Protein associated with disease resistance and encoding gene thereof, and use thereof in regulation of plant disease resistance

11254715 · 2022-02-22

Assignee

Inventors

Cpc classification

International classification

Abstract

A protein provided is: a) a protein with an amino acid sequence as shown in amino acids 1-264 of SEQ ID NO: 1; b) a protein that is associated with disease resistance and obtained after an amino acid sequence as shown in amino acids 1-264 of SEQ ID NO: 1 in a Sequence Listing is subjected to substitution and/or deletion and/or addition of one or several amino acid residues; c) a protein with an amino acid sequence as shown in SEQ ID NO: 1; or d) a protein that is associated with disease resistance and obtained after the amino acid sequence as shown in SEQ ID NO: 1 in the Sequence Listing is subjected to substitution and/or deletion and/or addition of one or several amino acid residues. Experiments demonstrate that the protein associated with disease resistance and the encoding gene thereof can be used to enhance plant disease resistance.

Claims

1. A protein of a) or c) as follows: a) the protein having an amino acid sequence as shown in amino acids 1-264 of SEQ ID NO: 1; and c) the protein having an amino acid sequence as shown in SEQ ID NO: 1.

2. A biomaterial associated with the protein of claim 1, wherein the biomaterial is any one selected from a group consisting of B1) to B22) as follows: B1) a nucleic acid molecule encoding the protein of claim 1; B2) an expression cassette comprising the nucleic acid molecule of B1); B3) a recombinant vector comprising the nucleic acid molecule of B1); B4) a recombinant vector comprising the expression cassette of B2); B5) a recombinant microorganism comprising the nucleic acid molecule of B1); B6) a recombinant microorganism comprising the expression cassette of B2); B7) a recombinant microorganism comprising the recombinant vector of B3); B8) a recombinant microorganism comprising the recombinant vector of B4); B9) a genetically modified plant cell line comprising the nucleic acid molecule of B1); B10) a genetically modified plant cell line comprising the expression cassette of B2); B11) a genetically modified plant cell line comprising the recombinant vector of B3); B12) a genetically modified plant cell line comprising the recombinant vector of B4); B13) a genetically modified plant tissue comprising the nucleic acid molecule of B1); B14) a genetically modified plant tissue comprising the expression cassette of B2); B15) a genetically modified plant tissue comprising the recombinant vector of B3); B16) a genetically modified plant tissue comprising the recombinant vector of B4); B17) a genetically modified plant organ comprising the nucleic acid molecule of B1); B18) a genetically modified plant organ comprising the expression cassette of B2); B19) a genetically modified plant organ comprising the recombinant vector of B3); B20) a genetically modified plant organ comprising the recombinant vector of B4); B21) a genetically modified plant comprising the nucleic acid molecule of B1); and B22) a genetically modified plant comprising the expression cassette of B2).

3. The biomaterial according to claim 2, wherein the nucleic acid molecule of B1) is a gene represented by: 1) a cDNA or DNA molecule having a nucleotide sequence as shown in nucleotides 1-792 of SEQ ID NO: 2; or 4) a cDNA or DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 2.

4. A method for a) regulation of plant disease resistance; or b) cultivation of a disease-resistant genetically modified plant, which comprises utilizing the protein of claim 1.

5. The method according to claim 4, wherein the plant is a dicotyledonous or monocotyledonous plant.

6. The method according to claim 4, wherein the disease resistance is Verticillium wilt resistance.

7. The method according to claim 4, wherein the plant is a dicotyledonous plant or a monocotyledonous plant, and the disease resistance is Verticillium wilt resistance.

8. A method for cultivating a disease-resistant genetically modified plant, comprising a step of introducing a gene encoding the protein of claim 1 into a recipient plant, to obtain the disease-resistant genetically modified plant having stronger disease resistance than the recipient plant.

9. The method according to claim 8, wherein the gene encoding the protein of claim 1 is a DNA molecule having an encoding sequence as shown in nucleotides 1-792 of SEQ ID NO: 2.

10. The method according to claim 8, wherein the plant is a dicotyledonous plant and/or a monocotyledonous plant.

11. The method according to claim 8, wherein the disease resistance is Verticillium wilt resistance.

12. The method according to claim 8, wherein the gene encoding the protein of claim 1 is a DNA molecule having an encoding sequence as shown in nucleotides 1-792 of SEQ ID NO: 2, and the plant is a dicotyledonous plant and/or a monocotyledonous plant.

13. The method according to claim 8, wherein the gene encoding the protein of claim 1 is a DNA molecule having an encoding sequence as shown in nucleotides 1-792 of SEQ ID NO: 2, and the disease resistance is Verticillium wilt resistance.

14. The method according to claim 8, wherein the plant is a dicotyledonous plant and/or a monocotyledonous plant, and the disease resistance is Verticillium wilt resistance.

15. The method according to claim 8, wherein the gene encoding the protein of claim 1 is a DNA molecule having an encoding sequence as shown in nucleotides 1-792 of SEQ ID NO: 2; the plant is a dicotyledonous plant and/or a monocotyledonous plant; and the disease resistance is Verticillium wilt resistance.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows disease indexes of Verticillium wilt of some genetically modified cotton lines containing VdAL, wherein WT, FCK, and RCK represent sGK9708-41, SCRC28, and GK44, respectively;

(2) FIG. 2 shows the numbers of boll setting in individual plant of some genetically modified cotton lines containing VdAL, wherein WT, YCK, and RCK represent sGK9708-41, SCRC28, and GK44, respectively;

(3) FIG. 3 shows resistance ability to Verticillium will of the genetically modified Arabidopsis thaliana containing VdAL, wherein A represents genetically modified Arabidopsis thaliana lines 2 and 3, containing VdAL, of a T3 generation; B represents the transcription levels of VdAL gene in genetically modified Arabidopsis thaliana lines 2 and 3, containing VdAL, of the T3 generation identified by semi-quantitative

(4) PCR; C indicates the growth status of genetically modified Arabidopsis thaliana lines 2 and 3, containing VdAL, of the T3 generation after inoculation of cotton Verticillium dahlia; and D shows the disease indexes of genetically modified Arabidopsis thaliana lines 2 and 3, containing VdAL, of the T3 generation;

(5) FIG. 4 shows western blot identification of VdAL protein expressed in genetically modified Arabidopsis thaliana lines 2 and 3, containing VdAL, of the T3 generation; and

(6) FIG. 5 shows western blot detection results of VdAL gene in genetically modified cotton lines P1-89, containing VdAL.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(7) The present invention will be described in further detail with reference to specific examples, which are provided for illustration of the present invention only, but not intended to limit the scope of the present invention.

(8) Experimental approaches indicated in the following examples are conventional approaches, unless otherwise specified.

(9) Materials, reagents, and the like used in the following examples are all commercially available, unless otherwise specified.

(10) Verticillium dahlia in the following examples refers to strain V.sub.991 (Qi Junsheng & Li Huaifang, “A New Detection Method of Wilting Induction by Phytotoxin from V. dahliae on Cotton through Leaf Pricking and Spreading,” Cotton Science, 2016, 18 (4): 228-232), which can be obtained by the public from the China Agricultural University (i.e., Applicant). This biomaterial can be used only for the purpose of repeating related experiments of the present invention and cannot be used for other purposes.

(11) GK44 used in the following examples is a product of Shandong Jinqiu Seed Industry Co., Ltd.

(12) SCRC28 used in the following examples is a product of Shandong Nongxing Seed Industry Co., Ltd.

(13) sGK9708-41 used in the following examples is a product of Xinjiang Cotton-Seed Industry Co., Ltd.

(14) Arabidopsis thaliana Col used in the following examples is a product of Salk Institute for Biological Studies.

(15) Vector pSPT01 used in the following examples is pSPT01 in Example 1 of Chinese patent application No. 201010521702.6 (published as CN 101962658 A). pSPT01 is built on the basis of pCambia1300, wherein a promoter of a target gene is a super promoter added with a Flag sequence after the promoter, and a reporter gene is replaced with a tfdA gene.

(16) Vector pCAMBIA1300-Super used in the following examples is pCAMBIA1300-Super in Example 1 of Chinese patent application No. 201010521702.6 (publication as CN 101962658 A). pCAMBIA1300-Super is a vector obtained after promoter CaMV35S in pCAMBIA1300 (GenBank of which is FJ362601.1) is replaced with a super strong promoter, and a restriction enzyme cutting site in pCAMBIA1300 is modified.

(17) Agrobacterium tumefaciens GV3101 used in the following examples is a product of Beijing Jiuzhou Tian Rui Technology Co., Ltd.

Example 1

(18) In this example, it was proved that protein VdAL associated with disease resistance could enhance disease resistance of cotton.

(19) I. Construction of the Genetically Modified Cotton Containing VdAL

(20) Procedure 1 Constructions of a Recombinant Vector and a Recombinant Strain

(21) A DNA molecule shown in nucleotides 1-792 of SEQ ID NO: 2 in the Sequence Listing, i.e., VdAL protein gene associated with disease resistance, was artificially synthesized. A sequence between recognition sites of Sal I and Kpn I of vector pSPT01 was replaced with the DNA molecule shown in nucleotides 1-792 of SEQ ID NO: 2 in the Sequence Listing (i.e., the VdAL protein gene associated with disease resistance), and other sequences of pSPT01 remained unchanged, to obtain a recombinant vector named pSPT01-VdAL. Recombinant vector pSPT01-VdAL expresses the VdAL protein associated with disease resistance shown in SEQ ID NO: 1 in the Sequence Listing.

(22) SEQ ID NO: 2 consists of 864 nucleotides, encoding an amino acid sequence shown in SEQ ID NO: 1. Nucleotides 793-864 of SEQ ID NO: 2 encode FLAG shown in amino acids 265-287 of SEQ ID NO: 1; and nucleotides 1-792 of SEQ ID NO: 2 encode a protein shown in amino acids 1-264 of SEQ ID NO: 1.

(23) pSPT01-VdAL was introduced into Agrobacterium tumefaciens GV3101, to obtain a recombinant strain, which was named A-pSPT01-VdAL.

(24) pSPT01 was introduced into Agrobacterium tumefaciens GV3101, to obtain a recombinant strain with an empty vector, and the resulting recombinant strain was named A-pSPT01.

(25) Procedure 2 Construction of disease resistance related VdAL protein genetically modified cotton

(26) In step (1), A-pSPT01-VdAL of procedure 1 was streaked on a YEB solid medium containing kanamycin with a final concentration of 50 μg/mL and rifampicin with a final concentration of 50 μg/mL, activated, and cultured for 48 h at 28° C., to obtain single colonies.

(27) In step (2), some single colonies obtained in step (1) were selected and added into a 5 mL of YEB liquid medium containing kanamycin with a final concentration of 50 μg/mL and rifampicin with a final concentration of 50 μg/mL, and shaken for 12 h at 28° C., to obtain a bacterial solution.

(28) In step (3), 2 mL of the bacterial solution obtained in step (2) was connected to a 500 mL of YEB liquid medium containing kanamycin with a final concentration of 50 μg/mL and rifampicin with a final concentration of 50 μg/mL, shaken on a shaking table at 28° C., and cultured to OD600=0.8-1.0, to obtain a bacterial solution.

(29) In step (4), the bacterial solution obtained in step (3) was centrifuged at 4000 rpm for 10 minutes at room temperature, to obtain a bacterial precipitate.

(30) In step (5), the bacterial precipitate obtained in step (4) was re-suspended in 200 mL of ½ MS solution, in which 15 μL of Silwet-77 was added, followed by homogeneous mixing, to obtain an Agrobacterium tumefaciens infection solution.

(31) In step (6), buds of a cotton variety sGK9708-41 (2,4-D sensitive line) were isolated by being bagged. The Agrobacterium tumefaciens infection solution of step (5) was sprayed on the bagged buds next day during a period from 8 to 9 o'clock. The buds sprayed with the Agrobacterium tumefaciens infection solution were then bagged to avoid light, and transformed buds were marked with red ropes. This line was then a genetically modified line of T.sub.0 generation. This genetically modified line was passaged to T4 generation (by selfing in each generation). Each generation was screened with 2,4-D, to obtain the following the genetically modified cotton lines of the T4 generation: P1-89, P1-96, P1-117, P1-90, P1-84, P1-134, P1-143, P1-109, P1-105, P1-76, P1-82, P1-136, P1-100, P1-127, P1-135, P1102, P1-80, P1-104, P1-69, P1-110, P1-125, and P1-111, containing VdAL.

(32) In step (7), the VdAL gene in the VdAL genetically modified cotton lines of the T4 generation obtained in step (6) was identified at a genomic level. Cotton variety sGK9708-41 was used as a wildtype reference, with a primer pair of ATGCTTTCTCTCCAGACCGC (SEQ ID NO: 8) and GAGATTTGCCGGCGGCGGTG (SEQ ID NO: 9). Results showed that PCR products of the genetically modified cotton lines, containing VdAL, of the T4 generation obtained in step (6) each had target bands of size 792 bp, indicating that the genetically modified cotton lines, containing VdAL, of the T4 generation obtained in step (6) each had the VdAL gene.

(33) In step (8), expression of the VdAL gene in the genetically modified cotton lines, containing VdAL, of the T4 generation obtained in step (6) was identified by semi-quantitative PCR. Cotton variety sGK9708-41 was used as a wildtype reference, with a primer pair of ATGCTTTCTCTCCAGACCGC (SEQ ID NO: 8) and GAGATTTGCCGGCGGCGGTGT (SEQ ID NO: 10). UBQ was used as an internal reference, with a primer pair of CCCTGGCTGATTACATC (SEQ ID NO: 11) and TGGTGTCAGTGGGTTCAATG (SEQ ID NO: 12). Results showed that PCR products of the genetically modified cotton lines, containing VdAL, of the T4 generation each had the target bands, indicating that the genetically modified cotton lines, containing VdAL, of the T4 generation obtained in step (6) each expressed the VdAL gene.

(34) In step (9), expression of VdAL protein in the genetically modified cotton lines, containing VdAL, of the T4 generation obtained in step (6) was identified by western-blot. Cotton variety sGK9708-41 was used as a wildtype reference. Antibody flag (item number AB003-01A, a product of Shanghai Nearshore Technology Co. LTD/Sinobio Biotech Co., Ltd.) was used. Protein was labeled with a Ponceau S dyeing solution, and a loading amount thereof was adjusted, to enable a same total amount of protein in different lanes. Results were shown in FIG. 5. The results indicated that the genetically modified cotton lines, containing VdAL, of the T4 generation obtained in step (6) each expressed the VdAl protein.

(35) A-pSPT01-VdAL was replaced with A-pSPT01 according to steps (1) to (6), and other steps were unchanged. Genetically modified cotton containing the empty vector was obtained and named genetically modified cotton containing empty-vector.

(36) II. Identification of disease resistance of the genetically modified cotton containing VdAL

(37) The genetically modified cotton containing VdAL was inoculated with Verticillium dahliae, and disease resistance of a plant after inoculation was evaluated in terms of Verticillium wilt index and the number of boll setting in individual plant thereof. The experiment was repeated three times, including the following specific steps each time.

(38) Cotton Verticillium dahliae was inoculated into a disease nursery in a field of Shandong Province, to obtain a disease nursery homogeneously distributed with V.sub.991 strains. Genetically modified cotton lines P1-89, P1-96, P1-117, P1-90, P1-84, P1-134, P1-143, P1-109, P1-76, P1-82, P1-136, P1-100, P1-127, P1-135, P1-102, P1-80, P1-104, P1-69, P1-110, and P1-111, containing VdAL, and the genetically modified cotton containing empty-vector obtained above, cotton variety sGK9708-41, Verticillium wilt resistant cotton variety GK44, and high-yield cotton variety SCRC28 were planted in the above disease nursery, respectively, 30 plants for each line.

(39) Incidence of cotton was graded as follows during a boll stage thereof, and Verticillium wilt disease index and relative control effect of cotton were calculated (see Table 2 and FIG. 1):

(40) Grade 0: no diseased leaves;

(41) Grade I: 0.1%-25% of diseased leaves;

(42) Grade II: 25% (excluded)-50% of diseased leaves;

(43) Grade III: 50% (excluded)-75% of diseased leaves; and

(44) Level IV: more than 75% of diseased leaves.
Disease index=(1×Grade Iplant number+2×Grade IIplant number+3×Grade IIIplant number+4×Grade IVplant number)/(4×a total plant number investigated)×100.
Relative control effect (%)=(disease index of sGK9708-41−disease index of genetically modified cotton containing VdAL)/disease index of sGK9708-41×100%
(the relative control effect of sGK9708-41 was defined to be 0).

(45) The numbers of boll setting in individual plant of cotton was counted at the end of the boll stage. The results were shown in Table 3 and FIG. 2.

(46) TABLE-US-00002 TABLE 2 Verticillium wilt disease index and relative control effect of the genetically modified cotton containing VdAL disease indexes of Relative control Line/Variety Verticillium wilt effect (%) P1-89  2.78 ± 1.00 93 P1-96  5.00 ± 0.58 88 P1-117  5.68 ± 0.58 86 P1-90  6.58 ± 1.41 84 P1-84  6.82 ± 0.50 83 P1-134  7.14 ± 3.00 83 P1-143  9.09 ± 1.00 78 P1-109 11.36 ± 1.29 73 P1-76 12.50 ± 1.05 70 P1-82 13.16 ± 2.50 68 P1-136 13.64 ± 2.16 67 P1-100 13.64 ± 0.50 67 P1-127 16.30 ± 2.06 61 P1-135 17.71 ± 1.71 58 P1-102 18.06 ± 1.26 57 P1-80 20.26 ± 2.45 51 P1-104 22.83 ± 4.24 45 P1-69 29.41 ± 0.00 30 P1-110 27.63 ± 0.96 34 P1-111 26.67 ± 1.50 36 Genetically 43.78 ± 2.54 −4 modified cotton containing empty- vector sGK9708-41 42.19 ± 0.95 0 GK44  7.61 ± 0.71 82 SCRC28 43.36 ± 1.04 −3

(47) The results showed that cotton variety sGK9708-41 had no substantial differences from the genetically modified cotton containing empty-vector in terms of Verticillium wilt index. Verticillium wilt indexes of the genetically modified cotton lines containing VdAL were each lower than the Verticillium wilt index of wildtype cotton variety sGK9708-41, and also each lower than the Verticillium wilt index of high-yield cotton variety SCRC28. The Verticillium wilt indexes of some lines (such as P1-89, P1-96, P1-117, P1-90, P1-84, and P1-134) were each lower even than the Verticillium wilt index of Verticillium wilt resistant cotton variety GK44. The relative control effect of cotton variety sGK9708-41 had no substantial differences from the relative control effect of the genetically modified cotton containing empty-vector. The relative control effects of the genetically modified cotton lines containing VdAL were each higher than the relative control effect of wild-type cotton variety sGK9708-41, and also higher than the relative control effect of high-yield cotton variety SCRC28. The relative control effects of some lines (such as P1-89, P1-96, P1-117, P1-90, P1-84, and P1-134) each reached above 80%, even higher than the relative control effect of Verticillium wilt resistant cotton variety GK44.

(48) The results showed that the VdAL of the present invention could enhance Verticillium wilt resistant ability in a plant.

(49) TABLE-US-00003 TABLE 3 The numbers of boll setting in individual plant of the genetically modified cotton containing VdAL the Numbers of Multiple Boll Setting in relationship with Line/Variety Individual plant sGK9708-41 P1-89 10.3 ± 1.91 2.71 P1-96 12.5 ± 1.00 2.55 P1-117 12.2 ± 1.21 2.49 P1-90  9.4 ± 1.32 1.92 P1-84  8.9 ± 1.10 1.82 P1-134  6.7 ± 0.89 1.37 P1-143 10.2 ± 0.78 2.08 P1-109  9.3 ± 1.12 1.90 P1-105 10.7 ± 0.99 2.18 P1-76 11.5 ± 1.13 2.35 P1-82 12.1 ± 0.57 2.47 P1-136  8.8 ± 1.31 1.80 P1-100 13.1 ± 1.16 2.67 P1-127 12.2 ± 1.30 2.49 P1-135  9.1 ± 2.00 1.86 P1-102 11.9 ± 0.30 2.43 P1-80 12.5 ± 1.23 2.55 P1-104 13.3 ± 0.95 2.71 P1-69 12.1 ± 1.41 2.47 P1-110 10.9 ± 0.59 2.22 P1-111   10 ± 1.11 2.04 Genetically  4.1 ± 1.18 0.84 modified cotton containing empty- vector sGK9708-41  4.9 ± 0.78 — GK44 11.5 ± 1.43 — SCRC28  8.0 ± 1.90 — Note: “—” indicates no comparison was made.

(50) The results showed that there were no significant differences in terms of the numbers of boll setting in individual plant between cotton variety sGK9708-41 and the genetically modified cotton containing empty-vector. The numbers of boll setting in individual plant of the genetically modified cotton lines containing VdAL were each higher than the numbers of boll setting in individual plant of the wildtype cotton variety sGK9708-41. The numbers of boll setting in individual plant of genetically modified cotton lines P1-89, P1-96, P1-117, P1-90, P1-84, P1-134, P1-143, P1-109, P1-105, P1-76, P1-82, P1-136, P1-100, P1-127, P1-135, P1-102, P1-80, P1-104, P1-69, P1-110, and P1-111, containing VdAL, were each higher than the numbers of boll setting in individual plant of high-yield cotton variety SCRC28 also. The numbers of boll setting in individual plant of some lines (such as P1-96, P1-117, P1-82, P1-100, P1-127, P1-102, P1-80, P1-104, and P1-69) were each higher even than the numbers of boll setting in individual plant of Verticillium wilt resistant cotton variety GK44.

(51) The results showed that the VdAL of the present invention could enhance Verticillium wilt resistant ability of a plant and reduce the effect of Verticillium wilt on cotton yield.

Example 2

(52) In this example, it was proved that VdAL protein associated with disease resistance could enhance disease resistance of Arabidopsis thaliana.

(53) I. Construction of the Genetically Modified Arabidopsis thaliana Containing VdAL

(54) Procedure 1 Constructions of a Recombinant Vector and a Recombinant Strain

(55) A DNA molecule shown in nucleotides 1-792 of SEQ ID NO: 2 in the Sequence Listing, i.e., VdAL protein gene associated with disease resistance, was artificially synthesized. A sequence between recognition sites of Pst I and Kpn I of vector pCAMBIA1300-Super was replaced with the DNA molecule shown in nucleotides 1-792 of SEQ ID NO: 2 in the Sequence Listing (i.e., the VdAL protein gene associated with disease resistance), and other sequences of pCAMBIA1300-Super remained unchanged, to obtain a recombinant vector named pCAMBIA1300-Super-VdAL. Recombinant vector pCAMBIA1300-Super-VdAL expresses the protein shown in SEQ ID NO: 1 in the Sequence Listing.

(56) SEQ ID NO: 2 consists of 864 nucleotides, encoding an amino acid sequence shown in SEQ ID NO: 1. Nucleotides 793-864 of SEQ ID NO: 2 encode FLAG shown in amino acids 265-287 of SEQ ID NO: 1; and nucleotides 1-792 of SEQ ID NO: 2 encode a protein shown in amino acids 1-264 of SEQ ID NO: 1.

(57) pCAMBIA1300-Super-VdAL was introduced into Agrobacterium tumefaciens GV3101, to obtain a recombinant strain, which was named A-pCAMBIA1287-Super-VdAL.

(58) pCAMBIA1300-Super was introduced into Agrobacterium tumefaciens GV3101, to obtain a recombinant strain with an empty vector, and the resulting recombinant strain was named A-pCAMBIA1300-Super.

(59) Procedure 2 Construction of Disease Resistance Related VdAL Protein Genetically Modified Arabidopsis thaliana

(60) In step (1), recombinant strain A-pCAMBIA1300-Super-VdAL of procedure 1 was streaked on a YEB solid medium containing kanamycin with a final concentration of 50 μg/mL and rifampicin with a final concentration of 50 μg/mL, activated, and cultured for 48 h at 28° C., to obtain single colonies.

(61) In step (2), some single colonies obtained in step (1) were selected and added into a 5 mL of YEB liquid medium containing kanamycin with a final concentration of 50 μg/mL and rifampicin with a final concentration of 50 μg/mL, and shaken for 12 h at 28° C., to obtain a bacterial solution.

(62) In step (3), 2 mL of the bacterial solution obtained in step (2) was inoculated to a 500 mL of YEB liquid medium containing kanamycin with a final concentration of 50 μg/mL and rifampicin with a final concentration of 50 μg/mL, shaken on a shaking table at 28° C., and cultured to OD600=0.8-1.0, to obtain a bacterial solution.

(63) In step (4), the bacterial solution obtained in step (3) was centrifuged at 4000 rpm for 10 minutes at room temperature, to obtain a bacterial precipitate.

(64) In step (5), the bacterial precipitate obtained in step (4) was re-suspended in 200 mL of ½ MS solution, in which 15 μL of Silwet-77 was added, followed by homogeneous mixing, to obtain an Agrobacterium tumefaciens infection solution.

(65) In step (6), flowers of Arabidopsis thaliana Col in a flowering stage were immersed in the Agrobacterium tumefaciens infection solution obtained in step (5) for 30 sec, and then taken out, and cultured at room temperature for 24 h in the darkness, to obtain infected Arabidopsis thaliana.

(66) In step (7), the infected Arabidopsis thaliana obtained in step (6) was cultured at room temperature for 24 h under low light, and then cultured at 22° C. under 16 hours of illumination/8 hours of darkness light cycle. Such a plant was a genetically modified plant of T.sub.0 generation. The genetically modified plant was passaged to T3 generation (by selfing in each generation). Each generation was screened with hygromycin, to obtain lines 2 and 3 of genetically modified Arabidopsis thaliana, containing VdAL, of the T3 generation (see A in FIG. 3).

(67) In step (8), VdAL gene in the lines 2 and 3 of the genetically modified Arabidopsis thaliana of, containing VdAL, the T3 generation obtained in step (7) was identified at a genomic level. Arabidopsis thaliana Col was used as a wildtype reference, with a primer pair of ATGCTTTCTCTCCAGACCGCAGC (SEQ ID NO: 13) and TAGCGCAGTTACGATCAGGGTCG (SEQ ID NO: 14). Results showed that PCR products of the lines 2 and 3 both had target bands of size 403 bp, indicating that the lines 2 and 3 both had VdAL gene.

(68) In step (9), expression of the VdAL gene in the lines 2 and 3 of the genetically modified Arabidopsis thaliana, containing VdAL, of the T3 generation obtained in step (7) was identified by semi-quantitative PCR. Arabidopsis thaliana Col was used as a wildtype reference, with a primer pair of GCAACATCACCCTTCGTACT (SEQ ID NO: 15) and CAGACTGGTTGCCGAAGAA (SEQ ID NO: 16). UBQ was used as an internal reference, with a primer pair of CCCTGGCTGATTACATC (SEQ ID NO: 11) and TGGTGTCAGTGGGTTCAATG (SEQ ID NO: 12) (see B in FIG. 3). Results showed that PCR products of the lines 2 and 3 both had target bands, indicating that the lines 2 and 3 both expressed the VdAL gene.

(69) In step (10), expression of VdAL protein in the lines 2 and 3 the genetically modified Arabidopsis thaliana, containing VdAL, of the T3 generation obtained in step (7) was identified by western-blot. Arabidopsis thaliana Col was used as a wildtype reference. Antibody flag (item number AB003-01A, a product of Shanghai Nearshore Technology Co. LTD/Sinobio Biotech Co., Ltd.) was used. Protein was labeled with a Ponceau S dyeing solution, and a loading amount was adjusted, to enable a same total protein amount in different lanes. Results were shown in FIG. 4. The results indicated that the lines 2 and 3 both expressed the VdAL protein.

(70) A-pCAMBIA1300-Super-VdAL was replaced with A-pCAMBIA1300-Super according to steps (1) to (7), and other steps were unchanged. Genetically modified Arabidopsis thaliana with an empty vector was obtained and named genetically modified Arabidopsis thaliana containing empty-vector.

(71) II. Identification of Disease Resistance of the Genetically Modified Arabidopsis thaliana Containing VdAL

(72) The genetically modified Arabidopsis thaliana containing VdAL was inoculated with Verticillium dahliae, and disease resistance of a plant after inoculation was evaluated by Verticillium wilt index of the plant. The experiment was repeated three times, including the following specific steps each time.

(73) Spores of Verticillium dahliae were suspended in sterile distilled water, to obtain a spore suspension at a concentration of 1×10.sup.6 cfu/mL. The line 2 of the genetically modified Arabidopsis thaliana containing VdAL obtained in step (1) was soaked in the spore suspension for 30 s and then cultured at 22° C. under a 16 hours of illumination/8 hours of darkness light cycle for 21 days, to obtain treated line 2, altogether 30 plants.

(74) The line 2 of the genetically modified Arabidopsis thaliana containing VdAL of step (1) was replaced with the line 3 of the genetically modified Arabidopsis thaliana containing VdAL of step (1), Col, and the genetically modified Arabidopsis thaliana containing empty-vector obtained in step (1), respectively, and the other steps were unchanged, to obtain treated line 3, treated Col, and treated the genetically modified Arabidopsis thaliana containing empty-vector, respectively.

(75) The strain 2 of the genetically modified Arabidopsis thaliana containing VdAL of step (1) was replaced Col, a non-genetically modified control, and the spore suspension was replaced with sterile distilled water, the other steps remaining unchanged, to obtain the control line, Col dipped in water.

(76) Disease indexes (see C and D in FIG. 3) of the treated line 2, the treated line 3, the treated Col, the treated the genetically modified Arabidopsis thaliana containing empty-vector, and the reference Col dipped in water were counted according to the following criteria, respectively:

(77) Grade 0: no diseased leaves;

(78) Grade I: 0.1%-25% of diseased leaves;

(79) Grade II: 25% (excluded)-50% of diseased leaves;

(80) Grade III: 50% (excluded)-75% of diseased leaves; and

(81) Level IV: more than 75% of diseased leaves.
Disease indexes were calculated according to the following formula: disease index=[Σdisease grades×plant number/(total plant number×highest disease grade)]×100.

(82) The results showed that there were no significant differences in terms of disease index between Col and the genetically modified Arabidopsis thaliana containing empty-vector. The disease index of Col was 95±2.6; the disease index of the line 2 was 76±1.6, 80% of that of Col; the disease index of the line 3 was 74±5.4, 78% of that of Col; and the disease index of reference Col dipped in water was 0. The disease indexes of the line 2 and the line 3 were both significantly lower than the disease index of Col. The results showed that VdAL could enhance resistant ability to Verticillium wilt of a plant.

INDUSTRIAL APPLICABILITY

(83) The experiments showed that the VdAL (protein associated with disease resistance) and its encoding gene could enhance a plant's ability to resist Verticillium wilt. Verticillium wilt indexes of the genetically modified cotton lines containing VdAL were each lower than the Verticillium wilt index of wildtype cotton variety sGK9708-41, and also lower than the Verticillium wilt index of high-yield cotton variety SCRC28. The Verticillium wilt indexes of genetically modified cotton lines P1-89, P1-96, P1-117, P1-90, P1-84, and P1-134, containing VdAL, were each lower even than the Verticillium wilt index of Verticillium wilt resistant cotton variety GK44. The relative control effects of the genetically modified cotton lines containing VdAL were each higher than the relative control effect of wildtype cotton variety sGK9708-41, and also higher than the relative control effect of high-yield cotton variety SCRC28. The relative control effects of genetically modified cotton lines P1-89, P1-96, P1-117, P1-90, P1-84, and P1-134, containing VdAL, each reached above 80%, higher even than the relative control effect of Verticillium wilt resistant cotton variety GK44.

(84) VdAL (protein associated with disease resistance) and its encoding gene of the present invention could enhance the ability in a plant to resist Verticillium wilt, and reduce the effect of Verticillium wilt on cotton yield. The numbers of boll setting in individual plant of the genetically modified cotton lines containing VdAL were each higher than the numbers of boll setting in individual plant of the wildtype cotton variety sGK9708-41. The numbers of boll setting in individual plant of genetically modified cotton lines P1-89, P1-96, P1-117, P1-90, P1-84, P1-134, P1-143, P1-109, P1-105, P1-76, P1-82, P1-136, P1-100, P1-127, P1-135, P1-102, P1-80, P1-104, P1-69, P1-110, and P1-111, containing VdAL, were each higher than the numbers of boll setting in individual plant of high-yield cotton variety SCRC28 also. The numbers of boll setting in individual plant of genetically modified cotton lines P1-96, P1-117, P1-82, P1-100, P1-127, P1-102, P1-80, P1-104, and P1-69 containing VdAL were each higher even than the numbers of boll setting in individual plant of Verticillium wilt resistant cotton variety GK44.

(85) The experiments showed that the VdAL (protein associated with disease resistance) and its encoding gene of the present invention could be used to enhance disease resistance of a plant.