Method For Screening Interfering Molecules

20170298351 · 2017-10-19

    Inventors

    Cpc classification

    International classification

    Abstract

    A method for screening interfering nucleic acids enhancing the expression or the activity of expressed gene sequences is described. The method includes a step of introducing, into a cell, a hybrid nucleic acid molecule having: a first non-coding sequence intended to initiate translation; a second sequence complementary to the interfering nucleic acids to be screened; and, optionally, a third nucleotide sequence encoding at least one pre-determined peptide, the first sequence being modified such that the translation level of the at least one peptide is reduced by at least 10%.

    Claims

    1-12. (canceled)

    13. A method for screening interfering nucleic acids increasing: gene expression and/or the activity of genes and/or of ribonucleic acids transcribed from said genes, said interfering nucleic acids having at least partial sequence complementarity with said gene or said RNA, and said method comprising a step of introducing, into an eukaryotic cell, a hybrid nucleic acid molecule comprising: a first non-coding sequence intended to initiate translation, a second sequence at least partially complementary to the sequence of said interfering nucleic acids to be screened, a third nucleotide sequence encoding at least one determined peptide, said third sequence being under cis translational control of the first sequence, said first sequence being modified, by substitution, deletion or addition of at least one nucleotide, such that the level of translation of said at least one peptide is reduced by at least 10% relative to the level of translation of said at least one peptide under control of said first sequence in its unmodified version.

    14. The method according to claim 13, wherein the eukaryotic cell is capable of RNA interference.

    15. The method according to claim 13, wherein the hybrid nucleic acid molecule comprises said first sequence positioned upstream of said third sequence.

    16. The method according to claim 13, wherein said nucleic acid molecule is a molecule of deoxyribonucleic acids or a molecule of ribonucleic acids.

    17. The method according to claim 16, wherein the nucleic acid molecule is contained in a vector.

    18. The method according to claim 13, wherein said first sequence is a Kozak sequence represented, in its unmodified version, by the following sequence: 5′-ssmRccA(T/U)GG-3′ (SEQ ID NO: 1) wherein R represents a purine, s represents G or C and m represents A/U or C.

    19. The method according to claim 13, wherein said first sequence is a Kozak sequence comprising or consisting of, in its modified version, one of the following sequences: SEQ ID NO: 4 or SEQ ID NO: 5

    20. The method according to claim 13, wherein said second sequence comprises from 18 to 10 000 nucleotides at least partially complementary to the sequence of said interfering nucleic acids.

    21. A hybrid nucleic acid molecule comprising: a first non-coding sequence intended to initiate translation, a second sequence at least partially complementary to at least one interfering nucleic acid, and a third nucleotide sequence encoding at least one determined peptide, said third sequence being under cis translational control of the first sequence, said first sequence being modified, by substitution, deletion or addition of at least one nucleotide, such that the level of translation of said at least one peptide is reduced by at least 10% relative to the level of translation of said at least one peptide under control of said first sequence in its unmodified version.

    22. The hybrid nucleic acid molecule according to claim 21, wherein said nucleic acid molecule is chosen from molecules with the following sequence: SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, and SEQ ID NO: 128.

    23. A eukaryotic cell comprising the at least one hybrid nucleic acid molecule as defined in claim 21.

    24. A kit, comprising: the at least one nucleic acid molecule as claimed in claim 21, and at least one eukaryotic cell.

    25. The kit of claim 24, further comprising: means for transforming a eukaryotic cell by said hybrid nucleic acid molecule.

    26. A kit, comprising: the at least one nucleic acid molecule as claimed in claim 21, and means for transforming a eukaryotic cell by said hybrid nucleic acid molecule.

    27. An intermediate hybrid nucleic acid molecule comprising: a first non-coding sequence intended to initiate translation, a third nucleotide sequence encoding at least one determined peptide, said third sequence being under cis translational control of the first sequence and at least one site for cleavage by a restriction enzyme, enabling the insertion nucleic acid molecule having a sequence complementary to an interfering nucleic acid, said first sequence being modified, by substitution, deletion or addition of at least one nucleotide, such that the level of translation of said at least one peptide is reduced by at least 10% relative to the level of translation of said at least one peptide under control of said first sequence in its unmodified version.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0184] FIG. 1 schematically describes the different types of hybrid nucleic acid molecules described in the invention. 1 schematically represents the first sequence, 2 schematically represents the second sequence, and 3 schematically represents the third sequence. 3* represents the third sequence into which the second sequence has been inserted. n represents a sequence which is neither the first, nor the second, nor the third sequence.

    [0185] FIG. 2 represents the diagrams resulting from sequencing of the first sequence of the hybrid nucleic acid molecule having a first, unmutated, sequence (top diagram) and of the first sequence of the hybrid nucleic acid molecule having a first sequence mutated by an insertion of an AT dinucleotide, indicated by the ellipse (top diagram).

    [0186] FIG. 3 represents the alignment of the hybrid nucleic acid molecule SEQ ID NO: 120 with the sequences of interfering nucleic acid molecules tested. The sequence numbers (SEQ ID) are indicated.

    [0187] FIG. 4 represents a Western blot produced from cells having the hybrid nucleic acid molecule SEQ ID NO: 120 and transfected with siRNAs SEQ ID NO: 138 (1), SEQ ID NO: 140 (3), SEQ ID NO: 142 (5), SEQ ID NO: 144 (7), control SEQ ID NO: 161/162 (T.), SEQ ID NO: 150 (F3), SEQ ID NO: 152 (F5), SEQ ID NO: 153 (F6) or SEQ ID NO: 154 (F-M). The proteins are revealed with an anti-HA antibody (B.). As control, the protein loading is revealed with an anti-actin antibody (A.).

    [0188] FIG. 5 represents a Western blot produced from cells having the hybrid nucleic acid molecule SEQ ID NO: 120, non-transfected (−) or transfected with the control siRNAs SEQ ID NO: 161/162 (T.), SEQ ID NO: 146 (F-N), SEQ ID NO: 149 (F2), SEQ ID NO: 148 (F), SEQ ID NO: 142 (5) or SEQ ID NO: 145 (CT). The proteins are revealed with an anti-HA antibody (B.). As control, the protein loading is revealed with an anti-actin antibody (A.).

    [0189] FIGS. 6A and 6B represent the comparison of the effect of the mutation of the first sequence of the hybrid nucleic acid molecule.

    [0190] FIG. 6A represents a Western blot produced from cells having the hybrid nucleic acid molecule SEQ ID NO: 136 transfected with the control siRNAs SEQ ID NO: 161/162 (T.), SEQ ID NO: 150 (F3) or SEQ ID NO: 154 (F-M). The proteins are revealed with an anti-HA antibody (B.). As control, the protein loading is revealed with an anti-actin antibody (A.).

    [0191] FIG. 6B represents a Western blot produced from cells having the hybrid nucleic acid molecule SEQ ID NO: 120 transfected with the control siRNAs SEQ ID NO: 161/162 (T.), SEQ ID NO: 150 (F3) or SEQ ID NO: 154 (F-M). The proteins are revealed with an anti-HA antibody (B.). As control, the protein loading is revealed with an anti-actin antibody (A.).

    [0192] FIG. 7 represents a histogram of FRET results representing the amount of expression of CD1 in cells having the sequence SEQ ID NO: 1 transfected with one of the following siRNAs: SEQ ID NO: 146 (B), SEQ ID NO: 147 (C), SEQ ID NO: 148 (D), SEQ ID NO: 149 (E), SEQ ID NO: 150 (F), SEQ ID NO: 151 (G), SEQ ID NO: 152 (H), SEQ ID NO: 153 (I), SEQ ID NO: 155 (J), SEQ ID NO: 156 (K), SEQ ID NO: 154 (L), SEQ ID NO: 137 (M), SEQ ID NO: 138 (N), SEQ ID NO: 139 (0), SEQ ID NO: 140 (P), SEQ ID NO: 141 (Q), SEQ ID NO: 142 (R), SEQ ID NO: 143 (S), SEQ ID NO: 144 (T) or SEQ ID NO: 145 (U), compared to cells having the sequence SEQ ID NO: 120 and transfected with the control siRNAs (SEQ ID NO: 161/162). The results are expressed as percentages. As control, the results obtained for non-transfected cells (U) are presented. siRNAs increasing expression are indicated by an arrow.

    [0193] FIG. 8 represents a Western blot produced from cells having the hybrid nucleic acid molecule SEQ ID NO: 121 and transfected with siRNAs SEQ ID NO: 139 (2), SEQ ID NO: 140 (3), SEQ ID NO: 142 (5), SEQ ID NO: 144 (7), control SEQ ID NO: 161/162 (T.), SEQ ID NO: 150 (F3), SEQ ID NO: 152 (F5), SEQ ID NO: 153 (F6) or SEQ ID NO: 154 (F-M). The proteins are revealed with an anti-HA antibody (B.). As control, the protein loading is revealed with an anti-actin antibody (A.).

    [0194] FIG. 9 represents a Western blot produced from cells having the hybrid nucleic acid molecule SEQ ID NO: 121 and transfected with siRNAs SEQ ID NO: 139 (2), SEQ ID NO: 140 (3), SEQ ID NO: 142 (5), SEQ ID NO: 144 (7), control SEQ ID NO: 161/162 (T.), SEQ ID NO: 150 (F3), SEQ ID NO: 152 (F5), SEQ ID NO: 153 (F6) or SEQ ID NO: 154 (F-M). The proteins are revealed with an anti-HA antibody (B.). As control, the protein loading is revealed with an anti-actin antibody (A.).

    [0195] FIG. 10 represents a histogram of FRET results representing the amount of expression of CD1 (in arbitrary units) in cells having a construct with the murine Kozak sequence (A), the murine Kozak sequence mutated by AT insertion (B) or the optimized Kozak sequence (C). The error bars indicate the standard deviation obtained for three independent experiments.

    [0196] FIG. 11 represents a Western blot produced from cells having a construct with the murine Kozak sequence (A), the murine Kozak sequence mutated by AT insertion (B) or the optimized Kozak sequence (C). The level of cyclin D1 is revealed with an anti-cyclin D1 antibody (1. RB-010-PABX (AB3), Fisher Scientific). As control, the protein loading is revealed with an anti-actin antibody (2. ab6276, Abcam).

    [0197] FIG. 12 represents a histogram showing the abundance of cyclin D1 messenger RNAs in cells having a construct with the murine Kozak sequence (A), the murine Kozak sequence mutated by AT insertion (B) or the optimized Kozak sequence (C).

    [0198] FIG. 13 represents a histogram of FRET results representing the amount of expression of CD1 (in arbitrary units) in cells having one of the following constructs: [0199] N-terminal-tagged cyclin D1 under the control of the murine cyclin D1 Kozak having an AT insertion (Ntag-mKozAT); black bars, [0200] N-terminal-tagged cyclin D1 under the control of the murine cyclin D1 Kozak (Ntag-mKoz); white bars, [0201] C-terminal-tagged cyclin D1 under the control of the murine cyclin D1 AT Kozak (Ctag-mKozAT); gray bars, [0202] C-terminal-tagged cyclin D1 under the control of the murine cyclin D1 Kozak having an AT insertion (Ctag-mKozAT); diagonally striped bars, and [0203] N-terminal-tagged cyclin D1 under the control of the murine cyclin D1 Kozak optimized to increase expression (Ntag-KozOPT); horizontally striped bars, [0204] treated with different siRNAs: irrelevant control (A); siRNA SEQ ID NO: 149/150 (B), siRNA SEQ ID NO: 155 (C), siRNA SEQ ID NO: 154 (D) and siRNA SEQ ID NO: 142 (C).

    DETAILED DESCRIPTION OF THE INVENTION

    EXAMPLES

    Example 1

    Example of a Construction of a Hybrid Nucleic Acid Molecule Comprising the First Sequence SEQ ID NO: 37 (AT Insertion).

    [0205] In order to obtain a construct comprising a mutated first sequence represented by the sequence SEQ ID NO: 36, the inventors used a strategy of site-directed mutagenesis by introducing, into the Kozak sequence SEQ ID NO: 9, an AT dinucleotide by PCR using the GeneArt® (Life Technology) kit, following the manufacturer's instructions.

    [0206] Put briefly, the insertion is carried out by means of the template vector comprising the sequence SEQ ID NO: 9 and sense and antisense oligonucleotides containing the AT mutation/insertion;

    TABLE-US-00008 sense: (SEQ ID NO: 132) 5′-TGGTACGGCgccaccATatggactacaaggac-3′, antisense: (SEQ ID NO: 133) 5′-gtccttgtagtccatATggtggcGCCGTACCA-3′.

    [0207] The polymerase chain reaction (PCR) is carried out under the following conditions: [0208] Step 1—methylation of the template plasmid: 20 minutes at 37° C. [0209] Step 2—PCR/mutagenesis [0210] a—1 cycle of 2 minutes at 95° C. [0211] b—1 cycle of 30 seconds at 95° C. [0212] 1 cycle of 30 seconds at 60° C. [0213] 1 cycle of 4 minutes at 68° C. [0214] c—Return to b 35 times [0215] d—1 cycle of 5 minutes at 68° C. [0216] e—1 cycle of undefined duration at 4° C. to preserve the reaction product.

    [0217] The PCR products obtained in this way are then sequenced and the vectors comprising the sequence SEQ ID NO: 59 are selected.

    [0218] FIG. 2 shows the results of the sequencing.

    Example 2

    Example of Construction of a Hybrid Nucleic Acid Molecule Comprising the First Sequence SEQ ID NO: 36 (G->T Substitution).

    [0219] In order to obtain a hybrid nucleic acid molecule comprising a first sequence mutated by substitution of the G located just after the ATG by a T, it is sufficient: [0220] 1—either to replace the tag by supplying a tag which starts with T instead of G (HA instead of FLAG, for example), [0221] 2—or to insert a triplet (1 codon) in order to add an amino acid encoded by a codon which starts with a T. It is necessary to add 3 bases (or a multiple of 3) to retain the open reading frame for translation of the ensuing reporter peptide.

    [0222] In the case in which the modification of the coding sequence is unimportant, it is also possible to carry out site-directed mutagenesis as indicated in example 1, using the following oligonucleotides:

    TABLE-US-00009 sense: (SEQ ID NO: 157) 5′-TGGTACGGCgccaccatgTTRactacaaggac-3′, R being a purine antisense: (SEQ ID NO: 158) 5′-gtccttgtagtYAAcatggtggcGCCGTACCA-3′, Y being a pyrimidine.

    Example 3

    Example of Transformation of Eukaryotic Cells by the Hybrid Nucleic Acid Molecule

    [0223] Depending on the experiments to be carried out, several transfection techniques may be used:

    [0224] a) Transfection with Lipofectamine® 3000 (Invitrogen).

    [0225] This method makes it possible to rapidly and transiently transfect the cells with the hybrid nucleic acid constructs. The transfection is carried out according to the manufacturer's instructions.

    [0226] b) Viral infection after production of virus containing the constructs of interest.

    [0227] In order to obtain cells which stably express a hybrid nucleic acid molecule according to the invention, the inventors made use of viral infection.

    [0228] The protocol used is as follows:

    [0229] Day 1: 3×10.sup.6 293T cells in exponential growth are seeded in 100 mm dishes with 10 ml of complete medium (DMEM, 10% fetal calf serum, penicillin, streptomycin and L-glutamine) and incubated at 37° C. overnight.

    [0230] Day 2: 2 to 3 hours before transfection, the culture medium is changed in order to limit pH variations.

    [0231] The following plasmids are added, in this order, into a tube: [0232] 12 μg of MSCV vector or of retroviral vector comprising the hybrid nucleic acid molecule, [0233] 6 μg of Gag-pol plasmid, and [0234] 2 μg of Eco plasmid (specific viral recognition protein of murine cells, used for safety reasons linked to GMO manipulations).

    [0235] 500 μl of sterile water are then added to the vectors. 500 μl of 2× HBS buffer are then added, and everything is agitated without however being subjected to vortex agitation. Finally, 50 μl of a solution of CaCl.sub.2, pH 5.5, is added, and the mixture is agitated without however being subjected to vortex agitation. The HSB 2× medium is prepared in the following way: 0.8 g of NaCl, 0.027 g of Na.sub.2HPO.sub.4.2H.sub.2O, and 1.2 g of HEPES are dissolved in a volume of 90 ml of distilled water. The pH is adjusted to 7.05 with 0.5 N NaOH, and the volume is adjusted to 100 ml with distilled water. The solution is sterilized by filtering it through a filter with 0.22 μm pores, and the solution is aliquoted by 5 ml before freezing at −20° C. for a maximum duration of one year.

    [0236] The mixture is left at room temperature for 20 to 30 min with occasional gentle agitation.

    [0237] The mixture is then added to the culture medium and the cells are incubated at 37° C. overnight.

    [0238] Day 3: On the morning of the third day, approximately half of the medium is changed. The medium is then conserved at 4° C. The operation is repeated every 6 hours and the supernatant conserved at 4° C. In the evening, the supernatants are mixed and optionally centrifuged at 10 000 rpm overnight.

    [0239] Day 4: The viruses are recovered, and the medium is changed three times during the day to keep the viruses infectious.

    [0240] Day 5: The viruses are filtered on a 0.45 μm filter and used to infect NIH3T3 cells for 1 to 2 hours in a volume of 1.5 to 2 ml comprising 8 μg/ml of polybrene. 10 ml of medium are then added and the cells incubated overnight.

    [0241] Day 6: the medium is changed with 10 ml of fresh medium.

    [0242] Days 8 and 9: the cells are then analyzed by flow cytometry to test the expression of fluorescent proteins.

    [0243] The cells are then infected with the molecule.

    Example 4

    Example of Screening of Interfering Nucleic Acid Molecules Increasing Gene Expression and/or the Activity of Genes and/or of Ribonucleic Acids Transcribed from Said Genes

    [0244] 1. Protocol [0245] Cell Culture: [0246] the stable cells expressing the hybrid nucleic acid construct are kept in sub-confluent culture at 37° C., 5% CO.sub.2 in an incubator. [0247] Plating:

    [0248] On the morning of the transfection of the siRNAs to be screened, the stock cells expressing the hybrid construct are treated with trypsin to detach them from the culture support and seeded in 24-well plates in order to achieve 40 to 80% confluence of adherent cells by the evening. [0249] Preparation of the siRNAs and Transfection:

    [0250] The siRNAs to be tested are prepared according to the Lipofectamine® RNAiMAX Reagent (Life Technologies) protocol. Put briefly, 1.5 μl of Lipofectamine® are diluted in 25 μl of OPTI-MEM® medium. In parallel, 5 pmol of siRNA in 0.5 μl of sterile water are diluted in 25 μl of OPTI-MEM® medium. The two solutions of OPTI-MEM® are then mixed and incubated for 5 minutes at room temperature.

    [0251] The preceding 50 μl mixture is then added into each well. The cells are incubated at 37° C. until the following day. [0252] Analysis of the Results:

    [0253] The following day, the cells are washed with PBS then lyzed by means of a lysis buffer (10 mM TRIS pH=8, 1 mM EDTA, 0.05% NP-40, +/−ROCHE-cOmplete-protease inhibitors) and a step of sonication at a rate of 5 sonication cycles with a bioruptor (Diagenode), composed of 15′ of active sonication (maximum power of the apparatus) followed by 15′ pause, in order to recover the intracellular proteins, especially the fusion protein produced by the hybrid sequence. The protein lysates of the different conditions tested are then standardized by means of DNA or protein quantification, in order to compare an equivalent total amount of material originating from the different treatment conditions. The standardized lysates are then analyzed by Western blot by means of an antibody specific to the translation product of the hybrid construct, or by FRET measurement, or by fluorescence measurement if the translation product of the hybrid construct enables it.

    [0254] 2—Results

    [0255] a) Mutation by AT Insertion

    [0256] In a first series of experiments, the inventors carried out screening of interfering molecules according to the invention using the hybrid nucleic acid molecule SEQ ID NO: 220. In this molecule:

    TABLE-US-00010 the first sequence is CGCGCCATatgg, (SEQ ID NO: 62) [0257] the second sequence is:

    TABLE-US-00011 (SEQ ID NO: 134) ACTACAAGGACGACGATGACAAGCTCGATGGAGGATACCCCTACGACGTG CCCGACTACGCCGGAGGACTCGAGG, and corresponds to a FLAG-spacer-HA-spacer sequence, [0258] and the third sequence is:

    TABLE-US-00012 (SEQ ID NO: 135) AACACCAGCTCCTGTGCTGCGAAGTGGAGACCATCCGCCGCGCGTACCCT GACACCAATCTCCTCAACGACCGGGTGCTGCGAGCCATGCTCAAGACGGA GGAGACCTGTGCGCCCTCCGTATCTTACTTCAAGTGCGTGCAGAAGGAGA TTGTGCCATCCATGCGGAAAATCGTGGCCACCTGGATGCTGGAGGTCTGT GAGGAGCAGAAGTGCGAAGAGGAGGTCTTCCCGCTGGCCATGAACTACCT GGACCGCTTCCTGTCCCTGGAGCCCTTGAAGAAGAGCCGCCTGCAGCTGC TGGGGGCCACCTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATTCCC TTGACTGCCGAGAAGTTGTGCATCTACACTGACAACTCTATCCGGCCCGA GGAGCTGCTGCAAATGGAACTGCTTCTGGTGAACAAGCTCAAGTGGAACC TGGCCGCCATGACTCCCCACGATTTCATCGAACACTTCCTCTCCAAAATG CCAGAGGCGGATGAGAACAAGCAGACCATCCGCAAGCATGCACAGACCTT TGTGGCCCTCTGTGCCACAGATGTGAAGTTCATTTCCAACCCACCCTCCA TGGTAGCTGCTGGGAGCGTGGTGGCTGCGATGCAAGGCCTGAACCTGGGC AGCCCCAACAACTTCCTCTCCTGCTACCGCACAACGCACTTTCTTTCCAG AGTCATCAAGTGTGACCCGGACTGCCTCCGTGCCTGCCAGGAACAGATTG AAGCCCTTCTGGAGTCAAGCCTGCGCCAGGCCCAGCAGAACGTCGACCCC AAGGCCACTGAGGAGGAGGGGGAAGTGGAGGAAGAGGCTGGTCTGGCCTG CACGCCCACCGACGTGCGAGATGTGGACATC.

    [0259] Under the experimental conditions as described above, the inventors tested the following different interfering nucleic acids (siRNAs):

    TABLE-US-00013 HA linker Nter: GAGCUACCUCCUAUGGGGAUG, (SEQ ID NO: 137) HA: AUGCUGCACGGGCUGAUGCGG, (SEQ ID NO: 138) HA 2: GGGAUGCUGCACGGGCUGAUG, (SEQ ID NO: 139) HA 3: AUGGGGAUGCUGCACGGGCUG, (SEQ ID NO: 140) HA 4: UGGGGAUGCUGCACGGGCUGA, (SEQ ID NO: 141) HA 5: GGGGAUGCUGCACGGGCUGAU, (SEQ ID NO: 142) HA 6: GGAUGCUGCACGGGCUGAUGC, (SEQ ID NO: 143) HA 7: GAUGCUGCACGGGCUGAUGCG, (SEQ ID NO: 144) HA Linker Cter: AGCCGGCGACCUCCUAUGGGG, (SEQ ID NO: 145) FLAG N: CUGCUGCUACUGUUCGAGCUA, (SEQ ID NO: 146) FLAG N2: UUCCUGCUGCUACUGUUCGAG, (SEQ ID NO: 147) FLAG: AUGUUCCUGCUGCUACUGUUC, (SEQ ID NO: 148) FLAG V2: CUGAUGUUCCUGCUGCUACUG, (SEQ ID NO: 149) FLAG 3: CUGAUGUUCCUGCUGCUACUG, (SEQ ID NO: 150) FLAG 4: UGAUGUUCCUGCUGCUACUGU, (SEQ ID NO: 151) FLAG 5: GAUGUUCCUGCUGCUACUGUU, (SEQ ID NO: 152) FLAG 6: ACCUGAUGUUCCUGCUGCUAC, (SEQ ID NO: 153) FLAG M: AUGUUCCUGCUGCUGCUAUUC, (SEQ ID NO: 154) FLAG + linker Cter: CUGCUGCUACUGUUCAGCCGG, (SEQ ID NO: 155) and FLAG Cter2 ha ct: UUCCUGCUGCUACUGUUCAGC. (SEQ ID NO: 156)

    [0260] In order to facilitate reading, FIG. 3 represents the alignment of the different interfering nucleic acids (siRNAs) tested are on the sequence of the molecule SEQ ID NO: 120.

    [0261] As siRNA transfection control, the negative control siRNAs (“scramble”; T.) are also transfected. These siRNAs have the following sense sequence: 5′-UUCUCCGAACGUGUCACGUtt-3′ (SEQ ID NO: 161) and the complementary strand has the following sequence: 5′-ACGUGACACAUUCGGAGAAtt-3′ (SEQ ID NO: 162).

    [0262] The results obtained by Western blot are represented in FIG. 4.

    [0263] From this figure it is observed that from the different siRNAs tested, the siRNA FLAG-M (SEQ ID NO: 154) makes it possible to detect a higher level of expression of the marker peptide CD1 than the level observed with an irrelevant control.

    [0264] In order to confirm that the position of the third sequence did not have any effect on the screening of interfering nucleic acids increasing expression, the inventors used the hybrid nucleic acid molecule SEQ ID NO: 118.

    [0265] The results obtained by Western blot are represented in FIG. 5.

    [0266] From this figure it can be seen that from the different siRNAs tested, the siRNA FLAG-N (SEQ ID NO: 146) and the siRNA HA-CT (SEQ ID NO: 145) make it possible to detect a higher level of expression of the marker peptide CD1 than the level observed with an irrelevant control.

    [0267] Finally, the inventors confirmed that only a hybrid nucleic acid molecule having a mutated first sequence made it possible to screen interfering nucleic acid molecules by comparing the effect of an interfering nucleic acid in the presence of a hybrid nucleic acid molecule having a first, unmutated, sequence (SEQ ID NO: 136).

    [0268] The results obtained by Western blot are represented in FIGS. 6A and 6B.

    [0269] It is observed from this experiment that the siRNA FLAG-M (SEQ ID NO: 154) makes it possible to detect an increase in the level of expression of CD1 only when the hybrid nucleic acid molecule comprises a mutation in its first sequence (FIG. 6A) but not when the first sequence is unmutated (FIG. 6B).

    [0270] b) Mutation by G->T Substitution

    [0271] In a second series of experiments, the inventors carried out screening of interfering molecules according to the invention using the hybrid nucleic acid molecule SEQ ID NO: 121. In this, the first sequence is CCAGCCATGt (SEQ ID NO: 52).

    [0272] As siRNA transfection control, the negative control siRNAs (“scramble”; T.) are also transfected. These siRNAs have the following sense sequence: 5′-UUCUCCGAACGUGUCACGUtt-3′ (SEQ ID NO: 161) and the complementary strand has the following sequence: 5′-ACGUGACACAUUCGGAGAAtt-3′ (SEQ ID NO: 162).

    [0273] The results obtained by Western blot are represented in FIG. 8.

    [0274] From this figure it is observed that from the different siRNAs tested, the siRNA FLAG-M (SEQ ID NO: 154) make it possible to detect a higher level of expression of the marker peptide CD1 than the level observed with an irrelevant control. The same results are therefore observed as those obtained for the hybrid nucleic acid molecule SEQ ID NO: 120.

    [0275] The inventors confirmed that only a hybrid nucleic acid molecule having a mutated first sequence made it possible to screen interfering nucleic acid molecules by comparing the effect of an interfering nucleic acid in the presence of a hybrid nucleic acid molecule having a first, unmutated, sequence (SEQ ID NO: 136).

    [0276] The results obtained by Western blot are represented in FIG. 9.

    [0277] It is observed from this experiment that the siRNA FLAG-M (SEQ ID NO: 154) makes it possible to detect an increase in the level of expression of CD1 only when the hybrid nucleic acid molecule has a mutation in its first sequence.

    [0278] In conclusion, only hybrid nucleic acid molecules comprising a mutated first sequence, especially mutated by a G->T substitution or an AT dinucleotide insertion, makes it possible to screen interfering nucleic acid molecules which increase expression.

    Example 5

    Example of Screening Using FRET as Detection Means

    [0279] The cells stably expressing the construct SEQ ID NO: 120 were seeded into 24-well plates in the morning, in order to achieve 60% confluence by the evening of the transfection with the siRNAs. In the evening, the cells were transfected with lipofectamine (RNAimax—manufacturer's procedure) at a rate of 10 nM of siRNA per well. Different siRNAs (see example 4) were tested in order to evaluate their respective impacts on the expression of the transgene of interest. The following morning, the cells were washed with 1× PBS, lyzed in 100 microliters of buffer (10 mM TRIS pH=8, 1 mM EDTA, 0.05% NP-40, +protease inhibitors), collected in Eppendorf tubes then subjected to sonication at a rate of 5 cycles composed of 15 seconds of active sonication (maximum power) followed by 15 seconds pause, in a Diagenode sonication bath. The cell lysates are then centrifuged for 5 minutes at 15 000 rcf at 4° C.

    [0280] The supernatant is recovered and after adjustment to similar concentrations of DNA (and/or protein) of each of the samples (after measuring the DNA concentration by nanodrop quantification, or the protein concentration by the Bradford method) at an amount of 100 micrograms of DNA per liter, 5 microliters per well are deposited in triplicates in a 384-well dish (Greiner-#784076). A mixture of 5 microliters of donor (CISBIO-#610HATAB) and acceptor (CISBIO-#61 FG2XLB) antibody, according to manufacturer (CISBIO)'s instructions, is added to each of the wells followed by incubation away from light at room temperature for 1 hour. The fluorescence arising from the FRET between the donor and the acceptor directed against the TAGs produced by the transgene of interest (FLAG and HA) is read by means of an HTRF apparatus (PHERAstar FS-BMG LABTECH), according to the manufacturer's instructions. After standardization of the data relative to the control which does not have FRET (lysate without TAGs capable of producing a FRET signal), a 10% signal increase compared to the control siRNA (T.) is considered to be significant in terms of increasing the expression of the transgene of interest.

    [0281] The results are indicated in FIG. 7.

    [0282] The quantitative FRET results show that the interfering nucleic acid molecules F-N (SEQ ID NO: 146; B), FLAG (SEQ ID NO: 148 and 149; D and E), FLAG Cter (SEQ ID NO: 156; J), F-M (SEQ ID NO: 154; L) and HA3 (SEQ ID NO: 140; P) increase expression.

    [0283] All of these data show that the method according to the invention makes it possible to screen interfering nucleic acid molecules which increase gene expression.

    Example 6

    Determining the Underlying Mechanism

    [0284] As mentioned above, it is observed that screening interfering nucleic acid molecules increasing gene expression requires the use of a Kozak sequence having a determined mutation. Such a Kozak sequence has the effect of reducing the expression of the gene it controls, that is to say reducing translation of the protein.

    [0285] The inventors thus firstly compared the levels of protein expression of the protein cyclin D1, the protein expression of which is controlled by: [0286] the murine cyclin D1 Kozak sequence (mKoz), especially represented by the sequence SEQ ID NO: 12 [0287] the murine cyclin D1 Kozak sequence having an AT insertion according to the invention (mKozAT), represented by the sequence SEQ ID NO: 9, and [0288] the optimized cyclin D1 Kozak sequence (KozOPT), of sequence SEQ ID NO: 62.

    [0289] Murine fibroblast cell lines devoid of the endogenous cyclin D1 gene (Ccnd1.sup.−/−) and stably expressing the construct mKoz-Ntag-CycD1 or mKozAT-Ntag-CycD1 (SEQ ID NO: 120) or KozOPT-Ntag-CycD1, were seeded on the morning of the first day and cultured in an incubator at 37° C. with a stable level of CO.sub.2 at 5%, in order to achieve approximately 80% cell confluence by the following day. At this stage, the lines were collected, in order to extract therefrom either the proteins (lysis buffer=10 mM Tris, 1 mM EDTA and 0.05% NP-40), or the total RNAs with Trizol.

    [0290] The protein lysates were then standardized to an equivalent total protein concentration by the Bradford method, then analyzed by Western blot for actin or cyclin D1. These samples were also analyzed by the Tandem-HTRF method described in example 5.

    [0291] The results obtained are presented in FIG. 10 and FIG. 11.

    [0292] The results illustrate a reduction in expression resulting from mKozAT compared to the wild-type mKoz sequence or compared to an artificial KozOPT sequence. This therefore means that the mutated Kozak sequence has the effect of reducing protein expression.

    [0293] The messenger RNAs were used to generate complementary DNA (cDNA) by reverse transcription, then these cDNAs were analyzed by quantitative PCR (qPCR). The content of messenger RNAs resulting from the mKoz-Ntag-CycD1 or mKozAT-Ntag-CycD1 or KozOPT-Ntag-CycD1 constructs was evaluated according to the qPCR following standardization using housekeeping genes (HPRT, B2M, Trfr1, TUBB and GAPDH).

    [0294] The results are presented in FIG. 12.

    [0295] A comparable content of messenger RNA appears for Ntag-CycD1 (non-significant difference between the groups, by a Student's test) between the mKoz-Ntag-CycD1 or mKozAT-Ntag-CycD1 or KozOPT-Ntag-CycD1 lines.

    [0296] Thus, the level of expression is therefore modulated at the translational level.

    Example 7

    Comparison of the Kozak Sequences within the Context of Screening of the siRNAs of the Invention

    [0297] In order to confirm the importance of the mutated Kozak sequences, the inventors finally tested the effect of different siRNAs (increase or reduction in expression) from different constructs: [0298] N-terminal-tagged cyclin D1 under the control of the murine cyclin D1 Kozak having an AT insertion (Ntag-mKozAT), [0299] N-terminal-tagged cyclin D1 under the control of the murine cyclin D1 Kozak (Ntag-mKoz), [0300] C-terminal-tagged cyclin D1 under the control of the murine cyclin D1 AT Kozak (Ctag-mKozAT), [0301] C-terminal-tagged cyclin D1 under the control of the murine cyclin D1 Kozak having an AT insertion (Ctag-mKozAT), and [0302] N-terminal-tagged cyclin D1 under the control of the murine cyclin D1 Kozak optimized to increase expression (Ntag-KozOPT).

    [0303] Several siRNAs tested in FIG. 7 were used: SEQ ID NO: 149/150; SEQ ID NO: 155, SEQ ID NO: 154, and SEQ ID NO: 142.

    [0304] The comparative tests are presented in FIG. 13.

    [0305] These data show that regardless of the Kozak sequence, an siRNA reducing expression will always be identified as such. On the other hand, siRNAs increasing expression are systematically identified when the reporter is placed under the control of a mutated Kozak sequence (here, having an AT insertion).

    [0306] All these results confirm the importance of the region regulating translation of the reporter in the screening of the siRNAs which increase gene expression according to the invention.

    [0307] The invention is not limited to the embodiments presented and other embodiments will become clearly apparent to those skilled in the art.