OLIGONUCLEOTIDE TARGETED TO THE A20-THREE PRIME UNTRANSLATED REGION

Abstract

An antisense oligonucleotide comprising a sequence targeted to the 3′ untranslated region (3′ UTR) of the TNFAIP3 (A20) transcript and its use as a medicament, for example in the treatment of cancer or an autoimmune disease.

Claims

1. An antisense oligonucleotide of 8 to 50 nucleobases in length comprising a sequence targeted to the 3′ untranslated region (3′ UTR) of a TNF Alpha Induced Protein 3 (TNFAIP3) (A20) transcript.

2. The antisense oligonucleotide according to claim 1, wherein said oligonucleotide specifically hybridizes/binds to the 3′ UTR of the TNFAIP3 (A20) transcript, wherein the 3′ UTR comprises a sequence according to SEQ ID No. 1.

3. The antisense oligonucleotide according to claim 1, wherein said oligonucleotide specifically hybridizes with an at least 8-nucleobase portion of the RC3H1 binding site of the 3′ UTR of a TNFAIP3 (A20) transcript according to SEQ ID No. 2.

4. The antisense oligonucleotide according to claim 1, wherein said oligonucleotide specifically hybridizes with an at least 8-nucleobase portion of the RC3H1 binding site of the 3′ UTR of a TNFAIP3 (A20) transcript according to SEQ ID No. 3.

5. The antisense oligonucleotide according to claim 1, wherein said oligonucleotide specifically hybridizes with an at least 8-nucleobase portion of the RC3H1 binding site of the 3′ UTR of a TNFAIP3 (A20) transcript according to SEQ ID No. 4.

6. The antisense oligonucleotide according to claim 1, wherein said oligonucleotide specifically hybridizes with an at least 8-nucleobase portion of the RC3H1 binding site of the 3′ UTR of a TNFAIP3 (A20) transcript according to SEQ ID No. 5.

7. The antisense oligonucleotide according to claim 1, wherein said oligonucleotide comprises a sequence of at least 80% sequence identity to SEQ ID No. 1 to 5 and/or complementary sequence thereof and hybridizes/binds to the 3′ UTR of the TNFAIP3 (A20) transcript.

8. The antisense oligonucleotide according to claim 1, wherein said oligonucleotide of 8 to 50 nucleobases in length comprises a sequence that is fully complementary to an at least 8-nucleobase portion of the RC3H1 binding site according to SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4 and/or SEQ ID No. 5.

9. The antisense oligonucleotide according to claim 8, wherein the oligonucleotide comprises 12 to 40 nucleobases in length, and the oligonucleotide comprises a sequence that is fully complementary to an at least 12 nucleobase portion of the RC3H1 binding site according to SEQ ID No. 2, SEQ ID No. 3 and/or SEQ ID No. 5.

10. The antisense oligonucleotide according to claim 1, wherein said oligonucleotide consists of a sequence of SEQ ID No. 6, SEQ ID No. 5 or SEQ ID No. 3 or complement, RNA, DNA or LNA counterpart thereof.

11. The antisense oligonucleotide according to claim 1, wherein said oligonucleotide comprises at least one structural modification that provides improved stability and/or half-life of said oligonucleotide post-administration in a cell and/or organism compared to a structurally unmodified oligonucleotide of the same sequence, wherein the structural modification occurs in the backbone, one or more linkages, nucleobase(s) and/or sugar structure(s) of the oligonucleotide.

12. (canceled)

13. The antisense oligonucleotide according to claim 11, wherein said oligonucleotide comprises a modified internucleoside linkage.

14. The antisense oligonucleotide according to claim 13, wherein the modified internucleoside linkage is a phosphorothioate linkage.

15. The antisense oligonucleotide according to claim 11, wherein said oligonucleotide comprises at least one modified sugar moiety.

16. The antisense oligonucleotide according to claim 15, wherein the one modified sugar moiety is a 2′-O-methoxyethyl (2′-MOE) sugar moiety or a bicyclic sugar moiety.

17. The antisense oligonucleotide of claim 11 comprising at least one modified sugar moiety, wherein the modified sugar moiety is a bicyclic sugar moiety that has a (—CH2-).sub.n group forming a bridge between the 2′ oxygen and the 4′ carbon atoms of the sugar ring, wherein n is 1 or 2.

18. The antisense oligonucleotide according to claim 1, wherein, upon binding of said oligonucleotide to its target, said oligonucleotide: inhibits or disrupts the binding of RC3H1 protein to the 3′ UTR of the TNFAIP3 (A20) transcript, increases the expression, amount of and/or activity of TNFAIP3 (A20), and/or increases IκB kinase activity.

19. (canceled)

20. A method of treating cancer in a subject comprising administering an antisense oligonucleotide according to claim 1 to the subject.

21. The method of claim 20, wherein the cancer is B-cell lymphoma.

22. A method of treating a subject for a medical condition associated with inflammation comprising administering the antisense oligonucleotide according to claim 1 to the subject.

23. The method according to claim 22, wherein the medical condition associated with inflammation is rheumatoid arthritis or psoriasis.

24. A method of treating a subject for an autoimmune disease comprising administering the antisense oligonucleotide according to claim 1 to the subject.

25. The method according to claim 24, wherein the autoimmune disease is systemic lupus erythematosus (SLE) or Crohn's disease.

26. A pharmaceutical composition comprising the antisense oligonucleotide of claim 1 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.

27. A method for detecting and/or measuring the binding of a candidate molecule to the 3′ UTR of TNFAIP3, comprising providing a nucleic acid reporter construct comprising the 3′ UTR of TNFAIP3 functionally linked to a marker molecule, wherein the nucleic acid reporter construct comprises a nucleic acid molecule that comprises or consists of a sequence of at least 80% sequence identity to SEQ ID No. 1 to 5 and/or a complementary sequence thereof, bringing a candidate molecule, preferably a candidate oligonucleotide, into contact and/or into proximity with said reporter construct, and assessing reporter activity via expression of said marker molecule.

28. (canceled)

Description

FIGURES

[0114] FIG. 1 PAR-CLIP identifies thousands of human mRNAs directly bound by RC3H1

[0115] (a) Phosphorimage of SDS-PAGE of radiolabeled FLAG/HA-RC3H1-RNA complexes from 365 nm UV crosslinked non-labeled, 6SG or 4SU-labeled cells. Crosslinked protein-RNA complexes were observed upon metabolic labeling with 4SU or 6SG. The lower panel shows an anti-HA Western blot, confirming correct size and equal loading of the IPed protein.

[0116] (b) Alignment statistics of PAR-CLIP reads prepared from 4SU-1 library. Sense mapping is shown above and antisense is shown below the horizontal axis. T to C transitions indicate cloning of crosslinked RNA fragments.

[0117] (c) A Venn diagram showing the overlap of target mRNA transcripts between PAR-CLIP experiments.

[0118] (d) Distribution of binding sites along mRNA transcripts based on consensus RC3H1 PAR-CLIP binding sites. The majority of binding sites are located in 3′UTR.

[0119] FIG. 2 Identification of AU-rich sequences and stem-loop secondary structure as recognition elements of RC3H1.

[0120] (a) log 10 frequencies of 7mers occurring in the 41 nt window around the RC3H1 preferred crosslink sites are shown for 4SU-2 and 6SG experiments. AU-rich sequences are frequently occurring in both 4SU and 6SG experiments.

[0121] (b) A scatter plot showing 7mers log 10 frequencies in the 41 nt window around the preferred crosslink sites of consensus 3′UTR RC3H1 binding sites versus 7mers log 10 frequencies in all 3′UTR sequences. 7mers comprising of only A/U or G/U are plotted in the upper and lower circles, respectively. AU-rich sequences (upper) are more frequent and enriched over the background frequency whereas control 7mers made up of G/U are not.

[0122] (c) A heatmap showing the coverage of 7mers, indicated on the left, around the preferred crosslinks in 3′UTR RC3H1 consensus binding sites. AU-rich elements (AREs) and conserved decay element (CDE) are indicated. U-rich sequences are found in the close vicinity of crosslink sites, which is indicative of direct association of RC3H1 with U-rich sequences.

[0123] (d) RC3H1 binding sites tend to have stem-loop secondary structure. 41 nt sequences centered around RC3H1 crosslink site were computationally folded. Base pairing probability for each position around crosslink sites are averaged over top 1000 AU-rich sequences containing 3′UTR binding sites, top 1000 AU-rich sequences non-containing 3′UTR binding sites, all 3′UTR binding site and control 3′UTR sequences.

[0124] FIG. 3 RC3H1 target transcripts have shorter half-lives.

[0125] (a) RC3H1 target transcripts have shorter half-lives. Gray or black dots represent the 3′UTR RC3H1 consensus targets or non-targets, respectively. log 2 expression levels and half-lives (min) are blotted on x- and y-axis, respectively.

[0126] (b) A cumulative distribution function (CDF) plot of half-lives shown in (c). The mean half-lives of RC3H1 targets and non-targets are 269.9 min and 311.1 min, respectively. The difference is significant with p-value smaller than 2.2e−16 (Wilcoxon's rank sum test).

[0127] (c) Inverse correlation (Spearman r coefficient −0.33, p value <2.2e−16) between mRNA half-live against PAR-CLIP index, defined by number of RC3H1 PAR-CLIP transitions normalized for expression level for each gene.

[0128] (d) A CDF plot of log 2-fold changes of protein synthesis of consensus RC3H1 target transcripts that have more than 100 transitions on 3′UTR after siRNA-mediated RC3H1 depletion. Protein synthesis of RC3H1-bound mRNAs was significantly up-regulated upon RC3H1 knockdown (p-value 0.0031, Wilcoxon's rank sum test). The mean log 2 fold changes of RC3H1 targets (n=390) and non-targets (n=1279) are 0.001 and −0.116, respectively.

[0129] FIG. 4 RC3H1 target transcripts are enriched for mRNAs induced upon DNA damage, and RC3H1 negatively regulates A20 at the posttranscriptional level.

[0130] (a) A scatter plot of mRNA expression levels of untreated cells and cells treated for 4 hours with 200 ng/ml of NCS (data derived from .sup.29). RC3H1 3′UTR target transcripts are shown in grey and non-targets are shown in black. Among the RC3H1 targets, A20 was the most differentially expressed mRNA upon DNA damage.

[0131] (b) A CDF plot of log 2 fold changes upon DNA damage is shown for RC3H1 3′UTR targets in grey and for non-targets in black. The difference is significant with p-value smaller than 2.2e−16 (Wilcoxon's rank sum test).

[0132] (c) RC3H1 overexpression specifically leads to reduced expression of A20 at each time point. mRNA expression level of A20 and GAPDH (negative control) are measured by qPCR at 0, 4, 9 and 24 hours post DNA damage induced by 250 ng/ml of NCS. Average and standard deviation (error bar) from three technical replicates are shown. A representative data from two independent biological replicates are shown.

[0133] (d) Overexpression of RC3H1 leads to shorter half-life of A20 mRNA. At 4 hours post DNA damage induced by NCS (250 ng/ml), transcription was blocked with actinomycin D and mRNA decay was measure by qRT-PCR. Percentage of A20 mRNA amount at each time point relative to starting point is shown. Error bars indicate standard deviations calculated from three replicates.

[0134] (e) Transfection of antisense LNA oligonucleotide targeting the stem-loop structure in HEK293 cells leads to specific increase in A20 mRNA half-life (grey) in comparison to control LNA transfection (black). Representative data from two independent experiments are shown.

[0135] FIG. 5 RC3H1 binds to a composite structure-sequence motif in the 3′UTR of A20 mediated by the CCCH-type zinc finger domain.

[0136] (a) Illustration of the RC3H1 binding site in the A20 3′UTR. The binding sites of RC3H1 binding site in the 3′UTR of TNFAIP3 is shown and zoomed in below. Number of T to C transitions for indicated base positions are shown. Bases shown in underline are forming stem. Phastcon vertebrate conservation is shown underneath the underline.

[0137] (b) Electrophoreic mobility shift assay (EMSA) experiments to examine the binding mode of RC3H1 to the A20 target site. Increasing concentration of recombinant RC3H1-N1 (amino acids 2-399) or RC3H1-N2 containing additional CCCH-type zinc finger domain (amino acids 2-452) was incubated with radiolabeled ICOS (13 nt), A20 stem-loop (23 nt), and A20 ARE-stem-loop (37 nt), and free RNA was separated from RNA-protein complexes by native PAGE.

[0138] (c) Increasing concentration of antisense LNA oligonucleotide targeting the A20 stem-loop structure impairs the interaction of RC3H1-N2 and ARE-stem-loop (37 nt).

[0139] (d) The effect of different elements in the A20 ARE-stem-loop sequence was assayed by transiently transfecting HEK293 cells with the d2GFP reporter plasmid containing the RC3H1 binding site in the A20 3′UTR and variants thereof. Mean Fluorescence Intensity (MFI) of d2GFP obtained by flow cytometry was normalized against MFI of mCherry, which was used as transfection control. Wild-type (Wt) contains 37 nt A20 ARE-stem-loop sequence inserted into the 3′UTR of d2GFP, and each variant (Mut1-6) carries mutations. Average and standard deviation (error bar) from 3 biological replicates are shown.

[0140] (e) The effect of A20 AU-rich element (ARE)-stem-loop hairpin (37 nucleotide (nt)) was assayed by transiently transfecting HEK293 cells with the d2GFP reporter plasmid, which contains the 37-nt sequence inserted into the 30 UTR of d2GFP. mRNA decay of the reporter transcripts were measured in mock and RC3H1/RC3H2 knockdown cells. Average and s.d.'s (error bar) from three technical replicates are shown.

[0141] FIG. 6 RC3H1 modulates the activation of IKK by TNFα.

[0142] (a) A scatter plot of mRNA expression levels of untreated cells and cells treated for 4 hours with 10 ng/ml of TNFalpha (data is derived from .sup.35). RC3H1 3′UTR target transcripts are shown in grey and non-targets are shown in black. Several TNFalpha-induced mRNAs, such as A20, IkBalpha and NFKBIZ are targets of RC3H1. Amongst the RC3H1 target transcripts, A20 was the most differentially expressed mRNA upon TNFalpha treatment.

[0143] (b) RC3H1 overexpression leads to reduced expression of A20 at each time point. mRNA expression levels of A20 and IkBalpha were measured by qPCR at indicated time points after TNFalpha treatment. Representative data from two independent experiments are shown. Average and standard error of the mean (error bar) are from three technical replicates.

[0144] (c) Western blot analyses of NF-kB pathway proteins after TNFα stimulation in cells with DOX-dependent RC3H1 expression. 293 cells were treated with Doxycycline (1 μg/ml; 24 h), to induce HA-RC3H1. Subsequently, cells were treated with TNFα as indicated, lysed and analyzed by Western-blotting with the indicated antibodies. RC3H1-upregulation results in decreased A20 expression, increased IKK activation (T-loop phosphorylation, P-IKK) and phosphorylation of p65 (P-p65). Representative data from two independent experiments are shown.

[0145] (d) EMSA analysis of whole-cell extracts for TNFa-induced NF-kB activity. Cells were treated as in c.

[0146] (e) Western blot analyses of the NF-kB pathway proteins after TNFa stimulation in mock or RC3H1/2 siRNA-treated HEK293. Cells were treated with TNFa, and analysed by western blot with the indicated antibodies. RC3H1 downregulation results in mildly increased A20 expression, leading to decreased IKK activation and phosphorylation of p65. Representative data from two independent experiments are shown. ‘*’ indicates phosphorylated form of IKK.

[0147] (f) EMSA analysis of whole-cell extracts for TNFα-induced NF-kB activity. Cells were treated as in e. Knockdown of RC3H1 expression reduced the NF-kB activity.

[0148] FIG. 7

[0149] (a) Western blot analyses for RC3H1, FLAG/HA-RC3H1, and TUBULIN in the presence and absence of doxycycline (1 μg/ml for 9 hours). RC3H1 signal was quantified and normalized for TUBLIN loading control. A bar plot shows relative normalized expression of RC3H1.

[0150] (b) Alignment statistics of PAR-CLIP reads prepared from 4SU-2 library. Sense mapping is shown in blue and antisense is shown in red. T to C transitions are prominent and diagnostic for efficient crosslinking.

[0151] (c) Alignment statistics of PAR-CLIP reads prepared from 6SG library, as shown in (a).

[0152] (d) A length histogram of clusters identified in 4SU-1, 4SU-2, 6SG or consensus PAR-CLIP. RC3H1 PAR-CLIP clusters are typically small with the median cluster length of around 25 to 30 nt.

[0153] (e) Top 1000 “consensus set” target genes, ranked by the number of transitions in the 3′UTR, were subjected to enrichment analysis for the KEGG pathway using the on-line DAVID program. The top 10 KEGG pathways are shown. The number of genes falling into each pathway and p-values corrected for multiple comparison by the Benjamini-Hochberg are shown in “count” and “Benjamini” column, respectively.

[0154] (f) Mouse RC3H1 target mRNAs identified by Leppek and colleagues are compared to human PAR-CLIP RC3H1 target mRNAs. Out of 95 genes, 91 genes are converted to orthologous human genes, and divided into two groups based on FPKM expression value in HEK293 cells. For each group, number of mRNAs that are overlapping in human PAR-CLIP RC3H1 target mRNAs is shown. Number of mouse CDE containing mRNAs is shown in parentheses.

[0155] (g) Distribution of consensus RC3H1 binding cluster along 3′UTRs of mRNA.

[0156] (h) Density of predicted conserved miRNA target sites around crosslink sites in 3′UTRs. RC3H1 crosslink sites and miRNA target sites display no tendency for direct overlap but the larger context (10-50 nt) shows mildly elevated seed density. The gray envelope represents the standard error of the mean. RC3H1 target sites identified in 4SU-1 is used in this analysis.

[0157] FIG. 8

[0158] (a) A RNA structure dot plot for top 1000 RC3H1 consensus targets, ranked by number of T to C transition events in 3′UTR (top right triangular), and control sets of random 3′UTR sequence from RC3H1 target genes (bottom left triangular) demonstrates the stem-loop structure of RC3H1 binding sites. A dot placed in the ith row and jth column of a triangular array represents the base pair between the ith base with jth base, and the size of dot is proportional to the square root of average base paring probability for each base paring.

[0159] (b) The 41 nt windows around the preferred crosslink sites for top 10 RC3H1 3′ UTR binding sites (ranking is based on PAR-CLIP transition events normalized for expression levels) are in silico folded using the on-line mfold program.sup.53, and the predicted RNA secondary structures are drawn using jViz.RNA 2.0.sup.54.

[0160] FIG. 9

[0161] (a) Overview of the pSILAC experiment. pSILAC measures changes in protein synthesis. Cellular proteins incorporate either heavy (mock) or medium-heavy (RC3H1 knockdown) amino acids for 24 h. The mass shift allows measurement of the difference in newly synthesized protein between normal and RC3H1 depleted cells.

[0162] (b) Western Blot analyses for endogenous RC3H1 knock-down mediated by two distinct siRNAs (siRNA-1 and siRNA-2) against RC3H1 and for TUBULIN as a loading control.

[0163] (c) A scatter plot of log 2 fold changes of protein synthesis after siRNA-1 (FIG. 4f) mediated knockdown versus siRNA-2 mediated knockdown. Grey and black dots indicate the PAR-CLIP targets (consensus set) and non-targets, respectively (upper right).

[0164] (d) A CDF plot of log 2 fold changes of protein synthesis of consensus RC3H1 targets that have more than 100 transitions on 3′UTR (1561 genes) shown in grey and non-targets shown in black after siRNA-2 mediated knockdown. Protein synthesis of RC3H1 targets is mildly but significantly increased upon RC3H1 knockdown (p-value 0.00015, Wilcoxon's rank sum test). The mean log 2 fold changes of RC3H1 targets (n=390) and non-targets (n=1307) are 0.089 and −0.023, respectively.

[0165] FIG. 10

[0166] (a) Western blot analyses for FLAG/HA-RC3H1, gammaH2AX (a marker for DNA damage), and vinculin (loading control). Samples are harvested at indicated time points following NCS induced DNA damage. Increased gammaH2AX indicates the proper induction of DNA damage.

[0167] (b) A CDF plot of log 2 fold changes upon TNFα treatment (FIG. 6a) is shown for RC3H1 3′UTR targets in grey and for non-targets in black. The mean log 2 fold changes of RC3H1 targets (n=3184) and non-targets (n=10142) are 0.0160 and −0.0146, respectively. The difference is significant with p-value of 0.00015 (Wilcoxon's rank sum test).

EXAMPLES

[0168] The invention is further described by the following examples. These are not intended to limit the scope of the invention.

PAR-CLIP Identifies Thousands of Human mRNAs Directly Bound by RC3H1

[0169] To identify RC3H1 binding sites at high resolution, we applied photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP) in combination with next-generation sequencing.sup.17. In PAR-CLIP experiments, nascent RNA is metabolically labeled with the non-perturbing photoreactive ribonucleosides 4-thiouridine (4SU) or 6-thioguanosine (6SG). Crosslinking of protein to 4SU- or 6SG-labeled RNA leads to specific T to C or G to A transitions, respectively, that occur at high-frequency in cDNA sequence reads and mark the protein crosslinking sites on the target RNA.sup.17. HEK293 cells stably expressing inducible FLAG/HA-tagged RC3H1 (FIG. 7a) were crosslinked after labeling of RNA with either 4SU or 6SG. Immunopurified, ribonuclease-treated and radiolabeled RC3H1-RNA complexes were separated by SDS-PAGE (FIG. 1a). Protein-protected RNA fragments were recovered and converted into a cDNA library amenable to Illumina sequencing.

[0170] In total we performed three independent PAR-CLIP experiments (two biological replicates with 4SU and one replicate with 6SG). Sequence reads were mapped to the human genome and overlapping reads were used to build RC3H1 binding clusters.sup.20. In PAR-CLIP experiments using 4SU, diagnostic T to C transitions detected in mapped reads were most highly abundant (FIG. 1b and FIG. 7b). Similarly, but less pronounced, the diagnostic G to A mutation was the most abundant type of mutation for 6SG PAR-CLIP experiments (FIG. 7c). A length histogram of RC3H1 PAR-CLIP clusters shows a median cluster size of around 25 to 30 nt (FIG. 7d).

[0171] We identified about 2000 to 4000 RC3H1 mRNA target transcripts in each of the 4SU PAR-CLIP experiments (FIG. 1c). Ninety-three percent of the 481 6SG PAR-CLIP mRNA targets were reproduced in 4SU libraries (FIG. 1c). We combined the reads from all PAR-CLIP experiments to derive a set of consensus binding sites supported by reads from at least two out of three experiments (see Online Methods). Based on this analysis, we identified 16234 RC3H1 binding sites on 3821 protein-coding transcripts as consensus data sets. The position with the highest number of PAR-CLIP derived diagnostic nucleotide transitions for each binding sites was referred to as the preferred crosslinking site.

[0172] To gain an insight into the transcripts regulated by RC3H1, genes encoding RC3H1-bound mRNAs were subjected to KEGG pathway and GO term enrichment analysis.sup.22,23. Interestingly, cell cycle and p53 signaling pathway were overrepresented in the KEGG pathway enrichment analysis (FIG. 7e), suggesting that RC3H1 could play a role in the response to DNA damage. Furthermore, GO term enrichment analysis showed that RC3H1-bound transcripts are highly enriched for regulators of gene expression such as transcription factors, RNA-binding proteins and ubiquitin ligases. In addition, when comparing the human RC3H1 targets with mouse Roquin-bound transcripts.sup.8, we identified 36 of 55 Roquin-interacting mRNAs by PAR-CLIP in HEK293 cells (FIG. 7f).

RC3H1 Binding Sites are Mostly Located in 3′UTR of mRNA Targets

[0173] Next we examined the distribution of RC3H1 binding sites along mRNA transcripts. The majority of binding sites (81%) were found to be located in 3′UTRs (FIG. 1d), consistent with previous observations that RC3H1 binds to ICOS and TNF mRNAs through 3′UTR interactions.sup.4,5,24. A preference for RC3H1 binding within 3′UTRs was not apparent and sequence clusters were almost equally distributed over this transcript region (FIG. 7g). Since a previous study suggested a functional link between RC3H1 binding and microRNA (miRNA) activity.sup.4, we examined the local interactions between RC3H1 and miRNA by computing the density of conserved miRNA target sites around RC3H1 preferred crosslinking sites (FIG. 7h). The observed profile did not show an overrepresentation of miRNA seeds complements overlapping with RC3H1 binding sites, arguing against a general functional link between miRNA regulation and RC3H1 binding.

Identification of U-Rich Sequences and Stem-Loop Secondary Structure as Recognition Element of RC3H1

[0174] To investigate the RNA elements recognized by RC3H1, we searched for sequence motifs and secondary structure features in RC3H1 binding sites. First, we examined 7mer occurrences in 41 nt windows centered on preferred crosslinking sites in RC3H1 binding sites. Notably, U-rich sequences were frequently found in RC3H1 binding sites derived from both 4SU and 6SG experiments, suggesting that the frequent observation of U-richness is not due to a bias introduced by using 4SU (FIG. 2a). Furthermore, AU-rich sequences were more highly enriched in RC3H1 consensus binding sites in 3′UTR sequences, when compared to GU-rich 7mer sequences (FIG. 2b). In addition, U-rich sequences were found in close proximity of preferred crosslink sites, suggesting the direct interaction of RC3H1 with these sequences (FIG. 2c). In addition, we examined the occurrence of the previously identified CDE motif.sup.8, and found that core CDE consensus sequence (UCYRYGA) was found in RC3H1 binding sites, but the frequency was less prominent than that of several U-rich sequences (FIG. 2c).

[0175] To examine potential secondary structure features in RC3H1 binding sites, we computationally folded a 41 nt sequence stretch centered around preferred crosslinking sites and averaged the resulting base pairing probabilities. Randomly selected RNA regions of the same length within 3′UTRs of RC3H1 mRNA target transcripts served as a background control. In 3′UTR RC3H1 consensus binding sites the base pairing probability was reduced in the vicinity of crosslink sites and increased in the flanking region compared to background, suggesting that RC3H1 binding sites tend to form stem-loop structures (FIG. 2d and FIG. 8). This observation was consistent with a recent finding that RC3H1 contacts the stem-loop structure of the CDE motif via its ROQ domain.sup.8-10. Since our motif analysis identified AU-rich sequences, we hypothesized that RC3H1 recognition elements might be composed of a combination of structure/sequence specificity features which could be contacted by the different RNA-binding domains of RC3H1. Therefore, we classified RC3H1 binding sites into two groups based on the presence of AU-rich sequences, and independently performed the secondary structure analysis for each group. RC3H1 binding sites which do not contain AU-rich sequences folded into more extended hairpin structure (FIG. 2d), similar to the TNFα CDE, than binding sites containing AU-rich sequences. These sites were also predicted to form stem-loop structures but with lower base pairing probability likely due to the higher AU-content, suggesting that these hairpin structures contained larger loops and shorter stems (FIG. 2d). Together with the observation that AU-rich sequences are located in the direct proximity of crosslink sites (FIG. 2c), which often map to the loop sequence (FIG. 2d), U-rich sequences seem to be embedded in or around the loop. Hairpin structures frequently containing AU-rich sequences and albeit less frequently the CDE consensus sequence were detected as recognition elements of RC3H1.

RC3H1-Bound mRNAs are Short-Lived and Show Increased Protein Synthesis Upon RC3H1 Knockdown

[0176] To examine whether RC3H1 influences the stability of its target transcripts we performed transcriptome-wide mRNA half-life measurements as described by Dölken and colleagues.sup.27, and compared half-lives of RC3H1-bound and unbound mRNA transcripts. Consistent with the function of RC3H1 in mRNA decay, RC3H1-targeted mRNAs were found to have significantly shorter half-lives than non-targets (FIG. 3c, d). Furthermore, we found that mRNA half-lives of RC3H1-bound transcripts inversely correlated with an expression normalized PAR-CLIP score (FIG. 3e), suggesting that the extent of RC3H1-mRNA binding determined the mRNA half-lives of bound mRNAs.

[0177] Next, we examined the effect of RC3H1 depletion on the protein synthesis rate of RC3H1-bound mRNAs. For this purpose, we monitored changes in newly synthesized proteins by pSILAC based quantitative proteomics.sup.20,28 upon depletion of endogenous RC3H1 in HEK293 cells (FIG. 9a). The mass shift between the RC3H1 knockdown (“medium” labeled) and mock-treated control (“heavy” labeled) allowed the quantification of changes in protein synthesis of ˜2400 proteins (FIG. 9a).

[0178] RC3H1 knockdown was confirmed by Western blot analysis (FIG. 9b). A cumulative distribution function showed that the level of protein synthesis of RC3H1-bound mRNAs was significantly increased upon RC3H1 depletion by two siRNAs (FIG. 3f and FIG. 9b,c,d). Taken together, our data indicate that RC3H1-bound mRNAs are short-lived and RC3H1 represses expression of target transcripts, validating the functionality of RC3H1-mRNA interactions.

RC3H1 Interacts with DNA Damage Induced Transcripts

[0179] Our KEGG pathway enrichment analysis revealed that RC3H1 mRNA targets are significantly enriched for genes involved in cell cycle regulation and p53 signaling (FIG. 7e) Furthermore, RC3H1 was shown to localize to stress granules upon oxidative stress induced by arsenite exposure.sup.24, suggesting an involvement of RC3H1 in the cellular stress response. To investigate a possible role of RC3H1 in the DNA damage response, we correlated changes in mRNA expression levels upon DNA damage induced by neocarcinostatin (NCS) in HEK293 cells.sup.29 with our RC3H1 PAR-CLIP data (FIG. 4a). Notably, RC3H1-bound transcripts were more induced upon DNA damage than non-targeted mRNAs (FIG. 4b). This finding implies that the expression levels of DNA damage induced genes are likely modulated at the post-transcriptional level at least in part by RC3H1. The A20, a NF-κB target gene that acts as a feedback regulator of NF-κB activation, was amongst the RC3H1 target transcripts and showed the largest increase upon DNA damage. Over-expression of FLAG/HA-tagged RC3H1 resulted in a significant reduction of A20 mRNA (FIG. 4c) upon DNA damage (FIG. 10a). Furthermore, we observed that A20 mRNA half-life was shortened by induction of tagged RC3H1 (FIG. 4d). To provide further support for this finding, we specifically blocked the RC3H1 binding site on A20 mRNA by transfecting an antisense Locked Nucleic Acid (LNA) oligonucleotide and observed an increase in A20 mRNA half-life (FIG. 4e).

RC3H1 Binds to a Composite Structure-Sequence Motif in the 3′UTR of A20

[0180] Our PAR-CLIP data indicated a single RC3H1 binding site in the 3′UTR of A20 mRNA. This site folds into a conserved short hairpin structure with an AU-rich sequence located in the loop and another AU-rich sequence upstream of the stem-loop structure. Diagnostic PAR-CLIP T to C transition events, indicating protein-RNA crosslinking sites, were detected in the AU-rich sequence located upstream of the stem-loop structure and within the loop (FIG. 5a).

[0181] To examine whether the putative A20-binding site bestows RC3H1-dependent mRNA decay, we cloned a 37-bp sequence covering the crosslinked region into a green fluorescent protein (GFP) reporter and assayed mRNA turnover by quantitative reverse transcription-PCR (qRT-PCR) after blocking transcription using actinomycin D. Indeed, insertion of the RC3H1-bound A20 site into the 3′ UTR of the reporter construct destabilized reporter transcripts in mock-transfected cells, but not in RC3H1- and RC3H2-depleted cells (FIG. 5e), indicating that RC3H proteins destabilize the re-porter transcripts through this A20 site.

[0182] To examine the RC3H1 interaction with the identified A20 binding site, which differs significantly from the previously described CDE stem-loop structure, we used electrophoretic mobility shift assays (EMSA). Additionally to assess the contribution of the different RC3H1 domains to RNA-binding, we expressed two variants: RC3H1-N1 (aa 2-399) contained the N-terminal RING and ROQ domains, while RC3H1-N2 (aa 2-452) harbored RING, ROQ, and CCCH-type zinc finger domains (FIG. 5b). Both recombinant proteins bound to the ICOS CDE-like stem-loop motif RNA (FIG. 5b). The formation of the protein-RNA complex seemed to be independent of the CCCH-type zinc finger domain. In contrast the 23 nt A20 hairpin RNA was bound by RC3H1-N2 with higher affinity than RC3H1-N1, indicating that the CCCH-type zinc finger domain plays a role in the interaction with the non-CDE-type A20 site. The addition of 14 nucleotides 5′ prime of the stem-loop structure (A20 37 nt) further increased the affinity of the RC3H1-N2 variant to the RNA substrate, suggesting that an additional sequence upstream of the A20 hairpin is involved in protein-RNA complex formation.

[0183] Moreover, the antisense LNA oligonucleotide, which was used to modulate A20 mRNA stability (FIG. 4e) and hybridizes to the loop and the 3′ part of the stem, reduced the binding of RC3H1-N2 to the 37 nt A20 target sequence in vitro, suggesting that the LNA oligonucleotide interferes with the binding of RC3H1 (FIG. 5c). Finally, we examined the functionality of the RC3H1 binding site in the A20 3′UTR in a cellular context. To this end, we generated a destabilized GFP (d2GFP) reporter construct with a 3′UTR harboring the RC3H1 A20 binding site including the upstream AU-rich sequence and stem-loop structure. This construct and variants with mutations in the RC3H1 binding site were co-transfected with a mCherry control plasmid into HEK293 cells. Since the d2GFP protein half-life is shortened to about 2 hours by a C-terminal fusion to a PEST domain.sup.30, the expression level of d2GFP measured by FACS analysis likely approximates the abundance of d2GFP mRNA. Indeed, insertion of the A20 site into the 3′UTR of the reporter construct reduced d2GFP expression, indicating a repressive effect in HEK293 cells (FIG. 5d). Mutations disrupting the base-paring of the stem had no apparent effect on d2GFP expression, whereas mutations of the AU-rich sequence element next to the stem loop partially abrogated repression. An additional mutation of a uridine in the hairpin loop almost completely derepressed d2GFP expression (FIG. 5d), suggesting that sequence-specific contacts by RC3H1 in the AU-rich sequence upstream of the hairpin and the loop are required for repression.

RC3H1 Overexpression Represses A20 Resulting in Increased Phosphorylation of IKK

[0184] NF-κB is activated by a wide variety of stimuli, including cytokines such as TNFα.sup.33,34. To examine whether RC3H1 acts in a pathway specific manner, we used previously published mRNA expression data of TNFα-treated HEK 293 cells.sup.35 to correlate RC3H1-bound mRNAs with TNFα-induced transcripts. Interestingly, RC3H1 target transcript showed a greater increase in expression upon TNFα induction than non-targets suggesting that RC3H1 acts posttranscriptionally on NF-κB target genes (FIG. 6a and FIG. 10b). Furthermore we could demonstrate that RC3H1 overexpression causes a reduction of basal and stimulus-dependent A20 mRNA and protein levels (FIG. 6b, c), similar to A20 expression changes observed during the response after DNA damage (FIG. 4c).

[0185] Since the A20 expression levels are regulated by RC3H1, enforced expression of RC3H1 could modulate NF-κB pathway activity. NF-κB activation is mediated via the IκB kinase (IKK) complex, which catalyzes the phosphorylation of IκB and NF-κB proteins, as well as of other substrates.sup.32-34,36. Signaling involves ubiquitin-mediated complex formation of pathway components and is controlled at various levels by negative feedback mechanisms, including ubiquitin-editing enzymes such as A20.sup.37.

[0186] Indeed, overexpression of RC3H1 resulted in a significant increase of IKK activation. In line with this, elevated Ser536 phosphorylation of the IKK substrate p65.sup.37 was also observed. However, IκBα degradation was not detectably affected, while IκBα re-synthesis was slightly reduced (FIG. 6c). IκBα was determined as another RC3H1 target (FIG. 6a), indicating RC3H1-mediated mRNA decay.

[0187] Knockdown of RC3H1 and RC3H2 in HEK293 cells resulted in a small, but reproducible, upregulation of A20 protein expression (FIG. 6e), which resulted in decreased phosphorylation of IKK (FIG. 6e), decreased phosphorylation of its substrate p65 (FIG. 6e) and reduced NF-kB DNA-binding activity (FIG. 6f). Taken together, the examples demonstrate that RC3H1 regulates the expression of several NF-kB pathway regulators, thereby modulating IKK and NF-kB activity.

Discussion of the Experimental Examples

[0188] In the present study, we identified transcriptome-wide RNA binding sites of human RC3H1 at nucleotide resolution in HEK293 cells using PAR-CLIP. Our bioinformatic analyses did not reveal a well-defined motif as observed for a number of RNA-binding proteins (Ray et al Nature 2013), however indicated a sequence-structure binding element with AU-rich sequences frequently embedded in RNA stem-loop structures located in 3′UTRs of target transcripts. Surprisingly, the CDE core consensus motif (UCYRYGA; SEQ ID NO 16) deduced by Leppek and coworkers.sup.8 was present in a minor fraction of identified RC3H1 binding sites. The interaction of RC3H1 with a relaxed CDE consensus is in agreement with recent structural and mutational analyses of roquin binding sites.sup.9 indicating that a shape-specific rather than sequence-specific recognition of CDE RNA hairpins by a monomeric ROQ domain explains the specificity of roquin in the regulation of transcripts containing CDE-like RNA elements.

[0189] Interestingly, our finding of a PAR-CLIP cluster in the A20 3′UTR indicated a yet-unrecognized RC3H1 binding mode and specificity. In contrast to a typical CDE stem-loop motif, which is sufficiently bound by the ROQ domain, we provide evidence that the CCCH-type zinc finger domain is involved in contacting the A20 site. A RC3H1 variant containing the CCCH-type zinc finger domain bound with higher affinity to a non-CDE-like stem-loop structure with an additional AU-rich sequence upstream of the hairpin than to the hairpin alone. In contrast, the N-terminal RC3H1 variant lacking the CCCH-type zinc finger domain poorly bound to both of these RNA substrates. In addition nucleotide changes in the upstream AU-rich sequence resulted in partial derepression of a reporter construct, suggesting that the AU-rich sequence next to the hairpin and the short stem-loop structure itself are likely collaboratively bound by the CCCH-type zinc finger and ROQ domains. The makeup of RC3H1 by distinct RNA-binding domains might allow the protein to recognize a wider range of RNA sequences and could function on a larger set of regulatory elements than previously anticipated. The ratio of sequence and structure specificity features, determining the strength of the RC3H1-mRNA association, and the RNA-recognition-element frequency would influence the regulatory capacity of the RNA-binding protein.

[0190] In addition our results indicate that RC3H1 target transcripts have in general shorter mRNA half-lives. RC3H1-bound mRNAs are encoded by genes with various biological functions outside of immune response pathways, which is in accordance with the mouse phenotype of Rc3h1 null-knockout that showed perinatal lethality with broad physiological complications.sup.38. Enriched KEGG pathways included cell cycle, p53 signaling and tumor pathways. By intersecting our PAR-CLIP target mRNAs with mRNA expression data, we found that RC3H1 targets are significantly enriched for mRNAs induced by DNA damage.sup.29 and TNF.sup.35. As shown for one of the top mRNA targets, A20, we postulate that RC3H1 in general is involved in fine-tuning or clearance of transcriptionally induced mRNAs by shortening their half-lives.

[0191] The zinc finger protein A20 is an important negative regulator of inflammation.sup.19 and several studies have highlighted the clinical and biological importance of A20. Vande Walle and colleagues recently showed that negative regulation of the NLRP3 inflammasome by A20 protects against arthritis.sup.39. Since RC3H1 is a negative regulator of A20, targeting of the RC3H1-A20 mRNA interaction by employing antisense technologies and concomitant upregulation of A20 protein demonstrates beneficial clinical outcomes in certain disease scenarios.

[0192] In summary, we identified comprehensive RC3H1 binding sites by PAR-CLIP, revealing a large number of novel mRNA targets as well as novel RC3H1 cis-acting recognition element in the A20 3′UTR.

Materials and Methods Used in the Experimental Examples

Antibodies

[0193] anti-HA.11 (COVANCE, 16612), anti-FLAG (SIGMA, F1804), anti-myc (SIGMA, 9E10) anti-gamma H2AX (Upstate, JBW301), anti-vinculin (Sigma, hVIN-1), anti-A20 (sc-32525, Santa-Cruz Biotechnology), anti-pIKKalpha (2697, Cell Signal Technology), anti-IKKalpha (556532, BD Pharmingen), anti-IkappaBalpha (sc-371, Santa-Cruz Biotechnology), anti-p65 (sc-8008P, Santa Cruz Biotechnology), anti-p-p65 (3033, cell signaling), polyclonal goat anti-mouse or anti-rabbit immunoglobulins/HRP (DAKO)

TABLE-US-00003 Oligonucleotides siRNAs siRNA 1 for RC3H1: (SEQ ID NO 17) 5′-GCUGGGAAAUACAAAGGAA[dT][dT] siRNA 2 for RC3H1: (SEQ ID NO 18) 5′-CCAAGAAAUGUGUAGAAGA[dT][dT] qPCR primers RC3H1 forward: (SEQ ID NO 19) 5′-tggacaaccagaaccacaaa; reverse; (SEQ ID NO 20) 5′-GCTGATCCATTTGGTACATCAC A20 forward: (SEQ ID NO 21) 5′-TGCACACTGTGTTTCATCGAG; reverse: (SEQ ID NO 22) 5′-ACGCTGTGGGACTGACTTTC RPL18A: forward; (SEQ ID NO 23) 5′-GGAGAGCACGCCATGAAG; reverse; (SEQ ID NO 24) 5′-AAGATTCGCATGCGGTAGAG GAPDH: forward; (SEQ ID NO 25) 5′-AGCCACATCGCTCAGACAC; reverse; (SEQ ID NO 26) 5′-GCCCAATACGACCAAATCC NFKBIA: forward; (SEQ ID NO 27) 5′-GAGTCAGAGTTCACGGAGTTC; reverse; (SEQ ID NO 28) 5′-CATGTTCTTTCAGCCCCTTTG DNA oligos for d2GFP-A20 3′UTR reporter WT sense: (SEQ ID NO 29) 5′-GGCCTGTACATATATAATATACCCTTACATTATGTATGAGGGATTTT; antisense: (SEQ ID NO 30) 5′-TCGAAAAATCCCTCATACATAATGTAAGGGTATATTATATATGTACA Mut1 sense: (SEQ ID NO 31) 5′-GGCCTGTACATATATAATATACCCTTACATAATCTATCAGCGATTTT; antisense: (SEQ ID NO 32) 5′-TCGAAAAATCGCTGATAGATTATGTAAGGGTATATTATATATGTACA Mut2 sense: (SEQ ID NO 33) 5′-GGCCTGTACAAAAAAAAAAAACCCTTACATAATCTATCAGCGATTTT; antisense: (SEQ ID NO 34) 5′-TCGAAAAATCGCTGATAGATTATGTAAGGGTTTTTTTTTTTTGTACA Mut3 sense: (SEQ ID NO 35) 5′-GGCCTGTACAAAAAAAAAAAACCCTTACATTATGTATGAGGGATTTT; antisense: (SEQ ID NO 36) 5′-TCGAAAAATCCCTCATACATAATGTAAGGGTTTTTTTTTTTTGTACA Mut4 sense; (SEQ ID NO 37) 5′-GGCCTGTACATGTACGATCTGCCCTTACATTATGTATGAGGGATTTT; antisense: (SEQ ID NO 38) 5′-TCGAAAAATCCCTCATACATAATGTAAGGGCAGATCGTACATGTACA Mut5 sense; (SEQ ID NO 39) 5′-GGCCTGTACATGTACGATCTGCCCTTACATAATCTATCAGCGATTTT; antisense: (SEQ ID NO 40) 5′-TCGAAAAATCGCTGATAGATTATGTAAGGGCAGATCGTACATGTACA Mut6 sense: (SEQ ID NO 41) 5′-GGCCTGTACATGTACGATCTGCCCTTACAAAATCTATGAGGGATTTT; antisense: (SEQ ID NO 42) 5′-TCGAAAAATCCCTCATAGATTTTGTAAGGGCAGATCGTACATGTACA RNA oligos ICOS (13 nt): (SEQ ID NO 43) 5′-AUUUCUGUGAAAU A20 (23 nt): (SEQ ID No. 5) 5′-ACCCUUACAUUAUGUAUGAGGGA A20 (37 nt): (SEQ ID No. 3) 5′-AUAUAUAAUAUACCCUUACAUUAUGUAUGAGGGAUUU

Plasmids

[0194] pENTR4 constructs were generated by PCR amplification of the RC3H1 and QKI5 coding sequences (CDS) from cDNA followed by restriction digest and ligation into the pENTR4 (Invitrogen) backbone, which were further recombined into the pFRT/TO/FLAG/HA-DEST destination vector.sup.40 using GATEWAY LR recombinase (Invitrogen) according to manufacturers protocol. Expression plasmids for HA-tagged CNOT1 and CNOT8 were kind gifts from Dr. W Filipowicz. pENTR4 QKI5 were recombined into pFRT/FLAG/HA-DEST (Addgene ID: 26360). The d2GFP reporter plasmids were generated by cloning the d2GFP (Clontech) coding sequence into pcDNA5/FRT, and synthetic DNA oligonucleotides containing the A20 binding site were annealed and ligated into the 3′UTR of d2GFP using the Xho1/Not1 site.

Cell Lines and Culture Conditions

[0195] Flp-In 293 T-REx cells (Invitrogen) were grown in DMEM high glucose with 10% (v/v) fetal bovine serum, 2 mM L-glutamine. Cell lines stably expressing FLAG/HA-tagged RC3H1 protein were generated by co-transfection of pFRT/TO/FLAG/HA constructs with pOG44 (Invitrogen). Cells were selected by adding 15 μg/ml blasticidin and 100 μg/ml hygromycin (Invivogen). Expression of epitope-tagged proteins was induced by addition of 1 μg/ml doxycyclin. The expression of FLAG/HA tagged RC3H1 protein was assessed by Western analysis using mouse anti-HA.11 monoclonal antibody (Covance). For quantitative proteomics, cells were grown in SILAC medium as described before.sup.25,41. Briefly, Dulbecco's Modified Eagle's Medium (DMEM) Glutamax lacking arginine and lysine (PAA) supplemented with 10% dialyzed fetal bovine serum (dFBS, Gibco) was used. Amino acids (84 mg/I .sup.13C.sub.6.sup.15N.sub.4 L-arginine plus 146 mg/I .sup.13C.sub.6.sup.15N.sub.2 L-lysine or 84 mg/I .sup.13C.sub.6-L-arginine plus 146 mg/I D4-L-lysine) or the corresponding non-labeled amino acids (Sigma), were added to obtain ‘heavy’ medium′ or ‘light’ cell culture medium respectively. Labeled amino acids were purchased from Sigma Isotec.

Western Blot Analysis

[0196] Total cell lysates were prepared in 1×SDS-PAGE sample loading buffer (50 mM Tris pH7.5, mercaptoethanol, 1% SDS, 0.01% bromophenol blue, 10% glycerol) and resolved by SDS-PAGE. Proteins were transferred to nitrocellulose membrane (Whatman) using a semi-dry blotting apparatus (BioRad) at constant 20V for 1 h. The membrane was blocked in 5% non-fat milk and incubated with primary antibody. Following incubation for 1 h at room temperature, membranes were washed 3 times in TBST (150 mM NaCl, 20 mM Tris-HCl pH 7.5, 0.1% Tween) and incubated with HRP-conjugated secondary antibody for 1 h. Following 3 additional TBST washes, protein bands were visualized using ECL detection reagent (GE Healthcare) and a LAS-4000 imaging system (GE-Healthcare).

PAR-CLIP

[0197] Stably transfected and inducible FLAG/HA-RC3H1 expressing cells were labeled with 100 μM 4-thiouridine (4SU) or 6-thioguanosine (6SG) for 9 h. After labeling the cells, PAR-CLIP was performed essentially as described.sup.17. Briefly, for 4SU-2 and one 6SG, UV-irradiated cells were lysed in NP-40 lysis buffer (50 mM HEPES-KOH at pH 7.4, 150 mM KCl, 2 mM EDTA, 0.5% (v/v) NP40, 0.5 mM DTT, complete EDTA-free protease inhibitor cocktail). After mild treatment with RNaseT1 (Fermentas), immunoprecipitation was carried out with protein G magnetic beads (Invitrogen) coupled to anti-FLAG M2 antibody (SIGMA) from extracts of FLAG/HA-RC3H1 expressing and 4SU labeled HEK 293 cells for 1 h at 4° C. For 4SU-1, a high-salt lysis buffer (50 mM Tris-HCl, 500 mM NaCl, 1% (w/v) NP-40, 1 mM DTT and complete EDTA-free protease inhibitor cocktail) was used for cell lysis followed by sonication. After mild treatment with RNaseT1, purification of the RC3H1/RNA complex was performed with Flag magnetic beads (SIGMA). Following additional digestion by RNase T1 (Fermentas), beads were incubated with calf intestinal phosphatase (NEB) and RNA fragments were radioactively end-labeled using T4 polynucleotide kinase (Fermentas). The crosslinked protein-RNA complexes were resolved on a 4-12% NuPAGE gel (Invitrogen). The SDS-PAGE gel was transferred to a nitrocellulose membrane (Whatman) and the protein-RNA complex migrating at an expected molecular weight was excised. RNA was isolated by Proteinase K (Roche) treatment and phenol-chloroform extraction, ligated to 3′ adapter. (5′-AppTCGTATGCCGTCTTCTGCTTG (SEQ ID NO 44)-InvdT for 4SU-1, 5′-AppTCTCGTATCGTATGCCGTCTTCTGCTTG (SEQ ID NO 45)-InvdT for 4SU-2, 5′-AppTCTCTGCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO 46)-InvdT for 6SG) and 5′ adapter (5′-rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrArUrC(SEQ ID NO 47)), reverse transcribed and PCR-amplified. The amplified cDNA was sequenced on a HighSeq2000 (Illumina) with a 1×51 nt cycle for 4SU-2 and 6SG and on a Genome Analyzer II with a 1×36 cycle for 4SU-1.

PAR-CLIP Data Processing

[0198] The PAR-CLIP cDNA sequencing data were analyzed using the PAR-CLIP analysis pipeline as described previously.sup.20. Reads mapping uniquely to the genome with up to one mismatch, insertion or deletion were used to build clusters of sequence reads, and filtering was performed to obtain RC3H1 clusters sites at an estimated 5% false-positive rate. For each cluster the position with the highest number of diagnostic transition events was determined and we defined this position as the preferred crosslink site. To define the consensus clusters, we pooled reads from all three experiments while ensuring that transition events are counted appropriately (T to C in reads originating from 4SU experiments and G to A only in reads from the 6SG experiment). Before the cutoff determination, clusters had to pass an additional consensus filter, demanding that reads from at least two out of the three experiments support the cluster. The resulting sets of clusters were denoted as the “consensus” set. Read alignment statistics, cluster length distribution, target gene identification, cluster distribution, cluster coverage profiles, conservation profile and miRNA target scan were generated by the PAR-CLIP analysis pipeline as described previously.sup.20. KEGG pathway and GO term enrichment analysis was performed using the on-line DAVID program.sup.42,43 The top 1000 transcripts (ranked by the number of PAR-CLIP diagnostic mutations falling into 3′UTR) were used for pathway enrichment analysis.

Motif Analysis

[0199] 7mer occurrences were counted in 41nt windows around the crosslink site identified in the 4SU and 6SG PAR-CLIP experiments using custom Perl scripts. To examine the enrichment of each 7mer motif, 7mer frequency occurring in RC3H1 consensus 3′UTR binding sites was compared to that occurring in all 3′UTR sequences retrieved from UTRdb.sup.44. The longest 3′UTR sequence for each gene was used in this analysis. To test whether RC3H1 binding sites showed a preferred secondary structure we used the library routines from the Vienna RNA package 1.8.2.sup.45 to compute base pairing probabilities within 41 nt sequences centered on the preferred crosslink positions of 3′UTR binding sites. The resulting profiles were accumulated and averaged over the following sets of binding sites (1) all 3′UTR consensus binding sites (2) Top 1000 3′UTR binding sites that contain AU-rich sequences defined by 6mer consisting of A or U. Ranking is based on the number of diagnostic PAR-CLIP transition divided by microarray expression level of the gene harboring the binding site. (3) Top 1000 3′UTR binding sites that do not contain AU-rich sequences. (4) Negative control 41 nt sequences randomly selected from the 3′UTRs of RC3H1 target transcripts.

siRNA Knockdown and pSILAC

[0200] Flp-In 293 T-REx cells were grown in SILAC medium supplemented with “light” labeled amino acids prior to siRNA knockdown experiments. siRNAs were transfected at a final concentration of 50 nM using Lipofectamine RNAiMAX (Invitrogen). Controls (mock) were treated with transfection reagent only. Following 24 h of incubation, siRNA transfected cells were switched to “medium” labeled SILAC medium, while mock control cells were switched to “heavy” labeled SILAC medium. After 24 h of labeling, cells were harvested and equal amounts of siRNA- and mock-transfected cells were pooled, lysed in urea buffer (8 M urea, 100 mM Tris.Math.HCl, pH 8.3) and sonicated for 20 s (2 pulses, 60% power). Cell debris was removed by centrifugation (14000 g, 5 min). Protein concentration was then measured by the Bradford colorimetric assay. 100 μg of proteins were reduced in 2 mM DTT for 30 min at 25° C. and successively free cysteines were alkylated in 11 mM iodoacetamide for 20 min at room temperature in the dark. LysC digestion was performed by adding LysC (Wako) in a ratio 1:40 (w/w) to the sample and incubating it for 18 h under gentle shaking at 30° C. After LysC digestion, the samples were diluted 3 times with 50 mM ammonium bicarbonate solution, 7 μl of immobilized trypsin (Applied Biosystems) were added and samples were incubated 4 h under rotation at 30° C. Digestion was stopped by acidification with 10 μl of trifluoroacetic acid and trypsin beads were removed by centrifugation. 15 μg of digest were desalted on STAGE Tips, dried and reconstituted to 20 μl of 0.5% acetic acid in water.sup.46. 5 μl of each sample were injected in duplicate on a LC-MS/MS system (nanoLC-Ultra 1D (Eksigent) coupled to LTQ-Orbitrap Velos (Thermo)), using a 240 min gradient ranging from 5% to 40% of solvent B (80% acetonitrile, 0.1% formic acid; solvent A=5% acetonitrile, 0.1% formic acid). For the chromatographic separation ˜25 cm long capillary (75 μm inner diameter) was packed with 1.8 μm C18 beads (Reprosil-AQ, Dr. Maisch). On one end of the capillary nanospray tip was generated using a laser puller (P-2000 Laser Based Micropipette Puller, Sutter Instruments), allowing fritless packing. The nanospray source was operated with spay voltage of 2.1 kV and ion transfer tube temperature of 260° C. Data were acquired in data dependent mode, with one survey MS scan in the Orbitrap mass analyzer (resolution 60000 at m/z 400) followed by up to 20 MS/MS in the ion trap on the most intense ions (intensity threshold=750 counts). Once selected for fragmentation, ions were excluded from further selection for 30 s, in order to increase new sequencing events. Raw data were analyzed using the MaxQuant proteomics pipeline (v1.3.0.5) and the built-in Andromeda search engine.sup.47 with the International Protein Index Human version 3.71 database. Carbamidomethylation of cysteines was chosen as fixed modification, oxidation of methionine and acetylation of N-terminus were chosen as variable modifications. The search engine peptide assignments were filtered at 1% FDR and the feature match between runs was enabled; other parameters were left as default. For SILAC analysis, two ratio counts were set as threshold for quantification

Quantitative PCR

[0201] Cells were harvested and total RNA was isolated using Trizol (Invitrogen) according to manufacturer's protocol. Total RNA was treated with DNaseI (Invitrogen), and complementary DNA (cDNA) synthesis was performed using Superscript III (Invitrogen) with oligo-dT primer (18-20 nt) or random hexamer primer (Invitrogen) according to manufacturer's protocol. qPCR analysis was performed with Power SYBR Green PCR Master Mix (ABI) and ABI light cycler as described in the manufacturers' instructions.

mRNA Decay Assay

[0202] Cells were treated with 5 μg/ml of actinomycin D (Sigma-Aldrich) to block the transcription. At 0, 2 and 4 h post actinomycin D treatment, total RNA was harvested using Trizol (Invitrogen) according to manufacturer's protocol. Abundance of specific RNA was quantified by quantitative RT-PCR. mRNA levels were normalized against RPL18A mRNA and plotted against time.

LNA Transfection

[0203] LNA oligonucleotide (Exiqon) antisense to the RC3H1 bound stem-loop located in the 3′UTR of A20 (+AA+AT+CC+CT+CA+TA+CA+TAA+T) was transfected at a final concentration of 100 nM using Lipofectamine RNAiMAX (Invitrogen). For control experiment, control LNA (Exiqon) targeting RC3H1 unbound region in the 3′UTR of A20 (+TCCA+CCTC+CCCT+CCC+CC+A) was transfected as above. Note that + indicates that the following nucleobase is present as a Locked Nucleic Acid modified residue. For mRNA decay assay after antisense inhibition at 4 h after the transfection of LNA, medium was replaced with fresh medium containing 250 ng/ml of neocarzinostatin (NCS) (Sigma-Aldrich) to induce DNA damage and A20 expression. At an additional 5 h after induction of DNA damage mRNA decay assay was performed. Random hexamer primers (Invitrogen) were used for cDNA generation.

Global Measurement of mRNA Half-Lives

[0204] Measurement of mRNA half-lives was performed as described previously.sup.27.

Recombinant Protein Expression and Purification

[0205] DNA encoding the RING and ROQ domains (RC3H1-N1; aa 2-399) or the RING, ROQ and zf domains (RC3H1-N2; aa 2-452) was subcloned into the pQLinkH vector.sup.48. The genes were expressed as N-terminal His.sub.7-tagged proteins at 17° C. in E. coli Rosetta™ 2 (DE3) (Novagen) using a LEX ultra-high-throughput bench-top bioreactor (Harbinger Biotech). Cells were grown at 37° C. in Terrific Broth medium and induced at an OD.sub.600 of 2.0-2.5 with 0.5 mM isopropyl β-D-1-thiogalactopyranoside. For purification, cells were resuspended in phosphate-buffered saline (PBS) lysis buffer (1×PBS pH 7.4, 0.5 M NaCl, 5% (v/v) glycerol, 0.5 mM DTT), supplemented with 0.25% (w/v) 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate, 0.1 mM phenylmethyl sulfonyl fluoride, 1 U/ml RNase-free DNase I (Qiagen) and one tablet of EDTA-free Complete Protease Inhibitor (Roche). The purification procedure comprises mechanical cell lysis by sonication (SONOPULS HD 2200, Bandelin), an Ni/Zn affinity chromatography on a 5 ml HisTrap FF crude column (GE Healthcare), and a size-exclusion chromatography on a Superdex 200 prep grade column (XK 26×60, GE Healthcare). The His.sub.7 tag was cleaved with tobacco etch virus protease prior to the gel-filtration step, followed by a reapplication of the cleaved protein on the Ni/Zn affinity column. The purification of protein constructs comprising the RING, ROQ and zf domains additionally included a cation-exchange chromatography on a Source 30S column (HR 16×10, GE Healthcare).

EMSA

[0206] The EMSA was performed as described before.sup.49 with the following modifications: RNA was prepared by 5′ end-labeling of commercially synthesized RNA oligonucleotides with [γ-.sup.32P]-ATP using T4 polynucleotide kinase (NEB). Labeled RNA was gel purified and eluted and adjusted with H.sub.2O to 1 pmol/μl. 50 fmol of labelled RNA was used per 20 μl reaction. Prior to binding reactions, a master mix containing labelled RNA, lx binding buffer (20 mM Tris-HCl (pH 7.5), 50 mM KCl, 5 mM MgCl.sub.2, 20 μM ZnSO.sub.4, 10% glycerol), 2 mM DTT, 0.05 mg/ml BSA, and 5 μg/ml heparin was heated at 90° C. for 1 min and gradually cooled down to room temperature. In parallel, a dilution series of 10× protein stocks was prepared in 1× protein dilution buffer (1× binding buffer, 5 μg/ml heparin). For each binding reaction, 2 μl of the 10× protein stock was added to 18 μl of the mastermix at room temperature for 2 h. After addition of 4 μl 6× loading buffer (30% glycerol, bromphenol blue, xylene cyanol), RNP complexes were resolved by nondenaturing PAGE (6% polyacrylamide, 0.5×TBE, 5% glycerol) in ice-cold 0.5×TBE buffer containing 20 μM ZnSO.sub.4 at 100 V for 40 min. The protein-bound RNA and the free RNA were quantified using a phosphorimager.

[0207] EMSA to detect DNA binding activity were performed as described .sup.50.

GFP Reporter Experiment

[0208] Reporter d2GFP plasmid was transfected together with mCherry-N1 using Lipofectamin 2000 (Invitrogen) according to manufacturer's protocol. At 18 h post transfection, cells were acquired by FACS (BD Fortessa) to measure GFP and mCherry signal using FlowJo 8.8.6 (Tree Star). Mean Fluorescence Intensity (MFI) of GFP from mCherry positive cells were normalized for MFI of mCherry.

Microarray Data Processing

[0209] Microarray raw data for DNA damage response and TNF□ response were retrieved from GEO accessions GSE1676 and GSE28548, respectively. Robust Multi-array Average (RMA) background correction and quantile normalization was applied using affyR Bioconductor packages.sup.51. For the analysis of Affymetrix Human Genome U133 Plus 2.0 Array, probe set intensities mapping to the same gene were averaged to summarize into gene intensities, and genes with log 2 steady state expression level smaller than 5 were filtered out.

REFERENCES

[0210] 1. Schoenberg, D. R. & Maquat, L. E. Regulation of cytoplasmic mRNA decay. Nat Rev Genet 13, 246-59 (2012). [0211] 2. Hao, S. & Baltimore, D. The stability of mRNA influences the temporal order of the induction of genes encoding inflammatory molecules. Nat Immunol 10, 281-8 (2009). [0212] 3. Vinuesa, C. G. et al. A RING-type ubiquitin ligase family member required to repress follicular helper T cells and autoimmunity. Nature 435, 452-8 (2005). [0213] 4. Yu, D. et al. Roquin represses autoimmunity by limiting inducible T-cell co-stimulator messenger RNA. Nature 450, 299-303 (2007). [0214] 5. Glasmacher, E. et al. Roquin binds inducible costimulator mRNA and effectors of mRNA decay to induce microRNA-independent post-transcriptional repression. Nat Immunol 11, 725-33 (2010). [0215] 6. Pratama, A. et al. Roquin-2 Shares Functions with Its Paralog Roquin-1 in the Repression of mRNAs Controlling T Follicular Helper Cells and Systemic Inflammation. Immunity 38, 669-80 (2013). [0216] 7. Vogel, K. U. et al. Roquin Paralogs 1 and 2 Redundantly Repress the Icos and Ox40 Costimulator mRNAs and Control Follicular Helper T Cell Differentiation. Immunity 38, 655-68 (2013). [0217] 8. Leppek, K. et al. Roquin promotes constitutive mRNA decay via a conserved class of stem-loop recognition motifs. Cell 153, 869-81 (2013). [0218] 9. Schlundt, A. et al. Structural basis for RNA recognition in roquin-mediated post-transcriptional gene regulation. Nat Struct Mol Biol (2014). [0219] 10. Tan, D., Zhou, M., Kiledjian, M. & Tong, L. The ROQ domain of Roquin recognizes mRNA constitutive-decay element and double-stranded RNA. Nat Struct Mol Biol (2014). [0220] 11. Maruyama, T. et al. Roquin-2 promotes ubiquitin-mediated degradation of ASK1 to regulate stress responses. Sci Signal 7, ra8 (2014). [0221] 12. Brooks, S. A. & Blackshear, P. J. Tristetraprolin (TTP): Interactions with mRNA and proteins, and current thoughts on mechanisms of action. Biochim Biophys Acta (2013). [0222] 13. Mukherjee, N. et al. Global target mRNA specification and regulation by the RNA-binding protein ZFP36. Genome Biol 15, R12 (2014). [0223] 14. Shaw, G. & Kamen, R. A conserved AU sequence from the 3′ untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell 46, 659-67 (1986). [0224] 15. Caput, D. et al. Identification of a common nucleotide sequence in the 3′-untranslated region of mRNA molecules specifying inflammatory mediators. Proc Natl Acad Sci USA 83, 1670-4 (1986). [0225] 16. Chen, C. Y. & Shyu, A. B. AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem Sci 20, 465-70 (1995). [0226] 17. Hafner, M. et al. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell 141, 129-41 (2010). [0227] 18. Shembade, N. & Harhaj, E. W. Regulation of NF-kappaB signaling by the A20 deubiquitinase. Cell Mol Immunol 9, 123-30 (2012). [0228] 19. Ma, A. & Malynn, B. A. A20: linking a complex regulator of ubiquitylation to immunity and human disease. Nat Rev Immunol 12, 774-85 (2012). [0229] 20. Lebedeva, S. et al. Transcriptome-wide analysis of regulatory interactions of the RNA-binding protein HuR. Mol Cell 43, 340-52 (2011). [0230] 21. Anders, G. et al. doRiNA: a database of RNA interactions in post-transcriptional regulation. Nucleic Acids Res 40, D180-6 (2012). [0231] 22. Ogata, H. et al. KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res 27, 29-34 (1999). [0232] 23. Ashburner, M. et al. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 25, 25-9 (2000). [0233] 24. Athanasopoulos, V. et al. The ROQUIN family of proteins localizes to stress granules via the ROQ domain and binds target mRNAs. FEBS J 277, 2109-27 (2010). [0234] 25. Ong, S. E., Foster, L. J. & Mann, M. Mass spectrometric-based approaches in quantitative proteomics. Methods 29, 124-30 (2003). [0235] 26. Doidge, R., Mittal, S., Aslam, A. & Winkler, G. S. Deadenylation of cytoplasmic mRNA by the mammalian Ccr4-Not complex. Biochem Soc Trans 40, 896-901 (2012). [0236] 27. Dolken, L. et al. High-resolution gene expression profiling for simultaneous kinetic parameter analysis of RNA synthesis and decay. RNA 14, 1959-72 (2008). [0237] 28. Selbach, M. et al. Widespread changes in protein synthesis induced by microRNAs. Nature 455, 58-63 (2008). [0238] 29. Elkon, R., Linhart, C., Sharan, R., Shamir, R. & Shiloh, Y. Genome-wide in silico identification of transcriptional regulators controlling the cell cycle in human cells. Genome Res 13, 773-80 (2003). [0239] 30. Corish, P. & Tyler-Smith, C. Attenuation of green fluorescent protein half-life in mammalian cells. Protein Eng 12, 1035-40 (1999). [0240] 31. Arlt, A. & Schafer, H. Role of the immediate early response 3 (IER3) gene in cellular stress response, inflammation and tumorigenesis. Eur J Cell Biol 90, 545-52 (2011). [0241] 32. Renner, F. & Schmitz, M. L. Autoregulatory feedback loops terminating the NF-kappaB response. Trends Biochem Sci 34, 128-35 (2009). [0242] 33. Napetschnig, J. & Wu, H. Molecular basis of NF-kappaB signaling. Annu Rev Biophys 42, 443-68 (2013). [0243] 34. Huang, T. T., Wuerzberger-Davis, S. M., Wu, Z. H. & Miyamoto, S. Sequential modification of NEMO/IKKgamma by SUMO-1 and ubiquitin mediates NF-kappaB activation by genotoxic stress. Cell 115, 565-76 (2003). [0244] 35. Grimley, R. et al. Over expression of wild type or a catalytically dead mutant of Sirtuin 6 does not influence NFkappaB responses. PLoS One 7, e39847 (2012). [0245] 36. Hayden, M. S. & Ghosh, S. NF-kappaB, the first quarter-century: remarkable progress and outstanding questions. Genes Dev 26, 203-34 (2012). [0246] 37. Hinz, M. & Scheidereit, C. The IkappaB kinase complex in NF-kappaB regulation and beyond. EMBO Rep 15, 46-61 (2014). [0247] 38. Bertossi, A. et al. Loss of Roquin induces early death and immune deregulation but not autoimmunity. J Exp Med 208, 1749-56 (2011). [0248] 39. Walle, L. V. et al. Negative regulation of the NLRP3 inflammasome by A20 protects against arthritis. Nature (2014). [0249] 40. Baltz, A. G. et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell 46, 674-90 (2012). [0250] 41. Schwanhausser, B., Gossen, M., Dittmar, G. & Selbach, M. Global analysis of cellular protein translation by pulsed SILAC. Proteomics 9, 205-9 (2009). [0251] 42. Huang da, W., Sherman, B. T. & Lempicki, R. A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 4, 44-57 (2009). [0252] 43. Huang da, W., Sherman, B. T. & Lempicki, R. A. Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res 37, 1-13 (2009). [0253] 44. Grillo, G. et al. UTRdb and UTRsite (RELEASE 2010): a collection of sequences and regulatory motifs of the untranslated regions of eukaryotic mRNAs. Nucleic Acids Res 38, D75-80 (2010). [0254] 45. Hofacker, I. L. RNA secondary structure analysis using the Vienna RNA package. Curr Protoc Bioinformatics Chapter 12, Unit 12 2 (2004). [0255] 46. Rappsilber, J., Ishihama, Y. & Mann, M. Stop and go extraction tips for matrix-assisted laser desorption/ionization, nanoelectrospray, and LC/MS sample pretreatment in proteomics. Anal Chem 75, 663-70 (2003). [0256] 47. Cox, J. et al. Andromeda: a peptide search engine integrated into the MaxQuant environment. J Proteome Res 10, 1794-805 (2011). [0257] 48. Scheich, C., Kummel, D., Soumailakakis, D., Heinemann, U. & Bussow, K. Vectors for co-expression of an unrestricted number of proteins. Nucleic Acids Res 35, e43 (2007). [0258] 49. Ryder, S. P., Recht, M. I. & Williamson, J. R. Quantitative analysis of protein-RNA interactions by gel mobility shift. Methods Mol Biol 488, 99-115 (2008). [0259] 50. Hinz, M. et al. A cytoplasmic ATM-TRAF6-cIAP1 module links nuclear DNA damage signaling to ubiquitin-mediated NF-kappaB activation. Mol Cell 40, 63-74 (2010). [0260] 51. Gautier, L., Cope, L., Bolstad, B. M. & Irizarry, R. A. affy—analysis of Affymetrix GeneChip data at the probe level. Bioinformatics 20, 307-15 (2004). [0261] 52. Raue, A. et al. Lessons learned from quantitative dynamical modeling in systems biology. PLoS One 8, e74335 (2013). [0262] 53. Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 31, 3406-15 (2003). [0263] 54. Wiese, K. C., Glen, E. & Vasudevan, A. jViz.Rna—a java tool for RNA secondary structure visualization. NanoBioscience, IEEE Transactions on 4, 212-218 (2005).