Nucleic acid amplification and detection assays

11254971 · 2022-02-22

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a method and kit for amplifying and detecting a quantity of nucleic acid. The invention is particularly relevant to isothermal amplification techniques carried out on a flow based assay device. The amplified nucleic acid may be detected on the device using an optical read-out.

Claims

1. A test strip device for detecting the presence of a target analyte in a fluid applied to the device, the device comprising: i) a displacement area having a first immobilised marker which can be displaced by the presence of the target analyte to produce a first released marker, wherein the first released marker comprises a viral protease; ii) a signal amplification area having further markers or detectable markers immobilised via a peptide which is specifically cleaved by the presence of the viral protease; iii) optionally one or more further signal amplification areas having further immobilised markers which are released by the presence of a released marker, wherein one or more of the signal amplification areas releases a detectable marker; and iv) one or more detection areas which can identify the presence of the detectable marker; wherein the displacement area, signal amplification area(s) and detection area(s) are connected on a porous material such that fluid can flow from the displacement area through the signal amplification area(s) and into the detection area(s) upon application of the fluid to the device.

2. The device according to claim 1 wherein the target analyte is a nucleic acid.

3. The device according to claim 2 wherein the first immobilised marker is a partly double stranded nucleic acid.

4. The device according to claim 1 wherein the displacement is via disruption of a protein-protein interaction.

5. The device according to claim 1 wherein release can be triggered by the displacement of an antibody/antigen, peptide/peptide or peptide/molecule interaction.

6. The device according to claim 1 wherein the device contains three or more signal amplification areas.

7. The device according to claim 1 having a first signal amplification area having immobilised markers which can be released by the presence of the first released protease to produce a second released marker protease; and a second amplification area having further immobilised markers which can be released by the presence of the second released marker protease to produce the detectable marker.

8. The device according to claim 7 wherein the first released marker protease and second released marker protease are different viral proteases.

9. The device according to claim 1 wherein the detectable marker contains an enzyme.

10. The device according to claim 1 wherein the detectable marker carries a detectable label.

11. The device according to claim 1 wherein the detection area performs a colourimetric assay.

12. The device according to claim 11 wherein the assay uses gold nanoparticles.

13. The device according to claim 1 claim wherein the porous material is nitrocellulose.

14. A method of detecting a target analyte, the method comprising applying a sample to a test strip device having i) a displacement area having a first immobilised marker which can be displaced by the presence of the target analyte to produce a first released marker, wherein the first released marker comprises a viral protease; ii) a signal amplification area having further markers or detectable markers immobilised via a peptide which is specifically cleaved by the presence of the viral protease; iii) optionally one or more further signal amplification areas having further immobilised markers which are released by the presence of a released marker, wherein one or more of the signal amplification areas releases a detectable marker; and iv) one or more detection areas which can identify the presence of the detectable marker; wherein the displacement area, signal amplification area(s) and detection area(s) are connected on a porous material such that fluid can flow from the displacement area through the signal amplification area(s) and into the detection area(s); flowing the sample from the displacement area through the signal amplification area(s) and into the detection area(s) and determining from the presence of the detectable marker in the detection area the presence of the target analyte in the sample.

15. The method according to claim 14 wherein the device has a first signal amplification area having immobilised markers which can be released by the presence of the first released viral protease to produce a second released marker viral protease; and a second amplification area having further immobilised markers which can be released by the presence of the second released marker viral protease to produce the detectable marker.

16. The method according to claim 14 wherein the target analyte is a nucleic acid.

17. The method according to claim 14 wherein the detection is a colourimetric assay.

18. The method according to claim 14 wherein the method uses multiple independent amplification cascades where the release of the detectable marker requires the presence of more than one target analyte.

Description

DESCRIPTION OF FIGURES

(1) FIG. 1 shows an exemplary assay for detecting a single nucleic acid target. An oligonucleotide is immobilised to a solid support and hybridised to a strand acting as a displaceable marker (shown as Z). Exposure to the target analyte, which hybridises to the immobilised strand, causes marker Z to be released into solution. Released marker Z flows into the first amplification area (amplification zone 1). The presence of Z in solution catalyses release of marker Y via cleavage of Z′ (Z′ can only be cleaved by Z). Marker Y flows into amplification zone 2 where marker X is released via cleavage of Y′ (Y′ can only be cleaved by Y). Marker X flows into amplification zone 3 where marker E is released via cleavage of X′ (X′ can only be cleaved by X). Marker E flows into the detection zone where the amount of marker E released into the fluid can be analysed.

(2) FIG. 2 shows an exemplary assay for co-detecting multiple nucleic acid targets. In the example shown, four separate oligonucleotides of different sequence (shown as target A, B, C and D) are immobilised to a solid support and hybridised to strands acting as displaceable markers (shown as Z, R, N and K respectively). Exposure to the target analyte A, which hybridises to the immobilised strand, causes marker Z to be released into solution. Exposure to the target analyte B, which hybridises to the immobilised strand, causes marker R to be released into solution. Exposure to the target analyte C, which hybridises to the immobilised strand, causes marker N to be released into solution. Exposure to the target analyte D, which hybridises to the immobilised strand, causes marker K to be released into solution. Thus all four target analytes are required in order to displace Z, R N and K into solution. The absence of one of the targets will mean than only three of the markers are displaced. The released markers flow into amplification zone 1. The presence of Z in solution catalyses release of marker Y via cleavage of Z′. The presence of R in solution catalyses release of marker Q via cleavage of R′. The presence of N in solution catalyses release of marker M via cleavage of N′. The presence of K in solution catalyses release of marker J via cleavage of K′. The up to four released markers flow into amplification zone 2, where four further markers (shown as X, P, L and H) can be released depending on the input sample. The released markers flow into amplification zone 3. In amplification zone 3, the releasable markers require two bonds to be cleaved. Thus the release of each marker is dependent on having two catalysts present. Marker W can only be cleaved if both X and P are present. Similarly marker U can only be cleaved if both L and H are present. The material flows into amplification zone 4. The presence of both W and U is required to cleave detectable marker E. Thus marker E is only released if targets A-D are all present. The fluid flows into the detection zone where the amount of marker E released into the fluid can be analysed.

(3) FIG. 3 shows the assay in strip format. The sample flows from the displacement zone, through the amplification zone, through the detection zone and into the absorbent pad.

(4) FIG. 4 shows immobilized marker printed on the displacement zone of the strip assay of FIG. 3.

(5) FIG. 5 shows immobilized marker printed on an amplification zone of the strip assay of FIG. 3.

(6) FIG. 6 shows generation of the detection zone of the strip assay of FIG. 3.

DETAILED DESCRIPTION OF THE INVENTION

(7) The technology described herein detects the presence of a small number of molecules, which occurs via a displacement event which triggers an amplification of the signal inducing a cascade or “domino effect” that amplifies the signal in every step in a near-exponential manner. The displacement event is a non-catalysed event which occurs only in the presence of the exact sequence whose presence is under evaluation.

(8) An aspect of the invention includes a device for detecting the presence of a target analyte in a fluid, the device comprising:

(9) i) a displacement area having a first immobilised marker which can be displaced by the presence of the target analyte to produce a first released marker;

(10) ii) one or more signal amplification areas having further immobilised markers which can be released by the presence of the first released marker to produce a detectable marker; and

(11) iii) one or more detection areas which can identify the presence of the detectable marker;

(12) wherein the displacement area, signal amplification area(s) and detection area(s) are connected such that fluid can flow from the detection area through the signal amplification area(s) and into the detection area(s).

(13) The device can take the form of a test strip where the fluid flow occurs along a single axis. The device may also be referred to as a chip, where the strip is contained within a holder in order to aid handing of the strip. All of the chemicals and reagents required for detection of the target analyte are immobilised onto a solid support surface which is then exposed to the fluid being tested for the target analyte.

(14) The target analyte can be any molecule for which the detection is desired. The target analyte can be a nucleic acid. The target analyte can be DNA, RNA or modified forms thereof. The nucleic acid, DNA or RNA may be derived directly from an organism, for example a virus, bacteria or other pathogen. The nucleic acid may be mammalian. The method allows the specific detection of particular sequences, depending on the choice of displacement method. The target analyte nucleic acid strand may be single stranded or double stranded.

(15) The displacement may be carried out by disrupting the binding of a double stranded nucleic acid where one of the two strands is immobilised. Such disruption results in the immobilisation of the target analyte via the formation of a duplex, and release of a first released marker, the first released marker being the non-immobilised strand or a fragment thereof. Thus the first immobilised marker may be a single nucleic acid strand. Alternatively the first immobilised marker may be a single nucleic acid strand which is in part double stranded and in part single stranded. The first immobilised marker may be a partly double stranded nucleic acid.

(16) The single stranded region of the immobilised marker may be used to sequence selectively capture the target analyte. Thus the sequence specificity of the assay comes from only the correct target sequence being captured by the immobilised marker. The capturing of the analyte gives rise to displacement of the partly double stranded section, thereby releasing a detectable marker into solution. Thus the detectable marker is only released when the correct sequence is hybridised.

(17) For non-nucleic acid based target analytes, the release can be triggered by the displacement of an antibody/antigen, peptide/peptide or peptide/molecule interaction. For example if copies of the target analyte are already immobilised to the surface, and conjugated to antibodies, exposure to the target analytes in solution causes the antibodies to be released from the surface via binding to the molecules in solution. The strength of the antibody/target interaction depends on the nature of the antibody, but can be adjusted as needed via control of the buffer conditions such as pH and ionic strength, and also via temperature. Similar immunoassays are well known in applications such as hormone testing, glucose testing etc. Conditions for the release of particular detectable markers can be designed based on the target analyte. The released marker may contain an antibody bound to the target analyte.

(18) Further examples of possible displacement mechanisms include the disruption of protein-protein interaction: one protein bound to the probe (printed) and the other protein coupled to first cleavage molecule. The presence of the target in the sample will disrupt the interaction with the printed molecule, which displaces the first released molecule to the amplification zone. Targets that can be detected by this method could be any molecule (organic or inorganic) that disrupt interaction between two molecules.

(19) Upon addition of a target sample to the device, the sample flows, either via capillary action or gravity directly into the displacement zone. The presence of the analyte causes release into solution of the first released marker. In the absence of the target analyte, the first marker is not released, and is therefore unable to flow into the amplification zone.

(20) Immobilisation of the first marker may be by any interaction which is stable to the flow of liquid. The immobilisation may be covalent or may be via a non-covalent interaction, such as for example an ionic interaction or a stable physical binding interaction such as biotin/avidin. The immobilisation of oligonucleotides may be via UV-crosslinking.

(21) Release of the first released marker allows the amplification process to start. The first released marker may contain a catalyst for use in the amplification zone. The catalyst may be for example an enzyme which can catalyse multiple events in the amplification zone(s). The first released marker may therefore contain an enzyme. The enzyme may be, for example a protease or peptidase.

(22) The device may contain more than one amplification zone. For example the device may contain three or more signal amplification areas. Each amplification area may be carrying out the same transformation, or different amplification processes may be carried out in each zone. For example the first displacement reaction may result in catalyst Z being released into solution. The first amplification zone may contain a catalyst Y immobilised by group Z′ (i.e. cleavable by Z). Exposure to Z thereby releases Y in the first amplification zone. After flow through the amplification zone, there are more molecules of Y is solution than there were molecules of Z entering the amplification zone. A second amplification zone can be present where catalyst X is immobilised by Y′. Exposure to released catalyst Y, which cleaves Y′, releases X. A further amplification zone can be present where catalyst W is immobilised by X′. Thus many more copies of W are released in the final amplification zone than copies of Z were present initially. Thus the amplification occurs.

(23) In the example given above, molecule W can be detected, or cause a detectable event to occur. Additionally, optionally X, Y or Z can each carry the same detectable moiety or cause the same detectable event to occur Alternatively each of W, X, Y and Z can each carry the same detectable moiety or cause the same detectable event to occur.

(24) Where the device contains more than one amplification zone, the detectable marker can be released in each amplification zone, or just the final amplification zone. A device may contain

(25) i) a displacement area having a first immobilised marker which can be displaced by the presence of the target analyte to produce a first released marker;

(26) ii) a first signal amplification area having further immobilised markers which can be released by the presence of the first released marker to produce a second released marker;

(27) iii) a second amplification area having further immobilised markers which can be released by the presence of the second released marker to produce a detectable marker; and

(28) iv) one or more detection areas which can identify the presence of the detectable marker;

(29) wherein the displacement area, signal amplification area(s) and detection area(s) are connected such that fluid can flow from the detection area through the signal amplification area(s) and into the detection area(s).

(30) The displacement process is a non-catalysed process that occurs without breaking chemical bonds.

(31) The device may contain further amplification areas, each capable of amplifying the signal and releasing further markers. A third amplification area may be present, in which case the second amplification area can release a third released marker, or further copies of the second or first released markers. The third amplification area releases the detectable marker, although the first, second or third markers may also be detectable.

(32) The amplification areas contain immobilised probes or markers which can be released upon exposure to the first, second or further marker(s). Immobilisation of the probes or further markers may be by any interaction which is stable to the flow of liquid. The immobilisation may be covalent or may be via a non-covalent interaction, such as for example an ionic interaction or a stable physical binding interaction such as biotin/avidin. The further probes/markers contain a portion which can be released from the surface by the presence of the first released marker to produce a detectable marker which is free in solution.

(33) The immobilised probes contain a cleavage element. Any catalyst which causes release of bound material via cleavage of the cleavage element can be used as part of the amplification system. Suitable catalysts include:

(34) Enzymatic Mediated Cleavage Such As:

(35) Polysaccharide hydrolases such as maltase, glucosidase, amylase, sucrase which cleave polysaccharide chains.

(36) Carboxylesterases, commonly found in the liver, such as acetylcholineesterase, carboxylesterase 1,2 and 3.

(37) Thiolases from the mevalonate pathway produce acetyl-coa and fatty acids upon cleavage.

(38) Lipases that hydrolyze fatty acids, such as lysosomal lipase and gastric lipase.

(39) Deoxyribonucleases that catalyze the hydrolytic cleavage of the phosphodiester bond in nucleic acids, producing free nucleotides.

(40) Phosphatases cleaving phosphate groups of proteins.

(41) Deubiquitinating enzymes cleaving ubiquitin molecules of proteins.

(42) Nuclease Mediated Cleavage Such As:

(43) Isomerases, deoxyribonucleases, such as deoxyribonuclease I, deoxyribonuclease II, Micrococcal nucleases, endonucleases, exonucleases

(44) Restriction enzymes type I, II, Iii, IV, V or artificial restriction enzymes, that cut DNA,

(45) Ribonucleases:

(46) a. endoribonucleases (RNase A, RNase H, RNase III, RNaseL, RNaseP, RNase PhyM, RNase T1, RNaseT2, RNase U, RNase V).

(47) b. exoribonucleases (Polynucleotide Phosphorylase (PNPase), RNase PH, RNase R, RNase D, RNase T, Oligoribonuclease, Exoribonuclease I, Exoribonuclease II).

(48) The immobilised markers may therefore include a cleavage element selected from an amide bond, a carbohydrate moiety, a dinucleotide, an ester moiety, a thioester moiety or a particular nucleotide sequence.

(49) The ratio of the first released marker to the detectable marker can be at least 1/1000. In order to detect the applied molecule, amplification to the marker molecules can allow for, for example, at least 10.sup.6 or more copies of the detectable marker released into solution. Such an amount is readily detectable. The number of detectable markers may be for example 10.sup.8 or higher. The number of detectable markers may be for example 10.sup.9 or higher. The number of detectable marker can be adjusted by the size and number of the amplification zones. Larger amplification zones mean that the sample takes longer to flow through the zone, thereby giving more time to catalyse release of the detectable markers.

(50) Each of the released products can carry the same detectable marker. The detectable marker may be for example an enzyme. The enzyme may for example cause a colour change in the detection zone. The detectable marker may carry a detectable label. The detectable marker may be for example a colloidal or nanoparticle stained molecule. The detectable label may be a fluorescent label. The detectable label may be a luminescent molecule. The nanoparticles may be gold, iron, copper, silver or similar metallic particles.

(51) The detection may result in the direct identification of released material. Alternatively the detection may be carried out using a colourimetric assay. The colourimetric assay may use the released enzyme to cause the colour change. The enzyme may cause luminescence or fluorescence or may result in a simple colour change.

(52) Suitable colourimetric assays include peroxidase assays (for example using HRP), galactosidase assays (for example using a Beta-galactosidase) or alkaline phosphatase (for example using alkaline phosphatase). The released enzyme may therefore be horseradish peroxidase (HRP), galactosidase or alkaline phosphatase.

(53) The measurement may be a simple end point detection (is the target analyte present; yes or no), or may involve an element of quantitative analysis. For quantitative analysis, the device can be coupled to a suitable reader allowing a direct measurement of the signal intensity in the detection zone. This can be correlated to the number of molecules present in the target sample. For semi-quantitative analysis, the detection zone can be calibrated to bind different amounts of colour particles (for example gold colloidal stained protein, bound to a printed antibody).

(54) For end point or semi-quantitative detection, the detection can be carried out using the human eye, rather than requiring any further hardware to read the result.

(55) The detection can be carried out in multiple zones or lines. For example, for semi quantitative detection different lines with different amount of trapping molecules can be printed (e.g. a first line containing 25 ng/cm, a second line containing 250 ng/cm, a third line containing 2.5 μg/cm and so on). Therefore, considering the molecular weight of the trapping molecule and calibrating the amplification steps, the accumulation of color on the stripes will be a reflection of the amount of target on the sample (i.e. if sample contains 1-10 target molecules, only first line will accumulate the color. If sample contains 10-100 target molecules, first and second lines will accumulate the color. If sample contains 100-1,000 target molecules, first, second and third lines will accumulate the color etc. Thus the quantification can be carried out using the different bands where the different bands have different responses depending on the amount of detectable marker in the fluid.

(56) Also disclosed herein is a method of detecting a target analyte, the method comprising applying a sample to a device having

(57) i) a displacement area having a first immobilised marker which can be displaced by the presence of the target analyte to produce a first released marker;

(58) ii) one or more signal amplification areas having further immobilised markers which can be released by the presence of the first released marker to produce a detectable marker; and

(59) iii) one or more detection areas which can identify the presence of the detectable marker;

(60) wherein the displacement area, signal amplification area(s) and detection area(s) are connected such that fluid can flow from the detection area through the signal amplification area(s) and into the detection area(s); flowing the sample from the detection area through the signal amplification area(s) and into the detection area(s) and determining from the presence of the detectable marker in the detection area the presence of the target analyte in the sample.

(61) The method requires no further material in solution. No enzymes or other catalysts are required to cause displacement.

(62) Also disclosed herein is a method of detecting a target analyte, the method comprising applying a sample to a device having

(63) i) one or more displacement areas having one or more immobilised markers which can be displaced by the presence of the one or more target analytes to produce one or more first released markers;

(64) ii) one or more signal amplification areas having further immobilised markers which can be released by the presence of the first released marker(s) to produce one or more detectable markers; and

(65) iii) one or more detection areas which can identify the presence of the detectable marker(s);

(66) wherein the displacement area(s), signal amplification area(s) and detection area(s) are connected such that fluid can flow from the detection area(s) through the signal amplification area(s) and into the detection area(s); flowing the sample from the detection area(s) through the signal amplification area(s) and into the detection area(s) and determining from the presence of the detectable marker(s) in the detection area the presence of the target analyte in the sample.

(67) The sensitivity and/or specificity of the assay can be improved by detecting more than one target analyte on the same device. More than one target may refer to, for example, different regions of the same gene or pathogen or may refer to, for example, two or more different pathogens. Detection of more than one target to trigger the detectable signal can be used to detect for example more than one part of a target gene or pathogen.

(68) The detection of separate target analytes may be carried out using independent amplification cascades for each target. Amplifications can be linked to release only one detectable molecule in the last step of the cascade, the final release being dependent on the presence of markers caused by the presence of both target analytes. Therefore signal will only be generated and detected in the presence of the different targets in the same sample. The use of displacement and amplification cascades for multiple regions of the same target gene or pathogen can achieve a greater accuracy than qPCR.

(69) As with the device, the target analyte can be a nucleic acid. The nucleic acid can have any of the properties describes above in connection with the device.

(70) Also disclosed is a kit of reagents for detecting a target analyte, the kit containing a device as described above and a buffer solution into which a biological sample can be added. The kit may further include instructions for use of the kit.

(71) Uses or Application of the Present Technology:

(72) Any biological sample can be analysed. Suitable fluids for application to the device include saliva, blood, plasma, urine, sweat etc. Samples may be lysed prior to analysis. Suitable solid sample may be dissolved in buffers prior to analysis.

(73) The present technology can be use for fast detection of the presence of many target analytes, for example interleukins, hormones, oncogenes, as protein or nucleic acids, pathogens (as protein or nucleic acid), virus (as protein or nucleic acid), drugs, toxins, metabolites.

(74) Fields in which the technology may be used include pathogen identification and contaminant tracing; forensic analyses; food industry; soil analyses; agriculture; aquaculture etc.

(75) Experimental Details & Methods:

(76) Generation of Lateral Flow Devices for Nucleic Acid Identification:

(77) Printing Immobilized Marker on Displacement Area:

(78) Strips of Positive charger Nylon membrane (e.g. Thermo scientific Cat #77016; Roche Cat #11417240001) were cut using clean scissors (e.g. strips of 15×80 mm).

(79) Reverse and complementary oligonucleotides (nucleic acid oligonucleotide) were designed to hybridize the target sequence (e.g. 49 base single strand DNA oligonucleotide, for example to detect: Ampicillin resistance gene bla 5′-ATCTGT CTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGA (SEQ ID NO: 1); Kanamycin resistance gene kan 5′-AAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGC (SEQ ID NO: 2); Chloramphenicol resistance gene cat 5′-GCAAGAATGTGAATAAAGGCCGGATAA AACTTGTGCTTATTTTTCTTTA (SEQ ID NO: 3)). The 49 base single stranded oligonucleotide was diluted to 0.25 μg/μl(approximately 15 μM) in printing solution (0.4 N NaOH in double distillated water).

(80) Oligonucleotides were printed using flat guide (e.g ruler or glass slip). Oligonucleotides in printed solutions were spread on the edge of the guide (e.g. 2.5 μl/cm of oligonucleotides in printing solution) and printed as a stripe in the middle of the 80 mm axis (e.g. leaving 7.5 mm on each side). The membranes were dried and further cross-linked using UV light (e.g. Stratalinker 2400). Membranes were blocked by incubating 1 hour in 2% BSA diluted in TBST (50 mM Tris pH 7.4, 150 mM NaCl, 0.05% tween-20) with constant agitation. Membranes were washed 4 times for 5 min in TBST.

(81) The single stranded displaceable probe carrying a detectable label (e.g. Biotin) was designed to partially hybridize to the printed probe (e.g. Tm 25-35° C., for example displaceable probe for: Ampicillin 5′-tacGAACGAtcaAGACAGATact[Biotin] (SEQ ID NO: 4); Kanamycin 5′-atcTGTTTGactTTGTCCTTact[Biotin] (SEQ ID NO: 5); Chloramphenicol 5′-ctaCTTTATattCATTCTTGCact[Biotin] (SEQ ID NO: 6)). The displaceable probe was diluted to 1 μM in TBST (e.g. 2 ml). Printed membranes were hybridized with displaceable probe at 42° C. overnight with constant movements. Membranes were washed 4 times for 5 min in TBST.

(82) Coupling of the catalyst to the displaceable probe. The printed membranes coupled with displaceable label probe, were incubated 2-4 hours in TBST containing 2% BSA plus the first enzymatically active molecule at 5 μg/ml (e.g. Avidin-protease Z, for example Avidin-Tobacco Vein Mottling Virus (TVMV) protease). Membranes were washed 4 times 5 min in TBST. Membranes were cut into four strips and then freeze dried for storage.

(83) Alternatively

(84) Strips of Positive charger Nitrocellulose membrane (e.g. Sartorius Unistart CN95, CN140, CN150) were cut using clean scissors (e.g. strips of 15×80 mm).

(85) Reverse and complementary Thiol-modified oligonucleotides (e.g. Ampicillin resistance gene bla 5′-[Thiol]ATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCC CGTCGTGTAGA (SEQ ID NO: 7); Kanamycin resistance gene kan 5′-[Thiol]AAGGACA ATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGC (SEQ ID NO: 8); Chloramphenicol resistance gene cat 5′-[Thiol]GCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTA (SEQ ID NO: 9)) where linked to Maleimide-activated BSA.

(86) Oligonucleotides-BSA were diluted in PBS at 2 μg/μl and printed using flat guide (e.g ruler or glass slip). Oligonucleotides in printed solutions were spread on the edge of the guide (e.g. 2.5 μl/cm of oligonucleotides in printing solution) and printed as a stripe in the middle of the 80 mm axis (e.g. leaving 7.5 mm on each side). The membranes were dried and the membranes were blocked by incubating 1 hour in 2% BSA diluted in TBST (50 mM Tris pH 7.4, 150 mM NaCl, 0.05% tween-20) with constant agitation. Membranes were washed 4 times for 5 min in TBST.

(87) The single stranded displaceable probe carrying a detectable label (e.g. Biotin) was designed to partially hybridize to the printed probe (e.g. Tm 25-35° C., for example displaceable probe for: Ampicillin 5′-tacGAACGAtcaAGACAGATact[Biotin] (SEQ ID NO: 4); Kanamycin 5′-atcTGTTTGactTTGTCCTTact[Biotin] (SEQ ID NO: 5); Chloramphenicol 5′-ctaCTTTATattCATTCTTGCact[Biotin] (SEQ ID NO: 6)). The displaceable probe was diluted to 1 μM in TBST (e.g. 2 ml). Printed membranes were hybridized with displaceable probe at 42° C. overnight with constant movements. Membranes were washed 4 times for 5 min in TBST.

(88) Coupling of the catalyst to the displaceable probe. The printed membranes coupled with displaceable label probe, were incubated 2-4 hours in TBST containing 2% BSA plus the first enzymatically active molecule at 5 μg/ml (e.g. Avidin-protease Z, for example Avidin-Tobacco Vein Mottling Virus (TVMV) protease). Membranes were washed 4 times 5 min in TBST. Membranes were cut into four strips and then freeze dried for storage.

(89) Printing Immobilized Marker on Amplification Area:

(90) Similarly as described above, stripes of membrane (e.g. Positive charger Nylon or Nitrocellulose) were cut using clean scissors (e.g. stripes of 15×80 mm).

(91) The labeled substrate (e.g. Biotinylated peptide BSA biotin) was printed along middle of the 80 mm axis (e.g. leaving 7.5 mm in each side). Considering the amount of labeled substrate and the binding capacity of the membrane (e.g. Nitrocellulose allow 170-200 μg/cm.sup.2 of protein) the level of amplification per step can be adjusted by varying the width of the printed area. Printed membranes were blocked by incubating 1 hour with 2% BSA diluted in TBST with constant agitation. Membranes were washed 4 times for 5 min in TBST.

(92) The printed membranes were incubated 2-4 hours in TBST containing 2% BSA plus first enzymatically active molecule at 5 μg/ml (e.g. Avidin-Z′-protease Y, for example Avidin-GSETVRFQSG-Tobacco Etch Virus (TEV) protease (SEQ ID NO: 10)). Membranes were washed 4 times for 5 min in TBST. Membranes were cut into four strips and then freeze dried for storage.

(93) Using this procedure, membranes carrying other steps of amplification were made (e.g. Avidin-Y′-protease_X, Avidin-X′-enzyme_E, etc). For the last amplification step, an enzyme (e.g. Avidin-GSENLYFQSG-HRP (SEQ ID NO: 11)) or colloidal stained molecule (e.g. Avidin-GSENLYFQSG-GFPgold (SEQ ID NO: 11) or Avidin-GSENLYFQSG -HRPgold (SEQ ID NO: 11)) was used.

(94) For detection of multiple targets at the last amplification step, an enzyme flanked by binding molecules at the amino and carboxyl terminus (e.g. Avidin-GSENLYFQSG -HRP (SEQ ID NO: 11)-GSETVRFQSG-Avidin (SEQ ID NO: 10)) or colloidal stained molecule (e.g. Avidin-GSENLYFQSG-GFPgold (SEQ ID NO: 11)-GSETVRFQSG-Avidin (SEQ ID NO: 10) or Avidin-GSENLYFQSG-HRPgold (SEQ ID NO: 11)-GSETVRFQSG-Avidin (SEQ ID NO: 10)) was used.

(95) Generation of Detection Zone:

(96) Similarly as described above, stripes of membrane (e.g. Whatman filter paper or Nitrocellulose) were cut using clean scissors (e.g. stripes of 50×80 mm).

(97) For enzymatic colourimetric detection end point detection, Whatman filters were printed with colourimetric substrate (e.g. TMB for HRP). For example, TMB solution (e.g. 10 μl/cm of solution containing 0.5 mg/ml of 3,′,5,5′ Tetramethyl Benzidine; 2.5 mg/ml Sodium Nitroprusside dehydrate, 50% DMSO in water) was printed along the 80 mm axis (e.g. leaving 10 and 40 mm distance from the side) for HPR detection. Membranes were let dry and were cut into 50 mm strips.

(98) For end-point detection or semi quantitative detection molecules that trap a stained molecule were printed (e.g. anti-HRP antibody that bind gold colloidal stained HRP). A line of anti-HRP antibody (e.g. 1 μg/cm affinity pure rabbit anti-horseradish peroxidase Jackson cat #323-005-021) was printed along the 80 mm axis (e.g. leaving 10 and 40 mm distance from the sides). For semi quantitative detection different lines with different amount of trapping molecules were printed (e.g. first line containing 25 ng/cm, second 250 ng/cm, third 2.5 μg/cm, fourth 25 μg/cm and so on). Therefore, considering the molecular weight of the printed molecule (e.g. rabbit anti-horseradish peroxidase molecular weight is 160kD, therefore the printed bands will be 9.2×10.sup.10, 9.2×10.sup.11, 9.2×10.sup.12 and 9.2×10.sup.13 molecules/cm respectively, which can bind 1.8×10.sup.11, 1.8×10.sup.12, 1.8×10.sup.13 and 1.8×10.sup.14 released molecules respectively) and calibrating the amplification steps (e.g. if the total amplification is 10.sup.11), the accumulation of color on the stripes will be a reflection of the amount of target on the sample (i.e. if sample contains 1-10 target molecules, only first line will accumulate the color. If sample contains 10-100 target molecules, first and second lines will accumulate the color. If sample contains 100-1,000 target molecules, first, second and third lines will accumulate the color. If sample contains 1,000-10,000 target molecules, first, second, third and fourth lines will accumulate the color). Printed membranes were blocked by incubating 1 hour with 2% BSA diluted in TBST with constant agitation. Membranes were washed 4 times for 5 min in TBST. Membranes were cut into four strips and then freeze dried for storage.

(99) Assembly of Lateral Flow Assay as Shown in FIG. 3:

(100) Each of the different sections (displacement, amplification and detection zones) of the assay were joined forming a line using small strip of tape to merge the junctions (e.g. scotch invisible tape). At the end of the detection zone a pad of absorbent material was added glass fiber paper.

(101) Performing the Assay:

(102) Sample was diluted in TBST buffer and applied to the assay strip. The sample travels through capillarity along the assay strip. In the displacement zone, the target hybridizes to the single stranded region of the immobilized probe, causing displacement of the oligonucleotide-biotin-avidin-protease marker. This flows into the amplification zone, thereby cleaving the peptide linkage between the avidin and the second protease to release the second protease. The second protease flows into the final amplification zone, where the second protease causes the HRP to be released. The HRP flows into the detection zone where its presence can be quantified.