Enterococcus faecalis bacteriophage and uses thereof

Abstract

Bacteriophages are provided that infect strains of Enterococcus faecalis, an opportunistic bacterial pathogen that causes human disease. Also provided are methods of treating Enterococcus faecalis by therapeutic administration of such bacteriophages.

Claims

1. A lytic bacteriophage capable of infecting and lysing an Enterococcus faecalis bacterium, said bacteriophage having a genome derived from the genome SEQ ID NO: 92, said lytic bacteriophage genome comprising: (A) the following ORFs: an ORF 1, having the nucleic acid sequence of SEQ ID NO: 170; an ORF 2, encoding the amino acid sequence of SEQ ID NO: 28; an ORF 3, encoding the amino acid sequence of SEQ ID NO: 29; an ORF 4, encoding the amino acid sequence of SEQ ID NO: 30; an ORF 5, encoding the amino acid sequence of SEQ ID NO: 31; an ORF 6, encoding the amino acid sequence of SEQ ID NO: 32; an ORF 7, encoding the amino acid sequence of SEQ ID NO: 33; an ORF 8, encoding the amino acid sequence of SEQ ID NO: 34; an ORF 9, encoding the amino acid sequence of SEQ ID NO: 35; an ORF 10, encoding the amino acid sequence of SEQ ID NO: 36; an ORF 11, encoding the amino acid sequence of SEQ ID NO: 37; an ORF 12, encoding the amino acid sequence of SEQ ID NO: 38; an ORF 13, encoding the amino acid sequence of SEQ ID NO: 39; an ORF 14, encoding the amino acid sequence of SEQ ID NO: 40; an ORF 15, encoding the amino acid sequence of SEQ ID NO: 41; an ORF 16, encoding the amino acid sequence of SEQ ID NO: 42; an ORF 17, encoding the amino acid sequence of SEQ ID NO: 43; an ORF 18, encoding the amino acid sequence of SEQ ID NO: 44; an ORF 19, encoding the amino acid sequence of SEQ ID NO: 45; an ORF 20, encoding the amino acid sequence of SEQ ID NO: 46; an ORF 21, encoding the amino acid sequence of SEQ ID NO: 47; an ORF 22, encoding the amino acid sequence of SEQ ID NO: 48; an ORF 23, encoding the amino acid sequence of SEQ ID NO: 49; an ORF 24, encoding the amino acid sequence of SEQ ID NO: 50; (x)an ORF 25, encoding the amino acid sequence of SEQ ID NO: 51; an ORF 26, encoding the amino acid sequence of SEQ ID NO: 52; an ORF 27, encoding the amino acid sequence of SEQ ID NO: 53; an ORF 28, encoding the amino acid sequence of SEQ ID NO: 54; an ORF 29, encoding the amino acid sequence of SEQ ID NO: 55; an ORF 30, encoding the amino acid sequence of SEQ ID NO: 56; an ORF 37, encoding the amino acid sequence of SEQ ID NO: 63; an ORF 38, encoding the amino acid sequence of SEQ ID NO: 64; an ORF 39, encoding the amino acid sequence of SEQ ID NO: 65; an ORF 40, encoding the amino acid sequence of SEQ ID NO: 66; an ORF 41, encoding the amino acid sequence of SEQ ID NO: 67; an ORF 42, encoding the amino acid sequence of SEQ ID NO: 68; an ORF 43, encoding the amino acid sequence of SEQ ID NO: 69; an ORF 44, encoding the amino acid sequence of SEQ ID NO: 70; an ORF 45, encoding the amino acid sequence of SEQ ID NO: 71; an ORF 46, encoding the amino acid sequence of SEQ ID NO: 72; an ORF 47, encoding the amino acid sequence of SEQ ID NO: 73; an ORF 48, encoding the amino acid sequence of SEQ ID NO: 74; an ORF 49, encoding the amino acid sequence of SEQ ID NO: 75; an ORF 50, encoding the amino acid sequence of SEQ ID NO: 76; an ORF 51, encoding the amino acid sequence of SEQ ID NO: 77; an ORF 52, encoding the amino acid sequence of SEQ ID NO: 78; an ORF 53, encoding the amino acid sequence of SEQ ID NO: 79; an ORF 54, encoding the amino acid sequence of SEQ ID NO: 80; an ORF 55, encoding the amino acid sequence of SEQ ID NO: 81; an ORF 56, encoding the amino acid sequence of SEQ ID NO: 82; an ORF 57, encoding the amino acid sequence of SEQ ID NO: 83; an ORF 58, encoding the amino acid sequence of SEQ ID NO: 84; an ORF 59, encoding the amino acid sequence of SEQ ID NO: 85; and an ORF 60, encoding the amino acid sequence of SEQ ID NO: 86; (B) immediately upstream of ORF 37, an inducible promoter responsive to a non-toxic inducer or constitutive promoter, which inducible promoter or constitutive promoter replaces the P.sup.CRO promoter between ORFs 36 and 37 of the genome SEQ ID NO: 92, which P.sup.CRO promoter is deleted in the genome of said lytic bacteriophage; and (C) immediately downstream of ORF 60, the following ORFs from bacteriophage ΦFL1C: (a) ΦFL1C ORF 40 encoding the amino acid sequence of SEQ ID NO: 158; (b) ΦFL1C ORF 41 encoding the amino acid sequence of SEQ ID NO: 159; (c) ΦFL1C ORF 42 encoding the amino acid sequence of SEQ ID NO: 160; (d) ΦFL1C ORF 43 encoding the amino acid sequence of SEQ ID NO: 161; (e) ΦFL1C ORF 44 encoding the amino acid sequence of SEQ ID NO: 162; which ΦFL1C ORFs 40-44 replace the following ORFs 61-65 of the genome SEQ ID NO: 92, which ORFs 61-65 are deleted in the genome of the lytic bacteriophage: ORF 61, encoding the amino acid sequence of SEQ ID NO: 87; ORF 62, encoding the amino acid sequence of SEQ ID NO: 88; ORF 63, encoding the amino acid sequence of SEQ ID NO: 89; ORF 64, encoding the amino acid sequence of SEQ ID NO: 90; and ORF 65, encoding the amino acid sequence of SEQ ID NO: 91; wherein the following segments of the genome SEQ ID NO: 92 are deleted in the genome of said lytic bacteriophage: (a) a portion of ORF 1 having the nucleic acid sequence of SEQ ID NO: 169; (b) ORF 31, encoding the amino acid sequence of SEQ ID NO: 57; (c) ORF 32, encoding the amino acid sequence of SEQ ID NO: 58; (d) ORF 33, encoding the amino acid sequence of SEQ ID NO: 59; (e) ORF 34, encoding the amino acid sequence of SEQ ID NO: 60; (f) ORF 35, encoding the amino acid sequence of SEQ ID NO: 61;and (g) ORF 36, encoding the amino acid sequence of SEQ ID NO: 62.

2. The bacteriophage of claim 1, wherein (a) ORF 2 has the nucleic acid sequence of SEQ ID NO: 94; (b) ORF 3 has the nucleic acid sequence of SEQ ID NO: 95; (c) ORF 4 has the nucleic acid sequence of SEQ ID NO: 96; (d) ORF 5 has the nucleic acid sequence of SEQ ID NO: 97; (e) ORF 6 has the nucleic acid sequence of SEQ ID NO: 98; (f) ORF 7 has the nucleic acid sequence of SEQ ID NO: 99; (g) ORF 8 has the nucleic acid sequence of SEQ ID NO: 100; (h) ORF 9 has the nucleic acid sequence of SEQ ID NO: 101; (i) ORF 10 has the nucleic acid sequence of SEQ ID NO: 102; (j) ORF 11 has the nucleic acid sequence of SEQ ID NO: 103; (k) ORF 12 has the nucleic acid sequence of SEQ ID NO: 104; (l) ORF 13 has the nucleic acid sequence of SEQ ID NO: 105; (m) ORF 14 has the nucleic acid sequence of SEQ ID NO: 106; (n) ORF 15 has the nucleic acid sequence of SEQ ID NO: 107; (o) ORF 16 has the nucleic acid sequence of SEQ ID NO: 108; (p) ORF 17 has the nucleic acid sequence of SEQ ID NO: 109; (q) ORF 18 has the nucleic acid sequence of SEQ ID NO: 110; (r) ORF 19 has the nucleic acid sequence of SEQ ID NO: 111; (s) ORF 20 has the nucleic acid sequence of SEQ ID NO: 112; (t) ORF 21 has the nucleic acid sequence of SEQ ID NO: 113; (u) ORF 22 has the nucleic acid sequence of SEQ ID NO: 114,; (v) ORF 23 has the nucleic acid sequence of SEQ ID NO: 115; (w) ORF 24 has the nucleic acid sequence of SEQ ID NO: 116; (x) ORF 25 has the nucleic acid sequence of SEQ ID NO: 117; (y) ORF 26 has the nucleic acid sequence of SEQ ID NO: 118; (z) ORF 27 has the nucleic acid sequence of SEQ ID NO: 119; (aa) ORF 28 has the nucleic acid sequence of SEQ ID NO: 120; (bb) ORF 29 has the nucleic acid sequence of SEQ ID NO: 121; (cc) ORF 30 has the nucleic acid sequence of SEQ ID NO: 122; (dd) ORF 37 has the nucleic acid sequence of SEQ ID NO: 129; (ee) ORF 38 has the nucleic acid sequence of SEQ ID NO: 130; (ff) ORF 39 has the nucleic acid sequence of SEQ ID NO: 131; (gg) ORF 40 has the nucleic acid sequence of SEQ ID NO: 132; (hh) ORF 41 has the nucleic acid sequence of SEQ ID NO: 133; (ii) ORF 42 has the nucleic acid sequence of SEQ ID NO: 134; (jj) ORF 43 has the nucleic acid sequence of SEQ ID NO: 135; (kk) ORF 44 has the nucleic acid sequence of SEQ ID NO: 136; (ll) ORF 45 has the nucleic acid sequence of SEQ ID NO: 137; (mm) ORF 46 has the nucleic acid sequence of SEQ ID NO: 138; (nn) ORF 47 has the nucleic acid sequence of SEQ ID NO: 139; (oo) ORF 48 has the nucleic acid sequence of SEQ ID NO: 140; (pp) ORF 49 has the nucleic acid sequence of SEQ ID NO: 141; (qq) ORF 50 has the nucleic acid sequence of SEQ ID NO: 142; (rr) ORF 51 has the nucleic acid sequence of SEQ ID NO: 143; (ss) ORF 52 has the nucleic acid sequence of SEQ ID NO: 144; (tt) ORF 53 has the nucleic acid sequence of SEQ ID NO: 145; (uu) ORF 54 has the nucleic acid sequence of SEQ ID NO: 146; (vv) ORF 55 has the nucleic acid sequence of SEQ ID NO: 147; (ww) ORF 56 has the nucleic acid sequence of SEQ ID NO: 148; (xx) ORF 57 has the nucleic acid sequence of SEQ ID NO: 149; (yy) ORF 58 has the nucleic acid sequence of SEQ ID NO: 150; (zz) ORF 59 has the nucleic acid sequence of SEQ ID NO: 151; and (aaa) ORF 60 has the nucleic acid sequence of SEQ ID NO: 152.

3. The bacteriophage of claim 2 wherein: (a) ΦFL1C ORF 40 has the nucleic acid sequence of SEQ ID NO: 163; (b) ΦFL1C ORF 41 has the nucleic acid sequence of SEQ ID NO: 164; (c) ΦFL1C ORF 42 has the nucleic acid sequence of SEQ ID NO: 165; (d) ΦFL1C ORF 43 has the nucleic acid sequence of SEQ ID NO: 166; (e) ΦFL1C ORF 44 has the nucleic acid sequence of SEQ ID NO: 167.

4. A bacteriophage having the genome of the ΦEf11 bacteriophage that is comprised by Enterococcus faecalis NRRL Deposit Number NRRL B-50832: (A) wherein the following segments of the genome of bacteriophage ΦEf11 have been deleted: (a) a portion of ORF 1 having the nucleic acid sequence of SEQ ID NO: 169; (b) ORF 31, encoding the amino acid sequence of SEQ ID NO: 57; (c) ORF 32, encoding the amino acid sequence of SEQ ID NO: 58; (d) ORF 33, encoding the amino acid sequence of SEQ ID NO: 59; (e) ORF 34, encoding the amino acid sequence of SEQ ID NO: 60; (f) ORF 35, encoding the amino acid sequence of SEQ ID NO: 61; (g) ORF 36, encoding the amino acid sequence of SEQ ID NO: 62; (h) ORF 61, encoding the amino acid sequence of SEQ ID NO: 87; (i) ORF 62, encoding the amino acid sequence of SEQ ID NO: 88; (j) ORF 63, encoding the amino acid sequence of SEQ ID NO: 89; (k) ORF 64, encoding the amino acid sequence of SEQ ID NO: 90; (l) ORF65, encoding the amino acid sequence of SEQ ID NO: 91; (B) wherein the P.sup.CRO promoter between ORFs 36 and 37 of the genome of bacteriophage ΦEf11 has been replaced with an inducible promoter responsive to a non-toxic inducer, or a constitutive promoter; and (C) wherein immediately downstream of ORF 60 of the genome of bacteriophage ΦEf11 the following ORFs from bacteriophage ΦFL1C are inserted, which ΦFL1C ORFs replace ORFs 61-65 of the genome of bacteriophage ΦEf11: (a) ΦFL1C ORF 40 encoding the amino acid sequence of SEQ ID NO: 158; (b) ΦFL1C ORF 41 encoding the amino acid sequence of SEQ ID NO: 159; (c) ΦFL1C ORF 42 encoding the amino acid sequence of SEQ ID NO: 160; (d) ΦFL1C ORF 43 encoding the amino acid sequence of SEQ ID NO: 161; and (e) ΦFL1C ORF 44 encoding the amino acid sequence of SEQ ID NO: 162.

5. The bacteriophage φEf11(vir).sup.PnisA , the genome of which is comprised by Enterococcus faecalis NRRL Deposit Number NRRL B-50833.

6. A bacteriophage which is a variant of the bacteriophage φEf11(vir).sup.PnsA , the genome of which bacteriophage 100 Ef11(vir).sup.PnsA is comprised by Enterococcus faecalis NRRL Deposit Number NRRL B-50833, wherein the nisin promoter in said bacteriophage φEf11(vir).sup.PnisA has been replaced by a constitutive promoter, and wherein the erythromycin resistance gene in said bacteriophage φEf11(vir).sup.PnisA has been deleted.

7. The bacteriophage of claim 1, wherein said promoter is a constitutive promoter.

8. The bacteriophage of claim 6, wherein the constitutive promoter is the Tu promoter having the nucleic acid sequence of SEQ ID NO: 168.

9. The bacteriophage of claim 7, wherein the constitutive promoter is the Tu promoter having the nucleic acid sequence of SEQ ID NO: 168.

10. A bacteria comprising the bacteriophage of claim 1.

11. A bacteria comprising the bacteriophage of claim 6.

12. A bacteria comprising the bacteriophage of claim 7.

13. A composition comprising the bacteriophage of claim 1 and a pharmaceutically acceptable carrier.

14. A composition comprising the bacteriophage of claim 6 and a pharmaceutically acceptable carrier.

15. The composition of claim 13, wherein the promoter in said bacteriophage is a constitutive promoter.

16. The composition of claim 14, wherein the constitutive promoter in the bacteriophage is the Tu promoter having the nucleic acid sequence of SEQ ID NO: 168.

17. The composition of claim 15, wherein the constitutive promoter is the Tu promoter having the nucleic acid sequence of SEQ ID NO: 168.

18. A method for prevention or treatment of Enterococcus faecalis infection in a subject in need of such treatment or prevention comprising administering to the subject the composition of claim 13 or 14.

19. The method for prevention or treatment of claim 18 wherein the composition is administered orally, otically, subcutaneously, peritoneally, intravenously, intradentally or parenterally.

20. The method for prevention or treatment of claim 19 wherein said composition is administered to a root canal.

21. The method for prevention or treatment of claim 19 wherein said infection is resistant to at least one antibiotic.

22. The method for prevention or treatment of claim 19 wherein said infection is in an immunocompromised patient.

23. The method for prevention or treatment of claim 18 wherein the composition is administered topically.

24. The method for prevention or treatment of claim 23 wherein the composition is impregnated in a wound dressing.

Description

DESCRIPTION OF THE FIGURES

(1) FIG. 1 is a schematic representation of the construction of plasmid pΔ31-36PnisA, the vector used to delete ORFs 31-36, and replace P.sup.cro with P.sup.nisA in the φEf11(Δ61-1, φFL1C40-44) prophage. The sequence comprising the two component nisin sensor system (nisR/nisK) is marked “A”. The fragment representing the nisin promoter (P.sup.nisA) is marked “B”. The segment representing an erythromycin resistance marker (erm) is marked “C”. Fragments immediately upstream (pre31) and downstream (post 36) of the φEf11 genomic region targeted for allelic exchange are marked “D”.

(2) FIGS. 2A-2F show the results of a plaque assay of φEf11 wild type (WT), spontaneous recombinant [(φEf11(φ61-1, φFL1C40-44)], and virulent mutant [φEf11(vir).sup.PnisA]: (2A) WT after incubation for 1 day, (2B) WT after incubation for 2 days, (2C) spontaneous recombinant after incubation for 1 day, (2D) spontaneous recombinant after incubation for 4 days, (2E) virulent mutant after incubation for 1 day, (2F) virulent mutant after incubation for 4 days.

(3) FIGS. 3A-3B show the results of an agarose gel electrophoresis analysis of ethidium bromide-stained NdeI restriction fragments of φEf11 and φEf11(φ61-1, φFL1C 40-44) DNA. (3A) Lanes 1 and 2: DNA molecular length standards (values on left are DNA lengths in kilobase pairs); 3: intact (undigested) φEf11 DNA; 4: NdeI-digested φEf11 DNA. (3B) Lane 1: DNA molecular length standards (values on left are DNA lengths in kilobase pairs); 2: NdeI-digested φEf11(φ61-1, φFL1C 40-44) DNA. Note that fragment 6, seen in gel containing Ndel fragments of φEf11 DNA, is missing in the gel containing the NdeI-digested φEf11(φ61-1, φFL1C

(4) FIG. 4 shows a Ndel restriction site analysis of the φEf11 DNA. The φEf11 DNA is 42,822 in length and is oriented as described in Stevens et al., 2011. supra), with the genes arranged with ORF 1 at the extreme left end and ORF 65 at the extreme right end. Ndel restriction sites (bp coordinates) are indicated the boxes. The Ndel restriction fragments, as visualized in agarose gel electrophoresis analysis AGE, are labeled 1-12. The first Ndel site is located 1.036 kbp from the left terminus of the DNA (coordinate 1036), and the Ndel site is located 1.754 kbp from the right terminus of the DNA (coordinate 41,068). The combined length of these two fragments (2,7980 kbp) is equal to the size estimated from Ndel fragment 6 observed in AGE analysis.

(5) FIG. 5 presents an overview of the regions of φEf11 (top) and φFL1C (bottom) that recombined to yield recombinant φEf11(Δ61-1, φFL1C 40-44) (middle). Non-bolded line portions indicate φEf11 sequences, bolded lines indicate φFL1C sequences.

(6) FIG. 6 shows the PCR detection of φFL1C genes in E. faecalis JH2-2. Template DNA, lanes: 1-3: φEf11(Δ61-1, φFL1C40-44); 4-6: E. faecalis JH2-2; 7-9: φEf11 wildtype. Primers, lanes: 1, 4, 7: φFL1C gp40 internal primers (FL1A35F/FL1A35R); 2, 5, 8: φFL1C gp44 internal primers (FL1A37F/FL1A38R); 3, 6, 9: φEf11 ORF44 internal primers (EF44F/EF44R); M: DNA marker.

(7) FIG. 7 shows a one-step growth curve for phage φEf11 (wild type), φEf11(Δ61-1, φFL1C40-44) (spontaneous recombinant), and φEf11(vir)P.sup.nisA (virulent variant). Log phase broth cultures of E. faecalis JH2-2 were infected with a phage stock. After adsorption for 30 minutes, the cells were collected by centrifugation, washed, and incubated at 37° C. At various time points aliquots of the suspension were centrifuged to remove the cells, and the supernatants were plaque assayed for phage titer (pfu/ml) using JH2-2 indicator cells. (-.circle-solid.- φEf11 titer (pfu/ml); -.square-solid.- φEf11(Δ61-1, φFL1C40-44) titer (pfu/ml); -.box-tangle-solidup.- φEf11 (vir)P.sup.nisA titer (pfu/ml).

(8) FIG. 8 represents a φEf11 (wild type) and φEf11(vir).sup.PnisA sequence comparison. The virulent mutant, φEf11(vir).sup.PnisA, genes ORF30-ORF36 as well as the cro promoter were allelically exchanged for the Nisin promoter cassette, and OR61-ORF1 were allelically exchanged with gp40-gp44 of φFL1C.

(9) FIG. 9 shows a PCR analysis of the φEf11(vir).sup.PnisA genome demonstrating absence of φEf11 ORFs 31 and 36, and the presence of nisR, P.sup.nisA, φFL1C ORFs gp40 and gp44. PCR products were separated by electrophoresis in 2% agarose gels and detected by ethidium bromide staining. Numbers to the left of the gel indicate DNA fragment size (kbp). Template DNA for PCR reactions: φEf11(vir).sup.PnisA (vir/lanes 1-4 and 7-8); φEf11 (wt/lanes 5-6 and 9-10). Primers used in the PCR reactions (see FIG. 8 for primer binding sites): Primer set EF31UUF/RK5R spanning ORF 29 to nisR (lane 1), primers PNISaF/37DDR spanning P.sup.nisA to ORF 38 (lane 2); primers EF31MF/EF31MR within ORF 31 (lanes 3 and 5); primers EF36MF/EF36MR within ORF 36 (lanes 4 and 6); primers FL1A35F/FL1A35R within φFL1C ORF gp40 (lanes 7 and 9), primers FL1A37F/FL1A38R within φFL1C ORF gp44 (lanes 8 and 10). Lane M: molecular weight markers (BenchTop 1 kb ladder, Promega).

(10) FIG. 10 shows the φEf11 genome. The numbered arrows indicate ORFs. The ORF numbering scheme in FIG. 10 corresponds to the numbering system contained in Stevens et al., 2011, supra. ORFs 25-29 are involved in host cell lysis.

(11) FIGS. 11A-11E show a nucleotide sequence alignment of phages φEf11, φFL1C, and spontaneous recombinant phage [φEf11(Δ61-1, φFL1C 40-44)] in the region of recombination (φEf11 ORFs 60/61-1 and φFL1C ORFs 39/40-44). Non-bolded text indicates φEf11 sequences, boldface text indicates φFL1C sequences. Spontaneous recombinant is abbreviated as Sp. Genomic coordinates are indicated to right of each row of sequence. Sites of sequence identity between φEf11 and φEf11(Δ61-1, φFL1C 40-44) are indicated by *****. The figures show φEf11 sequence from 39307 to 41213 (SEQ ID NO: 171) (within ORF60) and from 1 through 451 (SEQ ID NO:172) (within ORF1), and φFL1C sequence from 14237 to 16206 (SEQ ID NO: 173) (within ORF39) and from 1672 to 17451 (SEQ ID NO: 174) (within ORF44). The segment of the φEf11 sequence that has been replaced by the φFL1C sequence to form the φEf11(Δ61-1, φFL1C 40-44) recombinant is indicated as enclosed by the hashed brackets. The figures shows the nucleotide sequence of the spontaneous recombinant phage [φEf11(Δ61-1, φFL1C 40-44)] from 1772 to 3740 (SEQ ID NO: 175) and from 4527 to 5006 (SEQ ID NO: 176). NdeI restriction site in φEf11 sequence is indicated.

DETAILED DESCRIPTION OF THE INVENTION

(12) According to the present invention, engineered Enterococcus faecalis bacteriophages are provided that are virulent, highly lytic, incapable of lysogeny, insensitive to repressor, and capable of an extended host infectivity range. These characteristics make the recombinant phages useful as therapeutic agents in treatment and prevention of Enterococcus faecalis infections.

(13) A recombinant bacteriophage, designated φEf11(vir).sup.PnisA, has been derived from φEf11. A lysogenic Enterococcus faecalis strain harboring phage φEf11(vir).sup.PnisA was deposited in the Agricultural Research Service Culture Collection (NRRL), National Center for Agricultural Utilization Research Agricultural Research Service, USDA, 1815 North University Street Peoria, Illinois 61604-3999 on March 22, 2013 under accession number NRRL B-50833. The wild type phage φEf11 was deposited in the same depository on March 22, 2013 under accession number NRRL B-50832.

(14) φEf11 is a temperate bacteriophage that was induced from a lysogenic root canal isolate of Enterococcus faecalis (Stevens et al., Oral Microbiol. Immunol., 24: 278-284, 2009). Passage of φEf11 in E. faecalis JH2-2 has yielded the recombinant variant, φEf11(Δ61-1, φFL1C40-44), which provides elevated phage titers in broth cultures compared to the φEf11 wild type. The recombinant bacteriophage also produces much larger, clearer zones of lysis in lawns of E. faecalis cells, than does the wild type φEf11. Genetic analysis of the cloned virus producing the large plaques revealed that the variant was a recombinant between φEf11 and a defective φFL1C-like prophage located in the E. faecalis JH2-2 chromosome. The recombinant possessed 5 ORFs of the defective φFL1C-like prophage in place of 6 ORFs of the φEf11 genome. Deletion of ORFs 31-36 and replacement of the putative cro promoter from the recombinant phage genome with an exogenous regulatory element (inducible promoter) resulted in no loss of virus infectivity. Deletion of all lysogeny-related genes has resulted in a recombinant no longer having the capacity to form lysogens.

(15) It was found that ORFs 31-36 are completely dispensable for lytic cycle function, since deletion of these genes did not prevent productive infection by the virus. Infection of lawns of host cells by the mutant virus lacking these genes produced clear plaques. Furthermore, surviving (presumptive lysogenic) cells from the plaques produced by the mutant virus lacking ORFs 31-36 could not be recovered. This confirms that deleting these genes from the viral genome, results in an φEf11 mutant that is incapable of lysogeny.

(16) Regulatory elements in the φEf11 genome whose activation is required for the development of a productive/lytic infection within the cell, are inactivated by a protein (repressor) produced by ORF 36, one of the lysogeny-related genes. Lysogenic cells producing this repressor are thus immune to super infection by φEf11, and would consequently survive exposure to this virus.

(17) Accordingly, a stem-loop structure surrounded by P.sub.L and P.sub.R promoter sequences in the φEf11 genome lying between a putative cI repressor gene and a putative cro gene was replaced with an exogenous regulatory element that is not susceptible to inactivation by the repressor. This P.sup.CRO region lies between ORFs 36 and 37. Specifically, the native promoter sequence was replaced with a nisin-inducible promoter, generating a virus that was capable of productively infecting E. faecalis (φEf11) lysogens, in the presence of the φEf11 cI repressor protein. Accordingly, replacement of the φEf11 wild type regulatory element with an exogenous regulatory element that is not susceptible to inactivation by the repressor, as provided herein, allows the variant bacteriophage to productively infect and lyse lysogenic cells that harbor a previously integrated φEf11 genome.

(18) Surprisingly, spontaneous recombinational replacement of 5 genes (ORFs 61-65) of the DNA replication/modification module and 1 gene (ORF 1/terminase A) of the packaging module by 5 genes (ORFs 40-44) of E. faecalis phage φFL1C also had an effect on the virulence properties of the virus. While this genetic recombination had no effect upon host range, it did markedly alter the lytic properties observed during infection of either broth cultures or soft agar overlay lawns of susceptible host cells. Broth cultures rapidly and more thoroughly cleared, after infection by the recombinant phage φEf11(Δ61-1, φFL1C40-44), as compared to infection by the wild type φEf11 virus. Similarly, plaques produced by the recombinant phage φEf11(Δ61-1, φFL1C40-44) appeared as large, extensively spreading lytic zones with a clearer center, compared to those formed by the wild type φEf11 virus. Without wishing to be bound by any theory, the replacement (φFL1C) genes may contribute to a more robust, more productive lytic infection by increasing the efficiency of either phage DNA synthesis or packaging, or both. The results of one step growth experiments for wild type φEf11 and recombinant φEf11(Δ61-1, 95FL1C40-44) phages appear to bear out this hypothesis in that recombination of φEf11 with the φFL1C genes results in a greatly (>100 fold) enhanced production of progeny virus.

(19) The recombination that occurred resulted in the deletion of a portion of ORF 1 of φEf11 corresponding to the nucleic acid sequence of SEQ ID NO: 169. The portion of ORF 1 of φEf11 corresponding to the nucleic acid sequence of SEQ ID NO: 170 was retained in the spontaneous recombinant phage φEf11 (Δ61-1, φFL1C40-44). The region upstream of the recombined ORF 1 sequence is an intergenic sequence between ORFs 65 and ORF 1.

(20) In addition, the source of the φFL1C genes (i.e., the E. faecalis JH2-2chromosome) was unexpected, since previous studies reported that this E. faecalis strain was susceptible to φFL1C infection, and in fact, could form φFL1C lysogens following φFL1C infection, suggesting that this strain did not initially harbor a φFL1C prophage (Yasmin et al., J. Bacteria 192(4):1122-1130, 2010). PCR analysis failed to reveal other regions of the φFL1C genome that could be detected in JH2-2, suggesting that the φFL1C sequence that was detected was part of a defective (incomplete) prophage, or was the only φFL1C-like portion of a complete prophage.

(21) A genetic construct incorporating all the afore-mentioned φEf11 genomic modifications has resulted in the generation of a variant, designated φEf11(vir).sup.PnisA, that is incapable of lysogeny and insensitive to repressor, rendering it virulent and highly lytic, with a notably extended host-range in comparison with the wild type virus φEf11. Compared to the wild type φEf11, the recombinant virus produces a more robust infection of E. faecalis cells and a greater degree of lysis of the host E. faecalis cells.

(22) The φEf11(vir).sup.PnisA virus has been constructed, in part, by replacing the repressor-sensitive cro promoter of the wild type φEf11 virus with the repressor-insensitive, nisin-inducible promoter system to drive phage lytic infection functions. This replacement has proved to be a very effective and useful strategy in making genetic modifications in the virus, and allows the φEf11(vir).sup.PnisA virus to function as a useful intermediate in the preparation of derivative virus containing the desirable features discussed above. It may be appreciated, however, that to provide a therapeutic phage for managing Enterococcal infections would require replacement of the nisin-inducible promoter system of φEf11(vir).sup.PnisA with an alternative inducible promoter responsive to a non-toxic inducer, or with a constitutive promoter.

(23) One such promoter is the following constitutive promoter Tu derived from an E. faecalis strain:

(24) TABLE-US-00001 (SEQ ID NO: 168) TCTAGATITTTCCTTGAGAATAAAAGGTTTGTTTTTAGAACTATCCTTT TTTCAAGATTTCGTGTAAAATAGCTTATGATGATCAGACGATTTTTAGT AACGTCTATCACATATAAAACAAACAATAAAATTTATATTTTTAGGAGG AACATTCAAA 

(25) φEf11(vir).sup.PnisA was engineered to include the property of antibiotic (erythromycin) resistance in order to assist in the selection of transformant lysogen clones containing prophages with the desired genotype. The skilled artisan would recognize that this feature would be omitted from a therapeutic phage, without prejudice to the desirable characteristics discussed above.

(26) The bacteriophages of the present invention have been exemplified by preparation of φEf11 (vir).sup.PnisA Further variants may be prepared by utilizing φEf11 as a template and carrying out the following genetic modifications as described in detail in the Example: (i) deletion of lysogeny ORFs 31-36; (i) replacement of the repressor-sensitive cro promoter of the wild type φEf11 virus with a repressor-insensitive inducible promoter system or constitutive promoter system to drive phage lytic infection functions; (iii) replacement of 5 genes (ORFs 61-65) of the wild type DNA replication/modification module and 1 gene (ORF 1/terminase A) of the wild type packaging module by five genes (ORFs 40-44) of E. faecalis phage φFL1C. Utilization of the nisin-inducible promoter system as described in the Example, and provision for erythromycin resistance results in the φEf11(vir).sup.PnisA phage, may be omitted.

(27) Alternatively, variants of phage φEf11 (vir).sup.PnisA may be prepared by utilizing φEf11(vir).sup.PnisA phage as a starting material, and optionally removing the erythromycin resistance gene and optionally substituting the nisin-inducible promoter system of φEf11(vir).sup.PnisA with either an inducible promoter system that does not rely on a toxic inducer, or with a constitutive promoter system, e.g., the constitutive Tu promoter of SEQ ID NO: 168.

(28) Indications

(29) The bacteriophages used in the methods and compositions of the present invention may be used to prevent and treat Enterococcus faecalis and Enterococcus faecium infections. Non-limiting sites of infection include, for example, the urinary tract, bloodstream, abdomen, biliary tract, burn wounds, indwelling catheters, infected root canals and the heart (e.g. endocardium).

(30) The bacteriophages used in the methods and compositions of the present invention may be used to prevent and treat antibiotic-resistant Enterococcus faecalis and Enterococcus faecium infections, as well as infections that may be antibiotic-sensitive, to augment the antibiotic treatment regimen. The bacteriophages may also be used to treat immunocompromised patients and patients suffering from opportunistic hospital infections. Especially advantageous indications for the present invention may be as a treatment for root canal infections, infectious endocarditis, nosocomial infections, burn infections, urinary tract infections, meningitis and surgical wound infections.

(31) Administration

(32) The bacteriophages used in the methods and compositions of the present invention may be administered by any route, including orally, optically, subcutaneously, peritoneally, intravenously, topically, intradentally or parenterally. Also contemplated within the scope of the invention is the instillation of bacteriophage in the body of the patient in a controlled formulation, with systemic or local release of the drug to occur at a later time. For example, the bacteriophage may be localized in a depot for controlled release to the circulation, or for release to a local site of Enterococcus infection.

(33) The bacteriophage may be placed on or imbedded within a wound dressing, e.g., a surgical wound dressing, to treat or prevent Enterococcus infection of the wound. The bacteriophage may be applied to the wound in this fashion alone or in combination with other antibacterial agents that do not interfere with antibacterial action of the bacteriophage. For example, the bacteriophage may be contained in a composition impregnated in a wound dressing, e.g. a cotton wool dressing, for topical administration to a wound site.

(34) The specific dose of bacteriophage to obtain therapeutic benefit for treatment of an Enterococcus infection will, of course, be determined by the particular circumstances of the individual patient including, the size, weight, age and sex of the patient, the stage of the disease, the aggressiveness of the disease, and the route of administration of the bacteriophage.

(35) The daily dose of the bacteriophage may be given in a single dose, or may be divided, for example into two, three, or four doses, equal or unequal, but preferably equal, that comprise the daily dose. When given intravenously, such doses may be given as a bolus dose injected over, for example, about 1 to about 4 hours.

(36) The bacteriophages used in the methods of the present invention may be administered in the form of a pharmaceutical composition, in combination with a pharmaceutically acceptable carrier. The active ingredient in such formulations may comprise from 0.1 to 99.99 weight percent. By “pharmaceutically acceptable carrier” is meant any carrier, diluent or excipient which is compatible with the other ingredients of the formulation and not deleterious to the recipient.

(37) The bacteriophage is preferably administered with a pharmaceutically acceptable carrier selected on the basis of the selected route of administration and standard pharmaceutical practice. The active agent may be formulated into dosage forms according to standard practices in the field of pharmaceutical preparations. See Alphonso Gennaro, ed., Remington's Pharmaceutical Sciences, 18th Ed., (1990) Mack Publishing Co., Easton, Pa. Suitable dosage forms may comprise, for example, tablets, capsules, solutions, parenteral solutions, troches, suppositories, or suspensions.

(38) The compositions of the present invention can include pharmaceutically acceptable carriers such as lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, micro-crystalline cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, but not always limited thereto. The composition of the present invention can additionally include lubricants, wetting agents, sweetening agents, flavors, emulsifiers, suspensions and preservatives.

(39) The composition of the present invention contains bacteriophage as an active ingredient. The bacteriophage may be included at the concentration of 1×10.sup.1 pfu/ml-1×10.sup.15 pfu/ml or 1×10.sup.1 pfu/g-1×10.sup.15 pfu/g, and more preferably at the concentration of 1×10.sup.4 pfu/ml-1×10.sup.9 pfu/ml or 1×10.sup.4 pfu/g-1×10.sup.9 pfu/g. Other concentrations may be envisioned by the skilled artisan.

(40) For parenteral administration, the bacteriophage may be mixed with a suitable carrier or diluent such as water, an oil (particularly a vegetable oil), ethanol, saline solution, aqueous dextrose (glucose) and related sugar solutions, glycerol, or a glycol such as propylene glycol or polyethylene glycol. Solutions for parenteral administration preferably contain a water soluble salt of the active agent. Stabilizing agents, antioxidant agents and preservatives may also be added. Suitable antioxidant agents include sulfite, ascorbic acid, citric acid and its salts, and sodium EDTA. Preservatives may be included, but must be selected so as not to inactivate or otherwise impact the bacteriophage. The composition for parenteral administration may take the form of an aqueous or nonaqueous solution, dispersion, suspension or emulsion.

(41) For oral administration, the bacteriophage may be combined with one or more solid inactive ingredients for the preparation of tablets, capsules, pills, powders, granules or other suitable oral dosage forms. For example, the bacteriophage may be combined with at least one excipient such as fillers, binders, humectants, disintegrating agents, solution retarders, absorption accelerators, wetting agents absorbents or lubricating agents. According to one tablet embodiment, the bacteriophage may be combined with carboxymethylcellulose calcium, magnesium stearate, mannitol and starch, and then formed into tablets by conventional tableting methods.

(42) The pharmaceutical composition is preferably in unit dosage form. In such form the preparation is divided into unit doses containing appropriate quantities of the active component. The unit dosage form can be a packaged preparation, the package containing discrete quantities of preparation, such as packeted tablets, capsules, and powders in vials or ampoules. Also, the unit dosage form can be a capsule, tablet, cachet, or lozenge itself, or it can be the appropriate number of any of these in packaged form.

(43) The pharmaceutical compositions of the present invention may be used for the prevention and treatment of Enterococcus faecalis and Enterococcus faecium infections.

(44) The practice of the invention is illustrated by the following non-limiting example.

EXAMPLE

(45) A. Materials and Methods

(46) 1. Bacterial Strains and Growth Conditions

(47) TUSoD11 is a lysogenic E. faecalis strain, harboring a φEf11 prophage, which was previously isolated from an infected root canal (Stevens et al., Oral Microbiol. Immunol., 24:278-284 (2009). Following curing, the non-lysogenic variant of this strain was designated E. faecalis TUSoD11 (ΔφEf11).

(48) JH2-2 is a Fus.sup.r, Rif.sup.r mutant of a clinical E. faecalis isolate (Jacob & Hobbs, J. Bacteriol. 117(2):360-372, 1974) that was generously provided to us by Dr. Nathan Shankar. In the course of this study, it was found that this strain harbored a φFL1C-type prophage element (Yasmin et al., J. Bacteriol. 192(4):1122-1130, 2010), indicating that this strain was a lysogen with a defective prophage. Other E. faecalis strains used in this study are listed in Table 1.

(49) All strains were grown in brain heart infusion (BHI) broth (or on brain heart infusion agar, with appropriate antibiotics). Escherichia coli one shot mach-T1® (Invitrogen) was used in cloning plasmids as describe below. The cells were grown in LB medium supplemented with the appropriate antibiotics. Additional bacterial species used as negative controls in PCR experiments are also listed in Table 1.

(50) TABLE-US-00002 TABLE 1 Bacterial strains E. faecalis strain Characteristics Source TUSoD11 Lysogenic root canal isolate harboring 1 φEfll prophage JH2-2 Rif.sup.r, Fus.sup.r, clinical isolate harboring 2, 3 defective φFL1C prophage OG1RF Rif.sup.r, Fus.sup.r 3,4 MMH594 Gen.sup.r 3 OG1SSp Str.sup.r, Spc.sup.r 5 ER3/2s, ER5/1 root canal isolates 6, 7 E1, E2, E3, E4, E5, E6, E7, E8, E10, E11 oral isolates 6, 8 GS1, GS2, GS3, GS4, GS5, GS6, GS7, GS8, root canal isolates 9 GS9, GS10, GS12, GS13, GS14, GS15, GS16, GS17, GS18, GS19, GS21, GS22, GS23, GS24, GS25, GS26, GS27, GS28, GS29, GS30, GS31, GS32, GS33 GS34 tongue 6, 7 OS25 oral isolate 6, 10 AA-OR3, AA-OR4, AA-OR26, AA-OR34 oral isolates 6, 11 AA-T4, AA-T26 tongue 6, 11 V583 Van.sup.r, clinical isolate 6, 12 OS16 oral isolate 6, 10 TUSoD1, TUSoD2, TUSoD3 Lysogenic root canal isolate 1 TUSoD9, TUSoD10, TUSoD12 root canal isolates 1 TUSoD15, TUSoD17, TUSoD18 Non-Enterococcal spp: Streptococcus mutans 10449 grown in BHI broth ATCC Streptococcus sanguis 43055 grown in BHI broth ATCC Fingoldia (Peptostreptococcus) grown in chopped meat broth ATCC magna (magnus) Clostridium perfringens 13124 grown in modified PY broth ATCC Actinomyces israelii 10049 grown in BHI broth ATCC Eubacterium lentum 43033 grown in chopped meat broth ATCC .sup.1Stevens et al., Oral Microbiol. Immunol., 24: 278-284 (2009); .sup.2Jacobs and Hobbs, J. Bacteriol. 117(2): 360-372 (1974); .sup.3Dr. Nathan Shankar; .sup.4Dunny et al, Plasmid, 2: 454-465 (1979); .sup.5Dunny, Plasmid, 2: 454-465 (1979); .sup.6Dr. Christine Sedgley; .sup.7Johnson et al., J. Endod 32: 946-950 (2006); .sup.8Sedgley et al., Oral Microbiol Immunol. 19: 95-102(2004); .sup.9Sedgely et al., Oral Microbiol Immunol 20: 10-19 (2005a); .sup.10Sedgley et al., Archs oral Biol. 50(8): 575-583 (2005); .sup.11Sedgley et al., J. Endod 32(2): 104-111 (2006); .sup.12Sahm et al., Antimicrob Agents Chemother 33: 1588-1591 (1989).

(51) 2. Construction of Recombinant Plasmids

(52) The allelic exchange plasmid pΔ31-36 P.sup.nisA was prepared as follows.

(53) The Nisin promoter (P.sup.nisA) cassette containing an erythromycin selection marker (erm) was PCR-amplified using the AccuPrime DNA Taq Polymerase High Fidelity kit (Invitrogen) with primer set PNISaF/PNISR (see Table 2 for primer specifications) from plasmid pMSP3535 (Bryan et al. Plasmid, 44:183-190, 2000), a kind gift from Dr. B. Buttaro. PCRs were performed in 30 μl reaction mixtures containing 2 μl template DNA, 2 μl (20 pmol) forward primer, 2 μl (20 pmol) reverse primer, 21.5 μl dH.sub.20, 2 μl buffer (provided by manufacturer), and 0.5 μl AccuPrime DNA Taq Polymerase. The PCR program used was: 95° C. for 2 min, followed by 35 cycles of (i) 95° C. for 45 sec, (ii) 55° C. for 45 sec, and (iii) 72° C. for 2 min. This was followed by an additional 5 min extension at 72° C. Following PCR, the amplicons were detected by agarose gel electrophoresis and ethidium bromide staining.

(54) The allelic exchange plasmid pΔ31-36 P.sup.nisA was then constructed as follows, as shown in FIG. 1. The amplicons generated by the above procedure were cloned into pCR8/GW/TOPO vector (Life Technologies) to create pErm-PnisA. The two-component Nisin sensor system (nisR/nisK) that controls the activation of P.sup.nisA by Nisin, was also amplified from pMSP3535 by PCR, using primer set RKnpF/RKaxR, and cloned into pCR8/GW/TOPO to create pRK. The P.sup.nisA fragment plus the erythromycin selection marker was digested from pErm-PnisA with AatII and SphI, and inserted into pRK to create pRK-Erm-PnisA. A fragment (pre31) of 1088 bp from nucleotide coordinates 24585 to 25672 of φEf11 (upstream of ORF31, the first gene of the putative lysogeny module) and a fragment (post36) of 1090 bp from 28588 to 29577 of φEf11 (immediately upstream of the putative cro gene, ORF37) were PCR-amplified using primer sets EF31UF/EF31UR and EF37DF/EF37DR, respectively, and cloned into pCR8/GW/TOPO to create pPre31 and pPost36. The post36 fragment was cut out from the pPost 36 with BamHI and SphI and inserted into pRK-Erm-PnisA, to create pPost36-RK-PnisA. The pPre31 was first digested with EcoRI and blunt-ended with the Klenow fragment of DNA polymerase I (Promega), then digested with PstI. Following this, the digested pre31 fragment was cloned into pPost36-RK-PnisA to create the allelic exchange plasmid pΔ31-36 P.sup.nisA.

(55) 3. Isolation of Spontaneous Phage φEf11/φFL1C-Like Recombinant [φEf11(φ61-1, φFL1C40-44)] and the Creation of a Lysogen Harboring the Recombinant Prophage.

(56) A log phase BHI broth culture of E. faecalis JH2-2 was inoculated with phage φEf11. After incubation at 37° C. for 1 hr, the culture was centrifuged (17,000×g for 3 min) and the supernatant was filtered (0.45 μm) before being plaque-assayed. After overnight incubation at 37° C., the plates were examined, and several large, extensively-spreading plaques were noticed among a background of small, turbid plaques. These large plaques were picked, and the virus in these large plaques was cloned by successive plaque purifications. The genomic DNA from the cloned virus was sequenced by Sanger di-deoxy sequencing reactions as described previously (Stevens et al., FEMS Microbiol. Lett., 317: 9-26, 2011).

(57) To create a lysogen harboring a φEf11(Δ61-1, φFL1C40-44) prophage, JH2-2 cells from surviving colonies in the center of the large plaques produced by this virus were cloned and screened for the presence of the recombinant phage genome. This was done by PCR using primers (EF60F/FL1A35R) that recognized φEf11 ORF 60 at the 5′ end and φFL1C ORF 40 at the 3′ end (see Table 2 for primer specifications). The lysogen harboring this recombinant prophage was designated E. faecalis JH2-2[φEf11(Δ61-1, φFL1C40-44)]. In addition, virus spontaneously released from this lysogen was detected by plaque assay, and also confirmed to be recombinant by PCR analysis.

(58) TABLE-US-00003 TABLE 2 Primers Primer Sequence (5′.fwdarw.3′) Use EF31UF GATAGTTCTTGTTTCGACAAATCAC  Amplify upstream (SEQ ID NO: 1) of φEf11 Orf31 EF31UR CTGTCGACGTTCCTGCAGAGCTCTAAATAAATATGG Amplify upstream CAAGTA (SEQ ID NO: 2) of φEf11 Orf31 EF37DF CTGGATCCATGTGCTATGATTACTCAAAATTAGCAG  Amplify downstream of (SEQ ID NO: 3) φEf11 Orf36 EF37DR CTGCATGCCCTTTACCAGTAATTTTCGGCGT  Amplify downstream of (SEQ ID NO: 4) φEf11 Orf36 RKnpF CTCCATGGTCTCTCCTGCAGATAGAATTCTCATGTTT Amplify nisR and nisK GACAGCTTATCA (SEQ ID NO: 5) RKaxR CTGCATGCTCTCTCGACGTCGCCAGTTAATAGTTTGC  Amplify nisR and nisK CGAA (SEQ ID NO: 6) PNISaF CTGACGTCACAAAAGCGACTCATAGAATTATTTCCTC  Amplify Erm-P.sup.nisA C (SEQ ID NO: 7) PNISR GCTTATCGAAATTAATACGACTCACTATAGG  Amplify Erm-.sup.PnisA (SEQ ID NO: 8) EF31UUF AAGAGCACCTCAAATTCCAGT (SEQ ID NO: 9) Detection of φEf11 ΔOrf31-36 (upstream) RK5R TGATAAGCTGTCAAACATGAGAATTCT  Detection of φEf11 (SEQ ID NO: 10) ΔOrf31-36 (upstream) 37DDR TGTGATTTGCATGTAGACATCTCCT  Detection of φEf11 (SEQ ID NO: 11) ΔOr131-36 (downstream) PNIS3F TTGTAAAACAGGAGACTCTGCATG  Detection of φEf11 (SEQ ID NO: 12) ΔOrf31-36 (downstream) EF31MF AAGTTGTTTCCGTGTCAACGTGGC  Detection of φEf11 Orf31 (SEQ ID NO: 13) deletion EF31MR GTGTCCATCATGGTCGTTTAGCAG  Detection of φEf11 Orf31 (SEQ ID NO: 14) deletion EF36MF TTATCAGGGTCTGGTGAATGCG  Detection of φEf11 Orf36 (SEQ ID NO: 15) deletion EF36MR GCAACTTATGAGTGAGCGCAA  Detection of φEf11 Orf36 (SEQ ID NO: 16) deletion φEF11F GAGAGTGGAAGTGGA TTCAATG (SEQ ID NO: 17) Detection of φEf11 Orf43 φEf11R GCACTTTCATCTAAACTCTCG (SEQ ID NO: 18) Detection of φEf11 Orf43 EF44F ACCAAGATTTGACGCAGAAGTTGCC (SEQ ID NO: 19) Detection of φEf11 Orf44 EF44R TGGCCATCGTCGTCTTTATCTGCT (SEQ ID NO: 20) Detection of φEf11 Orf44 EF60F AGACGTTTGGACCGAATAGCTGGT (SEQ ID NO: 21) Detection of φEf11 Orf60 EF60R TGCGGTAAGCTTCTGCGAATTCAA (SEQ ID NO: 22) Detection of φEf11 Orf60 Fl1A35F GGGAACTAGCAGTTGAAGAATCGC (SEQ ID NO: 23) Detection of φFL1C gp40 Fl1A35R TTCCTTTGTACTATCTTGATCTCCA (SEQ ID NO: 24) Detection of φFL1C gp40 Fl1A37F GAGCGTTTAGATAAGTCGGATTGG (SEQ ID NO: 25) Detection of φFL1C gp44 Fl1A38R CCAAGTTTCTTTAGCCTGGTCACG (SEQ ID NO: 26) Detection of φFL1C gp44

(59) 4. Deletion of the Lysogeny Module and Replacement of Cro Promoter with P.sup.nisA by Allelic Exchange

(60) Cells of E. faecalis lysogen JH2-2[φEf11(Δ61-1, 4FL1C40-44)] were made competent using the procedures described by Shepard & Gilmore, Methods Mol Biol. 47:217-226 (1995). Briefly, the cells were grown in SGM17 medium (37.25 g/L M17, 0.5M sucrose and 8% glycine) for 48 hours at 37° C. The cells were then harvested by centrifugation, washed twice with EB buffer (0.5M sucrose and 10% glycerol), and finally resuspended in EB buffer. Plasmid pΔ31-36 P.sup.nisA was linearized with XhoI and then electroporated into the competent JH2-2 lysogens using the BioRad MicroPulser System. Following electroporation, 1 ml of SGM17MC medium (SGM17 plus 10 mM MgCl.sub.2 and 10 mM CaCl.sub.2) was added to the electroporation cuvette, which was then incubated for 2 hours. Transformants were selected on BHI agar containing erythromycin (30 μg/ml). Presumptive transformant colonies were screened for deletion of the lysogeny module genes (φEf11 ORFs 31-36) and replacement of P.sup.cro by P.sup.nisA by PCR using primers EF31UUF/RK5R, PNIS3F/37DDR, EF31MF/EF31MR and EF36MF/EF36MR. In addition, control of lytic functions in the prophage by the P.sup.nisA was demonstrated by measuring phage induction in the presence or absence of Nisin (40 ng/ml). The phage recovered from the induced lysogens lacking ORFs 31-36 and P.sup.cro, but containing the P.sup.nisA promoter, was designated φEf11 (vir).sup.PnisA.

(61) 5. Screening for the Presence of φEf11 Prophages in E. faecalis Strains

(62) Primers specific to φEf11 were designed from φEf11 ORF 43 (GenBank accession number GQ452243.1, Gene ID number 8683894). This sequence (ORF 43) of the φEf11 genome was chosen since searches of all available data bases failed to disclose any homologous sequences to this gene. The forward (φEf11F) and reverse (φEf11R) primers for amplification of a 165 bp amplicon of this gene are specified in Table 2, above. Template DNA was prepared as follows: 10 ml broth cultures of each strain to be screened were pelleted by centrifugation, washed in 4 ml of wash solution [20 mM Tris-HCl (pH 8.5), 0.85% NaCl], resuspended in 2 ml of lysis buffer [1% Triton X-100, 20 mM Tris-HCl (pH 8.5), 2 mM EDTA], and heated to 95°-100° C. for 10 min. The suspension was then centrifuged and the supernatants were collected and frozen away at −80° C. until being used in PCR assays (Goncharoff et al., 1993, Oral Microbiol Immunol 8:105-110). Extracts from E. faecalis TUSoD11 (lysogenic for φEf11) were used as positive controls, and extracts from E. faecalis JH2-2 (non-lysogenic for φEf11) and numerous unrelated species (see Table 1) were used as negative controls. Reaction mixtures (Σ=40 μl) for PCR contained 5 μl of template DNA, 5 μl (50 pmol) of forward primer, 5 μl (50 pmol) of reverse primer, 5 μl dH.sub.2O, and 20 μl 2X Go Taq green PCR master mix (Promega). The PCR program used was 97° C. for 1 min, followed by 26 cycles of (i) 97° C. for 1 min, (ii) 50° C. for 45 sec, and (iii) 72° C. for 1 min. This was followed by an additional 4 min at 72° C. Following PCR, amplification products were detected by agarose (2%) gel electrophoresis and ethidium bromide staining.

(63) 6. Preparation of Cured E. faecalis TUSoD11

(64) Cells of E. faecalis TUSoD11 were made competent for electroporation as described above. After electroporation with the allelic exchange vector pΔ31-36 PnisA, erythromycin-resistant colonies were screened for homologous recombination-mediated deletion of the lysogeny module genes (ORFs 31-36) in the genome of E. faecalis TUSoD11. Strains exhibiting deletion of ORFs 31-36 were further tested by PCR for the presence of φEf11 genes outside of the lysogeny module. In addition to clones containing φEf11 genes other than ORFs 31-36, a few rare clones were identified that lacked any of the φEf11 genes. Such clones could not be induced, but could now be infected by phage φEf11. These cured clones were designated E. faecalis TUSoD11(ΔφEf11).

(65) 7. Testing Adsorption of φEf11 and φEf11(Δ61-1, 4FL1C40-44) to Lysogenic and Non-Lysogenic E. faecalis Strains

(66) E. faecalis strains JH2-2, TUSoD11 and the cured strain, TUSoD11 (ΔφEf11) were grown in BHI medium to log phase. 100 μl of φEf11 or φEf11(Δ61-1, φFL1C40-44) preparations were added to 1 ml E. faecalis strains. After incubation at 37° C. for 10 minutes the mixtures were centrifuged at 17,000 g for 3 minutes, the supernatants were filtered through 0.45 μm filters, and filtrates containing any unabsorbed phage, were plaque-assayed, using JH2-2 indicator cells, to determine residual phage titers.

(67) 8. One Step Growth Curve

(68) The cells of a log phase BHI broth culture (2 ml) of E. faecalis JH2-2 were collected by centrifugation, resuspended in 1 ml of BHI broth, and inoculated with 100 μl of a stock culture of either phage φEf11, φEf11(Δ61-1, φFL1C40-44) or φEf11(vir).sup.PnisA. After incubation for 30 minutes to allow phage adsorption, the cells were recovered by centrifugation, washed 3 times in BHI broth, and finally resuspended in 10 ml of BHI broth. Aliquots (500 μl) of the suspension were made, and each was incubated at 37° C. At various time points, an aliquot was centrifuged to remove the cells, and the supernatant was plaque-assayed, using fresh JH2-2 indicator cells, for phage titer.

(69) 9. Host range determination for φEf11, φEf11(Δ61-1, φFL1C40-44), and φEf11(Vir).sup.PnisA.

(70) Plaque assays and spot tests were conducted with wild type phage φEf11 and recombinant phages φEf11(Δ61-1, φFL1C40-44) and φEf11(vir).sup.PnisA using a panel of 66 E. faecalis strains as indicators. The E. faecalis panel included both lysogenic and non-lysogenic strains. Lytic infection by each phage was detected by plaque assay with each E. faecalis indicator strain.

(71) B. Results and Discussion

(72) 1. Isolation of Spontaneous φEf11/φFL1C Recombinant

(73) Repeated propagation and plaque assay of phage φEf11 on host strain E. faecalis JH2-2, revealed that variants of the wild type virus were being generated. Whereas wild type φEf11 produced small, turbid plaques in lawns of JH2-2 (FIG. 2A), approximately 0.02% of the plaques appeared as large, extensively spreading, somewhat clearer zones of lysis. Interestingly, incubation of plaque assays of clones obtained by plaque purification of the virus producing these larger plaques resulted in continued expansion of the plaques to the extent that virtually the entire JH2-2 lawn was lysed (FIGS. 2C-2D). In contrast, wild type plaques typically disappeared after extended incubation, presumably due to growth of surviving lysogens within the plaques (FIG. 2B).

(74) AGE analysis of the NdeI restriction fragments of the DNA from the virus producing these large plaques revealed that it was missing one of the fragments (fragment 6, 2.79 kbp) that was present in the NdeI DNA digestion of the original φEf11 isolate (FIG. 3B). In addition, it was also noticed that another one of the NdeI fragments (fragment 2, approx. 9.4 kbp) from the DNA of the virus producing the large plaques, had increased in size (compared to the NdeI fragment 2 from the original φEf11 DNA) (FIG. 3A) by an amount approximately equal to the size of the missing NdeI fragment 6 (FIG. 3B).

(75) FIG. 4 shows the NdeI restriction site analysis of the φEf11 DNA. The φEf11 DNA is 42,822 in length and is oriented as described in Stevens et al., FEMS Microbiol. Lett., 317: 9-26 (2011), with the genes arranged with ORF 1 at the extreme left end and ORF 65 at the extreme right end. NdeI restriction sites (bp coordinates) are indicated the boxes. The NdeI restriction fragments, as visualized in agarose gel electrophoresis analysis AGE, are labeled 1-12.

(76) Inspection of the φEf11 NdeI restriction map (FIG. 4) and the φEf11 NdeI restriction digest summary (Table 3), revealed that NdeI fragment 6 was composed of the two extreme ends of the genome (fragment coordinates 0-1,036 plus 41,068-42,822), and that in a circularly permuted genome, this fragment is immediately adjacent to NdeI fragment 2 (coordinates 33,692-41,068) (FIG. 4).

(77) TABLE-US-00004 TABLE 3 NdeI restriction digest summary for φEf11 genome Fragment Number (as seen in gel) Fragment Length Fragment Coordinates 1 12,126  9,349-21,475 2 7,376 33,692-41,068 3 5,029 26,948-31,977 4 4,660 22,288-26,948 5 4,247 3,065-7,312 6 2,790 0-1,036 + 41,068-42,822 7 2,037 7,312-9,349 8 1,818 1,248-3,065 9 1,715 31,977-33,682 10 547 21,741-22,288 11 266 21,475-21,741 12 212 1,036-1,248

(78) FIGS. 5 and 11A-11E show the nucleotide sequence alignment of phages φEf11, φFL1C, and spontaneous recombinant phage [φEf11(Δ61-1, φFL1C 40-44)] in the region of recombination (φEf11 ORFs 60/61-1 and φFL1C ORFs 39/40-44). FIG. 5 presents an overview of the regions of φEf11 and φFL1C that recombined to yield recombinant φEf11(Δ61-1, φFL1C 40-44). FIGS. 11A-11E show φEf11 sequence from 39307 (within ORF60) through 451 (within ORF1), and φFL1C sequence from 14236 (within ORF39) to 17451 (within ORF44). Non-bolded text indicates φEf11 sequences, boldface text indicates φFL1C sequences. Spontaneous recombinant is abbreviated as Sp. Genomic coordinates are indicated to right of each row of sequence. Sites of sequence identity between φEf11 and φEf11(Δ61-1, φFL1C 40-44) are indicated by *****.

(79) Sequencing this region of the genome thus disclosed that ORFs 60 through 65 and 1 of φEf11 (coordinates 39671-42822 and 1-336), were replaced by ORFs 40 through 44 (coordinates 14600-17336) of E. faecalis phage φFL1C (FIGS. 5 and 11). NdeI restriction site at coordinate 41,068 which divides NdeI fragment 2 from NdeI fragment 6 in the φEf11 DNA is absent in the φFL1C DNA and consequently in the DNA of the recombinant virus (FIGS. 11A-11E). No other modifications of the genome were detected. Consequently, this φEf11/φFL1C recombinant was designated phage φEf11(Δ61-1, φFL1C40-44).

(80) Since the JH2-2 genome was the only possible source of the φFL1C genes, E. faecalis JH2-2 was screened for the φFL1C prophage. φFL1C (ORFs 40-44)-specific primers (Table 2) were used in PCR with JH2-2 extracts, prepared as described previously. As seen in FIG. 6, φFL1C-specific amplicons were generated from the JH2-2 templates and the φFL1C-specific primers, confirming the presence of (at least a portion of) a φFL1C prophage in the JH2-2 chromosome. PCR, using JH2-2 template DNA and primers specific for regions of the φFL1C genome other than ORFs 40-44, failed to produce any amplicons (data not shown).

(81) 2. Deletion of the Lysogeny Module and Replacement of Cro Promoter in φEf11(Δ61-1, φFL1C40-44) by Allelic Exchange

(82) A one-step growth curve was generated as follows for phage φEf11 (wild type), φEf11(Δ61-1, φFL1C40-44) (spontaneous recombinant), and φEf11(vir)P.sup.nisA (virulent variant). Log phase broth cultures of E. faecalis JH2-2 were infected with a phage stock. After adsorption for 30 minutes, the cells were collected by centrifugation, washed, and incubated at 37° C. At various time points aliquots of the suspension were centrifuged to remove the cells, and the supernatants were plaque assayed for phage titer using JH2-2 indicator cells. The results are shown in FIG. 7 (-.circle-solid.- φEf11 titer (pfu/ml); -.square-solid.- φEf11 (Δ61-1, φFL1C40-44) titer; -.box-tangle-solidup.- φEf11 (vir)P.sup.nisA titer. The φEf11(Δ61-1, φFL1C40-44) recombinant exhibited enhanced lytic activity (compared to wild type virus) as judged by the extensively enlarged plaques it forms in lawns of host cells (FIG. 2C), and the elevated titers it achieved in productive infection (FIG. 7). These variants of phage φEf11 could be subject to repression due to superinfection immunity, and be limited in lytic infection due to the possibility of entering into lysogeny, rather than generating a productive infection. Accordingly, all lysogeny-related genes were deleted and regulatory genetic elements were rendered insensitive to repressor control, as follows.

(83) Clones of JH2-2[φEf11(Δ61-1, φFL1C40-44)] transformed with plasmid pΔ31-36 PnisA, were selected on erythromycin-containing media. PCR analysis and sequencing of these erythromycin-resistant JH2-2[φEf11(Δ31-36, ΔP.sup.CRO, P.sup.nisA, erm, nisR/K, Δ61-1, φFL1C40-44)] clones demonstrated that they lacked φEf11 ORFs 31-36, and the φEf11 cro promoter, but contained the nisin promoter (P.sup.nisA) and nisR/nisK (FIG. 8 and FIG. 9). In the analysis, PCR products were separated by electrophoresis in 2% agarose gels and detected by ethidium bromide staining. Numbers in FIG. 9 to the left of the gel indicate DNA fragment size (kbp). Template DNA for PCR reactions: φEf11(vir).sup.PnisA (vir/lanes 1-4 and 7-8); φEf11 (wt/lanes 5-6 and 9-10). For the primers used in the PCR reactions, see FIG. 8 for primer binding sites: Primer set EF31UUF/RK5R spanning ORF 29 to nisR (lane 1), primers PNISaF/37DDR spanning P.sup.nisA to ORF 38 (lane 2); primers EF31MF/EF31MR within ORF 31 (lanes 3 and 5); primers EF36MF/EF36MR within ORF 36 (lanes 4 and 6); primers FL1A35F/FL1A35R within φFL1C ORF gp40 (lanes 7 and 9), primers FL1A37F/FL1A38R within φFL1C ORF gp44 (lanes 8 and 10). In FIG. 9, lane M shows molecular weight markers (BenchTop 1 kb ladder, Promega).

(84) Exposure of a population of this lysogenic clone, harboring a mutant prophage containing the nisin promoter (P.sup.nisA) in place of the wild type cro promoter/operator (P.sup.CRO), to nisin (40 ng/ml) resulted in the induction of phage, yielding a titer of 6.82×10.sup.7 pfu/ml (±0.31×10.sup.7). In the absence of nisin, a similar population of these lysogens spontaneously released phage, producing a titer of 5.57×10.sup.5 pfu/ml (±0.31×10.sup.5). In contrast, phage induction from lysogens [JH2-2{φEf11(Δ61-1, φFL1C40-44)}] containing a prophage with the wild type cro promoter/operator did not appear to be affected by the presence of nisin: In the presence of nisin (40 ng/ml), these cells produced a phage titer of 3.36×10.sup.5 pfu/ml (±0.25×10.sup.5), whereas the same cells produced a titer of 3.31×10.sup.5 pfu/ml (±0.38×10.sup.5) in the absence of nisin. These data indicate that productive infection was now under control of the nisin-sensitive promoter (P.sup.nisA), albeit somewhat leaky.

(85) The virus obtained, phage [φEf11(Δ31-36, ΔP.sup.CRO, P.sup.nisA, erm, nisR/KΔ61-1, φFL1C40-44)], by Nisin induction of the JH2-2[φEf11(Δ31-36, ΔP.sup.CRO, P.sup.nisA, erm, nisR/KΔ61-1, φFL1C40-44)] lysogens produced large, clear plaques (FIG. 2E-2F), and was designated φEf11 (vir).sup.PnisA. As will be shown below, this derivative of temperate phage φEf11 had all the characteristics of a virulent virus.

(86) 3. Isolation of Cured E. faecalis TUSoD11

(87) After electroporation of E. faecalis TUSoD11 with the gene exchange vector pΔ31-36 PnisA, erythromycin-resistant colonies were screened by PCR for deletion of ORF31-ORF36. Unexpectedly, a few colonies were found with deletions of not only the intended ORF31-ORF36 lysogeny module, but also all other phage genes outside this region. These clones may have been generated by the homologous recombination between the gene exchange vector and a permutated and terminally redundant prophage DNA that may have positioned the ORF30 and ORF37 regions at either end of the φEf11 prophage within the host E. faecalis TUSoD11 chromosome. These E. faecalis clones, lacking any detectable φEf11 genes, were designated TUSoD11(φEf11), and were further tested for phage induction. No phage could be induced from these cells.

(88) 4. Restoration of Adsorption of φEf11 and φEf11(Δ61-1, φFL1C40-44) by a Cured E. faecalis Strain

(89) Phage suspensions were incubated with each of the E. faecalis strains indicated in Table 4 for 10 minutes, whereupon the cultures were centrifuged and filtered to remove the cells along with all adsorbed phage. The cell-free filtrates were then assayed for residual phage titer. The values shown in Table 4 represent the mean of triplicate assays ±standard deviation.

(90) TABLE-US-00005 TABLE 4 Phage adsorption by lysogenic and non-lysogenic E. faecalis strains. Phage titer Residual phage titer after adsorption with: before Lysogen Non-lysogen Non-lysogen Phage adsorption TUSoD11 JH2-2 Cured TUSoD11 φEf11  1.2 × 10.sup.5 1.17 × 10.sup.5 ±  3.2 × 10.sup.2 ± 2.74 × 10.sup.2 ± 0.16 × 10.sup.5 0.25 × 10.sup.2 0.16 × 10.sup.2 φEf11(Δ61-1, ΦFL1C40-44) 5.58 × 10.sup.7 5.23 × 10.sup.7 ± 0.2 4.79 × 10.sup.2 ± 3.82 × 10.sup.2 ±   3 × 10.sup.7 0.23 × 10.sup.2 0.17 × 10.sup.2

(91) As shown in Table 4, neither φEf11 nor φEf11(Δ61-1, φFL1C40-44) could produce a viable infection on the lysogenic TUSoD11 strain due to superinfection immunity. It was interesting that incubation of either φEf11 or φEf11 (Δ61-1, φFL1C40-44) with a cell suspension of lysogenic E. faecalis strain TUSoD11 failed to result in phage adsorption to the cells. In contrast, cell suspensions of either strain JH2-2 (non-lysogenic with respect to φEf11) or TUSoD11(φEf11), a cured E. faecalis strain, effectively adsorbed both virus strains.

(92) 5. Host Range of φEf11(Vir).sup.PnisA

(93) Plaque assays and spot tests were conducted with wild type phage φEf11 and recombinant phages φEf11(Δ61-1, φFL1C40-44) and φEf11 (vir).sup.PnisA using a panel of 66 E. faecalis strains as indicators. The E. faecalis panel included both lysogenic and non-lysogenic strains. Lytic infection by each phage was detected by plaque assay with each E. faecalis indicator strain. The results are shown in Table 5. It can be seen that whereas wild type φEf11 productively infected only 4 (6%) of the 67 E. faecalis strains tested, productive infection occurred in 33 (49%) of these strains inoculated with phage φEf11(vir).sup.PnisA. The panel of E. faecalis strains was also screened by PCR for the presence of a prophage, using φEf11-specific primers. Among the strains tested, 14 were found to be φEf11 lysogens (data not shown). Of these 14 φEf11 lysogens, none were susceptible to wild type φEf11, however, 4 of these lysogenic strains (strains GS2, GS8, GS22 and GS25) could be productively infected by φEf11(vir).sup.PnisA. Furthermore, the presence of the φEf11 repressor gene (cI/ORF-36) was confirmed in these φEf11(vir).sup.PnisA-susceptible lysogenic strains by PCR (data not shown).

(94) TABLE-US-00006 TABLE 5 Host range of E. faecalis phages Phage φEf11 (Δ61-1, φEf11(Δ31-36, φFL1C39-44 ΔP.sup.cro, P.sup.nisA, Δ611, E. faecalis φEf11 (spontaneous φFL1C39-44) strain (wild type) recombinant) (virulent mutant) OG1RF − − − ER3/2s − − − ER5/1 − − + E1 + +  +* E2.sup.# − − − E3.sup.# − − − E4.sup.# − − − E5.sup.# − − − E6 − − − E7.sup.# − − − E8 − − + E10 − − + E11 − − + GS1 − − − GS2.sup.# − − + GS3 − − + GS4 − − − GS5 − − − GS6 − − + GS7 − − + GS8.sup.# − − + GS9.sup.# − − − GS10 − − − GS12 − − − GS13 − − + GS14 − −  +* GS15 − − + GS16 − − + GS17 − − − GS18 − − − GS19 − − + GS21 − − − GS22.sup.# − − + GS23# − − − GS24 − − + GS25.sup.# − − + GS26 − − + GS27 − − + GS28 − − − GS29.sup.# − − − GS30 − −  +* GS31 − − − GS32 − − − GS33.sup.# − − − GS34 − − − OS25 − − + AA-OR3 − − + AA-OR4 − − + AA-OR26 − −  +* AA-OR34.sup.# − − − AA-T4 − − + AA-26 − −  +* V583 − − + OS16 − − + TUSoD1  +*  +* + TUSoD2 − − − TUSoD3 − − − TUSoD9 − − + TUSoD10 − − − TUSoD12 − − − TUSoD15 − − − TUSoD17 − − − TUSoD18  +* − − MMH594 − − − OG1SSP − − + DG16 − − − JH2-2 + + + Cumulative 6.0% 4.5% 49.3% + = Sensitive to phage (plaque assay) +* = Sensitive to phage (spot test) − = Not sensitive to phage .sup.#= Lysogenic E. faecalis strain containing ∅Ef11 prophage

(95) The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. One skilled in the art will readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. While the invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope used in the practice of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.