TURKEY HERPESVIRUS VECTORED RECOMBINANT CONTAINING AVIAN INFLUENZA GENES

Abstract

The present invention provides a recombinant turkey herpesvirus modified by the presence of the cDNA encoding the hemagglutinin protein of avian influenza virus under a promoter. A poultry vaccine comprising the recombinant turkey herpesvirus described in the present invention can induce serological responses that may be easily detected by the hemagglutination inhibition assay but not by commercially available diagnostic ELISA kits; thus enabling easy differentiation between vaccination and field infection.

Claims

1. A recombinant turkey herpesvirus comprising a hemagglutinin gene of avian influenza virus and the cytomegalovirus immediate early promoter, wherein said hemagglutinin gene is under control of said promoter.

2. The recombinant turkey herpesvirus as in claim 1, wherein said hemagglutinin gene and said promoter are present in a non-essential region of the turkey herpesvirus genome.

3. The recombinant turkey herpesvirus as in claim 2, wherein said non-essential region is between UL45 and UL46 of the turkey herpesvirus genome.

4-6. (canceled)

7. A poultry vaccine comprising the recombinant turkey herpesvirus as in claim 1.

8-10. (canceled)

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0025] FIG. 1 Construction of the plasmid pGICMVpA

[0026] FIG. 2 Construction of the homology plasmid p45CMVH5Wis68

[0027] FIG. 3 Construction of the plasmid pGlBacpA2nd

[0028] FIG. 4 Construction of the homology plasmid p45BacH5Wis68

[0029] FIG. 5 Construction of the homology plasmid p45PecH5Wis68

[0030] FIG. 6 Western blot assay detecting expression of the hemagglutinin protein by the recombinant turkey herpesvirus

[0031] FIG. 7 Hemagglutination inhibition titers in chickens vaccinated with the recombinant turkey herpesvirus with hemagglutinin gene

[0032] FIG. 8 ELISA titers in chickens vaccinated with the recombinant turkey herpesvirus with hemagglutinin gene using a commercial ELISA kit (IDEXX LABORATORIES, FLOCKCHEK AIV)

[0033] FIG. 9 ELISA titers in chickens vaccinated with the recombinant turkey herpesvirus with hemagglutinin gene using a commercial ELISA kit (SYNBIOTICS, PROFLOK AIV Ab test kit)

[0034] FIG. 10 Hemagglutination inhibition titers in chickens vaccinated with the recombinant turkey herpesvirus with hemagglutinin gene (second trial)

DETAILED DESCRIPTION OF THE INVENTION

[0035] Gene cloning and plasmid construction was essentially performed by the standard molecular biology techniques (Molecular Cloning: A Laboratory Manual. 3rd Edition, Cold Spring Harbor Laboratory Press, Woodbury, N.Y. 2001). The turkey herpesvirus FC126 strain (R. L. Witter et al., 1970, Am. J. Vet. Res. 31, 525-538) was used as a backbone virus to generate a recombinant turkey herpesvirus.

Example 1

Hemagglutinin Gene Isolation from Avian Influenza Virus H5 Subtype

[0036] The avian influenza virus A/Turkey/Wisconsin/68 (H5N9) strain was propagated in the allantoic sac of specific pathogen free embryonating chicken eggs. Total genomic RNA from the A/Turkey/Wisconsin/68 virus was extracted using RNEASY MINI KIT (QIAGEN, Cat#74104). First-strand cDNA was synthesized with SUPERSCRIPT FIRST-STRAND System for RT-PCR (Invitrogen, Cat#11904-018). Using the resulting cDNA as a template, the HA gene was amplified by polymerase chain reaction (PCR) with PFUULTRA HIGH FIDELITY DNA Polymerase (STRATAGENE, Cat#600380) and PCR primers. These PCR primers, BamHA-F primer (SEQ ID NO: 4) and SalHA-R primer (SEQ ID NO: 5), anneal to the start and stop sequences of the HA gene and each primer contains a sequence at the 5′ ends for a restriction enzyme, BamHI or SalI, respectively. After the PCR reaction, Taq polymerase (PROMEGA, Cat# M2665) was added to the PCR mixture to add 3′ A-overhangs to the PCR products.

TABLE-US-00001 (SEQ ID NO: 4) BamHA-F primer 5'-TGACGGATCCATGGAAAGAATAGTGATTG-3' (SEQ ID NO: 5) SalHA-R primer 5'-CTGACAGTCGACCTAGATGCAAATTCTGC-3'

[0037] The amplified 1.8 kilobase (kb) HA cDNA was inserted into PCR2.1-TOPO vector (INVITROGEN, Cat# K4500-01), resulting in pCR2.1-H5Wis68. Nucleotide sequences of the HA genes in a few clones of the plasmid pCR2.1-H5Wis68 and the PCR product were determined using ABI PRISM 3730XL DNA Analyzer (APPLIED BIOSYSTEMS) with six primers; BamHA-F primer (SEQ ID NO: 4), Sa1HA-R primer (SEQ ID NO: 5), M13 Forward primer (SEQ ID NO: 6), M13 Reverse primer (SEQ ID NO: 7), HA-F primer (SEQ ID NO: 8), and HA-R primer (SEQ ID NO: 9).

TABLE-US-00002 (SEQ ID NO: 6) M13 Forward primer 5'-GTAAAACGACGGCCAGT-3' (SEQ ID NO: 7) M13 Reverse primer 5'-GGAAACAGCTATGACCATG-3' (SEQ ID NO: 8) HA-F primer 5'-CTGGACAATACTAAGGCCGAACGAT-3' (SEQ ID NO: 9) HA-R primer 5'-CACTGGGGTCTGACATTTGGTA-3'

[0038] The sequences in the clones of the plasmid pCR2.1-H5Wis68 were identical to each other and to the sequence of the PCR product. Although the deduced amino acid sequence was different from the reported sequence of A/Turkey/Wisconsin/68 (H5N9) (M. Garcia et al., 1997, Virus Res. 51: 115-124, GenBank Accession# U79456) by four amino acids, the amino acids we obtained were the same as the amino acids of a majority of H5 subtype HA proteins. The nucleotide sequence and the deduced amino acid sequence of the HA gene obtained from A/Turkey/Wisconsin/68 (H5N9) are shown in SEQ ID NO: 1 and SEQ ID NO: 2.

Example 2

Construction of Homology Plasmids 2-1. A Summary of Homology Plasmids and Recombinant Turkey Herpesviruses

[0039] In the present invention, three promoters, the CMV promoter, the chicken beta-actin promoter (Bac promoter), and a modified chicken beta-actin promoter (Pec promoter), were used to control expression of the HA gene of the AI virus A/Turkey/Wisconsin/68 (H5N9) strain. First, homology plasmids with the HA gene and one of the promoters were constructed and then recombinant turkey herpesviruses were generated using the homology plasmids. The recombinant turkey herpesviruses with different promoters were compared for capabilities of conferring serological titers against AI in chickens as shown in EXAMPLE 6. A recombinant HVT with the CMV promoter is presented here as an example and recombinant viruses with the Bac promoter or the Pec promoter are presented here as comparative examples. A list of the homology plasmids and the recombinant turkey herpesviruses constructed in the present invention is shown in TABLE 1.

TABLE-US-00003 TABLE 1 A list of homology plasmids and recombinant turkey herpesviruses Name of Name of Examples vs. Item homology recombinant comparative # plasmids viruses Promoters examples 1 p45CMVH5Wis68 rHVT/ CMV Example CMVH5Wis68 promoter 2 p45BacH5Wis68 rHVT/ Bac Comparative BacH5Wis68 promoter example 3 p45PecH5Wis68 rHVT/ Pec Comparative PecH5Wis68 promoter example
2-2. Construction of Plasmid pGICMVpA

[0040] The CMV promoter was obtained from pBK-CMV (STRATAGENE, Cat. #212209). Three BglI restriction enzyme sites in the CMV promoter were disrupted for ease of the plasmid construction process by PCR in vitro mutagenesis using four pairs of primers. The primer pairs were PrCMV1 (SEQ ID NO: 10) and PrCMV3 (SEQ ID NO: 12), PrCMV4 (SEQ ID NO: 13) and PrCMV5 (SEQ ID NO: 14), PrCMV6 (SEQ ID NO: 15) and PrCMV2′ (SEQ ID NO: 11), and PrCMVo1 (SEQ ID NO: 16) and PrCMVR1 (SEQ ID NO: 17). Four PCR reactions were conducted separately using each pair of primers and pBK-CMV as a template. Then four PCR products were combined and used as a template for the secondary PCR with primers PrCMV1 and PrCMVR1, yielding the 604 by fragment with a modified CMV promoter sequence. The nucleotide sequence of the CMV promoter used to express HA gene is provided in SEQ ID. NO. 3. The CMV promoter fragment was digested with PstI and XbaI and inserted into PstI and XbaI digested pUC18polyASfi (U.S. Pat. No. 6,866,852), resulting in pGICMV(−). The SV40 polyA signal was obtained from pBK-CMV by PCR using primers PolyA-SalKpn (SEQ ID NO: 18) and PolyA-SfiF2 (SEQ ID NO: 19). The PCR fragment containing SV40 polyA signal was digested with SalI and SfiI and ligated to pGICMV(−) digested with SalI and SfiI resulting in pGICMVpA (FIG. 1).

TABLE-US-00004 (SEQ ID NO: 10) PrCMV1 5'-GGGCTGCAGAGTTATTAATAGTAATCAATT-3' (SEQ ID NO: 11) PrCMV2' 5'-CGCGCCATTTACCGTCATTGACGTC-3' (SEQ ID NO: 12) PrCMV3 5'-GGGTCGTTGGGCGGTCAGCCGGCGG-3' (SEQ ID NO: 13) PrCMV4 5'-CTTACGGTAAATGGCCCGCCGGCTG-3' (SEQ ID NO: 14) PrCMV5 5'-TACACTTGATGTACTGCCAATGGGC-3' (SEQ ID NO: 15) PrCMV6 5'-TATTTACGGTAAACTGCCCATTGGC-3' (SEQ ID NO: 16) PrCMVo1 5'-ACGTCAATGACGGTAAATGGCGCGCCTGGC-3' (SEQ ID NO: 17) PrCMVR1 5'-CGTCTAGAGGATCTGACGGTTCACTAAACC-3' (SEQ ID NO: 18) PolyA-SalKpn 5'-TGTGGTACCGTCGACGATTCACAGTCCCAAGG C-3' (SEQ ID NO: 19) PolyA-SfiF2 5'- CTTGGCCTTATTGGCCTAAGATACATTGATGA G-3'
2-3. Construction of Homology Plasmid p45CMVH5Wis68

[0041] The CMV promoter and the SV40 polyA signal (940 bp) were excised from pGICMVpA by BglI and ligated into SfiI digested p45/46Sfi (U.S. Pat. No. 6,866,852), resulting in p45/46CMVpA. Then, the HA gene from A/Turkey/Wisconsin/68 (H5N9) was excised from pCR2.1-H5Wis68 using SalI and BamHI. The 1701 by HA gene was inserted into p45/46CMVpA digested with SalI and BamHI, resulting in p45CMVH5Wis68 (FIG. 2). The plasmid p45CMVH5Wis68 was used as a homology plasmid to generate recombinant turkey herpesvirus.

2-4. Construction of Plasmid pGlBacpA2nd

[0042] The Bac promoter was obtained by PCR using cellular DNA of CEF cells as a template. PrBac1 (SEQ ID NO: 18) and PrBac2′ (SEQ ID NO: 19) were the primer set used for PCR. An obtained 1.5-kilobase DNA fragment was digested with PstI and XbaI and inserted into PstI and XbaI digested pUC18polyASfi, resulting in pGIBac2. Then, the SV40 polyA signal obtained PCR using primers PolyA-SalKpn (SEQ ID NO: 18) and PolyA-SfiF2 (SEQ ID NO: 19) was digested with SalI and SfiI and ligated to pGIBac2 digested with SalI and SfiI resulting in pGlBacpA2nd (FIG. 3).

TABLE-US-00005 PrBac1 (SEQ ID NO: 20) 5'-CAGTGTCGCTGCAGCTCAGTGCATGCACGCTCATTGCCC-3' PrBac2' (SEQ ID NO: 21) 5'-GCTCTAGAGGCGTGGAGCTTGGGGGCTGCGGAGGAACAGAGAAGGG AAG-3'
2-5. Construction of Homology Plasmid p45BacH5Wis68

[0043] The Bac promoter and the SV40 polyA signal (1866 bp) were excised from pGlBacpA2nd by BglI and ligated into SfiI digested p45/46Sfi, resulting in p45/46BacpA2nd. Then, the HA gene of A/Turkey/Wisconsin/68 (H5N9) excised from pCR2.1-H5Wis68 using SalI and BamHI was inserted into p45/46BacpA2nd digested with SalI and BamHI, resulting in p45BacH5Wis68 (FIG. 4).

2-6. Construction of Homology Plasmid p45PecH5Wis68

[0044] Construction of the Pec promoter is described in U.S. Pat. No. 6,866,852. The Pec promoter was synthesized by fusing a part of the chicken beta-actin promoter with the enhancer region of the CMV promoter. The Pec promoter was excise from pGIPec (U.S. Pat. No. 6,866,852) with PstI and BamHI and inserted into PstI and BamHI digested p45/46BacpA2nd described in EXAMPLE 2-4, resulting in p45/46PecpA2nd. Then, the HA gene of A/Turkey/Wisconsin/68 (H5N9) excised from pCR2.1-H5Wis68 using SalI and BamHI was inserted into p45/46PecpA2nd digested with SalI and BamHI, resulting in p45PecH5Wis68 (FIG. 5).

Example 3

Generation and Isolation of Recombinant Turkey Herpesvirus

[0045] Viral DNA of the HVT FC126 strain was prepared as described by Morgan et al. (Avian Diseases, 1990, 34:345-351).

[0046] 10.sup.7 secondary chicken embryo fibroblast (CEF) cells were suspended in Saline G (0.14 M NaCl, 0.5 mM KCl, 1.1 mM Na.sub.2HPO.sub.4, 1.5 mM NaH.sub.2PO.sub.4, 0.5 mM MgCl.sub.2, and 0.011% glucose) and co-transfected with HVT viral DNA and 5 to 25 μg of the homology plasmid, p45CMVH5Wis68, p45BacH5Wis68, or p45PecH5Wis68 by electroporation. Electroporation was performed using BIO-RAD GENE PULSER. Transfected cells were incubated for 10 minutes at room temperature and transferred to wells of 96-well plates. After incubating at 37′C for 7 days in 4-5% CO.sub.2, or until the plaques became visible, the cells were detached from the plates by trypsinization, transferred equally to two 96-well plates with secondary CEF and incubated for 3 to 4 days until plaques were observed. Screening was conducted by the black plaque assay, staining only plaques expressing HA protein. Briefly, one of the two plates was fixed with methanol: acetone mixture (1:2) and incubated with chicken anti-HA antiserum. Next, incubated with biotinylated anti-chicken IgG antibody (VECTOR LABORATORIES, Cat# BA-9010) and then with VECTASTAIN ABC-AP kit (Vector Laboratories, Cat# AK-5000), plaques expressing HA protein were stained by addition of BCIP/NBT solution (BIO-RAD LABORATORIES, Cat#170-6539 and 170-6532). Wells containing stained recombinant plaques were identified and cells from the corresponding wells on the other 96-well plate were trypsinized. The cells were then diluted in fresh secondary CEF cells and transferred to 96-well plates to complete the first round of purification.

[0047] The purification procedure was repeated until all plaques were stained positively in the black plaque assay. Purified recombinant virus with the HA gene under the CMV promoter was designated as rHVT/CMVH5Wis68 (the present invention). Recombinant viruses with the Bac promoter or the Pec promoter were designated as rHVT/BacH5Wis68 and rHVT/PecH5Wis68, respectively (comparative examples).

Example 4

[0048] Verification of Genome Structure and Stability of Recombinant HVT

4-1. Southern Blot Analysis

[0049] Chicken embryo fibroblast cells in a 100-mm dish that were infected with the recombinant virus, rHVT/CMVH5Wis68 or the HVT FC126 parent strain were used in the Southern blot analysis to confirm the insertion of the HA gene in the desired insertion site. The cells were collected by a cell scraper and by centrifugation at 913×g for 5 minutes. The harvested cells were washed with phosphate buffered saline (PBS) and resuspended in 1.0 milliliter (ml) of lysis buffer (0.5% TRITON X-100, 100 mM 2-mercaptethanol, and 20 mM EDTA in PBS). The cell suspension was vortexed for a total of 30 seconds and incubated for 15 minutes at room temperature. Cell nucleus and cell debris were removed by centrifuging at 2,060×g for 5 minutes and the supernatant was transferred to a 1.5-ml tube. Viruses were collected by centrifugation at 20,800×g for 20 minutes at 4° C. The pellet was suspended in 0.33 ml of a nuclease solution (12.5 mM Tris-Cl (pH7.5), 1 μg/ml DNase I and 1 μg/ml RNase A) and incubated at 37° C. for 30 minutes. Then, 83 μl of SDS-protease solution (50 mM EDTA, 5% SDS, 0.5 mg/ml protease K, and 25 mM 2-mercaptoethanol) was added to the virus suspension and incubated at 55° C. for 30 minutes to disrupt virus envelopes. Phenol chloroform extraction was conducted twice and DNA was precipitated by adding 2.5 volume of cold 100% ethanol and NaCl at a final concentration of 0.16 M. After centrifuging at 20,800×g for 30 mininutes at 4° C., the pellet was washed with 70% ethanol and air-dried. The pellet was dissolved in TE buffer (10 mM Tris-Cl (pH8.0), and 1 mM EDTA).

[0050] The viral DNA in TE buffer and the homology plasmid (positive control) were digested with XhoI, BamHI and SpeI and separated by agarose gel electrophoresis using 0.6% agarose gel. DNA fragments on the gel were transferred to a BIODYNE A nylon membrane (PALL, Cat# BNXF3R). The membrane was hybridized with either Digoxigenin (DIG)-labeled HA probe or DIG-labeled IS45/46 probe. The DIG-labeled HA probe and the IS45/46 probe were prepared with PCR DIG Probe Synthesis Kit (ROCHE APPLIED SCIENCE, Cat#11636090910) using primers HAI-P-F (SEQ ID NO: 22) and HAI-P-R (SEQ ID NO: 23) and primers 45/46-F (SEQ ID NO: 24) and 45/46-R (SEQ ID NO: 25), respectively.

TABLE-US-00006 HA1-P-F (SEQ ID NO: 22) 5'-GGGGGTGGCAAGGAATG-3' HA1-P-R (SEQ ID NO: 23) 5'-GCTAGGGAACTCGCCACTGT-3' 45/46-F-B (SEQ ID NO: 24) 5'-TAGCGGCACGGAAACAGATAGAGA-3' 45/46-R-B (SEQ ID NO: 25) 5'-TGGCGATACGGTTCCTGGTTTGAC-3'

[0051] The membrane was washed with 2×SSC solution at room temperature and then with 0.5×SSC solution at 68° C. The membrane was blocked and incubated with anti-Digoxigenin-AP, Fab fragments (ROCHE APPLIED SCIENCE, Cat#11093274910) for 30 minutes at room temperature. After washing two times with maleic acid washing buffer (0.1 M maleic acid, 0.15 M NaCl, and 0.3% Tween20, pH 7.5), DNA bands that were hybridized with the probes were visualized by incubating the membrane with BCIP/NBT solution. The HA probe hybridized with 3.6 kb bands in the recombinant virus DNA and the homology plasmid, while no bands were detected with the HVT parent. The IS45/46 probe hybridized with 3.6 kb and 1.2 kb bands in the recombinant DNA and the homology plasmid, and with 2.3 kb band in the HVT parent. These results demonstrated that rHVT/CMVH5Wis68 obtained in EXAMPLE 3 had an expected genomic structure.

[0052] Southern blot analysis of rHVT/BacH5Wis68 and rHVT/PecH5Wis68 was conducted in a similar way as that of rHVT/CMVH5Wis68, except that XhoI and SpeI restriction enzymes were used for rHVT/BacH5Wis68. For rHVT/BacH5Wis68, the HA probe hybridized with 4.9 kb bands in the recombinant virus DNA and the homology plasmid, while no bands were detected with the HVT parent. The IS45/46 probe hybridized with 4.9 kb and 0.8 kb bands in the recombinant DNA and the homology plasmid, and with 2.3 kb band in the HVT parent. For rHVT/PecH5Wis68, the HA probe hybridized with 3.6 kb bands in the recombinant virus DNA and the homology plasmid, while no bands were detected with the HVT parent. The IS45/46 probe hybridized with 3.6 kb and 1.2 kb bands in the recombinant DNA and the homology plasmid, and with 2.3 kb band in the HVT parent. These recombinant viruses were also demonstrated to have expected genomic structures.

4.2. Stability of Recombinant HVT

[0053] The recombinant viruses, rHVT/CMVH5Wis68, rHVT/BacH5Wis68, and rHVT/PecH5Wis68, were passed 20 times blindly in CEF cells. After the 20 passages, the viruses were analyzed by the Southern blot analysis as described in EXAMPLE 4.1. Bands detected in DNA isolated from the virus after 20 passages were identical to the bands described in EXAMPLE 4.1, demonstrating that the recombinant viruses were stable even after 20 passages.

Example 5

HA Protein Expression by Recombinant HVT

[0054] Expression of the HA protein by the recombinant viruses, rHVT/CMVH5Wis68, rHVT/BacH5Wis68, and rHVT/PecH5Wis68, was confirmed by the black plaque assay and the Western blot assay. Procedures for the black plaque assay are described in EXAMPLE 3. The western blot was conducted using CEF cells infected with the recombinant viruses and chicken anti-HA antiserum. Briefly, CEF cells in 100-mm dishes were infected with one of the recombinant viruses or the parent HVT FC126 strain at a multiplicity of infection of approximately 0.01. Two to three days post inoculation, cells were harvested with cell scrapers and centrifuged at 913×g for 5 minutes. The pellet was washed with PBS twice and resuspended with 50 to 100 ml of PBS. After adding the same volume of 2×SDS sample buffer (130 mM Tris-Cl (pH6.8), 6% SDS, 20% Glycerol, 10% 2-Mercaptoethanol and 0.01% Bromo Phenol Blue), cell suspension was boiled for 5 minutes. The samples were separated by SDS-PAGE using 8% polyacrylamide gel and transferred to a PVDF membrane (IMMOBILON-P, MILLIPORE). The membrane was dried completely and then incubated with chicken anti-HA antiserum. After the anti-HA antiserum was washed off, the membrane was incubated with alkaline phosphatase-conjugated anti-chicken IgG Fc antibody (BETHYL, Cat# A30-104AP). Protein bound with chicken anti-HA antiserum was visualized by adding BCIP/NBT solution. As shown in FIG. 3, a protein band of 74 kilodaltons (kDa) was observed only in the lane with the recombinant virus infected cells, which was the expected size of the non-processed HA protein.

Example 6

Serological Evaluation of Chickens Inoculated with Recombinant HVT

[0055] Serological responses against AI in chickens that were vaccinated with the recombinant viruses, rHVT/CMVH5Wis68, rHVT/PecH5Wis68, and rHVT/BacH5Wis68, were evaluated. One-day-old specific pathogen free chicks (SPAFAS, Flock T-10) were vaccinated subcutaneously with one of the recombinant viruses. Groups 1 and 2 were inoculated with 1638 pfu per dose (0.2 ml) and 375 pfu per dose of rHVT/CMVH5Wis68, respectively (TABLE 2). Groups 3 and 4 contained chickens vaccinated with 2800 pfu (Group 3) or 550 pfu (Group4) of rHVT/PecH5Wis68. Groups 5 and 6 were inoculated with 4350 pfu and 720 pfu per dose of rHVT/BacH5Wis68, respectively. A group of chickens (Group 8) were held as non-inoculated negative controls. Another group of chickens (Group 7) was vaccinated subcutaneously with inactivated A/Turkey/Wisconsin/68 (H5N9) vaccine at three weeks old as an inactivated vaccine control. Chickens were bled between 3 to 7 weeks old and obtained sera were evaluated by the AI HI tests and AW ELISA tests. The AI HI tests were conducted using four hemagglutination units of an inactivated avian influenza virus homologous antigen of the A/Turkey/Wisconsin/68 (H5N9) strain, the HA gene of which was used in the recombinant viruses, as described by D. E. Swayne et al (D. E. Swayne et al., 1998, Avian Influenza. In: A Laboratory Manual for the Isolation and Identification of Avian Pathogens, 150-155). Briefly, before the HI assay, the number of the hemagglutination units in the inactivated A/Turkey/Wisconsin/68 (H5N9) antigen was determined as the highest dilution of the antigen giving complete agglutination, and the antigen was diluted to contain four hemagglutination units in 25 μl. In U-bottom 96 well plates, the sera were initially diluted 1:5 and then serially diluted by two fold across the plates with phosphate buffered saline (PBS) to contain 25 μl per well. Four hemagglutination units of the antigen in 25 μl were added to each well and incubated for 30 minutes at room temperature. Finally, 50 μl of 0.5% chicken erythrocytes in PBS was added to each well and incubated for about 40 minutes at room temperature. HI titers are the highest dilution of the sera exhibiting inhibition of hemagglutination. HI titers of equal to or more than 10 were considered positive. The ELISA tests were conducted using two commercial AW ELISA kits (IDEXX Laboratories, FLOCKCHEK AW and SYNBIOTICS, PROFLOK AIV Ab test kit) that are available in the United States.

[0056] As shown in TABLE 3 and FIG. 7, sera from chickens vaccinated with rHVT/CMVH5Wis68 (Groups 1 and 2) started to show HI titers as early as three weeks post vaccination and the HI titers continued to increase up to the HI titer of 100 (geometric mean titer) by six weeks post vaccination. Also, more than 80% of vaccinated chickens at three weeks post vaccination and all vaccinated chickens after five weeks post vaccination had HI titers of equal to or more than 10 (TABLE 3). High levels of HI titers have not been consistently observed with the commercial fowlpox-vectored AW vaccine and this was not easily accomplished. The dose difference between two vaccine groups (1638 pfu and 375 pfu) did not have a significant influence on serological responses. Surprisingly, when tested with the commercial AIV ELISA kits, these sera from rHVT/CMVH5Wis68-vaccinated chickens that were highly positive by the HI tests did not give positive ELISA titers through 3 and 7 weeks post vaccination, whereas sera collected from the inactivated vaccine control (Group 7) showed highly positive ELISA titers with both commercial ELISA kits (FIGS. 8 and 9). This feature of the rHVT/CMVH5Wis68 vaccine would make it extremely easy to differentiate vaccine reactions from field virus exposure and to track vaccinated chickens. Geometric mean HI titers of sera from chickens vaccinated with rHVT/PecH5Wis68 (Groups 3 and 4) or rHVT/BacH5wis68 (Groups 5 and 6) were not as high as those conferred by rHVT/CMVH5Wis68. Also, rHVT/PecH5Wis68 and rHVT/BacH5wis68 failed to confer serological titer by HI to vaccinated chickens consistently as shown in TABLE 3. The non-inoculated negative controls (Group 8) did not show positive serological results in either the HI tests or the ELISA tests throughout the observation period.

[0057] In summary, the recombinant HVT with the HA gene in combination with the CMV promoter (rHVT/CMVH5wis68) provided vaccinated chickens with higher and more uniform serology titers by HI than the recombinant HVT with the Bac promoter (rHVT/BacH5Wis68) and the recombinant HVT with the Pec promoter (rHVT/PecH5Wis68), which are presented here as comparative examples. The sera collected from chickens vaccinated from rHVT/CMVH5Wis68 were negative by commercially available AW ELISA kits although the sera were highly positive by the AI HI tests, thus enabling easy differentiation between reaction from vaccination and field infection.

Example 7

Second Serological Evaluation of Chickens Inoculated with Recombinant HVT

[0058] In order to further investigate the potency of the recombinant HVT with the HA gene, another serological evaluation test was conducted. Specific pathogen free chickens (SPAFAS, Flock R105) were divided into four groups in this study (TABLE 4). Embryos at 18 days of incubation in Group 1 was vaccinated with 980 pfu per dose (0.1 ml) of rHVT/CMVH5Wis68 via the in ovo route. Group 2 and Group 3 were vaccinated subcutaneously at one day old with 695 pfu per dose (0.2 ml) of rHVT/CMVH5Wis68 or 1155 pfu per dose of rHVT/BacH5Wis68, respectively. A group of chickens (Group 4) were held as non-inoculated negative controls. Chickens were bled between 2 to 7 weeks old and obtained sera were evaluated by the AI HI tests and AIV ELISA tests. The AI HI tests were conducted using four HA units of an inactivated A/Turkey/Wisconsin/68 (H5N9) antigen as described by D. E. Swayne et al (D. E. Swayne et al., 1998, Avian Influenza. In: A Laboratory Manual for the Isolation and Identification of Avian Pathogens, 150-155).

[0059] As shown in TABLE 5 and FIG. 10, rHVT/CMVH5Wis68 by subcutaneous administration (Group 2) again showed excellent potency as in the first trial. HI titers in this group reached 100 (geometric mean titer) by three weeks post vaccination and high levels of HI titers were maintained through seven weeks post vaccination. Also, in this study, we found that in ovo administration of rHVT/CMVH5Wis68 (Group 1) is as potent as subcutaneous administration. HI titers in Group 1 were very similar to those in Group 2. Titers from chickens vaccinated with rHVT/BacH5Wis68 (Group 3) were somewhat lower than those from chickens vaccinated with rHVT/CMVH5Wis68 (Groups 1 and 2) again except at 5 weeks post vaccination when Group 3 had a higher HI titers than other groups, but the HI titer dropped at following weeks. No detectable HI titers were observed from non-inoculated negative controls throughout the observation period.

Example 8

Efficacy of Recombinant HVT Against Highly Pathogenic Avian Influenza Virus (H5N1) Challenge

[0060] In the third trial, the efficacy of the recombinant HVT with the HA gene against highly pathogenic avian influenza virus (H5N1 subtype) was examined Specific pathogen free chickens were divided into four groups in this study (TABLE 6). One-day-old chicks in Groups 1 and 2 were vaccinated with 1075 pfu per dose (0.2 ml) of rHVT/CMVH5Wis68 and 1080 pfu per dose of rHVT/BacH5Wis68, respectively. Chicks in Group 3 (unvaccinated, challenged positive control) were inoculated with vaccine diluent and challenged at four weeks old. Group 4 was held as non-vaccinated, non-challenged negative controls.

[0061] At four weeks old, chickens in Groups 1, 2 and 3 were challenged intranasally with 10.sup.5.0 EID.sub.50 (200 LD.sub.50) of highly pathogenic avian influenza virus A/Viet Nam/1203/04 (H5N1) strain. Protection was evaluated by mortality and clinical signs of avian influenza. All chickens in Group 3 (unvaccinated, challenged positive control) died within two days after challenge, confirming severity of the challenge (Table 7). rHVT/CMVH5Wis68 showed excellent protection against lethal highly pathogenic avian influenza challenge, as in Group 1, vaccinated with rHVT/CMVH5Wis68, 95% (19 out of 20 chickens) were protected. On the other hand, only 65% (13 out of 20) of chickens in Group 2 (rHVT/BacH5Wis68) survived the challenge. All chickens in Group 4 (non-vaccinated, non-challenged negative control) were free from mortality and clinical signs of avian influenza. As is consistent with two serological evaluation studies described in EXAMPLE 6 and 7, the recombinant HVT with the HA gene in combination with the CMV promoter (rHVT/CMVH5wis68) provided much better protection against challenge with highly pathogenic avian influenza virus (H5N1) than the recombinant HVT with the Bac promoter (rHVT/BacH5Wis68), which is presented here as a comparative example.

TABLE-US-00007 TABLE 2 Treatment groups Group Age of Vaccine Vaccine # of # Treatment Group Promoters vaccination dose (pfu.sup.1) route chickens 1 rHVT/CMVH5Wis68 CMV (Ex.sup.2) One-day-old 1638 SQ.sup.3 17 2 rHVT/CMVH5Wis68 CMV (Ex) One-day-old 375 SQ 17 3 rHVT/PecH5Wis68 Pec (CE.sup.4) One-day-old 2800 SQ 17 4 rHVT/PecH5Wis68 Pec (CE) One-day-old 550 SQ 17 5 rHVT/BacH5Wis68 Bac (CE) One-day-old 4350 SQ 17 6 rHVT/BacH5Wis68 Bac (CE) One-day-old 720 SQ 17 7 Inactivated H5N9 vaccine N/A.sup.5 3-weeks-old 0.5 ml.sup.6 SQ 17 8 Negative controls N/A N/A None N/A 10 pfu.sup.1 = plaque forming units Ex.sup.2 = example SQ.sup.3 = subcutaneous CE.sup.4 = comparative example N/A.sup.5 = not applicable ml.sup.6 = milliliter

TABLE-US-00008 TABLE 3 HI titers 3 weeks 4 weeks 5 weeks 6 weeks 7 weeks Group Positive.sup.1/ GMT Positive/ GMT Positive/ GMT Positive/ GMT Positive/ GMT # Total titer.sup.2 Total titer Total titer Total titer Total titer 1 16/17 23.5 15/17 47.1 17/17 62.6 17/17 94.2 17/17 70.8 (94%) (88%) (100%) (100%) (100%) 2 14/17 18.4 17/17 47.1 17/17 53.2 16/16 113.1 16/16 118.1 (82%) (100%) (100%) (100%) (100%) 3 15/17 17.7 16/17 24.5 16/17 28.9 17/17 38.4 16/17 47.1 (88%) (94%) (94%) (100%) (94%) 4 14/17 23.5 16/17 28.9 15/17 23.5 13/17 23.2 14/17 28.9 (82%) (94%) (88%) (76%) (82%) 5 16/17 35.4 16/17 32.6 15/17 25.5 14/17 21.4 13/17 28.5 (94%) (94%) (88%) (82%) (76%) 6 11/17 11.0 11/17 11.6 12/17  9.5 10/17 13.9 10/16 10.9 (65%) (65%) (71%) (59%) (63%) 7 N/A.sup.3 N/A N/A N/A N/A N/A 17/17 294.9 17/17 461.9 (100%) (100%) 8 0/10 N/A 0/10 N/A 0/10 N/A 0/10 N/A 0/10 N/A (0%) (0%) (0%) (0%) (0%) Positive.sup.1 = HI titers of equal to or more than 10 were considered positive. GMT titer.sup.2 = Geometric mean titer N/A.sup.3 = not applicable

TABLE-US-00009 TABLE 4 Treatment groups for the second serological evaluation Group Age of Vaccine Vaccine # of # Treatment Group Promoters vaccination dose (pfu.sup.1) route chickens 1 rHVT/CMVH5Wis68 CMV (Ex.sup.2) 18-day old 980 In ovo 18 embryos 2 rHVT/CMVH5Wis68 CMV (Ex) One-day-old 695 SQ.sup.3 10 3 rHVT/BacH5Wis68 Bac (CE.sup.4) One-day-old 1155 SQ 10 4 Negative controls N/A.sup.5 N/A None N/A 10 pfu.sup.1 = plaque forming units Ex.sup.2 = example SQ.sup.3 = subcutaneous CE.sup.4 = comparative example N/A.sup.5 = not applicable

TABLE-US-00010 TABLE 5 HI titers for the second serological evaluation 2 weeks 3 weeks 4 weeks 5 weeks 6 weeks 7 weeks Group Positive.sup.1/ GMT Positive/ GMT Positive/ GMT Positive/ GMT Positive/ GMT Positive/ GMT # Total titer.sup.2 Total titer Total titer Total titer Total titer Total titer 1 12/18 8.3 18/18 66.0 18/18 83.1 18/18 148.1 18/18 201.6 18/18 179.6 (67%) (100%) (100%) (100%) (100%) (100%) 2  9/10 17.0 10/10 105.6 10/10 171.5 10/10 91.9 10/10 105.6 10/10 80.0 (90%) (100%) (100%) (100%) (100%) (100%) 3  7/10 7.1 10/10 45.9 10/10 65.0 10/10 211.1 10/10 60.6 10/10 49.2 (70%) (100%) (100%) (100%) (100%) (100%) 4  0/10 N/A.sup.3  0/10 N/A  0/10 N/A  0/10 N/A  0/10 N/A  0/10 N/A  (0%)  (0%)  (0%)  (0%)  (0%)  (0%) Positive.sup.1 = HI titers of equal to or more than 10 were considered positive. GMT titer.sup.2 = Geometric mean titer N/A.sup.3 = not applicable

TABLE-US-00011 TABLE 6 Treatment groups for the efficacy trial against highly pathogenic avian influenza virus Group Age of Vaccine Vaccine # of # Treatment Group Promoters vaccination dose (pfu.sup.1) route chickens 1 rHVT/CMVH5Wis68 CMV (Ex.sup.2) One-day-old 1075 SQ.sup.3 20 2 rHVT/BacH5Wis68 Bac (CE.sup.4) One-day-old 1080 SQ 20 3 Challenge controls N/A.sup.5 N/A None N/A 20 4 Negative controls N/A N/A None N/A 5 pfu.sup.1 = plaque forming units Ex.sup.2 = example SQ.sup.3 = subcutaneous CE.sup.4 = comparative example N/A.sup.5 = not applicable

TABLE-US-00012 TABLE 7 Protection of recombinant HVT against highly pathogenic avian influenza virus Group # protected / # Treatment Group total % protection 1 rHVT/CMVH5Wis68 19/20  95% 2 rHVT/BacH5Wis68 13/20  65% 3 Challenge controls  0/10   0% 4 Negative controls 5/5 100%