LIPOPLEX FORMULATIONS FOR SPECIFIC DELIVERY TO VASCULAR ENDOTHELIUM

Abstract

The present invention is related to a lipid composition contained in and/or containing a carrier comprising at least a first lipid component, at least a first helper lipid, and a shielding compound which is optionally removable from the lipid composition under in vivo conditions, whereby the lipid composition containing carrier has an osmolarity of about 50 to 600 mosmole/kg, preferably about 250-350 mosmole/kg, and more preferably about 280 to 320 mosmole/kg, and/or whereby liposomes formed by the first lipid component and/or one or both of the helper lipid and the shielding compound in the carrier have a particle size of about 20 to 200 nm, preferably about 30 to 100 nm, and more preferably about 40 to 80 nm.

Claims

1. A lipid composition contained in and/or containing a carrier comprising at least a first lipid component, at least a first helper lipid, and a shielding compound which is optionally removable from the lipid composition under in vivo conditions, whereby the lipid composition containing carrier has an osmolarity of about 50 to 600 mosmole/kg, preferably about 250-350 mosmole/kg, and more preferably about 280 to 320 mosmole/kg, and/or whereby liposomes formed by the first lipid component and/or one or both of the helper lipid and the shielding compound in the carrier have a particle size of about 20 to 200 nm, preferably about 30 to 100 nm, and more preferably about 40 to 80 nm, wherein the composition comprises a second helper lipid.

2. The lipid composition according to claim 1, wherein the composition comprises a further constituent.

3. The lipid composition according to claim 1, whereby the first lipid component is a compound according to formula (I), ##STR00006## wherein R.sub.1 and R.sub.2 are each and independently selected from the group comprising alkyl; n is any integer between 1 and 4; R.sub.3 is an acyl selected from the group comprising lysyl, ornithyl, 2,4-diaminobutyryl, histidyl and an acyl moiety according to formula (II), ##STR00007## wherein m is any integer from 1 to 3, wherein the NH.sub.3.sup.+ is optionally absent, and Y.sup.− is a pharmaceutically acceptable anion, preferably wherein Y.sup.− is selected from the group comprising halogenids, acetate and trifluoroacetate.

4. The lipid composition according to claim 3, wherein R.sub.1 and R.sub.2 are each and independently selected from the group comprising lauryl, myristyl, palmityl and oleyl.

5. The lipid composition according to claim 4, wherein R.sub.1 is lauryl and R.sub.2 is myristyl; or R.sub.1 is palmityl and R.sub.2 is oleyl.

6. The lipid composition according to claim 3, wherein m is 1 or 2.

7. The lipid composition according to claim 3, wherein the compound is selected from the group comprising β-arginyl-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide trihydrochloride ##STR00008## β-arginyl-2,3-diamino propionic acid-N-lauryl-N-myristyl-amide trihydrochloride ##STR00009## and ε-arginyl-lysine-N-lauryl-N-myristyl-amide trihydrochloride ##STR00010##

8. The lipid composition according to claim 2, wherein the lipid composition comprises a nucleic acid, whereby such nucleic acid is preferably the further constituent.

9. The lipid composition according to claim 8, wherein the nucleic acid is selected from the group comprising RNAi, siRNA, siNA, antisense nucleic acid, ribozymes, aptamers and spiegelmers.

10. The lipid composition according to claim 1, wherein the composition comprises a nucleic acid and the nucleic acid forms together with the liposome a lipoplex.

11. The lipid composition according to claim 10, wherein the concentration of the lipids in the carrier is about from 0.01 to 100 mg/ml, preferably about from 0.01 to 40 mg/ml and more preferably about from 0.01 to 25 mg/ml, each based on the overall amount of lipid provided by the lipoplex.

12. The lipid composition according to claim 10, whereby the nucleic acid is an siRNA and the concentration of the siRNA in the lipid composition is about 0.2 to 0.4 mg/ml, preferably 0.28 mg/ml, and the total lipid concentration is about 1.5 to 2.7 mg/ml, preferably 2.17 mg/ml.

13. The composition according to claim 1, wherein the first helper lipid and/or the second helper lipid is selected from the group comprising phospholipids and steroids.

14. The composition according to claim 13, wherein the first and/or second helper lipid is selected from the group comprising 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine and 1,2-dioleyl-sn-glycero-3-phosphoethanolamine.

15. The composition according to claim 1, wherein the content of the helper lipid component is from about 20 mol % to about 80 mol %, preferably from about 35 mol % to about 65 mol % of the overall lipid content of the composition or of the lipoplex.

16. The composition according to claim 1, wherein the composition further comprises a nucleic acid, preferably a functional nucleic acid which is more preferably a double-stranded ribonucleic acid and most preferably a nucleic acid selected from the group comprising RNAi, siRNA, siNA, antisense nucleic acid and ribozyme, whereby preferably the molar ration of RNAi to cationic lipid is from about 0 to 0.075, preferably from about 0.02 to 0.05 and even more preferably 0.037.

17. The composition according to claim 1, wherein the carrier is an aqueous medium, preferably a sugar containing isotonic aqueous solution, and whereby the lipid composition contained in the carrier is present as a dispersion, preferably as a dispersion of liposomes and/or lipoplexes.

Description

[0172] The present invention is further illustrated by the following figures and examples from which further features, embodiments and advantages may be taken.

[0173] FIG. 1A shows the structures of the constituents of the lipid composition in accordance with the present invention.

[0174] FIG. 1B shows a schematic representation of a liposome formed by the lipid composition according to the present invention and the siRNA lipoplex according to the present invention formed by the lipid composition together siRNA molecules indicating that the siRNA molecules are forming a complex predominantly with the outer surface of the liposome rather than being contained in the liposome, whereby the negatively charged siRNAs are complexed by electrostatic interaction with the positive charges of the cationic lipid.

[0175] FIG. 1C shows a diagram depicting the size of a liposome formed by the lipid composition in accordance with the present invention and the siRNA lipoplex in accordance with the present invention.

[0176] FIG. 1D shows a diagram depicting the zeta potential of a liposome formed by the lipid composition in accordance with the present invention and the siRNA lipoplex in accordance with the present invention.

[0177] FIG. 2A shows the result of a Western blot analysis of concentration dependent inhibition of PKN3 protein expression with lipoplexed siRNAs and naked siRNA, respectively, in HeLa cells, whereby PTEN served as a loading control.

[0178] FIG. 2B shows pictures taken by confocal microscopy of HeLa cells treated with siRNAs labelled with Cy3 and administered either naked or as a lipoplex in accordance with the present invention.

[0179] FIG. 3A shows the result of a Western blot analysis using liposomal formulations containing different mol % of PEG.

[0180] FIG. 3B shows confocal microscopy pictures of cellular uptake of siRNA-Cy3-lipoplexes with 0, 1, 2 and 5 mol % PEG; EOMA cells were transfected with fluorescently labelled siRNA-lipoplexes; note: at 5 mol % PEG, most of the lipoplex decorates the surface of the cell (arrows).

[0181] FIG. 3C shows the result of a Western blot analysis and more specifically immunoblots with extracts from HUVEC cells transfected with different amounts of PEGylated (1 mol %) and non-PEGylated siRNA.sup.PKN3-lipoplex (upper panel) or siRNA.sup.PTEN-lipoplex (lower panel); the final concentration of siRNA is indicated (1-20 nM; ut: untreated); immunoblots were probed with anti-PTEN and anti-PKN3.

[0182] FIG. 3D shows various diagrams indicating the body weight development of nude mice treated with different formulations over a five days period, whereby the mice were treated (single i.v. injections on day 1-5) with PEGylated (triangle) or non-PEGylated (squares) lipoplexes of siRNA.sup.Luc, siRNA.sup.PKN3, siRNA.sup.CD31 and siRNA.sup.PTEN over a 5 days period; shown are the relative changes in body weight as mean±s.e.m. from 7 mice per treatment group.

[0183] FIG. 3E shows a diagram indicating the result of an IL-12 ELISA of blood samples from C57/BL6 mice (2 mice per group) after single treatment with poly(I:C) or indicated siRNA-lipoplexes for 2 (dark grey) or 24 (light grey) hours.

[0184] FIG. 4A shows epifluorescence microscopy pictures of paraffin embedded sections visualizing the distribution of naked (middle row) or lipoplexed (lower row) siRNA-Cy3 (1.88 mg/kg) in different tissues 20 minutes after tail vein injection.

[0185] FIG. 4B shows pictures of epifluorescence microscopy of heart, lung, spleen and liver analyzed at different time points after single systemic i.v. administration of siRNA-Cy3-lipoplex; tissue samples were recorded at identical microscopy settings (for each organ); size bars: 100 μm; in the case of liver and spleen: 200 μm.

[0186] FIG. 4C shows confocal microscopy pictures of endothelial cell distribution in the heart as revealed by IHC using anti-CD31 antibody (left picture) decorating cross and longitudinal sections of capillaries (arrow); Cy3-fluorescence staining of endothelial cells in the vasculature (right picture, arrow).

[0187] FIG. 4D shows pictures of confocal microscopy illustrating endothelial cell distribution in the lung as revealed by IHC using anti-CD31 antibody (left picture) decorating the lung capillaries in the lung (arrow, vessel; double-arrow, alveolar macrophages); Cy3-fluorescence staining of endothelial cells in the vasculature (right picture, arrow); alveolar macrophages also show strong fluorescence (right picture, small arrows).

[0188] FIG. 5A shows a diagram illustrating knockdown of mRNA levels for Tie2 (right diagram) or CD31 (left diagram) in lung, heart and liver tissue from animals treated daily on four consecutive days with sucrose, siRNA.sup.CD31-, siRNA.sup.PTEN- or siRNA.sup.Tie2-lipoplex as quantified by TaqMan RT-PCR; the indicated mRNA levels are shown relative to the sucrose group and normalized to the mRNA level of CD34; the values are means±s.e.m. of the ratios from all animals per group.

[0189] FIG. 5B shows immunoblots of lung, heart, liver protein extracts from 6-7 individual mice treated with either siRNA.sup.CD31-lipoplex or siRNA.sup.Tie2-lipoplex were probed with anti-Tie2, or anti-CD31 and anti-PTEN (loading control); note: levels in protein expression changes only in Tie-2 or CD31 according to the lipoplex applied, while no changes in PTEN expression levels occurred.

[0190] FIG. 5C shows a diagram illustrating s-Tie2 as a function of various formulations and more specifically the decrease of soluble Tie2 (s-Tie2) after four daily treatments with siRNA.sup.Tie2-lipoplex (day 5, right diagram), but not with control lipoplexes (siRNA.sup.PTEN, siRNA.sup.CD31) and sucrose; the measured s-Tie2 levels of individual mice per treatment group are indicated as rhombuses; soluble Tie2 levels from mice before treatment (day 0) are shown in the left diagram, after treatment in the right diagram; the mean value of s-Tie2 for each treatment group is shown as lines.

[0191] FIG. 6 shows a diagram indicating the size distribution of liposomes having a mean particle size of about 85 nm suitable for the preparation of lipoplexes having a mean particle size of about 120 nm.

[0192] FIG. 7 shows a diagram indicating the size distribution of lipoplexes having a mean particle size of about 120 nm.

[0193] FIG. 8 shows a diagram indicating the size distribution of several batches of liposomes having a mean particle size of about 30 nm suitable for the preparation of lipoplexes having a mean particle size of about 60 nm.

[0194] FIG. 9 shows a diagram indicating the size distribution of lipoplexes having a mean particle size of about 60 nm.

EXAMPLE 1: MATERIAL AND METHODS

siRNAs

[0195] The siRNA molecules (AtuRNAi) used in this study are blunt, 19-mer double-stranded RNA oligonucleotides stabilized by alternating 2′-O-methyl modifications on both strands (for details see (Czauderna et al., 2003)) and were synthesized by BioSpring (Frankfurt a. M., Germany). siRNA sequences used in this study are listed in Table 1.

TABLE-US-00001 TABLE 1 siRNA sequences siRNA name sequence 5′ to 3′ PKN3 s gagagccuguacugcgaga SEQ ID NO: 1 PKN3 as ucucgcaguacaggcucuc SEQ ID NO: 2 PTEN s ccaccacagcuagaacuua SEQ ID NO: 3 PTEN as uaaguucuagcuguggugg SEQ ID NO: 4 CD31 s uuccguucuagaguaucug SEQ ID NO: 5 CD31 as cagauacucuagaacggaa SEQ ID NO: 6 PTEN s ccaccacagcuagaacuua SEQ ID NO: 7 PTEN as-Cy3 uaaguucuagcuguggugg-Cy3 SEQ ID NO: 8 PTEN s ccaccacagcuagaacuua SEQ ID NO: 9 PTEN as-Cy5 uaaguucuagcuguggugg-Cy5 SEQ ID NO: 10 Luciferase s cguacgcggaauacuucga SEQ ID NO: 11 Luciferase as ucgaaguauuccgcguacg SEQ ID NO: 12 Tie2 s auaucugggcaaaugaugg SEQ ID NO: 13 Tie2 as Ccaucauuggcccagauau SEQ ID NO: 14
Nucleotides with 2′-O-methyl modifications are underlined.
S stands for the sense strand which is also referred to herein as the first strand; and
As stands for the antisense strand which is also referred to herein as the second strand.
Preparation and Characterization of siRNA-Lipoplexes

[0196] Cationic liposomes comprising the novel cationic lipid AtuFECT01 which is β-L-arginyl-2,3-L-diaminopropionic acid-N-palmityl-N-oleyl-amide trihydrochloride, Atugen AG (Berlin), the neutral/helper lipid phospholipid 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhyPE) (Avanti Polar Lipids Inc., Alabaster, Ala.) and the PEGylated lipid N-(Carbonyl-methoxypolyethyleneglycol-2000)-1,2-distearoyl-sn-glycero-3-phospho-ethanolamine sodium salt (DSPE-PEG) (Lipoid GmbH, Ludwigshafen, Germany) in a molar ratio of 50/49/1 were prepared by lipid film re-hydration in 300 mM sterile RNase-free sucrose solution to a total lipid concentration of 4.34 mg/ml 300 mM sucrose, pH=4.5-6.0. Subsequently the multilamellar dispersion was further processed by high pressure homogenization (22 cycles at 750 bar and 5 cycles at 1000 bar) using an EmulsiFlex C3 device (Avestin, Inc., Ottawa, Canada). To generate siRNA-lipoplexes (AtuPLEX) the obtained liposomal dispersion was mixed with an equal volume of a 0.5625 mg/ml solution of siRNA in 300 mM sucrose, resulting in a calculated charge ratio of nucleic acid backbone phosphates to cationic lipid nitrogen atoms of approximately 1 to 4. The size of the liposome and the lipoplex-dispersion was determined by Quasi Elastic Light Scattering (N5 Submicron Particle Size Analyzer, Beckman Coulter, Inc., Miami, Fla.) and the zeta potential was measured using a Zetasizer Nano-ZS (Malvern Instruments, Worcestershire, UK).

[0197] For siRNA-lipoplex double labelling, the fluorescently labeled liposomes were generated by adding the fluorescently-labeled tracer lipid TexasRed®-1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine, triethylammonium salt (TexasRed®-DHPE; Molecular Probes) at following ratio: 50 mol % cationic lipid (AtuFECT01)/44 mol % helper lipid DPhyPE/1 mol % DSPE-PEG/5 mol % TexasRed®-DHPE. The liposomes were processed by 51 extrusion cycles through a 400 nm polycarbonate membrane prior mixing resulting in a final concentration of 2.17 mg/ml total for the lipids and 0.28 mg/ml siRNA (a 200 μl injection into a 30 g mouse represents a dose of 1.88 mg/kg siRNA and 14.5 mg/kg lipid).

In Vitro Transfection and Immunoblotting

[0198] Human, HeLa and murine EOMA cell lines were obtained from American Type Culture Collection and cultivated according to the ATCC's recommendation. Cell lines were transfected with siRNA using the cationic liposomes described above. Briefly, about 12 hours after cell seeding different amounts of siRNA-lipoplex solution diluted in 10% serum containing medium were added to the cells to achieve transfection concentrations in a range of 1-50 nM siRNA. After transfection (48 h) cells were lysed and subjected to immunoblotting as described (Klippel et al., 1998). For total protein extraction tissues were dissected and instantly snap-frozen in liquid nitrogen. 20 mg of tissue were homogenized in a Mixer Mill MM 301 (Retsch GmbH, Haan, Germany) using tungsten carbide beads (Qiagen) and proteins were extracted in NP40-lysis buffer. Protein concentration was determined with a DC Protein Assay (BioRad) and equal amounts were loaded for immunoblot analysis using the following antibodies: Rabbit anti-PTEN (Ab-2, Neomarkers), monoclonal p110α (Klippel et al., 1994), rabbit anti-PKN3 (Leenders et al., 2004), goat anti-CD31 (Santa Cruz Biotechnology), rabbit anti Tie-2 (Cell Signaling Technology).

siRNA-Cy3 Uptake Experiments in Cell Culture and Mice

[0199] For uptake studies of non-formulated siRNA-Cy3 molecules in cell culture, cells were incubated with defined amounts of siRNA solution overnight in serum-containing medium. Uptake of lipoplexed siRNA-Cy3 was carried out by transfection overnight as mentioned above. Treated cells were rinsed with ice cold PBS and fixed in 4% formaldehyde/PBS solution for 15 minutes prior to microscopy. In vivo delivery experiment using fluorescently labeled siRNA-Cy3 was carried out by administering formulated and naked siRNA intravenously. Mice were treated with a single 200 μl i.v. injection at a final dose of 1.88 mg/kg siRNA-Cy3 and 14.5 mg/kg lipid and were sacrificed at defined time-points and fluorescence uptake examined by microscopy on either formalin fixed, paraffin embedded or OCT mounted frozen tissue sections.

Histological Analysis and Microscopy

[0200] After mice were sacrificed, tissues were instantly fixed in 4.5% buffered formalin for 16 hours and consequently processed for paraffin embedding. 4 μm sections were cut and placed on glass slides. Tissue sections were stained with goat polyclonal anti-CD31/PECAM-1 (Santa Cruz Biotechnology) (alternatively for cryosections rat CD31, Pharmingen) to visualize endothelial cells in paraffin sections. Immunohistochemistry and hematoxylin/eosin (H+E) staining on paraffin tissue sections were performed according to standard protocols. For in vivo uptake studies of fluorescently labeled siRNAs, paraffin sections were directly examined by epifluorescence with a Zeiss Axioplan microscope. Images were recorded and processed using the Zeiss LSMS imaging software. In depth microscopic analysis of siRNA uptake was performed with a Zeiss LSM510 Meta confocal microscope. For this, sections were deparaffinized with xylene, rehydrated through graded ethanol washes, counterstained with Sytox Green dye (Molecular Probes 100 nM), rinsed and finally mounted in FluorSave (Calbiochem) for microscopy.

mRNA Quantification by RT-PCR (TaqMan)

[0201] Tissues were dissected and instantly snap-frozen in liquid nitrogen. Approximately 20 mg of tissue was homogenized in a Mixer Mill MM 301 (Retsch GmbH, Haan, Germany) using tungsten carbide beads (Qiagen) and total RNA was prepared with the Invisorb Spin Tissue RNA Mini Kit (Invitek, Berlin, Germany). Depending on the tissue 25 to 100 ng total RNA was used for quantitative TaqMan RT-PCR with the following amplicon sets (BioTez GmBH, Berlin, Germany) (UPR: upper primer, LWR: lower primer, PRB: probe): CD31-specific for mouse mRNA, UPR 5′GGGAACGAGAGCCACAGAGAC3′ (SEQ ID NO: 15), LWR 5′CATTAAGGGAGCCTTCCGTTC3′ (SEQ ID NO: 16), PRB FAM-5′CGGAAGGTCGACCCTAATCTCATGGAAA3′-TAMRA (SEQ ID NO: 17); CD34-specific for both mouse splice variants, UPR 5′GAGGCTGATGCTGGTGCTAGT3′ (SEQ ID NO: 18); LWR 5′CAGCAAACACTCAGGCCTAACC3′ (SEQ ID NO: 19); PRB FAM-5′CTGCTCCCTGCTTCTAGCCCAGTCTGA3′-TAMRA (SEQ ID NO: 20); Tie2-specific for mouse mRNA, UPR 5′ATGCCTCTGCTCTCAAGGATG3′ (SEQ ID NO: 21); LWR 5′ TCTGGCAAATCCTCTATCTGTGG3′ (SEQ ID NO: 22); PRB FAM-5′ TGAGAAAGAAGGCAGGCCAAGGATGACT3′-BHQ1 (SEQ ID NO: 23). The TaqMan RT-PCR reactions were carried out with an ABI PRISM 7700 Sequence Detector (Software: Sequence Detection System v1.6.3 (ABI)) using a standard protocol for RT-PCR (48° C. 30 min, 95° C. 10 min, 40× (95° C. 15 s, 60° C. 1 min)) with primers at a concentration of 300 nM and 100 nM for the probe. TaqMan data were calculated by using the Comparative C.sub.T method. Here the amount of target mRNA (CD31 or Tie2), normalized to an endogenous reference (CD34) and relative to a calibrator (sucrose group) is given by the formula 2.sup.−ΔΔC.sup.T. Data for individual mice are shown as C.sub.T of CD31, CD34 or Tie2 mRNA relative to sucrose presenting the mean of a triplicate±s.e.m. Data for treatment groups are shown as ΔΔC.sub.T normalized to an endogenous reference and relative to sucrose presenting the mean of 6-8 mice per group±s.e.m.

Quantification of Soluble Tie2 by ELISA

[0202] For serum analysis blood was collected from anesthetized mice by orbital sinus bleeding on day 0 and day 5. Soluble Tie2 was measured by ELISA (R&D Systems, Minneapolis, USA) according to the manufacturer's instructions.

Quantification of Interleukin-12 by ELISA

[0203] Male C57BL/6 mice received a single 204.1 tail-vein injection of Poly(I:C)- (Sigma, Taufkirchen, Germany) or siRNA-lipoplex solution (final dose of 1.88 mg/kg siRNA or Poly(I:C) and 14.5 mg/kg lipid). Blood was harvested from anesthetized mice by orbital sinus bleeding 2 and 24 hours post injection and serum IL-12 (p40) as well as interferon-α levels were measured by ELISA (R&D Systems, Minneapolis, USA) according to the manufacturer's instructions.

Mouse Studies

[0204] Immune deficient male Hsd:NMRI-nu/nu nude mice (9 weeks) were used for toxicity assessment of siRNA-lipoplexes in vivo as well as for detection of RNAi (knock-down analysis in vivo) and Tie2 ELISA. The microscopic analysis of organ and cell type distribution of fluorescently labelled siRNA-lipoplexes, and the IL-12 ELISA analysis were carried out with immune competent male C57BL/6 mice (8-10 weeks). The animal maintenance and experiments were conducted according to the approved protocols and in compliance with the guidelines of the Landesamt für Arbeits-, Gesundheitsschutz and technische Sicherheit Berlin, Germany (No. G0264/99).

Statistical Analysis

[0205] Data are expressed as means±s.e.m. Statistical significance of differences was determined by the Mann-Whitney U test. P values <0.05 were considered statistically significant.

EXAMPLE 2: CHARACTERIZATION OF siRNA-LIPOPLEXES IN VITRO

[0206] We have employed 19-mer siRNA duplexes lacking 3′-overhangs, which are chemically stabilized by alternating 2′-O-methyl sugar modifications on both strands (Czauderna et al., 2003), whereby unmodified nucleotides face modified ones on the opposite strand as depicted in Table 1 of Example 1.

[0207] It has been demonstrated previously in cell culture (ex vivo) (Czauderna et al., 2003) that these particularly modified molecules enhances resistance towards serum nuclease while RNAi activity is preserved. First we analyzed whether these molecules mediate RNAi in cell culture either complexed with cationic liposomes or without formulation (“naked”). For this purpose we synthesized a newly designed cationic lipid, referred to as AtuFECT01, in combination with commercially available helper lipids the structure of which are depicted in FIG. 1A. This novel lipid is characterized by a highly charged head group, which allows for more efficient siRNA-binding as compared to other commercially available cationic lipids such as DOTAP or DOTMA. In the following study we used siRNA-lipoplexes consisting of positively charged liposomes (50 mol % cationic lipid AtuFECT01, 49 mol % neutral/helper lipid DPhyPE, and 1 mol % DSPE-PEG) in combination with different target specific siRNA molecules. The liposomes and the siRNA-lipoplexes were characterized regarding seize and charge by QELS (unimodal analysis at an angle of 90°) and zeta-potential measurement. The results thereof are depicted in FIGS. 1C and 1D. The zeta potential of a representative cationic lipid formulation was +63 mV, while the lipoplex formulation in accordance with the present invention showed a zeta potential of +46 mV.

[0208] Immunoblot analysis performed for in vitro delivery demonstrated that no gene silencing occurred when naked siRNA was applied at even micromolar concentrations compared to nanomolar concentrations used for siRNA-lipoplexes as may be taken from FIG. 2A. To analyze whether the lack of gene silencing was the result of an inefficient cellular uptake due to repulsive effects between the anionic siRNAs and the negatively charged cell membrane, we employed 3′ fluorescently (Cy3) labeled siRNAs to study their uptake by confocal microscopy. We, and others have previously shown that fluorescence labeling at the 3′-end of the antisense molecule does not impair RNA silencing activity when transfected with delivery vehicles (Chiu and Rana, 2002; Czauderna et al., 2003). Surprisingly, we observed a significant uptake of fluorescently labeled siRNAs in the absence of transfection reagents when high concentrations (10 μM) of siRNA-Cy3 molecules were applied, as depicted in FIG. 2B. In contrast, equivalent siRNA-Cy3 uptake was achieved when transfected with AtuFECT01 at a thousand fold lower siRNA-Cy3 concentration (10 nM). These results indicate that siRNA-lipoplexes provide two beneficial effects for functional delivery of siRNAs: an improved cellular uptake and more importantly, the escape from the endocytotic/endosomal pathway into the cytoplasm (Zelphati and Szoka, 1996), where RNAi-mediated mRNA degradation takes place.

EXAMPLE 3: PEGylated siRNA-LIPOPLEXES ARE FUNCTIONAL IN VITRO AND SUITABLE FOR IN VIVO APPLICATION

[0209] It has been suggested that cationic liposomal particles can interact with negatively charged serum proteins or bind to other serum components. These unspecific interactions might negatively influence the distribution and delivery properties of the liposomal formulations in vivo. To overcome this problem, many liposomal carriers are coated with the polymer poly(ethylene glycol), PEG, to avoid carrier clearance by serum proteins or complement system and improve circulation time. In addition, the incorporation of PEG may help to stabilize the liposomes by shielding and reduce macrophage clearance (Allen et al., 1995; Felgner et al., 1987).

[0210] In order to demonstrate the advantage of PEGylation in the case of siRNA-lipoplexes we performed experiments with and without PEGylated lipid. In the following experiments we used siRNA-lipoplexes comprising of positively charged liposomes (cationic lipid Atufect01, neutral/helper lipid DPhyPE, and different amounts of DSPE-PEG-2000) in combination with different target specific siRNA molecules. First, we determined the effect of different amounts of PEGylation on RNA interference activity in vitro. SiRNA mediated gene silencing was completely abolished in the presence of 5 mol % of DSPE-PEG-2000 but was maintained in the presence of 1-2 mol % in the formulation. The results are depicted in FIG. 3A which shows the result of a Western blot analysis testing of siRNA.sup.PTEN liposomal formulations with different mol % of PEG by transfection of HeLa cells (20 nM (left panel) or 5 nM (right panel) siRNA concentration; ut: untreated); whereby protein extracts were probed with anti-PTEN and anti-p110α. The intracellular distribution of fluorescently labelled siRNA lipoplexes changed upon 1-2% PEGylation from large interconnected perinuclear vesicles to small uniform vesicles as depicted in FIG. 3B. In contrast, at 5 mol % of PEGylation, when no RNAi was observed (FIG. 3A), cellular uptake appeared to be blocked, since lipoplexed siRNA-Cy3 mainly became attached to the cell's surface as may be taken from FIG. 3B, right panel. When siRNA complementary to the target sequence of the PTEN or PKN3 gene was formulated in the presence or absence of 1 mol % DSPE-PEG-2000, a specific siRNA mediated protein knockdown was observed regardless of the PEGylation as may be taken from FIG. 3C. However, non-PEGylated siRNA-lipoplexes gave rise to a slightly more efficient protein knockdown at lower concentrations when compared to PEGylated variants (FIG. 3C, compare 1 nM siRNA concentrations), but exhibited also unspecific knockdown effects (see PTEN loading control for siRNA.sup.PKN3-lipoplexes) when applied at higher doses (20 nM, FIG. 3C). This unspecific inhibition of a non-target protein level is probably due to a more pronounced toxic effect of the non-PEGylated lipoplex in vitro.

[0211] To analyze whether the PEGylation of the siRNA-lipoplexes can also reduce the toxicity in vivo we applied identical doses of PEGylated (1 mol % DSPE-PEG-2000) and non-PEGylated siRNA-lipoplexes by tail-vein injection into mice. Consecutive daily treatments (day 1 to 5) of non-PEGylated siRNA-lipoplexes (four different siRNA sequences were used siRNA.sup.Luc, siRNA.sup.PKN3, siRNA.sup.CD31 and siRNA.sup.PTEN) by systemic administration (i.v.) caused loss in body weight over time, while mice treated with the same daily doses of PEGylated variants (1 mol % DSPE-PEG-2000) appeared unaffected as may be taken from FIG. 3D.

[0212] To elucidate the differences in body weight loss after treatment with PEGylated and non-PEGylated siRNA-lipoplexes, a possible immune reaction upon lipoplex treatment was analyzed. For this reason, interleukin-12 level (IL-12) was assayed (Alexopoulou et al., 2001; Liu et al., 2003) in immune competent mice after single i.v. bolus of non complexed Poly(I:C) (positive control) or PEGylated and non-PEGylated siRNA-lipoplexes (siRNA.sup.PTEN, siRNA.sup.Luc). The ELISA analysis revealed that no increase of IL-12 occurred upon siRNA-lipoplex treatment regardless of PEGylation as may be taken from FIG. 3E. Therefore, it seems unlikely that an unspecific cytokine response caused the observed body weight reduction upon non-PEGylated siRNA-lipoplex treatment. Taken together these data show that 1 mol % of DSPE-PEG-2000 in the siRNA-lipoplex formulations is sufficient to reduce unspecific toxic side effects in vivo without a severe loss in RNAi efficacy in vitro. Consequently, a defined degree of PEGylation appears to be an important prerequisite for a safe and efficient in vivo application of the here characterized siRNA-lipoplexes.

EXAMPLE 4: SPECIFIC UPTAKE OF LIPOPLEXED siRNA INTO THE VASCULAR ENDOTHELIUM AND RENAL EXCRETION OF NAKED siRNA

[0213] In a next step we set out to investigate the biodistribution and kinetics of siRNA-lipoplexes in comparison to non-formulated siRNA after systemic treatment of mice. For this purpose, we injected a single dose of Cy3 fluorescently labeled siRNA either complexed with lipids (200 μl i.v. injection at a final dose of 1.88 mg/kg siRNA-Cy3 and 14.5 mg/kg lipid) or not formulated (siRNA-Cy3: 0.188 mg/ml equal to 15 μM) into immune competent mice, and dissected six different organs at nine time points (from 5 min to 48 h) for examination by epifluorescence and confocal miscroscopy. An initial microscopic analysis revealed that fluorescence was detectable in all tissues analyzed from animals 20 min post treatment with siRNA-Cy3-lipoplex as depicted in FIG. 4A, lower panels. The Cy3-fluorescence appeared in a distinct staining pattern for each organ. This organ-specific Cy3-staining pattern is reminiscent of the tissue endothelia distribution. In contrast, naked siRNA was predominantly found in the kidney 20 min post injection, with no detectable signals in other organs, suggesting a rapid renal excretion of non-formulated siRNA molecules (FIG. 4A, upper row). In addition the applied, naked siRNA-Cy3 accumulates in the pole and lumen of the proximal tubules and in the urine 5 minutes after injection, which was not observed for lipoplexed siRNA-Cy3. In conclusion, non-formulated siRNAs were not targeted any cell type of analyzed tissues in vivo after systemic administration, this being most likely due to instant renal excretion. For the siRNA-Cy3-lipoplexes, the microscopic fluorescence data suggest however, that the siRNA molecules were taken up by the vasculature endothelium in different organs with a profound delayed clearance rate. To analyze the pharmacokinetics of siRNA-Cy3-lipoplexes in more detail we compared the uptake of siRNA-Cy3-lipoplexes more closely at different time points. The four organs (lung, heart, liver, and spleen) with the highest amount of Cy3-fluoresecence at 20 min post injection (200 μl i.v. injection at a final dose of 1.88 mg/kg siRNA-Cy3 and 14.5 mg/kg lipid) were selected for this analysis. The Cy3-fluorescence was compared by microscopic examination using identical recording parameters. Substantial amounts of lipoplexed siRNA-Cy3 accumulated in all of these organs starting five minutes after injection as may be taken from FIG. 4B. This level of fluorescence declined gradually within the following 2 hour period in heart and lung tissue. In contrast, most fluorescence was detected in the spleen 20 min after siRNA-Cy3-lipoplex administration, and was retained up to 20 hours in this tissue. In liver, siRNA-Cy3-lipoplex accumulated over time resulting in the highest amount of Cy3-fluorescence at 2 hours post injection, before tapering off during the next 4-20 h time period. Remarkably, the distinct fluorescence staining pattern of the siRNA-Cy3-lipoplex in each tissue did not change over time suggesting that the siRNA molecules do not diffuse throughout the entire tissue. No Cy3-fluorescence was observed at 48 h post single administration of siRNA-Cy3-lipoplexes in any of the samples analyzed by this microscopic assay. These results indicate that siRNA molecules formulated in lipoplexes attain a better organ uptake compared to those administered as naked siRNAs.

[0214] The improved siRNA uptake of an organ, however, does not necessarily indicate an intracellular or cell type specific uptake of these molecules, which is a prerequisite for the functionality of the delivered siRNAs. A more detailed analysis of formulated siRNA-Cy3 uptake in the heart and lung by confocal microscopy revealed that on the cellular level, fluorescence staining was predominantly present in the linings of the blood vessels suggesting delivery to endothelial cells. The vascular endothelium in the heart was visualized by immunohistochemistry using an anti-CD31 antibody. The results are depicted in FIG. 4C. The staining for the CD31 expressing endothelial cells illustrates the presence of numerous blood capillaries along the cardiac muscle cells (FIG. 4C; arrow: cross and longitudinal sections of capillaries). These capillary structures were decorated in the heart from mice treated with a single i.v. injection of siRNA-Cy3-lipoplex as revealed by confocal microscopy (FIG. 4C, right panel).

[0215] Confocal microscopy of lung sections from mice treated with siRNA-Cy3-lipoplexes revealed a punctuate staining of the alveolar wall, but not of the bronchiole epithelium as may be taken from FIG. 4D. The alveolar wall is traversed by the endothelium of the alveolar capillaries as visualized by staining with anti-CD31 (FIG. 4D, left panel). We therefore conclude that siRNAs lipoplexed using the here described liposomes become delivered to the capillary endothelium of the lung. A similar endothelial cell specific siRNA uptake was observed for other organs including liver, pancreas, kidney, small intestine, stomach. Taken together, these data demonstrate that cationic lipid based formulations of siRNAs improve the biodistribution properties of siRNAs and allow for a predominant uptake of siRNAs into endothelial cells throughout the body.

EXAMPLE 5: siRNA-LIPOPLEX MEDIATED RNAi IN THE VASCULATURE OF LUNG, HEART AND LIVER

[0216] Systemic treatment of mice with siRNA-Cy3-lipoplex suggests a delivery of siRNAs to the endothelial compartment of different organs. Following this observation, we then aimed to correlate siRNA uptake and distribution with the efficacy of RNA interference in particular organs. For this purpose, we designed the following in vivo experiment: Nude mice (6-8 per cohort) were treated with four consecutive daily i.v. injections (daily dose: 1.88 mg/kg siRNA and 14.5 mg/kg lipid) with three target specific siRNA-lipoplexes. Potent siRNAs specific for the two endogenous gene targets, CD31 (PECAM-1) and Tie2, were identified in vitro and applied to demonstrate RNAi silencing in the vasculature of selected organs. Importantly, the expression of these two genes is highly restricted to endothelial cells. Additional groups of mice were treated in parallel with sucrose solution or with siRNA-lipoplex specific for the murine PTEN coding sequence to control for unspecific effects. PTEN is, in contrast to CD31 and Tie2, ubiquitously expressed in all cell types of the mice. Gene expression was assessed by measuring changes in mRNA levels employing RT-PCR and protein levels by immunoblot and ELISA methods 24 h after the last siRNA-lipoplex treatment. The results are depicted in FIG. 5. Total RNA was prepared from lung, heart and liver of corresponding treatment groups (sucrose, siRNA.sup.PTEN, siRNA.sup.Tie2, siRNA.sup.CD31) to analyze mRNA knockdown in the endothelium of the two target genes by quantitative RT-PCR (TaqMan). The mRNA level of CD34, another gene with a restricted expression to vascular endothelial cells was measured to normalize for equivalent amounts of RNA from endothelial cells. The mean ratio of CD31 or Tie2 mRNA level normalized to CD34 mRNA level is shown in FIG. 5A. Only in samples derived from animals treated with siRNA.sup.Tie2- and siRNA.sup.CD31-lipoplexes, Tie2 and CD31 mRNA levels were significantly reduced, as revealed by the respective mRNA quantification data. The reduction in Tie2 mRNA levels in the siRNA.sup.Tie2-lipoplex treatment group or CD31 mRNA for the siRNA.sup.CD31-lipoplex group demonstrates the target specificity of the siRNA treatment. In the liver the knockdown in mRNA level was more prominent for Tie2 (FIG. 5A, lower panel), whereas in lung and heart the expression of both target genes were inhibited similarly. To corroborate the siRNA mediated inhibition of the both target genes we set out to confirm the inhibition of Tie2 protein expression by immunoblot (FIG. 5B). Organ protein lysates from 6-7 individual animals of the siRNA.sup.Tie2-lipoplex or the siRNA.sup.CD31-lipoplex treatment groups were prepared, separated by SDS-polyacrylamide gelelectrophoresis, and corresponding immunoblots were probed with anti-Tie2 and anti-PTEN (loading control). A significant reduction of Tie2 protein was observed in all three organs from siRNA.sup.Tie2-lipoplex treated animals. With protein lysates from liver we were not able to detect significant amounts of CD31 by immunoblot. However, a significant siRNA.sup.CD31-lipoplex specific reduction of CD31 protein level was demonstrated for lung and heart. Taken together, these data demonstrate an siRNA mediated “gene silencing” on mRNA and protein level in the vascular endothelium of the mouse.

[0217] Since the Tie-2 protein level was significantly reduced in protein lysates of all three analysed organs we analysed whether we can detect a reduction in the level of the soluble form of Tie2 in the blood of siRNA.sup.Tie2-lipoplex treated animals. The Tie2 protein acts as a receptor tyrosine kinase exclusively in endothelial cells in concert with its ligands, the angiopoietins, thus contributing to vessel remodelling and integrity (Davis et al., 1996; Thurston, 2003). The soluble form of Tie2, s-Tie2, is a product of proteolytic cleavage of the receptor's extracellular domain which can be easily detected in the blood by ELISA assays. We monitored changes in s-Tie2 in the serum before and after siRNA-lipoplex treatment using an s-Tie2 ELISA as readout. All four groups of mice tested showed similar levels in s-Tie2 before treatment (day 0; FIG. 5C, left diagram). Mice treated with siRNA.sup.Tie2-lipoplex exhibited a significant reduction in s-Tie2 levels when compared to treated mice from control cohorts (sucrose, siRNA.sup.PTEN, siRNA.sup.CD31) on day 5 of the treatment schedule (day 5; FIG. 5C, right diagram). This result implies that systemic siRNA.sup.Tie2-lipoplex treatment affects overall Tie2 gene expression in vivo, presumably by suppressing Tie2 protein expression in the body's vasculature endothelium. In conclusion, AtuFECT01-based siRNA-lipoplexes are targeted to the vascular endothelium of many tissues after i.v. administration. Repeated administration of siRNA-lipoplexes resulted in RNA as well as protein knockdown of endothelial gene expression in a target specific manner in tissues such as lung, heart, and liver.

EXAMPLE 6: METHOD FOR THE PREPARATION OF siRNA LIPOPLEXES

siRNA Lipoplexes Having a Mean Particle Size of about 120 nm

[0218] Solutions of the lipids forming the lipoplexes of the present application in chloroform (c=20 mg/ml) were dispensed into a 100 ml round bottom flask so that in the mixture a ratio of cationic lipid β-(L-arginyl)-2,3-L-diaminopropionic acid-N-palmityl-N-oleyl-amide tri-hydrochloride (AtuFECT01): helper lipid 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhyPE): PEG lipid N-(Carbonyl-methoxypolyethyleneglycol-2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt (DSPE-PEG) of 50 mol %:49 mol %:1 mol % is resulting. Subsequently, the solvent is removed under vacuum and the resulting lipid film is dried under high vacuum for 4 hours. To the dried lipids, a 270 mM sterile sucrose solution is added, resulting in a concentration of 4.335 mg/ml total lipid. By short sonification in an ultrasound bath for 5 minutes, the lipids are dispersed and subsequently homogenised by high pressure homogenisation (Avestin C3). Such homogenisation of the liposomes is performed by subjecting them to 21 cycles at 750 bar and 52 cycles at 1250 bar. The thus obtained liposomes have a mean particle size of about 85 nm as depicted in FIG. 6 and as determined by QELS (Beckman-Coulter N5 and Malvern Zetasizer NS).

[0219] These liposomes are subject to a further treatment under aseptic conditions. For such purpose, they are mixed with the same volume of an siRNA solution in 270 mM sucrose (c=0.5625 mg/ml). The siRNA solution is added to the liposomes under agitation at 1500 rpm by means of a syringe. This results in the formation of lipoplexes having a mean particle size of about 120 nm.

[0220] The size distribution of the thus obtained lipoplexes is illustrated in FIG. 7. The particle size was determined by QELS (Beckman-Coulter N5 and Malvern Zetasizer NS).

siRNA Lipoplexes Having a Mean Particle Size of about 60 nm

[0221] 1 ml of a solution containing the lipids as specified above in connection with the preparation of siRNA lipoplexes having a mean particle size of about 120 nm (c=86.5 mg/ml overall lipid in the above ratio of 50:49:1) in 30% tert.-butanol is added by means of a syringe under aseptic conditions and agitation at 1500 rpm to 19 ml of a sterile 270 mM sucrose solution within one minute. By doing so, liposomes having a mean particle size of about 30 nm may be obtained. FIG. 8 shows the respective size distribution. The particle size was determined by QELS (Beckman-Coulter N5 and Malvern Zetasizer NS).

[0222] The liposome solution thus obtained is aliquoted into 1.6 ml portions in 5 ml-Lyo-Vials which are subsequently shock frozen to −80° C. and then lyophilised.

[0223] For the preparation of lipoplexes, 3.2 ml of a solution of 0.28 mg/ml siRNA in 135 mM sterile sucrose solution are injected into the Vial containing the lyphilised liposomes which are also referred to as the lyophilisate. The Vial containing the lyophilisate and the solution is subsequently shaken until complete dissolution of the cake formed by the lyophilisate. The thus obtained lipoplexes have a mean particle size of about 60 nm as depicted in FIG. 9. The particle size was determined by QELS (Beckman-Coulter N5 and Malvern Zetasizer NS).

REFERENCES

[0224] To the extent it is referred herein to various documents of the prior art, such documents the complete bibliographic data of which read as follows, are incorporated herein in their entirety by reference. [0225] Alexopoulou, L., Holt, A. C., Medzhitov, R. and Flavell, R. A. (2001) Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3. Nature, 413, 732-738. [0226] Allen, T. M., Hansen, C. B. and de Menezes, D. E. L. (1995) Pharmacokinetics of long-circulating liposomes. Advanced Drug Delivery Reviews, 16, 267-284. [0227] Barron, L. G., Uyechi, L. S. and Szoka, F. C., Jr. (1999) Cationic lipids are essential for gene delivery mediated by intravenous administration of lipoplexes. Gene Ther, 6, 1179-1183. [0228] Braasch, D. A., Paroo, Z., Constantinescu, A., Ren, G., Oz, O. K., Mason, R. P. and Corey, D. R. (2004) Biodistribution of phosphodiester and phosphorothioate siRNA. Bioorg Med Chem Lett, 14, 1139-1143. [0229] Chae, S. S., Paik, J. H., Furneaux, H. and Hla, T. (2004) Requirement for sphingosine 1-phosphate receptor-1 in tumor angiogenesis demonstrated by in vivo RNA interference. J Clin Invest, 114, 1082-1089. [0230] Chien, P. Y., Wang, J., Carbonaro, D., Lei, S., Miller, B., Sheikh, S., Ali, S. M., Ahmad, M. U. and Ahmad, I. (2005) Novel cationic cardiolipin analogue-based liposome for efficient DNA and small interfering RNA delivery in vitro and in vivo. Cancer Gene Ther, 12, 321-328. [0231] Chiu, Y. L. and Rana, T. M. (2002) RNAi in human cells: basic structural and functional features of small interfering RNA. Mol Cell, 10, 549-561. [0232] Chiu, Y. L. and Rana, T. M. (2003) siRNA function in RNAi: a chemical modification analysis. Rna, 9, 1034-1048. [0233] Czauderna, F., Fechtner, M., Dames, S., Aygun, H., Klippel, A., Pronk, G. J., Giese, K. and Kaufmann, J. (2003) Structural variations and stabilising modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res, 31, 2705-2716. [0234] Davis, S., Aldrich, T. H., Jones, P. F., Acheson, A., Compton, D. L., Jain, V., Ryan, T. E., Bruno, J., Radziejewski, C., Maisonpierre, P. C. and Yancopoulos, G. D. (1996) Isolation of angiopoietin-1, a ligand for the TIE2 receptor, by secretion-trap expression cloning. Cell, 87, 1161-1169. [0235] Felgner, P. L., Gadek, T. R., Holm, M., Roman, R., Chan, H. W., Wenz, M., Northrop, J. P., Ringold, G. M. and Danielsen, M. (1987) Lipofection: a highly efficient, lipid-mediated DNA-transfection procedure. Proc Natl Acad Sci USA, 84, 7413-7417. [0236] Hu-Lieskovan, S., Heidel, J. D., Bartlett, D. W., Davis, M. E. and Triche, T. J. (2005) Sequence-Specific Knockdown of EWS-FLI1 by Targeted, Nonviral Delivery of Small Interfering RNA Inhibits Tumor Growth in a Murine Model of Metastatic Ewing's Sarcoma. Cancer Res, 65, 8984-8992. [0237] Klippel, A., Escobedo, J. A., Hirano, M. and Williams, L. T. (1994) The interaction of small domains between the subunits of phosphatidylinositol 3-kinase determines enzyme activity. Mol Cell Biol, 14, 2675-2685. [0238] Klippel, A., Escobedo, M. A., Wachowicz, M. S., Apell, G., Brown, T. W., Giedlin, M. A., Kavanaugh, W. M. and Williams, L. T. (1998) Activation of phosphatidylinositol 3-kinase is sufficient for cell cycle entry and promotes cellular changes characteristic of oncogenic transformation. Mol Cell Biol, 18, 5699-5711. [0239] Landen, C. N., Jr., Chavez-Reyes, A., Bucana, C., Schmandt, R., Deavers, M. T., Lopez-Berestein, G. and Sood, A. K. (2005) Therapeutic EphA2 gene targeting in vivo using neutral liposomal small interfering RNA delivery. Cancer Res, 65, 6910-6918. [0240] Leenders, F., Mopert, K., Schmiedeknecht, A., Santel, A., Czauderna, F., Aleku, M., Penschuck, S., Dames, S., Sternberger, M., Rohl, T., Wellmann, A., Arnold, W., Giese, K., Kaufmann, J. and Klippel, A. (2004) PKN3 is required for malignant prostate cell growth downstream of activated PI 3-kinase. Embo J, 23, 3303-3313. [0241] Liu, L., Zhou, X., Shi, J., Xie, X. and Yuan, Z. (2003) Toll-like receptor-9 induced by physical trauma mediates release of cytokines following exposure to CpG motif in mouse skin. Immunology, 110, 341-347. [0242] Liu, T. G., Yin, J. Q., Shang, B. Y., Min, Z., He, H. W., Jiang, J. M., Chen, F., Zhen, Y. S. and Shao, R. G. (2004) Silencing of hdm2 oncogene by siRNA inhibits p53-dependent human breast cancer. Cancer Gene Ther, 11, 748-756. [0243] Morrissey, D. V., Lockridge, J. A., Shaw, L., Blanchard, K., Jensen, K., Breen, W., Hartsough, K., Machemer, L., Radka, S., Jadhav, V., Vaish, N., Zinnen, S., Vargeese, C., Bowman, K., Shaffer, C. S., Jeffs, L. B., Judge, A., MacLachlan, I. and Polisky, B. (2005) Potent and persistent in vivo anti-HBV activity of chemically modified siRNAs. Nat Biotechnol, 23, 1002-1007. [0244] Muratovska, A. and Eccles, M. R. (2004) Conjugate for efficient delivery of short interfering RNA (siRNA) into mammalian cells. FEBS Lett, 558, 63-68. [0245] Nogawa, M., Yuasa, T., Kimura, S., Tanaka, M., Kuroda, J., Sato, K., Yokota, A., Segawa, H., Toda, [0246] Y., Kageyama, S., Yoshiki, T., Okada, Y. and Maekawa, T. (2005) Intravesical administration of small interfering RNA targeting PLK-1 successfully prevents the growth of bladder cancer. J Clin Invest, 115, 978-985. [0247] Richard, J. P., Melikov, K., Vives, E., Ramos, C., Verbeure, B., Gait, M. J., Chernomordik, L. V. and Lebleu, B. (2003) Cell-penetrating peptides. A reevaluation of the mechanism of cellular uptake. J Biol Chem, 278, 585-590. [0248] Schiffelers, R. M., Ansari, A., Xu, J., Zhou, Q., Tang, Q., Storm, G., Molema, G., Lu, P. Y., Scaria, P. V. and Woodle, M. C. (2004) Cancer siRNA therapy by tumor selective delivery with ligand-targeted sterically stabilized nanoparticle. Nucleic Acids Res, 32, e149. [0249] Shadidi, M. and Sioud, M. (2003) Identification of novel carrier peptides for the specific delivery of therapeutics into cancer cells. Faseb J, 17, 256-258. [0250] Song, E., Zhu, P., Lee, S. K., Chowdhury, D., Kussman, S., Dykxhoorn, D. M., Feng, Y., Palliser, D., Weiner, D. B., Shankar, P., Marasco, W. A. and Lieberman, J. (2005) Antibody mediated in vivo delivery of small interfering RNAs via cell-surface receptors. Nat Biotechnol, 23, 709-717. [0251] Soutschek, J., Akinc, A., Bramlage, B., Charisse, K., Constien, R., Donoghue, M., Elbashir, S., Geick, A., Hadwiger, P., Harborth, J., John, M., Kesavan, V., Lavine, G., Pandey, R. K., Racie, T., Rajeev, K. G., Rohl, I., Toudjarska, I., Wang, G., Wuschko, S., Bumcrot, D., Koteliansky, V., Limmer, S., Manoharan, M. and Vornlocher, H. P. (2004) Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs. Nature, 432, 173-178. [0252] Takeshita, F., Minakuchi, Y., Nagahara, S., Honma, K., Sasaki, H., Hirai, K., Teratani, T., Namatame, [0253] N., Yamamoto, Y., Hanai, K., Kato, T., Sano, A. and Ochiya, T. (2005) Efficient delivery of small interfering RNA to bone-metastatic tumors by using atelocollagen in vivo. Proc Natl Acad Sci USA, 102, 12177-12182. [0254] Thurston, G. (2003) Role of Angiopoietins and Tie receptor tyrosine kinases in angiogenesis and lymphangiogenesis. Cell Tissue Res, 314, 61-68. [0255] Turner, J. J., Arzumanov, A. A. and Gait, M. J. (2005) Synthesis, cellular uptake and HIV-1 Tat-dependent trans-activation inhibition activity of oligonucleotide analogues disulphide-conjugated to cell-penetrating peptides. Nucleic Acids Res, 33, 27-42. [0256] Uprichard, S. L. (2005) The therapeutic potential of RNA interference. FEBS Lett, 579, 5996-6007. [0257] Urban-Klein, B., Werth, S., Abuharbeid, S., Czubayko, F. and Aigner, A. (2005) RNAi-mediated gene-targeting through systemic application of polyethylenimine (PEI)-complexed siRNA in vivo. Gene Ther, 12, 461-466. [0258] Yano, J., Hirabayashi, K., Nakagawa, S., Yamaguchi, T., Nogawa, M., Kashimori, I., Naito, H., Kitagawa, H., Ishiyama, K., Ohgi, T. and Irimura, T. (2004) Antitumor activity of small interfering RNA/cationic liposome complex in mouse models of cancer. Clin Cancer Res, 10, 7721-7726. [0259] Zelphati, O. and Szoka, F. C., Jr. (1996) Mechanism of oligonucleotide release from cationic liposomes. Proc Natl Acad Sci USA, 93, 11493-11498.

[0260] The features of the present invention disclosed in the specification, the claims and/or the drawings may both separately and in any combination thereof be material for realizing the invention in various forms thereof.