NUCLEIC ACID ANALYSIS

Abstract

A method of analysing for a single stranded nucleic acid present, or potentially present, in a sample comprises a step in which the target nucleic acid (if present in the sample) displaces—and hybridises to—a reporter strand originally present in an interrogating duplex structure comprised of the reporter strand and a displaceable shorter strand. The reporter strand is tagged at or adjacent one end thereof with a reporter moiety capable of providing a detectable signal. The reporter/target duplex structure is such that the reporter strand may be selectively enzymatically digested (e.g. by means of λ-exonuclease) from its end opposite the reporter moiety to release that moiety for direct or indirect detection and regenerate single stranded target, which may then cycle through a plurality of the displacement and digestion steps to result in amplification of signal.

Claims

1. A method of analysing for a single strand target nucleic acid sequence in a target nucleic acid present, or potentially present, in a sample the method comprising the steps of: (i) providing an interrogating duplex nucleic acid structure which comprises (a) a first reporter strand which is specifically hybridizable to the single strand target nucleic acid sequence in the target strand (if present in the sample) and which is tagged at or towards one end thereof with a reporter moiety capable of providing a detectable signal, said reporter strand being configured such that in a reporter/target duplex structure formed by hybridisation of the first reporter strand and the single strand target nucleic acid sequence the reporter strand may be selectively enzymatically digested from its end opposite the reporter moiety to release the hybridised single strand target nucleic acid sequence and the reporter moiety; and (b) a second, displaceable strand shorter than said first reporter strand and hybridised thereto to form the interrogating duplex nucleic acid structure in which the reporter strand provides an interrogating overhang, (ii) providing an enzyme capable of effecting said selective enzymatic digestion of the reporter strand in a duplex structure comprised of the reporter strand and target nucleic acid sequence, and (iii) effecting the analysis under conditions such that the single strand target nucleic acid sequence, if present, displaces the second strand from the interrogating duplex nucleic acid structure and hybridises to the reporter strand with subsequent enzymatic digestion of the reporter strand, and (iv) directly or indirectly detecting for the presence of reporter moiety.

2. A method as claimed in claim 1 wherein the single strand target nucleic acid is present in the sample.

3. A method as claimed in claim 1 effected isothermally.

4. A method as claimed in claim 1 wherein the reporter/target duplex structure formed by hybridisation of the first reporter strand and the single strand target nucleic acid has a blunt end and enzymatic digestion of the reporter strand proceeds from that end of the duplex structure.

5. A method as claimed in claim 4 wherein the target nucleic acid strand is longer than the reporter strand and forms a “tail” in the reporter/target duplex structure.

6. A method as claimed in claim 5 wherein the tail has a maximum length of 200 bases.

7. A method as claimed in claim 4 wherein the blunt end is at the 5′-end of the reporter strand.

8. A method as claimed in claim 1 wherein the 5′-end of the reporter strand is phosphorylated.

9. A method as claimed in claim 8 wherein the enzyme is A-exonuclease.

10. A method as claimed in claim 9 wherein the target nucleic acid is produced in a PCR reaction effected using a primer with a 5-phosphorylated end.

11. A method as claimed in claim 1 wherein the overhang in the interrogating duplex nucleic acid structure has 5 to 20 bases.

12. A method as claimed in claim 11 wherein the overhang in the interrogating duplex nucleic acid structure has 7 to 20 bases.

13. A method as claimed in claim 12 wherein the overhang in the interrogating duplex nucleic acid structure has 15 to 17, preferably 16, bases.

14. A method as claimed in claim 1 wherein the enzyme is A-exonuclease, the reporter strand has a 5′-phosphorylated end, the interrogating overhang has 15 to 20 bases, and the reaction is effected isothermally.

15. A method as claimed in claim 14 wherein, in the reporter/target duplex structure the target nucleic acid strand has a tail having a maximum length of 100 bases.

16. A method as claimed in claim 14 wherein the reaction is effected at a temperature of 35° C. to 40° C., preferably 37° C.

17. A method as claimed in claim 14 wherein the interrogating overhang has a length of 15 to 17 bases.

18. A method as claimed in claim 1 wherein the reporter moiety is a luminescent moiety.

19. A method as claimed in claim 18 wherein the second displaceable strand is provided with a quencher moiety to quench luminescence of the reporter moiety in the interrogating duplex nucleic acid structure.

20. A method as claimed in claim 1 wherein the reporter moiety is an enzyme capable of detecting a signal upon reaction with a substrate.

21. A method as claimed in claim 1 effected in the liquid phase.

22. A method as claimed in claim 1 wherein the interrogating duplex nucleic acid structure is immobilised on a solid phase by virtue of the second displaceable strand being attached to the solid phase.

23. A method as claimed in claim 22 effected in an assay device having a reaction region at which the immobilised interrogating duplex nucleic acid structure is provided and a downstream detection region at which signal resulting from the reporter moiety is detected, said liquid sample flowing from the reaction region to the detection region during the method.

24. A method as claimed in claim 23 wherein the assay device has an upstream sampling region to which the liquid sample is applied, the liquid sample flowing from the sampling region and through the reaction to the detection region during the method.

25. A method as claimed in claim 1 wherein the sample is a liquid sample.

26. A method as claimed in claim 1 effected in an aqueous phosphate-based buffer having a concentration of less than 80 mM of each of sodium and chloride ions.

27. A method as claimed in claim 26 wherein the buffer has a concentration of 20 to 50 mM sodium ions and 2 to 7 mM chloride ions.

28. (canceled)

29. A method as claimed in claim 1 wherein the target nucleic acid sequence is AATTGGTCGCATAACAATAGAAATATATGCCAAG (SEQ ID NO: 20) or a variant thereof having one or two point mutations.

30. A procedure for identifying a target nucleic acid sequence in a target nucleic acid strand in a sample, said target nucleic acid sequence either having a first sequence or a second sequence differing from the first sequence by a base change, wherein the procedure comprises the steps of: (i) effecting method of claim 1 with a reporter strand including a sequence which is fully complementary to said first sequence; and (ii) effecting the method with a reporter strand including a sequence which is fully complementary to said second sequence; and (iii) comparing the results of steps (i) and (ii) to determine whether the target sequence is said first sequence or said second sequence.

Description

[0058] The invention will now be further described, by way of example only, with reference to the accompanying drawings and non-limiting Example. In the drawings:

[0059] FIG. 1 schematically illustrates one embodiment of the method of the invention effected as a solution phase analysis;

[0060] FIG. 2 schematically illustrates a further embodiment of the method of the invention effected using a solid phase support;

[0061] FIG. 3 shows details, in the order indicated, of nucleotide sequences represented as SEQ ID NOS: 1-6 employed in Example 1;

[0062] FIG. 4 schematically illustrates the method of Example 1; and

[0063] FIG. 5 illustrates the results of the Example 1;

[0064] FIG. 6 illustrates the results Example 2;

[0065] FIGS. 7(a) and (b) show details, in the order indicated, of sequences represented as SEQ ID NOS: 7-10 employed in Example 3; and

[0066] FIG. 7(c) illustrates the results of Example 3.

[0067] Reference is firstly made to FIG. 1 which shows a solution phase embodiment of the analysis method of the invention. More specifically, FIG. 1 (a) illustrates an interrogating duplex nucleic acid structure which is comprised of two nucleic acid (DNA) strands hybridised together. More particularly, the interrogating duplex nucleic acid structure comprises: [0068] (a) a first reporter strand which is phosphorylated at its 5′-end and provided with a fluorescent label (Cy5) at its 3′-end; and [0069] (b) a second shorter strand having a sequence complementary to the 3′ end of the reporter strand and being provided at its 5′ end with a BHQ2 (“Black Hole Quencher 2”) moiety at its 5′ end.

[0070] As it will be appreciated from FIG. 1(a) the 5′-region of the reporter strand provides an overhang in the interrogating duplex nucleic acid structure, the purpose of which will be described more fully below.

[0071] The BHQ2 moiety serves to quench the fluorescence of the Cy5.

[0072] Further illustrated in FIG. 1(a) is a single stranded, nucleic acid (DNA) target sequence, shown as having a length greater than the reporter strand. For the purposes of the present description, the reporter strand and the target strand are considered to be fully complementary to each other reading from their 5′ and 3′-ends respectively.

[0073] Further provided in the liquid phase is the enzyme A-exonuclease. The A-exonuclease is not shown in FIG. 1(a) but is illustrated as an ellipse in FIGS. 1(b)-(d).

[0074] Conveniently, the method may be affected by “pre-preparing” the interrogating duplex nucleic acid structure in solution. This solution itself may then be used for the analysis procedure by incorporating the sample to be analysed and the A-exonuclease into the solution. Alternatively, the solution comprising the interrogating duplex nucleic acid structure may be lyophilised for incorporation in a well of an analysis device (e.g. a microtitre plate) in which the analysis is carried out by formation of a liquid mixture containing (or potentially containing) the target sequence and the A-exonuclease.

[0075] The reaction proceeds under hybridising conditions so that the target sequence displaces the quencher oligonucleotide from the reporter and hybridises thereto, as schematically illustrated in FIG. 1(b). In view of their complementary sequences, the reporter and the target hybridised to provide a duplex structure with a blunt end formed by the 5′ end of the reporter and the 3′ end of the target (see FIG. 1(b).

[0076] Given that the reporter has a 5′ phosphorylated end at a blunt end of the duplex structure, the λ-exonuclease now proceeds selectively to digest the reporter strand from its 5′ end, as depicted in FIG. 1(c) by the exonuclease (depicted as an “ellipse”) passing over and along the duplex structure. With full digestion of the reporter strand, the original target strand, the λ-exonuclease molecule used for digestion, and the Cy5 originally bound to the reporter moiety are now all free in the liquid phase.

[0077] The net effect is that the target strand (and the λ-exonuclease) are free to undergo a further sequence of reactions as depicted by FIGS. 1(a)-(d). The overall effect, therefore, is one of signal amplification—namely that each target displaces more than one Cy5 allowing amplification of the fluorescence signal, as compared to the case where the exonuclease is not provided in the analysis mixture (in which case each target strand only serves to displace one quencher strand and thereby only release one Cy5 from its associated BHQ2 quencher).

[0078] This signal amplification is a significant feature of the invention since it allows detection of very low levels of target molecules which (without the amplification provided by the method of the invention) could be insufficient to provide a detectable signal.

[0079] The solution phase embodiment has been described above with specific reference to the reporter moiety being Cy5 and the quencher being BHQ2. It will however be appreciated that other combinations of fluorescent reporter moiety and quencher may be used. Examples of combinations of fluorescent reporter moiety and quencher that may be used are shown in the following table:

TABLE-US-00002 Reporter/Quencher Cy5/BHQ2 Cy5/BHQ1 TexRed/BHQ2 TexRed/QSY7 TexRed/BHQ1 TexRed/Dabcyl Cy3/BHQ2 Cy3/BHQ1 FAM/BHQ2 FAM/QSY7 FAM/BHQ1 Quasar670/BHQ2 CallRed/BHQ2 Quasar570/BHQ2 TAMRA/BHQ2 TAMRA/Dabcyl FAM/BHQ2

[0080] It will however be appreciated that the solution phase analysis as described above will generally require the use of a quencher moiety, in conjunction with the fluorescent reporter moiety. This is of course, to ensure, that in the absence of target nucleic acid, no fluorescence will be generated (since fluorescence emission is dependent on the quencher strand being displaced (by the target nucleic acid) from the fluorescent reporter moiety.

[0081] Detection of fluorescent emission from the Cy5 or other fluorescent reporter moiety that may be used may be detected in the solution phase by any conventional means with the intensity of the (amplified) fluorescence being a quantitative measure of the amount of target nucleic acid in the original sample.

[0082] Reference is now made to FIG. 2 which illustrates a further embodiment of method in accordance with the invention but, in this case, effected using a solid phase support. Preferably, the embodiment of FIG. 2 is effected in an assay device having a flow (e.g. capillary flow) pathway with an upstream sampling region, and a downstream detection region and an intermediate “reaction region” in which the interrogating duplex nucleic acid structure is immobilised, more particularly by virtue of its second strand being linked to (and therefore immobilised on) the solid phase. Similar such assay devices (together with techniques for immobilising nucleic acids on the capillary pathway thereof) are disclosed in WO 2012/049465.

[0083] In such an assay device, a liquid sample (potentially) containing the target nucleic acid sequence is introduced onto the sampling region and is then able to flow (e.g. by capillary action) to a region of the flow (e.g. capillary flow) pathway at which the interrogating duplex nucleic acid structure is immobilised, the flow then continuing to the downstream detection region, which for convenience is a well into which the liquid flows for the purpose of detection signal.

[0084] In principle, the embodiment of FIG. 2 functions in a manner entirely analogous to that described in FIG. 1 to the extent that the target nucleic acid sequence displaces the reporter sequence and hybridises thereto to form a “blunt ended” duplex structure for which the reporter strand is then digested (from its phosphorylated 5′-end) by the λ-exonuclease to release the target nucleic acid strand which is then able to partake in further displacement reactions (i.e. displacement of the reporter strand from the interrogating duplex nucleic acid structure). However, as applied to a flow (e.g. capillary flow) based procedure in which the interrogating duplex nucleic acid structure is immobilised, there are the following differences as compared to the embodiment of FIG. 1.

[0085] Firstly, as indicated above, the interrogating nucleic acid structure is immobilised on the (inner) wall of the flow (e.g. capillary flow) pathway. Although only one such immobilised interrogating duplex nucleic acid structure is illustrated in FIG. 2, there will be many such structures immobilised along the length, and around the interior, of the flow pathway.

[0086] Secondly, the second strand (i.e. the strand that is immobilised on the wall of the flow pathway) does not carry a quencher. Put another way, there is no quenching of the Cy5 or other fluorescent reporter moiety in the interrogating duplex nucleic acid structure.

[0087] Thirdly, it is possible for the reporter moiety to be an enzyme (e.g. Alkaline Phosphatase or Horse Radish Peroxidase) which develops a colour by reaction which a substrate provided at the detection region.

[0088] In an alternative embodiment of the method of the invention using a solid phase support, the latter could, for example, be the internal surface of a well of a microtitre plate on which the interrogating duplex nucleic acid structure is immobilised. For this embodiment, the reporter moiety should be a quenched luminescent moiety, as described for the embodiment of FIG. 1.

[0089] The invention will now be illustrated with reference to the following non-limiting Examples.

EXAMPLE 1

General Description

[0090] This Example demonstrates use of the method of the invention for detecting a 34 nucleotide target sequence from Neisseria Gonorrhoeae CDS 8 in a liquid sample, the method employing a fluorescent label for the purpose of detecting the presence of the nucleic acid. More particularly, the Example demonstrates amplification of the fluorescent signal as compared to a control method not embodying the invention. Additionally, the Example demonstrates the specificity potential of the method of the invention for distinguishing between a wild-type nucleic acid sequence and a similar sequence with at least one point mutation.

[0091] Reference is firstly made to FIGS. 3a and 3b. FIG. 3a shows a conserved sequence in Neisseria Gonorrhoeae CDS 8 incorporating a unique 34 nucleotide sequence highlighted in bold. This 34 nucleotide sequence is currently used in a qPCR method for the detection of Neisseria Gonorrhoeae CDS 8.

[0092] FIG. 3b shows nucleotide sequences (based on the unique sequence) which were used as “reporter”, “Quencher”, “Wild Type” (“WT”) analyte “1 Point Mutation” (“PT1”) analyte and “2 Point Mutation” (“PT2”) analyte sequences used for the purpose of this Example.

[0093] The WT analyte sequence comprised all 34 nucleotides of the unique sequence (i.e. the emphasised sequence—bold or underlined—in FIG. 3(a)). In PT1 and PT2, the mutation(s) is/are represented in lower case letters. Compared to WT, (a) PT1 had one point mutation (C instead of A) three nucleotides from its 3′-end, and (b) PT2 had the same mutation as PT1 and an additional mutation (T instead of A) seven nucleotides from its 3′-end.

[0094] Reading from its 5′-end, the reporter sequence comprised 24 nucleotides which provided a complementary sequence to the first 24 nucleotides reading from the 3′ end of the WT sequence. As shown in FIG. 3b, the reporter sequence was phosphorylated at its 5′-end and carried a Cy5 reporter moiety at its 3′ end. The quencher sequence comprised a 17 nucleotide sequence complementary to the seventeen nucleotide sequence at the 3′ end of the reporter sequence. At its 5′ end, the Quencher sequence carried BHQ2 (“Black Hole Quencher 2”).

[0095] As will be appreciated from a consideration of the sequences shown in FIG. 3b, the reporter sequence (comprised of 24 nucleotides) is capable of hybridising to the quencher sequence (comprised of 17 nucleotides) with a seven base overhang at its 5′ end (i.e. the phosphorylated end). Additionally the reporter sequence is capable of hybridising to the WT sequence (comprised of 34 nucleotides) so that the latter has a ten base overhang at its 5′ end.

[0096] The above described “hybridisation relationship” between the various sequences is illustrated in FIG. 4 and, as it will be appreciated from the following description, the seven base overhang of the reporter sequence in a duplex formed by hybridisation of the reporter sequence and Quencher sequence (in which the fluorescence of Cy5 is quenched) provides a “target” for the WT, PT1 and PT2 analyte sequences. More specifically, the WT, PT1 and PT2 analyte sequences are such that their 3′ ends will hybridise to the aforementioned seven base overhang of the reporter sequence (in the reporter/Quencher duplex) and that will facilitate full hybridisation of the analyte sequence to the reporter sequence and displacement of the Quencher sequence from the reporter sequence to provide for detectable fluorescent emission from Cy5.

[0097] The method of this Example utilises a duplex formed by hybridisation of the reporter and Quencher sequences to “interrogate” samples containing WT, PT1 or PT2 in the presence of λ-exonuclease and provide an amplified signal according to the procedure described more fully above in relation to FIG. 1.

Experimental Procedure

[0098] All oligonucleotides were stored in TE buffer (10 mM Tris-HCl, pH8, 1 mM EDTA) at 10 pmol per μl.

[0099] To produce the interrogating duplex, the reporter and quencher oligonucleotides (in TE buffer as above) were mixed together with additional TE buffer in the following ratio reporter/quencher/TE: 4/10/6 μl i.e. 4 pmol of reporter for every 10 pmol of quencher. The mix was then denatured at 95° C. for 5 mins and allowed to hybridise at RT for at least 1 hr. The duplex mixture was then used as an interrogating duplex in a displacement solution experiment.

[0100] 2 μl of the duplex mixture were added to wells of a black polycarbonate strip. To certain (individual) wells were added 100 fmol of the WT, PT1 and PT2 analyte oligonucleotides (1 μl of their solutions in TE buffer). No analyte oligonucleotides were added to other wells. To each well was added 80 μl of 80% PBS-Tween 0.2% pH9.4-KOH with 5 U of λ-exonuclease and 10 μl of λ-exonuclease buffer (67 mM Glycine-KOH, pH 9.4, 2.5 m M MgCl.sub.2, 50 μg/ml BSA). Liquid volumes in the wells were made up to 100 μl with water.

[0101] The reactions were allowed to proceed at room temperature with measurements made after 20 mins and 40 mins.

[0102] Cy5 fluorescence was measured on a plate reader against a reporter titration curve of 0, 10, 100 and 1000 fmol of reporter oligonucleotide in the presence of 1×λ-exonuclease buffer per 100 μl of 80% PBS-Tween 0.2% pH9.4-KOH. The readout RFU values were converted to displaced fmol by the use of the titration curve and the 0 mol background was subtracted from all analyte treatments to produce the displacement readout.

Results

[0103] The results of the Example are shown in FIGS. 5(a) and 5(b).

[0104] FIG. 5a shows the displacement of the reporter oligonucleotide (minus negative control) for each of the WT, PT1 and PT2 analytes at periods of 20 mins (left-hand bar) and 40 mins (right hand bar). It will be seen that, after 20 mins, the WT analyte had displaced about 74 fmol of reporter oligonucleotide and this figure reached about 146 fmol after 40 minutes. In contrast, the corresponding figures for PT1 were about 35 and about 60 respectively, and those for PT2 were about 18 and 15 respectively.

[0105] Therefore FIG. 5(a) shows that displacement amplification as achieved over time, mostly for the WT analyte.

[0106] FIG. 5(b) shows the displacement ratios of WT analyte to PT1 and PT2 analytes after both 20 minutes and 40 minutes. For the results after 20 minutes, the left-hand bar is the WT/PT1 ratio and the right-hand bar is the WT/PT2 ratio. Similarly, for the results after 40 minutes.

[0107] It will be seen from FIG. 5(b) after 20 minutes that the ratio of WT/PT1 as about 2 and that for WT/PT2 about 4. The corresponding figures for 40 minutes were about 2 and 10 respectively. Generally speaking, therefore, the ratios of WT/PT1 and WT/PT2 increase over time, revealing that amplification is slower for the PT1 and PT2 analytes (than for the WT analyte). This also related to the number of mutations.

EXAMPLE 2

[0108] This Example again demonstrates the specificity of the method of the invention as applied to the WT and PT1 analytes as employed in Example 1.

Experimental Procedure

[0109] All oligonucleotides were stored in TE buffer (10 mM Tris-HCl, pH8, 1 mM EDTA) at 10 pmol per μ1.

[0110] To produce the interrogating duplex, the reporter and quencher oligonucleotides (in TE buffer as above) were mixed together with additional TE buffer in the following ratio reporter/quencher/TE: 4/10/6 μl i.e. 4 pmol of reporter for every 10 pmol of quencher. The mix was then denatured at 95° C. for 5 mins and allowed to hybridise at RT for at least 1 hr. The duplex mixture was then used as an interrogating duplex in a displacement solution experiment.

[0111] 2 μl of the duplex mixture were added to wells of a black polycarbonate strip. To certain (individual) wells were added 10, 10, 50, 100 and 200 fmol of the WT and PT1 analyte oligonucleotides (added in their solutions in TE buffer). No analyte oligonucleotides were added to other wells. To each well was added 80 μl of 80% PBS-Tween 0.2% pH9.4-KOH with 5 U of λ-exonuclease and 10 μl of λ-exonuclease buffer (67 mM Glycine-KOH, pH 9.4, 2.5 m M MgCl.sub.2, 50 μg/ml BSA). Liquid volumes in the wells were made up to 100 μl with water.

[0112] The reactions were allowed to proceed at room temperature with measurements made after 20 minutes and 40 minutes.

[0113] The procedure was also repeated using the indicated concentrations of the analyte oligonucleotide WT and PT1 but omitting the λ-exonuclease.

[0114] Cy5 fluorescence was measured on a plate reader against a reporter titration curve of 0, 10, 100 and 1000 fmol of reporter oligonucleotide per 100 μl of 80% PBS-Tween 0.2% pH9.4-KOH in the presence of 1×λ-exonuclease buffer. The readout RFU values were converted to displaced fmol by the use of the titration curve and the 0 mol background was subtracted from all analyte treatments to produce the displacement readout.

Results

[0115] The results of this Example are shown in FIG. 6.

[0116] FIG. 6 shows the amount of reporter sequence (in fmol) displaced by the WT and PT1 analytes at each concentration used. For any one concentration, the result for the WT analyte is the left-hand bar. Considering firstly the results obtained without inclusion of λ-exonuclease, it will be noted that detectable fluorescence was obtained with both the WT and PT1 analyte sequences, although, for any one concentration of analyte sequence, the strongest signal was always obtained with the WT sequence. Similar specificity was retained in the samples incorporating λ-exonuclease.

[0117] With the exception of the 10 fmol concentration of PT1 analyte (discussed below), a comparison of the results with and without λ-exonuclease for any particular concentration of analyte sequence shows that amplification of the fluorescence signal had been obtained. Consider, for example, the results for 100 fmol. Without λ-exonuclease, the WT and PT1 sequences displaced ca 93.94 fmol and 36.08 fmol of reporter strand respectively whereas in the presence of the λ-exonuclease the corresponding figures were ca 296.82 and 80.49 respectively. Thus, the WT analyte provided a degree of amplification such that, on average, each WT strand displaced three reporter strands. More generally, the results demonstrate amplification to varying degrees for all concentrations of the WT strand. There was also amplification in the case of the PT1 strand. However, for each concentration tested, the degree of amplification was less for the PT1 strand than the WT strand.

[0118] It will be appreciated that a similar experiment using a reporter strand fully complementary to PT1 would provide a set of result in which, for any particular concentration, amplification will be shown to be greater in the case of the PT1 strand than the WT strand.

[0119] It will thus be seen that the method of the invention can readily distinguish between a wild-type sequence and one with a point mutation relative thereto.

[0120] It will be noted that the amount of reporter sequence displaced (measured in fmol) for the 10 fmol concentration of PT1 analyte in the presence of 5 U of λ-exonuclease was negative. This is attributed to the fact that the interrogating overhang in the interrogating duplex structure was 7 bases long. As such, the background digestion of the interrogating duplex structure was relatively high compared to the displacement achieved by the PT1 analyte. Subtraction of the background displacement from the result obtained for the PT1 run provided the negative result, (probably due to more background in the PT1 run than in the control).#

EXAMPLE 3

[0121] This Example demonstrates use of an interrogating duplex nucleic acid structure with a 16 base overhang in an isothermal reaction carried out at 40° C. to improve sensitivity of the method of the invention.

[0122] This Example utilises analyte (WT), reporter and quencher sequences based on the sequence of Neisseria Gonorrhoeae CDS 8 shown in FIG. 7(a).

[0123] The analyte, reporter and quencher sequences are shown in FIG. 7(b). The analyte sequence comprised the 45 nucleotides emphasised in the sequence of FIG. 8(a). The reporter sequence (which was phosphorylated at its 5′-end and provided with a Cy5 moiety at its 3′-end) comprised a 35 nucleotide sequence which reading from its 5′ end was complementary to a 35 nucleotide sequence reading from the 3′-end of the analyte. The quencher sequence comprised a 19 nucleotide sequence which (reading from its 5′-end) was complementary with the 19 nucleotides at the 3′-end of the reporter sequence. At its 5′-end, the quencher sequence was provided with a BHQ2 quencher moiety. An interrogating duplex structure prepared by hybridisation of the quencher and reporter sequences had a 16 base overhang at the 5′-end of the reporter.

Experimental Procedure

[0124] All oligonucleotides were stored in TE buffer (10 mM Tris-HCl, pH8, 1 mM EDTA) at 10 pmol per μl.

[0125] To produce the interrogating duplex, the reporter and quencher oligonucleotides were mixed in the following ratio reporter/quencher ⅓ i.e. 10 μl of reporter and 30 μl of quencher containing in total 100 and 300 pmol of reporter and quencher respectively. The mix was briefly vortexed and boiled at 95° C. degrees in the dark for 3 mins. 460 μl of 1×PBS, pH7.4, 0.2% Tween was added to the 40 μl oligonucleotide mix, and it was vortexed briefly and incubated at RT in the dark for 1 hr. 50 μl of the mix (containing 10 pmol of reporter oligonucleotide in duplex structure) was added per well of device or plate and another 10 μl of 1×PBS, pH7.4, 0.2% Tween was added per well (to give a 60% PBS dilution in 100 μl of reaction volume) together with 0, 10 amol, 100 amol or 1 fmol of analyte sequence, 1×λ-exonuclease buffer and 10 U of λ-exonuclease in a total of volume of 100 μl volume in made up with H.sub.2O 0.2% Tween at 40° C.

[0126] Cy5 fluorescence was measured on a plate reader against a reporter titration curve of 0, 10, 100 and 1000 fmol per 100 μl of 60% PBS-Tween 0.2% pH7.4-KOH, containing 1×λ-exonuclease buffer. The readout RFU values were converted to displaced fmol by the use of the titration curve and the 0 mol background was subtracted from all analyte treatments to produce the displacement readout.

Results

[0127] The results are shown in FIG. 7(c).

[0128] As shown in FIG. 7(c) 10 amol of analyte sequence displaced 4.35 fmol, 100 amol displaced 7.78 fmol and 1 fmol displaced 28.61 fmol achieving amplification ratios (reporter molecules displaced/analyte molecules) of 435, 77.8 and 28.61 respectively (FIG. 3.c). It is a common occurrence that amplification ratios drop as analyte concentration increases. This probably due to the fact that the enzyme saturates at higher concentrations of analyte/reporter displaced duplex. The Example does however demonstrate the sensitivity that can be achieved by the method of the invention using (in this case) a 16 base overhang in the interrogating duplex structure, it being noted that a detectable signal was obtained from a sample containing 10 amol (i.e. 10.sup.−18 mol) of the analyte sequence.

EXAMPLE 4

[0129] This Example demonstrates the effect on the method of the invention using buffers of different composition.

[0130] For the purposes of this Example, a different set of oligonucleotides (“oligos”) was utilised. The sequences of these oligos are shown in Table 2 below.

TABLE-US-00003 TABLE 2 Oligo sequences Oligo Sequence (5′ to 3′) name Function including modifications RG Wild type PO4-CTGTAGAAATCGAAAAATGGGGG reporter CTGTGGCTAAAA-Cy5 SEQ ID NO: 11 QG Wild type BHQ2-TT TTA GCC ACA GCC CCC quencher AT SEQ ID NO: 12 RGM* Mutant PO4-CTGTAGAAATCGAAAAATCGGGG reporter CTGTGGCTAAAA-Cy5 SEQ ID NO: 13 QGM* Mutant BHQ2-TT TTA GCC ACA GCC CCG  quencher AT SEQ ID NO: 14 AG Analyte TTTTAGCCACAGCCCCCATTTTTCGAT TTCTACAG SEQ ID NO: 15 *The point mutation is underlined

[0131] As shown in Table 2, the oligos included wild type reporter and quencher (RG and QG), the same oligos with a single mutation incorporated (RGM and QGM), and an analyte oligo that is 100% complementary to RG (AG). RG/QG and RGM/QGM were used to create duplexes in order to detect the presence of a particular sequence (the AG sequence in this case) in its wild type form and to discriminate to the same sequence harbouring a single point mutation. Both duplexes created a 16 bases overhang (5′ to 3′ on the reporter) after the reporter and the quencher oligos were hybridised and for the double stranded part of the duplex both oligos had 100% complementarity. Since the mutation is incorporated within the double stranded part of the duplex and in order to maintain 100% complementarity the homologous mutations are incorporated on both RGM and QGM oligos. Sequence alignment for both duplexes are shown in Table 3 below.

TABLE-US-00004 TABLE 3 Duplex sequence alignment RG/QG duplex: SEQ ID NO: 11 5′-PO4-CTG TAG AAA TCG AAA AAT GGG GGC TGT GGC TAA AA-Cy5-3′ (RG) SEQ ID NO: 16 3′-TA CCC CCG ACA CCG ATT TT-BHQ2-5′ (QG) RGM/QGM duplex (mutation underlined): SEQ ID NO: 13 5′-PO4-CTG TAG AAA TCG AAA AAT CGG GGC TGT GGC TAA AA-Cy5-3′ (RGM) SEQ ID NO: 17 3′-TA GCC CCG ACA CCG ATT TT-BHQ2-5′ (QGM)

[0132] PBS-0.2% Tween contains 137 mM NaCl, and it is known from the literature that 25, 50 and 100 mM of sodium chloride inhibits lambda exonuclease activity by 52, 82 and 99% respectively (Little et al 1967). The aim of this Example was (a) to test the reaction in buffers containing various concentrations of sodium chloride, and (b) in buffers which were not formulated with sodium chloride per se but which did contain various concentrations of sodium ions and chloride ions.

[0133] Solutions with different concentrations of NaCl (100, 75, 50, 25 and 0% of original PBS NaCl concentration; all buffers contained 0.2% Tween) were prepared as described in Table 4 below. KH.sub.2PO.sub.4 was not added, since its absence does not affect the reaction (data not shown).

TABLE-US-00005 TABLE 4 Reaction buffers (mM) Chemical PBS 100% 75% 50% 25% 0% Na2HPO4 10 10 10 10 10 10 KH2PO4 1.8 — — — — — KCl 2.7 2.7 2.7 2.7 2.7 2.7 NaCl 137 137 103 68.5 34 —

[0134] For the reaction, the AG analyte was used against the RG/QG duplex. The duplex was prepared by mixing together in a single tube 10 pmol of RG and 12 pmol of the QG oligos (in 1 and 1.2 μl of TE respectively), incubating at 95° C. for 3 min, then making the volume up to 50 μl using different buffers. The solution was then left to hybridise for 30 min at room temperature in the dark.

[0135] After hybridisation, the duplex solution was pipetted to the wells of a microplate. 10 μl of the equivalent buffer containing 0 or 100 fmol of analyte oligo AG was added to the duplex solution and initial displacement (Pre) was measured on a plate reader. The volume was made up to 100 μl by adding 1 μl (5 U) of lambda exonuclease, 10 μl of 10×lambda exonuclease buffer (1× final concentrations: 67 mM Glycine-KOH, 2.5 mM MgCl2 and 50 μg/ml of BSA, pH 9.4) and 39 μl of the equivalent buffer. Fluorescence was then read immediately (0 min) and at every 10 min after that, up to 30 min. During the assay the samples were incubated at 37° C. in the dark.

[0136] Each condition was performed in duplicate and the average of each duplicate for 0 mol of AG was subtracted from the average of each duplicate for 100 fmol of AG for each buffer condition at each time point, providing the net gain in signal due to the presence of analyte. The results are shown in Table 5 below.

TABLE-US-00006 TABLE 5 Net fluorescence in RFU (100 fmol minus 0 fmol of AG) Buffer Pre 0 min 10 min 20 min 30 min PBS 228 272 275 369 500 100% 230 249 225 230 215  75% 227 226 214 219 221  50% 211 252 235 296 352  25% 217 245 464 983 1356  0% 132 189 831 1368 1687

[0137] As can be seen from the results in Table 5, the reaction buffer with 0% NaCl provided the greatest net gain in signal from 10 mins onwards. In the subsequent description the 0% buffer is referred to as Phosphate Buffer (PB).

[0138] The procedure described above was repeated with different concentrations of PB i.e. 1×, 2×, 3× and 4×, for which the Na.sub.2HpO.sub.4 and KCl concentrations are shown in Table 6 below.

TABLE-US-00007 TABLE 6 Reaction buffers (mM) Chemical 1× PB 2× PB 3× PB 4× PB Na2HPO4 10 20 30 40 KCl 2.7 5.4 8.1 10.8

[0139] All buffers contained 0.2% Tween.

[0140] The purpose of these repeats was to test for any possible beneficial effects of the PB salts to the reaction. The results are shown in Table 7 below which shows the net fluorescence in RFU after subtracting the averages of 0 fmol from 100 fmol of AG for each buffer condition/time point.

TABLE-US-00008 TABLE 7 Net fluorescence in RFU (100 fmol minus 0 fmol of AG) Buffer Pre 0 min 10 min 20 min 30 min 1× PB 273 331 1602 2217 2173 2× PB 324 378 1403 2387 3017 3× PB 317 356 1020 1904 2457 4× PB 294 320 583 1047 1380

[0141] It can be seen from Table 7 that reaction buffer 2×PB provided the greatest net gain from 20 mins onwards. Therefore since 2×PB produced the best net fluorescence effect, it (2×PB) was chosen as reaction buffer for the purposes of Example 5 below.

EXAMPLE 5

[0142] This Example demonstrates application of the method of the invention to PCR amplicons.

[0143] The Examples used the same oligos as listed in Table 2 above together with the primers shown in Table 8 below.

TABLE-US-00009 TABLE 8 Oligo sequences Oligo Sequence (5′ to 3′) name Function including modifications PO4-FW Phosphorylated PO4-CTGTAGAAATCGAAAA forward primer ATGGGG SEQ ID NO: 18 REV Reverse primer TCTTGGTTCTTTATTTCTAC TTGGC SEQ ID NO: 19

[0144] In brief, an amplicon was generated in a PCR reaction in which one of the primers was phosphorylated on the 5′ end (primer PO4-FW), therefore generating an amplicon with one of the strands phosphorylated on the 5′ end. This strand was recognised by the enzyme (λ-exonuclease) and the phosphorylated strand was digested, releasing the non-phosphorylated strand (the analyte strand). The 3′ end of the analyte strand hybridised to the 5′ end of the reporter and induced displacement. The reporter on the displaced duplex was digested by the enzyme, releasing the analyte for downstream displacement. If analyte to reporter hybridization is not 100% specific the reaction would be delayed or blocked, therefore duplexes of appropriate sequences can be utilised in point mutation analysis.

[0145] 5 μl of DNA extracted from 12 Neisseria gonorrhoea-positive urine pellet clinical samples derived from 10 ml of urine was used as a template in a PCR reaction (50 μl). The PCR ingredient concentrations per 50 μl of reaction volume are shown in Table 9 and the PCR cycling protocol is shown in Table 10.

TABLE-US-00010 TABLE 9 Reagents Concentration/volume/units 1× Taq buffer Tris-HCl   10 mM KCl   50 mM MgCl2  1.5 mM Template DNA    5 μl PO4-FW   10 pmol REV   10 pmol Taq DNA polymerase 0.625 U dNTPs (dATP, dCTP, dGTP,   200 μM of each dTTP)

TABLE-US-00011 TABLE 10 Number of cycles Step Temp (° C.) Time (sec)  1× Initial denaturation 95 30 30× Denaturation 95 30 Annealing 57 60 Extension 68 60  1× Final extension 68 300 Hold Hold 12 ∞

[0146] After the end of the PCR reaction, 10 μl of each amplicon was used as an analyte against duplexes RG/QG and RGM/QGM. The duplexes and the set-up of the experiment was as above (in 2×PB-0.2% Tween), apart from the fact that 10 μl of amplicon was used instead of 10 μl of reaction buffer plus 0 and 100 fmol of oligo AG. All conditions were in duplicate and net fluorescence was calculated by subtracting the RGM/QGM (mutant duplex) signal from the RG/QG (wild type) signal. The results are included in Table 11 below which shows net fluorescence in RFU after subtracting the averages of the RGM/QGM from the RG/QG signal for Neisseria gonorrhoea-positive sample/time point.

TABLE-US-00012 TABLE 11 Net fluorescence in RFU (RGM/QGM minus the RG/QG signal) Sample Pre 0 min 10 min 20 min 30 min 1 −276 −151 1744 3482 4891 2 −261 −108 1934 3948 5416 3 −232 −214 159 601 1096 4 −243 −237 245 704 1163 5 −257 291 2344 4146 5566 6 −257 19 1359 2580 3440 7 −256 355 2476 4184 5450 8 −255 −8 2217 4281 5719 9 −218 −116 2205 4109 5652 10 −220 −5 1167 2207 2976 11 −233 −71 1088 2166 2954 12 −222 25 1007 1875 2637

[0147] In all cases net fluorescence increased with time, indicating that the analyte sequence in question did not contain the mutation introduced in duplex RGM/QGM. The same effect was also observed by the use of oligo AG (wild type oligo) vs the RG/QG and RGM/QGM duplexes (data not shown). Because the RGM/QGM duplex exhibited a slightly higher background fluorescence than the RG/QG duplex net gain was negative for the Pre and some of the 0 min conditions. However, the net gain turned positive soon after λ-exonuclease was introduced to the reaction (10 mins) and kept increasing with time

REFERENCES

[0148] Little, J. W. Lehman, I. R. Kaiser, A. D. (1967) An exonuclease induced by bacteriophage λ I. preparation of the crystalline enzyme. The Journal of Biological Chemistry. 242(4): 672-678 [0149] P G Mitsis and J G Kwaqh (1999) Characterization of the interaction of lambda exonuclease with the ends of DNA. Nucleic Acids Res. 27(15): 3057-3063. [0150] C. S. Karapetis (2008) K-ras Mutations and Benefit from Cetuximab in Advanced Colorectal Cancer. The New England Journal of Medicine, 359 (17):1757-1765. [0151] Rogers, G. S. and Weiss, B. (1980). L. Grossman and K. Moldave (Ed.), Methods Enzymol. 65, 201-211. New York: Academic Press.