium comprising 6-benzylaminopurine, kanamycin and timentin; elongating the at least one transformed shoot to form an elongated shoot, comprising incubating the transformed shoot in a shoot elongation medium in a ventilated jar, said elongation medium comprising 6-benzylaminopurine, kanamycin, and timentin; rooting said elongated shoot in a rooting medium comprising indole-3-butyric acid (IBA), kanamycin, and timentin; and regenerating a transformed tarwi plant from the elongated shoot after rooting for 2-3 weeks.
2. The method of claim 1, wherein infecting the explant with Agrobacterium comprises slicing the tarwi seed embryo longitudinally using a scalpel having the Agrobacterium thereon.
3. The method of claim 1, wherein the co-cultivation medium comprises Gamborg B5 salts.
4. The method of claim 1 further comprising removing the elongated shoot from the transformed explant prior to regenerating.
5. The method of claim 1, wherein the hADA comprises the amino acid sequence of SEQ ID NO:1.
6. The method of claim 1, wherein the functional variant of hADA comprises an amino acid sequence that is at least 80% identical to the amino acid sequence of SEQ ID NO:1, and the functional variant is capable of deaminating adenosine.
7. The method of claim 1, wherein the functional variant of hADA comprises the amino acid sequence as set forth in SEQ ID NO:2.
8. The method of claim 1, wherein the polynucleotide sequence is as set forth in SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5; or is a polynucleotide sequence with 80% or greater identity to SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5.
9. The method of claim 8, wherein the polynucleotide sequence has 85% or greater identity to SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:5.
10. A transformed tarwi plant produced by the method of claim 1.
11. A transformed seed of the plant of claim 10.
12. A transformed cell of the seed of claim 11.
13. The method of producing transformed tarwi according to claim 1, wherein the co-cultivation medium comprises Gamborg B5 salts, vitamins, sucrose, 200 μM acetosyringone and agar, at pH 5.75.
14. The method of producing transformed tarwi according to claim 1, wherein the shoot induction medium comprises Gamborg B5 salts, vitamins, 13 μM 6-benzylaminopurine, sucrose, kanamycin, and agar, at pH 5.75.
15. The method of producing transformed tarwi according to claim 1, wherein the shoot elongation medium comprises salts, vitamins, about 0.5 μM 6-benzylaminopurine, sucrose, kanamycin, timentin and agar, at about pH 5.75.
16. The method of producing transformed tarwi according to claim 1, wherein the rooting medium comprises Gamborg B5 salts, vitamins, sucrose, about 20 μM indole-3-butyric acid (IBA), kanamycin, timentin and agar, at about pH 5.6.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) Embodiments of the present disclosure will now be described, by way of example only, with reference to the attached figures, described below.
(2)
(3)
(4)
(5)
(6)
(7)
DETAILED DESCRIPTION
(8) Generally, the present disclosure provides a method of transforming tarwi, tarwi cells expressing human adenosine deaminase (hADA) and a method of purifying ADA from tarwi seed.
(9) SEQ ID NO:1 refers to the amino acid sequence of a human ADA protein.
(10) SEQ ID NO:2 refers to the amino acid sequence of a human ADA protein with cysteine at position 75 mutated to serine to increase stability.
(11) SEQ ID NO:3 refers to the cDNA sequence of a human ADA.
(12) SEQ ID NO:4 refers to the cDNA sequence of a human ADA that has been back translated to utilize the codon preferences of pea.
(13) SEQ ID NO:5 refers to the cDNA sequence of a human ADA that has been back translated and encodes a cysteine at position 75
(14) SEQ ID NO:6 refers to the LegB4Fw primer.
(15) SEQ ID NO:7 refers to the LegB1Ry primer.
(16) SEQ ID NO:8 refers to the PinllB1Fw primer.
(17) SEQ ID NO:9 refers to the PinllB2Ry primer.
(18) SEQ ID NO:10 refers to the hADAB2Fw primer.
(19) SEQ ID NO:11 refers to the hADAB3Rv primer. SEQ ID NO:12 refers to the hADA-fw primer. SEQ ID NO:13 refers to the hADA-rv primer.
(20) There is described herein a method of producing transformed tarwi comprising a human adenosine deaminase (hADA) or a functional variant thereof. A tarwi seed embryo is sliced to produce at least one explant. The explant is infected by incubating the explant in co-cultivation medium which comprises agrobacterium, wherein the agrobacterium comprise a polynucleotide sequence encoding a human adenosine deaminase (hADA) or functional variant thereof; thereby generating a transformed explant. A transformed shoot is elongated from the transformed explant to form an elongated shoot. A transformed tarwi plant is regenerated from the elongated shoot.
(21) The method may comprise slicing the tarwi seed embryo longitudinally using a scalpel having the agrobacterium thereon. The co-cultivation medium may comprise Gamborg B5 salts and may be essentially free of auxins or cytokinins. The explants and transformed explants may be cultured in ventilated MAGENTA™ jars. The elongated shoot may be removed from the explant prior to regeneration. The method may include inducing root formation from the elongated shoot by incubating the shoot in a rooting medium comprising Indole-3-butyric acid (IBA), to root the elongated shoot.
(22) The hADA may comprise the amino acid sequence of SEQ ID NO:1 and the functional variant of hADA may comprise an amino acid sequence that is at least 80% identical to the amino acid sequence of SEQ ID NO:1 and is capable of deaminating adenosine. The functional variant of hADA may comprise the sequence as set forth in SEQ ID NO:2.
(23) The polynucleotide sequence may be set forth in SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5; or may be a polynucleotide sequence with 80% or greater identity to SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5 which hybridizes to the complement of SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5 under stringent conditions.
(24) The polynucleotide sequence may have at least 85%, at least 90% or at least 95% identity to SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5.
(25) In another aspect, there is described herein a transformed plant produced by the method described above or a transformed seed of the plant. A transformed cell of the seed described herein is also provided.
(26) There is also described herein a tarwi seed comprising: a human adenosine deaminase (hADA) or variant thereof wherein the variant is capable of deaminating adenosine, and a cell of the tarwi seed.
(27) There is further described a method of purifying human adenosine deaminase (hADA) or functional variant thereof from a tarwi seed. The method includes: a) extracting protein from the seed; b) passing the extracted protein through a dye affinity column to collect the dye affinity column flowthrough; c) salting the dye affinity column flowthrough to produce a salted dye affinity column flowthrough; d) filtering the salted dye affinity column flowthrough and collecting the filtrate; e) passing the filtrate through a hydrophobic interaction chromatography column to bind the hADA or functional variant thereof; f) eluting the hADA or functional variant thereof from the hydrophobic interaction chromatography column; g) desalting the eluted hADA to produce a desalted eluate; h) passing the desalted eluate through an anion exchange chromatography column to bind the hADA or functional variant thereof; and i) eluting the hADA or functional variant thereof from the anion exchange chromatography column to generate purified hADA or functional variant thereof.
(28) The transformed tarwi may be from known and characterized cultivars of Lupinus mutabilis and naturally occurring feral forms of Lupinus mutabilis.
(29) As used herein, the term “adenosine deaminase” (ADA) refers to an enzyme that is capable of adenosine deaminase activity. ADA may be in the form of a monomer or dimer complex. The term “human adenosine deaminase (hADA)” refers to a protein or polypeptide of native human adenosine deaminase, for example proteins purified from a human source. hADA may comprise the amino acid sequence set forth in SEQ ID NO:1.
(30) The cells may also comprise “functional variants” of hADA that have a function that is substantially similar to hADA. A “functional variant” includes an ADA protein or polypeptide comprising an amino acid sequence that is at least 80% identical to the amino acid sequence of a human adenosine deaminase along the entire length of the protein. A variant may contain amino acid substitutions, insertions, deletions, post translational modifications or other modifications. Amino acid-substituted variants of hADA may include stabilized versions of hADA. Stabilized ADA may have oxidizable amino acids residues replaced with non-oxidizable amino acid residues; examples of which can be found in U.S. Pat. No. 8,071,741. An ADA variant may include the protein set forth in SEQ ID NO:2. An ADA variant may also comprise naturally occurring variants for example those found in the protein sequence database “Uniprot” maintained by the European Bioinformatics Institute (EBI), the Swiss Institute of Bioinformatics (SIB) and the Protein Information Resource (PIR), under, for example, accession number P00813. An ADA variant may be an isoform of ADA. Fragments having at least 80% identity to the sequence of hADA are considered to be functional variants as described herein, provided such variants maintain a function that is substantially similar to hADA. For example, a fragment that comprises 80% (or more) of hADA, but not the entire length of hADA are encompassed herein.
(31) A functional variant of ADA may also include a fragment of ADA that retains the ability to deaminate adenosine.
(32) The “ability to deaminate adenosine” is defined as the ability to catalyze the deamination reaction of adenosine to inosine at a level equivalent to at least 80% of that of wild type ADA. This reaction is based on the enzymatic deamination of adenosine to inosine which is converted to hypoxanthine by purine nucleoside phosphorylase (PNP). Hypoxanthine is then converted to uric acid and hydrogen peroxide (H.sub.2O.sub.2) by xanthine oxidase (XOD). H.sub.2O.sub.2 is further reacted with N-Ethyl-N-(2-hydroxy-3-sulfopropyl)-3-methylaniline (EHSPT) and 4-aminoantipyrine (4-AA) in the presence of peroxidase (POD) to generate quinone dye which is monitored in a kinetic manner at 550 nm.
(33) An adenosine deaminase assay is described in Petolino et al., which is a modification of an assay described by Gusti and Galanti (1984), that measures ammonia formation when adenosine is used as substrate. Commercial assays are available from, for example, Bio-Quant (San Diego, Calif.).
(34) A “polynucleotide sequence encoding a human adenosine deaminase” refers to a nucleic acid molecule that encodes a human adenosine deaminase protein, polypeptide or fragment or variant thereof. Thus, such a sequence is often a cDNA sequence that encodes human adenosine deaminase, for example Genbank Accession number X02994.1. In other embodiments, a sequence encoding a human adenosine deaminase may include sequences, such as introns that are not present in a cDNA. In other embodiments a polynucleotide sequence encoding a human adenosine deaminase may comprise an artificial sequence that is back translated from a human deaminase protein sequence to alter the codon preference to that of a legume, such as pea, in order to increase the translation of hADA in tarwi. Examples of such sequences are set forth in SEQ ID NO: 4 and SEQ ID NO:5.
(35) A “polynucleotide sequence” unless otherwise limited encompasses known analogues of natural nucleotides that hybridize to nucleic acids in a manner similar to naturally occurring nucleotides.
(36) “Identity” is used interchangeable with “percentage sequence identity” or “percentage (%) identity” and is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the nucleic acid or amino acid sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
(37) Percentage identity can be any integer from 80% to 100%. Exemplary embodiments include at least: 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more identity compared to a reference sequence using the programs described herein; preferably BLAST using standard parameters.
(38) The person skilled in the art will understand that optimal alignment of sequences for comparison may be conducted by the local homology algorithm, by the homology alignment algorithm, by the search for similarity method, by computerized implementations of these algorithms (GAP, BESTFIT, BLAST, FASTA, TFASTA, and DASH), or by inspection.
(39) As used herein “stringent hybridization conditions” or “stringent conditions” refers to conditions under which a probe will hybridize to its target subsequence, typically in a complex mixture of nucleic acid molecules, with little or no binding to other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be about 5-10° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic acid molecule concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent hybridization conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 M to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides). Stringent hybridization conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least two times background, optionally 10 times background hybridization. Exemplary stringent hybridization conditions can be as following: 50% formamide, 5×SSC, and 1% SDS, incubating at 42° C., or 5×SSC, 1% SDS, incubating at 65° C., with wash in 0.2×SSC, and 0.1% SDS at 55° C., 60° C., or 65° C. Such washes can be performed for 5, 15, 30, 60, 120, or more minutes.
(40) In some embodiments “stringent conditions” are, for example, conditions that allow hybridization comparable with the hybridization that occurs using a DNA probe that may be 500 nucleotides in length, in a buffer containing 0.5 M Na.sub.2HPO.sub.4, pH 7.2, 7% SDS, 1 mM EDTA, and 1% BSA (fraction V), at a temperature of 65° C., or a buffer containing 48% formamide, 4.8×SSC, 0.2 M Tris-Cl, pH 7.6, 1×Denhardt's solution, 10% dextran sulfate, and 0.1% SDS, at a temperature of 42° C. (These are typical conditions for high stringency northern or Southern hybridizations). Those of ordinary skill in the art will readily recognize that alternative hybridization and wash conditions can be utilized to provide conditions of similar stringency, such as those described in Maniatis et al. in Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, (1982) p. 387 to 389. Hybridizations may be carried out over a period of about 20 to 30 minutes, or about 2 to 6 hours, or about 10 to 15 hours, or over 24 hours or more. High stringency hybridization is also relied upon for the success of numerous techniques routinely performed by molecular biologists, such as high stringency PCR, DNA sequencing, single strand conformational polymorphism analysis, and in situ hybridization. In contrast to northern and Southern hybridizations, these techniques are usually performed with relatively short probes (e.g., usually about 16 nucleotides or longer for PCR or sequencing and about 40 nucleotides or longer for in situ hybridization). The high stringency conditions used in these techniques are well known to those skilled in the art of molecular biology, and examples of them can be found, for example, in Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y., 1998, and in Maniatis et al., in Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, (1982). A nucleic acid sequence may be detectably labeled.
(41) As used herein the term “encodes” refers to a nucleic acid or polynucleotide which comprises the information for translation into the specified protein.
(42) The term “dye affinity column” refers to a column that comprises immobilized dyes of high affinities for the binding sites on proteins. For example, an Affi-Gel Blue Gel column can be used. Cibacron® Blue F3GA dye used in this medium.
(43) The term “hydrophobic interaction column” is meant to include any chromatography column with medium to high hydrophobicity. Hydrophobic interaction columns can be used in the capture of intermediate stages of protein purification. Such columns bind hydrophobic areas on a protein(s) to the hydrophobic area of the column. Generally, proteins bind a hydrophobic interaction column at a high salt concentration and elute at a low salt concentration.
(44) As used herein the term “anion exchange column” includes any anion exchange column that comprises a positively charged support which separates proteins of negative charge.
(45) As used herein the term “salting” is used interchangeably with antisolvent crystallization, precipitation, or precipitation crystallization and refers to a method of separating proteins based on the principle that proteins are less soluble at high salt concentrations. The salt concentration needed for the protein to precipitate out of the solution differs from protein to protein. The salt is a salt that is not detrimental to the protein and may be, for example ammonium sulfate.
(46) The construction of vectors suitable for transformation of plants is known and routine to a person of skill in the art. The vector includes a promoter that may be organ specific (i.e. that may direct expression to a specific organ). The promoter is operatively linked to a polynucleotide sequence that encodes a human adenosine deaminase. The vector may include enhancers, either translational or transcriptional enhancers as may be required.
(47) The vector may further comprise a selectable marker gene. Selectable marker genes are well known in the art and include enzymes that provide antibiotic (i.e. kanamycin, hygromycin, spectinomycin) resistance or a visual colour change of cells and tissues and includes all genes that can help differentiate transformed and non-transformed cells. Examples of visual markers include the microbial beta-glucuronidase gene, (GUS) and the green fluorescent protein, (GFP) without being limited thereto.
(48) The present disclosure discloses a method for producing tarwi (Lupinus mutabilis Sweet) expressing recombinant human adenosine deaminase. A schematic of a method of producing transforming tarwi is outlined in
(49) A schematic of a method of purifying hADA or functional variant thereof from a tarwi seed is shown in
(50) The following examples are provided to illustrate the transformation method and production and purification of recombinant proteins of the present invention and should not be interpreted in any way to limit the scope of the invention.
EXAMPLE 1
(51) Construction of a PPS2 hADA Transformation Vector
(52) The PPS2 expression vector was constructed to express the human adenosine deaminase enzyme in tarwi seed The PPS2 vector contains the LegA2 seed specific promoter from pea (Rerie et al. 1991) a potato proteinases inhibitor II (PinII) apoplast-specific targeting sequence, (Gene Bank Accession #X04118), (Liu et al. 2004) and a CaMV 35S terminator. The amino acid sequences of a hADA (GenBank: CAH73885.1) was back-translated using the codon preference of legumes, and the resulting artificial ORF was synthesized at the NRC-PBI, DNA sequencing facility.
(53) Three DNA fragments (attB4-LegA2-attB1, attB1-PinII-attB2 and attB2-hADA-attB3) were amplified by polymerase chain reaction (PCR) using specific pairs of primers and template DNA (Table 1). The sequence of these fragments was verified by automated nucleotide sequencing at NRC-PBI (National Research Council of Canada-Plant Biotechnology Institute, Saskatoon).
(54) Table 1 lists primers and template DNA used for generating entry clones.
(55) TABLE-US-00001 TABLE 1 List of primers and template DNA used for generating entry clones Amplified DNA Template DNA fragments (Plasmid pBluskript II with specific KS(+) carries following DNA recombines site Pair of primers sequence) Source attB4-LegA2- LegB4Fw LegA2 Pea seed specific Dr. Patricia attB1 5′GGGGACAACTTTGTATAGAAAAGTTGAA promoter (Gene Bank Polowick, (Size 857 bp) TTCCTTCTTAATGGTAGTCTAGTTTA 3′ Accession # X17193) (NRC-PBI) (SEQ ID NO: 6) LegB1Rv 5′GGGGACTGCTTTTTTGTACAAACTTGTG GTTGGATAGAATATATGTTTGTGAC 3′ (SEQ ID NO: 7) attB1-PinII- PinIIB1Fw PinII (Potato Proteinase A 279 bp PinII attB2 5′GGGGACAAGTTTGTACAAAAAAGCAGGC inhibitor II) apoplast DNA sequence (size 279 bp) TATTCACAGACACTCTTCACCCCAA 3′ specific signal peptide was synthesized (SEQ ID NO: 8) (Gene Bank Accession # at NRC-PBI, DNA PinIIB2Rv X04118) sequencing 5′GGGGACCACTTTGTACAAGAAAGCTGGG facility TAAGCCTTCGCATCAACATGCTCCAT 3′ (SEQ ID NO: 9) attB2- hADAB2Fw ORF of hADA gene (human A 1092 bp hADA-attB3 5′GGGGACAGCTTTCTTGTACAAAGTGGTG Adenosine Deaminase gene) artifical ORF (size 1092 bp) CCTAGAATGGCTCAAACTCCTGCTTTTGA was synthesized T 3′ at NRC-PBI, DNA (SEQ ID NO: 10) sequencing hADAB3Rv facility 5′ GGGGACCACTTTGTACAAGAAAGCTGG GTTTATTAAAGATTTTGACCAGCAGA 3′ (SEQ ID NO: 11)
(56) The entry clones were obtained by BP clonase reaction between said three DNA fragments and specific donor clones from Gateway (Invitrogen; Catalogue #12537-023). The vector pER598 was derived from pKm43GW (Karimi et al. 2005) used as a destination clone. A binary vector pLPhA was generated by inserting a single gene cassette into pER598 using LR clonase reactions to transfer the gene cassette from the entry clone to the destination vector were performed according to the protocol of the MultiSite Gateway Three Fragment Vector Construction Kit (Invitrogen; Catalogue #12537-023). The vector was electroporated into disarmed Agrobacterium tumefaciens strain GV3101-pMP90 (Koncz and Schell, 1986) prior to plant transformation experiments.
(57) Media Composition
(58) A range of media were evaluated for plant tissue co-cultivation of tarwi tissues with Agrobacteria that ranged from a few simple salts to complete basal media, both with and without plant growth regulators and acetosyringone. Different explants, including whole seed, cotyledons and entire but wounded embryo axes were tested. The media and methods that resulted in the successful generation of transgenic plants are described and the components of the relevant media are listed in Table 2. Except where stated otherwise, all media contained 3% sucrose, were adjusted to a pH of 5.7, solidified with agar and sterilized by autoclaving. All media, except for the co-cultivation medium, contained the antibiotic mixture of Timentin (200 mg I-1; GlaxoSmithKline, Research Triangle Park, N.C., US) to check the growth of residual Agrobacterium and kanamycin to kill untransformed tissue. Acetosyringone, kanamycin and Timentin were filter-sterilized prior to incorporation into the culture media.
(59) The co-cultivation medium was comprised of B5 salts and vitamins and supplemented with acetosyringone (200 μM). The shoot-inducing medium also contained Gamborg' s (Gamborg et al. 1968) B5 salts and vitamins supplemented with benzylaminopurine (BAP 13 μM) and kanamycin at 50 mg/L. In the shoot elongation medium, B5 salts were substituted with MS salts (Murashige and Skoog 1962), the BAP concentration was reduced to 0.5 μM and the kanamycin concentration was halved to 25 mg/L. The rooting medium consisted of Gamborg's B5 salts and vitamins, 2% sucrose and 20 μM indole butyric acid (IBA). The concentration of antibiotics in the rooting medium was retained as in the shoot elongation medium (Table 2).
(60) TABLE-US-00002 TABLE 2 Media Composition Co-cultivation Shoot induction Shoot elongation Rooting Components.sup.a medium medium medium medium Macro- and micro- Gamborg B5.sup.b Gamborg B5 MS.sup.c Gamborg B5 salts Vitamins Gamborg B5.sup.d Gamborg B5 Gamborg B5 Gamborg B5 6-Benzylaminopurine — 13 μM 0.5 μM — (BAP) Indole-3-butyric acid — — — 20 μM (IBA) Sucrose 30,000 30,000 30,000 30,000 Acetosyringone 200 μM — — — Kanamycin — 50 25 25 Timentin — 200 200 200 Agar 7,000 7,500 7,000 8,000 pH 5.75 5.75 5.75 5.6 .sup.aExcept where stated, concentrations for components are mg/L .sup.bB-5 basal salt mixture as described by Gamborg et al. (1968) .sup.cBasal medium as described by Murashige and Skoog (1962) .sup.dB-5 vitamin mixture as described by Gamborg et al. (1968)
Tarwi Transformation Method
(61) Agrobacterium Culture Preparation
(62) Overnight Agrobacterium cultures in 2YT medium with appropriate antibiotics (30 mg/l rifampicin, 25 mg/l gentamycin; PPS2, 50 mg/l each of rifampicin, gentamycin and spectinomycin), were harvested by brief centrifugation and re-suspended in fresh 2YT media without antibiotics. For co-cultivation, the Agrobacterium suspension was diluted to a final OD of 0.06 at A660.
(63) Plant Material and Preparation of Explants
(64) Lupinus mutabilis Sweet (tarwi) seeds were obtained from the National Plant Germplasm System of the USDA (Bethesda, Md.). Seeds were sterilized for 1 min in 70% ethanol followed by 20 min in 10% commercial bleach solution (Javex™) equivalent to 1% (w/v) NaOCl. The seeds were rinsed thoroughly with sterile distilled H.sub.2O and imbibed on wet filter paper in deep Petri dishes (100×25-mm) at room temperature (23° C.) in the dark for approximately 18 h (overnight). Fully imbibed seeds with intact seed coats (i.e. radicle not emerged) were used for explant isolation. To isolate the embryo, the seed coat was removed and one cotyledon as well as half of the radicle was excised. The remaining cotyledon with the embryo axis still attached was secured with forceps and the embryo axis was cut into longitudinal sections with a blade that had been dipped into the Agrobacterium suspension.
(65)
(66) Co-cultivation
(67) Longitudinal slices through mature embryo axes of an imbibed seed, or inoculated explants, were placed onto sterile filter paper on the surface of the co-cultivation medium (302), which consisted of Gamborg's B5 medium with acetosyringone but without added plant growth regulators (Table 2). The addition of plant growth regulators (auxins and/or cytokinins) limited both the regeneration of the tarwi explants and transient expression of reporter genes. Plates with explants were incubated for 4 days in the dark at room temperature (23° C.).
(68) Shoot Induction
(69) After 4 days of co-cultivation, explants were transferred to shoot inducing medium (304), as outlined in Table 2). The inclusion of filter paper on the surface of the co-cultivation medium obviated the requirement to rinse explants in Timentin® to reduce growth of Agrobacteria. Explants were cultivated in small Petri dishes (60×15 mm) for the first 2 weeks of incubation on the shoot initiation medium and then transferred to the same shoot inducing medium but in larger, deep Petri dishes to accommodate the growth of the explants for two additional 3 week cycles (306). The first flush of shoots developing within the first five weeks of cultivation on shoot inducing medium were excised and discarded, as they have been found to arise from pre-existing meristems. The base of the original explant was cut off when it was possible to do so without damaging any developing bud primordia.
(70) One of the factors that affected regeneration and transformation efficiencies of tarwi was severe browning of the media, beginning during incubation on the shoot induction medium. This is a common problem with legume species (Bottinger et al. 2001; Olhoft et al. 2001), and is believed to result from released phenolics and elevated ethylene production. Approaches which can be implemented to eliminate or at least reduce the negative effect of browning include addition of antioxidants, buffering media with MES and adding agents such as silver nitrate to inhibit production of ethylene (Nguyen et al. 2007). An additional approach to reduce browning is to reduce ethylene accumulation by enhancing ventilation. Replacement of Parafilm® for wrapping Petri plates with surgical tape substantially reduced tissue and medium browning and increased the quality and survival rate of explants.
(71) Wild type (control) tarwi explants were screened for their sensitivity to kanamycin to establish concentrations needed to eliminate non-transformed regenerated shoots. It was determined that a minimal concentration of 50 mg/L kanamycin in the shoot-inducing medium was required over at least 5 weeks of cultivation. Higher concentrations of kanamycin (75 and 100 mg/L) killed explants too rapidly before shoot regeneration was initiated.
(72) Shoot Elongation
(73) After 8 weeks on shoot initiation medium, surviving explants had expanded in size and single or multiple shoots were initiated. Clusters of buds were transferred to the shoot elongation medium (308), see Table 2. At each transfer, the clusters of shoots were separated into smaller pieces both to minimize competition and to expose all of the tissue to selection pressure.
(74) Reducing the kanamycin to 25 mg/L in the shoot elongation medium after the initial selection on the higher level of kanamycin minimized non-transformed escapes and maximized the number of transgenic shoots that survived.
(75) The browning which first appeared during the shoot induction phase was more intense and developed more rapidly after explants were transferred to the shoot elongation medium. The substitution of surgical tape for Parafilm® had a pronounced beneficial effect on the number of developing shoots.
(76) In addition to a reduction in the browning of the medium, improvements in ventilation introduced by using MAGENTA™ jars with vented lids also reduced other common problems observed in tissue culture including vitrification, early flowering and poor apical meristem expansion. The enhanced stem development significantly improved the rooting capacity of shoots and the viability of rooted plantlets after transfer to soil.
(77) Rooting
(78) A major hurdle in the development of the tarwi transformation protocol was a low rooting efficiency which is typical of legumes, (Bean et al. 1997; Krishnamurthy et al. 2000, Babaoglu et al. 2000, Polowick et al., 2000, 2004). When individual shoots reached approximately 2 cm in height they were cut off and transferred to rooting medium (310) in MAGENTA™ boxes at a reduced temperature (23° C.), (Chitty et al. 2003). Different medium formulations (full strength and half strength basal salts) plant growth regulators (naphthalene acetic acid, indole butyric acid) as well as structural media (vermiculite, rock wool, agar) were tested. It was determined that an important factor for rooting was the inclusion of freshly prepared IBA.
(79) Transformation procedures for other large-seeded legumes have shown that as high as 70% of surviving shoots to be “escapes”, non-transformed shoots/plants that escaped being killed by the selection system (Nadolska-Orczyk and Orczyk 2000). The optimized tarwi transformation procedure results in a low frequency of escapes of only 12.8%.
(80) Transferring of Rooted Plants to the Soil and Growth of Transgenic Tarwi
(81) Roots were visible within 10 days of cultivation on rooting medium and, after 2-3 weeks, rooted plantlets were transferred to soil (312). DNA extracted from leaf material of each rooted plantlet was tested by PCR for the presence hADA and nptll gene sequences and only PCR-positive plants were transferred to soil.
(82) Once shoots were 5-10 cm in length with well-developed roots, the agar was carefully washed off the roots and the small plantlets were transferred to commercial potting soil (Sunshine Mix #4, Sun Gro Horticulture Inc., Bellevue, Wash.) in 10 cm plastic pots.
(83) To maintain the humidity, each plantlet was covered with a clear plastic cup. The pots with plants were arranged in trays which, in turn, were covered with clear plastic domes. Trays were kept in a controlled environment chamber with a 16 h photoperiod and 24/20° C. day/night temperature regime; the plants were watered as required, and fertilized biweekly with 20:20:20 (Plant Products Co., Bramalea, Ontario). The plastic cups were removed after 7-10 days; however, the whole tray remained covered with the plastic dome for a further week until plants had grown to at least 15 cm in height. Plants could be then transplanted to larger pots, if required.
(84)
(85) Production of Tarwi Plants with Seed Specific Expression of rhADA
(86) ADA Colorimetric Detection Assay
(87)
(88) Sample 1 of
(89) PCR and Southern Blot Analysis for the Transgene
(90) Plant genomic DNA was extracted from 100 mg of in vitro plant leaf material from each putative transgenic tarwi plants. The CTAB extraction method (Stacey and Isaac, 1994) was followed to extract genomic DNA for PCR screening and Southern blot analysis (Sambrook et al. 1989). The presence of the transgene, hADA was confirmed by PCR amplification using the following specific primer pairs: hADA-fw (5′-GGTGCTTGGAAGCCTGATAC-3′) SEQ ID NO:12, and hADA-rv (5′-ACCAGCAGAAGCAGAAGGAG-3′) SEQ ID NO:13.
(91) For Southern blot analysis, 20 μg of genomic DNA from selected TO transgenic lines of tarwi was digested overnight with HindIII at 37° C. After digestion, all of the digestion reactions were loaded into deep wells of 1% agarose gel and separated by running at 60-65 V for 16-18 h. DNAs were transferred by capillary blotting onto a positively charged nylon membrane (Roche; Catalogue #1-209-299) using the method of Sawada et al. (1995). Digoxigenin-labelled hADA probes were generated by using a PCR DIG probe synthesis kit (Roche; Catalogue #1-636-090). Hybridization and detection of probe was carried out using a non-radioactive, DIG luminescent detection kit for nucleic acids (Roche; 1-363-514) according to the manufacturer's instructions.
(92) Immunoblot Analysis
(93) About 100 mg of T1 seeds from tarwi was homogenized in 400 μl of chilled protein extraction buffer and total protein was isolated according to Petolino et al., (2000). Protein concentration was determined using a standard Bio-Rad Protein Analysis protocol (Bio-Rad; Catalogue #500-006). The extract was diluted to 2 μg/μl of total protein using the extraction buffer. Following a standard procedure for protein separation (Simpson et al., 2009), 50 μg of protein was loaded in each well of a 10% SDS-Polyacrylamide gel for electrophoresis. Subsequently, the protein was transferred onto a PVDF membrane using a trans-blot SD semi-dry electrophoretic transfer cell (Bio-Rad; Catalogue #170-3940). Remaining steps for Immuno blotting were carried out as per the instructions given in HRP color blot starter kit 1 (Bio-Rad; Catalogue #170-5050). The primary antibody used in this experiment was mouse monoclonal antibody raised against amino acids 64-363 of adenosine deaminase of human origin (Santa Cruz Biotechnology, Inc; Cat # SC-18346).
(94) Western blot analysis of the protein lysate is shown in
EXAMPLE 2
(95) Purification of ADA from Tarwi Seed
(96) Scale-up Production of Transformed Tarwi Seed
(97) Individual primary transformants produced by the method of example 1 were assessed for ADA expression and transgenic gene copy number. Plants with single copy numbers and high levels of expression were selected and selfed to derive homozygous plants. Seed was produced from these plants under confinement as follows: Viable L. mutabilis seed is generally cream colored with both sides noticeably convex. Only seeds that appeared viable were planted. Seeds were germinated in 6 cm seed pots that are filled level to the top with the prepared soil mix. A one cm deep indentation was poked into the surface of each pot and one seed placed into the indentation and then lightly covered with soil. Clear plastic covers were placed over the trays to retain humidity and the trays were placed away from direct light sources. On day 3, the outer hull of each seed was manually removed and the soil mounded in the center of each pot to a height of about 2.5 cm. A 1 cm deep indentation was made in the center of the mound and the seed was replanted, root down. The seed was gently covered with 1 cm of moist soil and the clear covers were replaced. Plants were re-potted when at least one set of true leaves was fully emerged.
(98) Sterilized 10 liter pots for each seedling were filled three quarters full with pasteurized soil. Seedlings were removed from the starter tray and placed in the large pot. Soil was added, lifting the plant as needed, until the soil line was about 2.5 cm below the surface of the 10 liter pot. About 2 g of iron chelate was sprinkled on the soil surface of each pot, near the base of the plants. Pots were attached to an automatic Argus watering system.
(99) The timing and frequency of water delivery (2-3 times per week) was controlled by the Argus System that supplied water as needed until the plants were large enough to require daily watering. Plants were watered four times daily for three minute periods until the plants begin flowering. When the plants begin flowering, the watering time was changed to seven minute periods starting at 7:30 am, 8:30 am, 9:30 am.
(100) A stock solution of plant nutrients was prepared as needed. The nutrients were supplied to the plants, via an inline fertilizer injector, using the water supply system described above.
(101) The following nutrient solution was used to water the plants daily beginning two to four weeks after the date seeds are started and continuing until plants begin to set pods. Four gallons of nutrient solution comprised: 2000 g of 15-15-18 water soluble fertilizer 500 g of MgSO.sub.4 100 g of iron chelate
(102) The Dosatron fertilizer injector was set to 1:200.
(103) The above procedure delivered nutrients to the plants at the following concentrations:
(104) TABLE-US-00003 Nitrogen (N) 100 ppm Phosphorous (P) 100 ppm Potassium (K) 120 ppm Magnesium (Mg) 16 ppm Sulfur (S) 22 ppm Iron (Fe) 3 ppm
(105) Pod Production
(106) The following nutrient solution is used to water the plants daily beginning when the plants started to set pods. Four gallons of nutrient solution comprised: 1200 g of 15-15-18 100 g of iron chelate 250 g of MgSO.sub.4
(107) The Dosatron fertilizer injector was set to 1:200.
(108) The above procedure delivered nutrients to the plants at the following concentrations:
(109) TABLE-US-00004 Nitrogen (N) 60 ppm Phosphorous (P) 60 ppm Potassium (K) 72 ppm Magnesium (Mg) 8 ppm Sulfur (S) 11 ppm Iron (Fe) 3 ppm
(110) Harvesting:
(111) Mature seed pods are light tan, with no visible green, completely hard and will rattle when shaken. Mature pods were removed from the plant by cutting the stem at the branch point directly below the seed pod. Pods were opened by pressing against the front of the seed pod until it popped open. Seeds were inspected and only those that are smooth, uniformly cream in color, and evenly rounded on both sides were kept.
(112) Seed Storage
(113) Seed was stored in labeled cloth specimen bags at 4 degrees Celsius (40 degrees Fahrenheit).
(114) Aqueous Extraction from the Seed
(115) 60 g of the recombinant tarwi seed containing hADA was pulverized thrice for ten seconds at maximum speed in a kitchen-grade electric coffee mill. This flour was transferred to a lab-grade electric blender (Waring model 34BL97) along with 0.40 L of extraction buffer (0.050 M (2-(N-Morpholino)ethanesulphonic acid (MES), in water, pH 6.0 using sodium hydroxide) and mixed at maximum speed for 15 seconds. The blender was rinsed with 0.10 L then 0.050 L of buffer and the pooled fluids were dispensed into the centrifugation bottles, including an additional 0.050 L of buffer bringing the total to 0.60 L of buffer for the 60 g of seed. Solids were removed from this suspension by centrifugation (+5° C., 66 minutes, Beckman JA-14 rotor at 14,000 rpm). To induce precipitation of tarwi proteins, the fluid phase, containing the aqueous fraction and the floating lipid pad, was pooled in a 1 L glass beaker and placed in a +60° C. water bath for 18 minutes, with continuous, gentle stirring. The beaker was then transferred to an ice bath and placed in a refrigerator (+2 to +8° C.) for an hour and then subjected to the same centrifugal conditions. The decanted fluid phase was pooled and refrigerated for 72 hours and then centrifuged again. The decanted fluid was vacuum-filtered twice (Whatman GF/F then Millipore nylon GNEPO4700) to generate the final extract.
(116) Purification by Chromatography
(117) All of the following steps were performed at room temperature (+20 to +25° C.) with overnight storage in the refrigerator (+2 to +8° C.). All solvents were vacuum filtered before use through a 0.20 micron membrane (Millipore nylon GNWPO4700).
(118) The extract was passed at a rate of 23 cm/h through a column of Affi-Gel® Blue Gel (Bio-Rad, 100-200 mesh, d=2.6 cm, l=16 cm) which had been equilibrated with extraction buffer. This was done to reduce tarwi protein, not to bind hADA. The flowthrough was mixed with a solution of ammonium sulfate dissolved in extraction buffer at the weight ratio of 1.0:1.7:6.9 (ammonium sulfate:extraction buffer:Affi-Gel® Blue Gel flowthrough) then vacuum filtered through a 0.20 micron membrane (Millipore nylon GNWPO4700). This filtrate was passed at 300 cm/h through a column of Capto™ Phenyl (high sub) (GE Healthcare, d=1.6 cm, l=16.5 cm) which had been equilibrated with aqueous 1.2 M ammonium sulfate, 0.050 M MES, pH 6.0, using sodium hydroxide. This was done to bind the hADA which was then eluted by a 16.5 minute linear gradient vs extraction buffer. The elution was divided into 14.5 mL fractions and fractions containing hADA activity at the desired purity were pooled. This pool was divided into 13 mL aliquots and each was passed at 113 cm/h through a HiPrep™ 26/10 Desalting column (GE Healthcare, d=2.6 cm, I=10.0 cm) which had been equilibrated with aqueous 0.050 M Tris-(hydroxymethyl)aminomethane (Tris), pH 7.0 with hydrochloric acid (HCl). This was done as a buffer exchange step. The pool from these desalting cycles was diluted 2.5-fold with water and passed at 300 cm/h through a column of BioRad Macro-Prep DEAE (d=1.6 cm, l=13.5 cm) which had been equilibrated with aqueous 0.020 M Tris-HCl, pH 7.0. This was done to bind the hADA which was then eluted at 150 cm/h by a 27 minute linear gradient vs 0.050 M Tris-HCl, pH 7.0, 0.20 M potassium chloride. The elution was divided into 14.5 mL fractions and fractions containing hADA activity at the desired purity were pooled. The pooled fractions from the DEAE step were diluted with 0.050 M Tris-HCl, pH 7.0 and glycerol to give a final concentration of 1 U/mL (+25° C.) and 20% v/v glycerol and stored at −15 to −25° C.
(119) The above-described embodiments are intended to be examples only. Alterations, modifications and variations can be effected to the particular embodiments by those of skill in the art without departing from the scope, which is defined solely by the claims appended hereto.
REFERENCES
(120) All documents listed herein are incorporated by reference, including the following documents for which a full citation is provided below.
(121) Asad, S., et al., (2008) Silicon carbide whisker-mediated embryonic callus transformation of cotton, (gossypium hirsutum L.) and regeneration of salt tolerant plants, Mol. Biotechnol. 40(2): 161-9.
(122) Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y., 1998,
(123) Babaoglu M, McCabe M, Power J, Davey M (2000) Agrobacterium-mediated transformation of Lupinus mutabilis L. using shoot apical explants. Acta Physiol Plant 22:111-119
(124) Bean S J, Gooding P S, Mullineaux P M, Davies D R (1997) A simple system for pea transformation. Plant Cell Rep 16:513-519
(125) Böttinger P, Steinmetz A, Schieder O, Pickardt T (2001) Agrobacterium-mediated transformation of Vicia faba. Mol Breed 8:243-254
(126) Chitty J A, Allen R S, first A J, Larkin P J (2003) Genetic transformation in commercial Tasmanian cultivars of opium poppy, Papaver somniferum, and movement of transgenic pollen in the field. Functional Plant Biol 30:1045-1058
(127) Daddona, et al., “Human Adenosine Deaminase, cDNA and complete primary amino acid sequence” The Journal of Biological Chemistry, vol 259, No 19, October 10, pp 12821-12106, 1984)
(128) Ellis, et al., (1988), Tissue specific expression of a pea legumin gene in seeds of Nicotiniana plumbaginifolia, Plant Molec. Biol 10:203-214.
(129) Fischer, R., et al., (2004), Plant-based production of biopharmaceuticals, Current Opinions in Plant Biology 7:152-158
(130) Gamborg O L, Miller R A, Ojima K (1968) Nutrient requirements of suspension cultures of Nutrient requirement suspension cultures of soybean root cells. Exp Cell Res 50: 151-158.
(131) Gelvin, S. B., (2003), Agrobacterium-mediated plant transformation: the biology behind the “gene-jockeying” tool. Microbiology and Molecular Biology Reviews, pp 16-37.
(132) Gusti G, and Galanti, B. (1984). Methods of Enzymatic Analysis. Vol. IV (pp. 315-323).
(133) Hills, M., et al., (2007), “Genetic use restriction technologies [GURTS]: strategies to impede transgene movement”, Trends in Plant Science 12(4): 177-183).
(134) Jaiswal, R., et al., (2007), Isolation of pigeon pea (Cajanus cajan L.,) legumin gene promoter and identification of conserved regulatory elements using tools of bioinformatics. Indian J of Biotechnology Vol 6: 495-503.
(135) Jefferson, R. A. (1987). Assaying chimeric genes in plants: The GUS gene fusion system. Plant MOl. Biol. Rep. 5: 387-405.
(136) Karimi, M., De Meyer, B. and Hilson, P. (2005) Modular cloning and expression of tagged fluorescent protein in plant cells. Trends Plant Sci., 10, 103-105.
(137) Koncz, C. and Schell, J. (1986) The promoter of the TL-DNA gene 5 controls the tissue-specific expression of chimeric genes carried by a novel type of Agrobacterium binary vector. Mol. Gen. Genet., 204, 383-396.
(138) Li H, Wylie S J, Jones M G K (2000) Transgenic yellow lupin (Lupinus luteus). Plant Cell Rep 19:634-637
(139) Liu, Y. J., Yuan, Y., Zheng, J., Tao, Y. Z., Dong, Z. G., Wang, J. H. and Wang, G. Y. (2004) Signal Peptide of Potato Pinll Enhances the Expression of Cry1Ac in Transgenic Tobacco. Acta Biochimica et Biophysica Sinica, 36: 553-558.
(140) Lycett Q. W., et al., (1985), “The 5′ flanking regions of three pea legumin genes: Comparison of the DNA sequences, Nucleic Acid Research 13:6733-6743”.
(141) Maliga, P., (2004), Plastid transformation in higher plants, Annu. Rev. Plant Biol 55:289-313.
(142) Maniatis et al., in Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory, (1982) p 387 to 389.
(143) Martinez-Navio et al., (2011) “An old enzyme for current needs: adenosine deaminase and a dendrytic vaccine for HIV, Immunology and Cell Biology, 20 September, doi: 10.1038/icp.2011.8
(144) Molvig L, Tabe L M, Eggum B O, Moore A E, Craig S, Spencer D, Higgins T J V (1997) Enhanced methionine levels and increased nutritive value of seeds of transgenic lupins (Lupinus angustifolius L.) expressing a sunflower seed albumin gene. Proc Natl Acad Sci USA 94:8393-8398
(145) Mulin M, Bellio-Spataru A (2000) Organogenesis from hypocotyl thin cell layers of Lupinus mutabilis and Lupinus albus. J Plant Growth Regul 30:177-183
(146) Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15:473-497
(147) Nadolska-Orczyk A (1992) Somatic embryogenesis of agriculturally important lupin species (Lupinus angustifolius, L. albus, L. mutabilis). Plant Cell Tissue Organ Cult 28:19-25.
(148) Nadolska-Orczyk A, Orczyk W (2000) Study of the factors influencing Agrobacterium-mediated transformation of pea (Pisum sativum L.). Mol Breed 6:185-194
(149) Nguyen T V, Thanh Thu T, Claeys M, Angenon G (2007) Agrobacterium-mediated transformation of sorghum (Sorghum bicolor (L.) Moench) using an improved in vitro regeneration system. Plant Cell Tissue Organ Cult 91:155-164
(150) Olhoft P, Lin K, Galbraith J, Nielsen N, Somers D (2001) The role of thiol compounds in increasing Agrobacterium-mediated transformation of soybean cotyledonary-node cells. Plant Cell Rep 20:731-737
(151) Petolino J. F., Young, S., Hopkins, N., Sukhapinda, K., Woolsey, A., Hayes, C., and Pelcher, L. (2000), Expression of murine adenosine deaminase (ADA) in transgenic mice. Transgenic Research 9: 1-9.
(152) Pigeaire A, Abernethy D, Smith P M, Simpson K, Fletcher N, Lu C Y, Atkins C A, Cornish E (1997) Transformation of a grain legume (Lupinus angustifolius L.) via Agrobacterium tumefaciens-mediated gene transfer to shoot apices. Mol Breed 3:341-349
(153) Pniewski T, Kapusta J, Legocki A (2002) In vitro micropropagation of four lupin species. Acta Physiol Plant 24:417-424
(154) Polowick P L, Baliski D S, Mahon J D (2004) Agrobacterium tumefaciens-mediated transformation of chickpea (Cicer arietinum L.): Gene integration, expression and inheritance. Plant Cell Rep 23:485-491.
(155) Polowick P L, Quandt J, Mahon J (2000) The ability of pea transformation technology to transfer genes into peas adapted to western Canadian growing conditions. Plant Sci 153:161-170.
(156) Rerie W. G., Whitecross, M. I., and Higgins, T. J. V. (1991) Nucleotide sequence of an A-type legumin gene from pea. Nuc. Acids. Res. 18: 655.
(157) Schernthaner, J. P., et al., (2003), A repressible system to prevent seed germination—Implications for controlling transgenes under agricultural conditions, PNAS 100(11) 6855-6859.
(158) Sharma, A. K., et al., (2009), Plants as bioreactors: recent developments and emerging opportunities, Biotechnology Advances 27:811-832.Singhabahu, S., Bringloe, D., and George, J. (2010), Expression of a functional human adenosine deaminase in tobacco plant cell suspensions and whole plants, Conference Proceedings from Recombinant pharmaceutical manufacturing from plants—the future of molecular farming.
(159) Singhabahu, S, and Bringloe D. (2012) Production of human adenosine deaminase in tobacco BY2 calli and cell suspensions, Conference Proceedings from Molecular Pharming—recent progress in manufacturing medicines in plants.
(160) Spok et al., (2008) Plant Molecular Farming; Opportunities and Challenges. J R C, European Commission, EUR 23383, DOI 10.2791/30861
(161) Ward, W., et al., (2009), Protein purification, Current Analytical Chemistry 5(2):1-21.
(162) Ziolkowski, M. J., (2007) Advancements in biolistics and applications for agriculturally significant crops, MMG445 Basic Biotechnology e Journal 3:34-39.