NUCLEIC ACIDS AND METHODS FOR DETECTING METHYLATION STATUS
20170298427 · 2017-10-19
Inventors
- Jeffrey Buis (Ann Arbor, MI, US)
- Tobias Mann (Ann Arbor, MI, US)
- Julie Catherine Laliberte (Ypsilanti, MI, US)
- Adele Kruger (Livonia, MI, US)
Cpc classification
G16B25/00
PHYSICS
C12Q1/6811
CHEMISTRY; METALLURGY
C12P19/34
CHEMISTRY; METALLURGY
C12Q1/6811
CHEMISTRY; METALLURGY
G16B30/00
PHYSICS
G16B35/00
PHYSICS
G16B25/20
PHYSICS
C12N15/00
CHEMISTRY; METALLURGY
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
Abstract
The invention provides compositions and methods for determining whether a subject is predisposed to the disease or condition, or for diagnosing a disease or condition, or for detecting the state of a disease or condition, by detecting the methylation state of the subject's nucleic acids. In addition, the invention provides methods for determining the methylation age of a subject or tissue from a subject or for differentiation between nucleic acids originating from different subjects or tissues. The invention further provides methods for selecting nucleic acid molecules for use in the methods of the invention.
Claims
1. A method of determining the methylation state of a nucleic acid in a subject, the method comprising: a) obtaining a nucleic acid sample isolated from a sample from the subject; b) performing bisulfite conversion of the nucleic acid sample; c) capturing a plurality of target sequences of interest in the nucleic acid sample obtained in step b) by using one or more populations of molecular inversion probes (MIPs) to produce a plurality of replicons, wherein each of the MIPs in the population of MIPs comprises in sequence the following components: first targeting polynucleotide arm-first unique molecular tag-polynucleotide linker-second unique molecular tag-second targeting polynucleotide arm; wherein the first targeting polynucleotide arm in each of the MIPs is substantially complementary to a first repeat region, and the second targeting polynucleotide arm in each of the MIPs is substantially complementary to a second repeat region, further wherein the first and second repeat regions, respectively, flank each sequence in the plurality of target sequences of interest; wherein the first and second unique targeting molecular tags in each of the MIPs in combination are distinct in each of the MIPs; wherein the target sequence of interest in the plurality of target sequences of interest has one or more CpG sites; wherein each CpG site has a corresponding known position within the target sequence of interest; d) sequencing a plurality of MIPs amplicons that are amplified from the replicons obtained in step c); and e) determining the number of occurrences of cytosine nucleotides at each corresponding CpG site within the MIPs amplicons sequenced at step d) to determine the methylation state of a nucleic acid.
2-113. (canceled)
114. The method of claim 1, further comprising the step of comparing the methylation state of the nucleic acid to a methylation state of a second nucleic acid present in the sample.
115. The method of claim 114, wherein the subject is a pregnant female and the second nucleic acid is fetal nucleic acid.
116. The method of claim 114, wherein the subject is a tissue transplant recipient and the second nucleic acid is tissue donor nucleic acid.
117. The method of claim 1, wherein the sample is blood, plasma, or serum.
118. The method of claim 1, wherein the sample is selected from the group consisting of: liver, kidney, uterus, ovary, placenta, pancreas, colon, stomach, lung, and bladder tissue.
119. The method of claim 1, wherein the nucleic acid sample is DNA or RNA.
120. The method of claim 119, wherein the nucleic acid sample is genomic DNA.
121. The method of claim 1, wherein the length of the first targeting polynucleotide arm is between 14 and 30 bases.
122. The method of claim 1, wherein the length of the second targeting polynucleotide arm is between 14 and 30 bases.
123. The method of claim 1, wherein each of the targeting polynucleotide arms has a melting temperature between 45° C. and 66° C.
124. The method of claim 1, wherein each of the targeting polynucleotide arms has a GC content between 10% and 40%.
125. The method of claim 1, wherein the length of the first unique molecular tag is between 4 and 15 bases.
126. The method of claim 1, wherein the length of the second unique molecular tag is between 4 and 15 bases.
127. The method of claim 1, wherein the polynucleotide linker is not substantially complementary to any genomic region of the subject.
128. The method of claim 1, wherein the polynucleotide linker has a length of between 14 and 50 bases.
129. The method of claim 1, wherein the polynucleotide linker has a melting temperature of between 45° C. and 85° C.
130. The method of claim 1, wherein the polynucleotide linker has a GC content between 30% and 66%.
131. The method of claim 1, wherein the polynucleotide linker comprises at least one amplification primer binding site.
132. The method of claim 1, wherein the population of MIPs has a concentration between 10 fM and 100 nM.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0411] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.
[0412]
[0413]
[0414]
[0415]
[0416]
[0417]
[0418]
[0419]
[0420]
[0421]
[0422]
[0423]
[0424]
[0425]
[0426]
[0427]
[0428]
[0429]
[0430]
[0431]
[0432]
DETAILED DESCRIPTION OF THE INVENTION
[0433] This invention provides a system and method for detecting diseases or conditions. There is a need for informative, non-invasive tools facilitating improved diagnosis, prognosis, and surveillance of human disease. Several complex diseases including carcinogenesis display altered CpG methylation at specific loci and more broadly across the genome. Both targeted and whole genome bisulfite sequencing methods have been used to discern these changes in tissue and in cell-free DNA, but have significant cost and complexity drawbacks. To this end, the inventors have developed a single-probe capture method for sequencing ready libraries from input of DNA as low as 200 pg of tissue or circulating genetic material. This method simultaneously assesses >200,000 sites across the genome, which can be analyzed simultaneously to determine one or more of methylation status, genomic instability (e.g. copy number variation), or mutational landscape. Further, the inventors have developed methods to identify methylated regions and patterns, areas of genomic instability, and mutational landscapes that are significantly different between sample types.
[0434] The following detailed description is set forth as an aid to understanding various embodiments.
[0435] Unless otherwise defined herein, scientific and technical terms used in this application shall have the meanings that are commonly understood by those of ordinary skill in the art to which this invention belongs. Generally, nomenclature used in connection with, and techniques of, cell and tissue culture, molecular biology, cell biology, cancer biology, neurobiology, neurochemistry, virology, immunology, microbiology, genetics, protein and nucleic acid chemistry, chemistry, and pharmacology described herein, are those well-known and commonly used in the art. Each embodiment of the inventions described herein may be taken alone or in combination with one or more other embodiments of the inventions.
[0436] The methods and techniques of the various embodiments are generally performed, unless otherwise indicated, according to methods of molecular biology, cell biology, biochemistry, microarray and sequencing technology well known in the art and as described in various general and more specific references that are cited and discussed throughout this specification. See, e.g. Motulsky, “Intuitive Biostatistics”, Oxford University Press, Inc. (1995); Lodish et al., “Molecular Cell Biology, 4th ed.”, W. H. Freeman & Co., New York (2000); Griffiths et al., “Introduction to Genetic Analysis, 7th ed.”, W. H. Freeman & Co., N.Y. (1999); Gilbert et al., “Developmental Biology, 6th ed.”, Sinauer Associates, Inc., Sunderland, Mass. (2000).
[0437] Chemistry terms used herein are used according to conventional usage in the art, as exemplified by “The McGraw-Hill Dictionary of Chemical Terms”, Parker S., Ed., McGraw-Hill, San Francisco, Calif. (1985).
[0438] All of the above, and any other publications, patents and published patent applications referred to in this application are specifically incorporated by reference herein. In case of conflict, the present specification, including its specific definitions, will control.
[0439] Throughout this specification, the word “comprise” or variations such as “comprises” or “comprising” will be understood to imply the inclusion of a stated integer (or components) or group of integers (or components), but not the exclusion of any other integer (or components) or group of integers (or components).
[0440] The singular forms “a,” “an,” and “the” include the plurals unless the context clearly dictates otherwise.
[0441] The term “including” is used to mean “including but not limited to”. “Including” and “including but not limited to” are used interchangeably.
[0442] The following terms and definitions are provided herein.
Definitions
[0443] The term “DNA methylation” as used herein refers to the addition of a methyl group to the 5′ carbon of cytosine residues (i.e. 5-methylcytosines) among CpG dinucleotides. DNA methylation may occur in cytosines in other contexts, for example CHG and CHH, where H is adenine, cytosine or thymine. Cytosine methylation may also be in the form of 5-hydroxymethylcytosine. DNA methylation may include non-cytosine methylation such as N6-methyladenine.
[0444] The term “methylation state” or “methylation status” as used herein, refers to the state of a nucleic acid molecule or population of nucleic acid molecules with respect to the methylation of certain nucleotides. For example, genomic DNA is methylated at certain sites (e.g., CpG sites) at cytosine nucleotides. Thus, the methylation state of a nucleic acid may refer to the ratio of CpG sites in a genome that is methylated, or the ratio of CpG sites in a genome that is unmethylated.
[0445] The term “methylation score” as used herein refers to a ratio calculated from the number of cytosine sites (C's) observed at CpG sites. It may also be referred to as a “test ratio” or “reference ratio”. The methylation score provides the ratio of unconverted (i.e., methylated) cytosine nucleotides at one or more CpG sites usually across a region or the entire genome. The methylation score can be calculated using the following ratio:
Methylated C's at CpG site/(Methylated C's at CpG site+Unmethylated C's at CpG site).
[0446] While a single CpG site in a nucleic acid molecule can be methylated or unmethylated, it is more common, and clinically useful, to determine the methylation status of a population of cells with each cell containing a unique diploid genome. In some embodiments, the compositions and methods described herein provide a methylation score for a subset of the total diploid genomes within a selected sample. Thus, the binary methylation status of a collection of single CpG sites is being summed over the population of cells to give a methylation score across many CpG sites in a sample. In some embodiments, the methylation score of a region (e.g., block, gene, chromosome, or globally) can be calculated as a median, mean or average of the individual site ratios. The methylation score can also be expressed as a ratio or a percentage. In some embodiments that employ a sequencing readout such as next generation sequencing, the methylation score is calculated from the nucleic acid sequence information contained in sequencing reads comprising CpG sites. Thus, a methylation score can be thought of as the proportion of sequence reads showing methylation at CpG sites over the total number of reads covering the CpG sites—whether methylated or not. In some embodiments, a single read can generate multiple counts if it comprises multiple CpG sites. For example in
[0447] In some embodiments, the methylation score can be expressed as the “methylation density”, which is the methylation score for the CpG sites in a defined region (e.g., a particular CpG site, CpG sites within a CpG island, or a larger region such as a block). For example, the methylation density for a 1 Mb bin in the human genome can be determined from the number of counts showing CpG methylation divided by the total number of counts covering CpG sites in the 1 Mb region. This analysis can also be performed for other bin sizes, e.g. 50 kb, 100 kb, 200 kb, 250 kb, 300 kb, 400 kb, 500 kb, 750 kb, etc.
[0448] In some embodiments, the methylation score can be expressed as the “proportion of methylated cytosines”, which includes cytosines outside of the CpG context in the region.
[0449] In some embodiments, the methylation score can be expressed as a “global methylation score” or “global methylation index”. The global methylation index refers to the methylation score for all of the CpG sites interrogated by the compositions and methods described herein, which includes CpG sites across the genome (e.g., greater than 50,000, 60,000, 70,000, 80,000, 100,000, 150,000, 200,000, 300,000, 400,000, 500,000 or more CpG sites distributed throughout the genome); thus allowing one to generate a global methylation index with a single assay. The skilled worker will appreciate that not every CpG site in a genome needs to be studied to determine the global methylation index. For example, the methylation score of a subset of CpG sites may be determined as an indication for the global methylation state of the entire genome, and given as a “global methylation index”.
[0450] In some embodiments, a methylation score is determined for a test subject, sample, tissue or portion thereof, in which case it is referred to as a “test methylation score” or “test ratio”. A test ratio can be compared to a “reference methylation score” or “reference ratio” from a corresponding known (reference) subject, sample or tissue. For example, the methylation score from a population of cells (e.g., from a tumor, or from a particular tissue type), multiple or mixed populations of cells (e.g., maternal and fetal cells), or multiple subjects (e.g., smoker vs. non-smoker) can be determined and compared to corresponding well-characterized, reference samples or subjects.
[0451] In some embodiments, the regions with methylation differences between test samples and reference samples are referred to as “differentially methylated regions” (DMRs), which are regions or blocks having different methylation scores. A differentially methylated region (e.g., block, chromosome, gene, island, etc.) is identified by a difference in the methylation score between a test and reference sample across a sufficient number of samples to be significant.
[0452] The term “site” as used herein refers to a single site, which may be a single base position or a group of correlated base positions, e.g., a CpG site; whereas a “block” or “region” refers to a portion of the genome that includes multiple sites. A block may include one or more CpG islands, genes, chromatin regions such as large organized chromatin lysine-modifications, or nuclear organization regions such as lamin associated domains. A block may contain one or more repeat elements. The compositions and methods described herein offer improved methods for identifying large scale phenomenon of methylation dysregulation in diseases such as cancer. Rather than a specific targeting of methylation change at particular sites, the compositions and methods described are able to assay the regions of the genome believed to be pathologically important for cell differentiation and disease. Furthermore, in the case of cancer, there is evidence that epigenetic dysregulation is occurring early in cancer—even before full cancer development (see Timp et al. Genome Medicine 2014, 6:61) and is more likely to occur at CpG sites that reside in Alu repeat elements (see Luo et al. BioMed research international 2014); thereby adding to the clinical utility of the methods and compositions described herein.
[0453] The term “methylome” as used herein refers to the amount or pattern of methylation at different sites or regions within a population of cells. Thus, methylome can be thought of as the methylation score for a particular population of cells. For example, a disease state may have a methylome, such as the healthy liver methylome versus the necrotic liver. A tissue type may have a methylome, such as a liver methylome versus a blood methylome. A cellular phenotype may have a methylome, such as senescent cells versus dividing cells. The methylome may correspond to all of the genome, a subset of the genome (e.g., repeat elements in the genome), or a portion of the subset (e.g., those areas found to be associated with disease). A “fetal methylome” corresponds to a methylome of a fetus of a pregnant female. The fetal methylome can be determined using a variety of fetal tissues or sources of fetal DNA, including placental tissues and cell-free fetal DNA in maternal plasma. A “tumor methylome” corresponds to a methylome of a tumor of an organism (e.g., a human). The tumor methylome can be determined using tumor tissue or cell-free tumor DNA. In certain embodiments, cell-free tumor DNA is present in plasma. The fetal methylome and the tumor methylome are examples of a methylome of interest. Other examples of methylomes of interest are the methylomes of organs (e.g. methylomes of the liver, lungs, prostate, gastrointestinal tract, bladder etc.) that can contribute DNA into a bodily fluid (e.g. plasma, serum, sweat, saliva, urine, genital secretions, semen, stools fluid, diarrheal fluid, cerebrospinal fluid, secretions of the gastrointestinal tract, ascitic fluid, pleural fluid, intraocular fluid, fluid from a hydrocele (e.g. of the testis), fluid from a cyst, pancreatic secretions, intestinal secretions, sputum, tears, aspiration fluids from breast and thyroid, etc.). The organs may be transplanted organs. A methylome from plasma may be referred to a “plasma methylome”. The plasma methylome is an example of a cell-free methylome since plasma and serum include cell-free DNA (cfDNA). The plasma methylome is also an example of a mixed population methylome since it is a mixture of fetal/maternal methylome or tumor/non-tumor methylome or DNA derived from different tissues or organs.
[0454] The term “read” as used herein refers to the raw or processed output of sequencing systems, such as massively parallel sequencing. In some embodiments, the output of the methods and compositions described herein is reads. In some embodiments, these reads may need to be trimmed, filtered, and aligned, resulting in raw reads, trimmed reads, aligned reads. The term “count” as used herein refers to a uniquely aligned read within a target sequence of interest. In the context of the methylation score, a count will correspond to the information retrieved from the reads (methylated or unmethylated) at the CpG sites. Therefore, if a read encompassed multiple CpG site, this read can produce multiple counts.
[0455] In certain embodiments, the methods may be used to detect copy number variations. As used herein a “copy number variation” (CNV) generally is a class or type of genetic variation or chromosomal aberration. In some contexts, copy number variations refer to changes in copy number in germline cells, while copy number alterations/aberrations (CNAs) refer changes in copy number that have arisen in somatic tissue (e.g., in tumor cells). As used herein, copy number variations include copy number alterations/aberrations. A copy number variation can be a deletion (e.g. micro-deletion), duplication (e.g., a micro-duplication), or insertion (e.g., a micro-insertion). In certain embodiments, the prefix “micro” as used herein may refer to a segment of a nucleic acid less than 5 base pairs in length. A copy number variation can include one or more deletions (e.g. micro-deletion), duplications and/or insertions (e.g., a micro-duplication, micro-insertion) of a segment of a chromosome. In certain embodiments a duplication comprises an insertion. In certain embodiments an insertion is a duplication. In certain embodiments an insertion is not a duplication. For example, a duplication of a sequence in a portion increases the counts for a portion in which the duplication is found. Often a duplication of a sequence in a portion increases the elevation or level. In certain embodiments, a duplication present in portions making up a first elevation or level increases the elevation or level relative to a second elevation or level where a duplication is absent. In certain embodiments an insertion increases the counts of a portion and a sequence representing the insertion is present (i.e., duplicated) at another location within the same portion. In certain embodiments an insertion does not significantly increase the counts of a portion or elevation or level and the sequence that is inserted is not a duplication of a sequence within the same portion. In certain embodiments an insertion is not detected or represented as a duplication and a duplicate sequence representing the insertion is not present in the same portion. In some embodiments a copy number variation is a fetal copy number variation. Often, a fetal copy number variation is a copy number variation in the genome of a fetus. In some embodiments a copy number variation is a maternal and/or fetal copy number variation. In certain embodiments a maternal and/or fetal copy number variation is a copy number variation within the genome of a pregnant female (e.g., a female subject bearing a fetus), a female subject that gave birth or a female capable of bearing a fetus. A copy number variation can be a heterozygous copy number variation where the variation (e.g., a duplication or deletion) is present on one allele of a genome. A copy number variation can be a homozygous copy number variation where the variation is present on both alleles of a genome. In some embodiments a copy number variation is a heterozygous or homozygous fetal copy number variation. In some embodiments a copy number variation is a heterozygous or homozygous maternal and/or fetal copy number variation. A copy number variation sometimes is present in a maternal genome and a fetal genome, a maternal genome and not a fetal genome, or a fetal genome and not a maternal genome.
[0456] The term “aneuploidy,” as used herein, refers to a chromosomal abnormality characterized by an abnormal variation in chromosome number, e.g., a number of chromosomes that is not an exact multiple of the haploid number of chromosomes. For example, a euploid individual will have a number of chromosomes equaling 2n, where n is the number of chromosomes in the haploid individual. In humans, the haploid number is 23. Thus, a diploid individual will have 46 chromosomes. An aneuploid individual may contain an extra copy of a chromosome (trisomy of that chromosome) or lack a copy of the chromosome (monosomy of that chromosome). The abnormal variation is with respect to each individual chromosome. Thus, an individual with both a trisomy and a monosomy is aneuploid despite having 46 chromosomes. Examples of aneuploidy diseases or conditions include, but are not limited to, Down syndrome (trisomy of chromosome 21), Edwards syndrome (trisomy of chromosome 18), Patau syndrome (trisomy of chromosome 13), Turner syndrome (monosomy of the X chromosome in a female), and Klinefelter syndrome (an extra copy of the X chromosome in a male). Other, non-aneuploid chromosomal abnormalities include translocation (wherein a segment of a chromosome has been transferred to another chromosome), deletion (wherein a piece of a chromosome has been lost), and other types of chromosomal damage (e.g., Fragile X syndrome, which is caused by an X chromosome that is abnormally susceptible to damage).
[0457] The terms “subject” and “patient”, as used herein, refer to any animal, such as a dog, a cat, a bird, livestock, and particularly a mammal, and preferably a human. The term “reference subject” and “reference patients” refer to any subject or patient that exhibits known genotypes (e.g., known euploidy or aneuploidy), phenotypes, or age, or to a subject or patient that is known to have a disease or condition, or known to not have a disease or condition, or known to have a particular state of a disease or condition, or known to have a predisposition to a disease or condition, or known to have been exposed to drugs, toxins, a particular diet, or an agent or conditions suspected of causing methylation changes. The skilled worker will appreciate that the subject can be any human. In certain embodiments, the subject is a pregnant female. In these embodiments, the blood sample may be a maternal plasma or serum sample. In certain embodiments, the subject is an organ transplant recipient, and the subject's methylation state may be indicative of organ rejection. In certain embodiments, the methylation state of a population of target sequences of interest (e.g., of fetal, tumor, or disease origin) may be determined among a background of target sequences of interest (e.g., maternal, non-tumor, or disease-free origin). The background target sequences of interest may serve as a reference, wherein differences from the reference are indicative of a disease or condition, or to identify a nucleic acid species.
[0458] The term “mutational landscape”, as used herein, is the cumulative frequency of a collection of mutations that generally span the genome. The types of mutations that make up a mutational landscape, include but are not limited to, single nucleotide variations, deletions, and insertions, and the type of mutations also inform a given mutational landscape or pattern. Examples of specific mutational landscapes associated with diseases or conditions include an increased frequency of C>A transversions associated with cigarette smoke exposure (Ding, L. et al. Somatic mutations affect key pathways in lung adenocarcinoma. Nature 455, 1069-1075 (2008)), and an increased frequency of C>T transitions and C>G transversions associated with 12 cancer types (Kandoth, Cyriac, et al. “Mutational landscape and significance across 12 major cancer types.” Nature 502.7471 (2013): 333-339).
[0459] The term “tissue-of-origin” as used herein refers to the tissue source of nucleic acids in a sample, where “tissue” is used to describe a group or population of cells of a same type. Some tissue may have multiple cell types, for example hepatocytes, alveolar cells or blood cells, while other tissue may originate from different organisms, for example, mother and fetus, or from healthy vs. disease tissue. Likewise, “reference tissues” may be used to determine methylation-specific tissue patterns or levels. For example, reference tissues from multiple subjects may be used to determine the tissue components of a test sample. In some embodiments, the DNA molecules of differing origin are DNA molecules of maternal origin and DNA molecules of fetal origin. In some embodiments, the DNA molecules of differing origin are DNA molecules of a first tissue origin and DNA molecules of a second tissue origin or of leukocyte origin. In some embodiments, determining the tissue-of-origin may be indicative of the presence of disease (e.g., cancer), or may be used to determine the relative or absolute amount of DNA from a particular tissue (e.g., fetal cfDNA in a maternal sample). Thus, the compositions and methods described herein can be used to differentiate and identify the tissue source of DNA. Given an unknown source of tissue, DNA can be extracted using standard methods, the compositions and methods described herein can be used to generate tissue-specific data, and the data can be fit into the most likely tissue reference bin as described further in the Examples.
[0460] The terms “polynucleotide”, “nucleic acid” and “nucleic acid molecules”, as used herein, are used interchangeably and refer to DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), DNA-RNA hybrids, and analogs of the DNA or RNA generated using nucleotide analogs. The nucleic acid molecule can be a nucleotide, oligonucleotide, double-stranded DNA, single-stranded DNA, multi-stranded DNA, complementary DNA, genomic DNA, non-coding DNA, messenger RNA (mRNAs), microRNA (miRNAs), small nucleolar RNA (snoRNAs), ribosomal RNA (rRNA), transfer RNA (tRNA), small interfering RNA (siRNA), heterogeneous nuclear RNAs (hnRNA), or small hairpin RNA (shRNA). In certain embodiments, the methods can be performed on a nucleic acid sample such as DNA or RNA, e.g., genomic DNA. In some embodiments the nucleic acid molecule may be cell-free DNA (cfDNA). Cell-free DNA is thought to result from cellular necrosis or apoptosis, wherein genomic cellular DNA is digested and becomes fragmented, extracellular DNA. Cell-free DNA of apoptotic origin may be from a non-host (e.g., transplanted organ or tissue), fetus (e.g., from the placenta resulting in cell-free fetal DNA), or a diseased tissue (e.g., from a tumor resulting in circulating tumor DNA). Cell-free DNA can be detected in a range of samples including, but not limited to, blood, plasma and urine. In some embodiments, the nucleic acid molecules are associated with exosomes, which are microvesicles released from a variety of different cells, including cancer cells. In some embodiments, the compositions and methods described herein may be able to differentiate cfDNA of necrotic and apoptotic origin based on its methylation status. A nucleic acid sample may be isolated in any manner known to a person of ordinary skill in the art (e.g., by centrifugation).
[0461] The term “sample”, as used herein, refers to a sample typically derived from a biological fluid, cell, tissue, organ, or organism, comprising a nucleic acid or a mixture of nucleic acids comprising at least one nucleic acid sequence that is to be screened for, e.g., cancer or aneuploidy. In some embodiments, a sample is a blood sample such as a whole blood sample, a serum sample, or a plasma sample. In some embodiments the sample comprises at least one nucleic acid sequence whose genome is suspected of having undergone variation. Such samples include, but are not limited to sputum/oral fluid, amniotic fluid, blood, a blood fraction, or fine needle biopsy samples (e.g., surgical biopsy, core needle biopsy, fine needle biopsy, etc.) urine, stool, peritoneal fluid, pleural fluid, cerebro-spinal fluid, gastrointestinal fluid, cell lines, tissue embedded in paraffin, fresh frozen tissue, and the like. Although the sample is often taken from a human subject (e.g., patient), the assays can be used to detect a disease or condition, or detect the state of a disease or condition, or determine whether a subject has a predisposition to a disease or condition, in samples from any mammal, including, but not limited to dogs, cats, horses, goats, sheep, cattle, pigs, etc. The sample may be used directly as obtained from the biological source or following a pretreatment to modify the character of the sample. For example, such pretreatment may include preparing plasma from blood, diluting viscous fluids and so forth. Methods of pretreatment may also involve, but are not limited to, bisulfite conversion, filtration, precipitation, dilution, distillation, mixing, centrifugation, freezing, lyophilization, concentration, amplification, nucleic acid fragmentation, inactivation of interfering components, the addition of reagents, lysing, etc. If such methods of pretreatment are employed with respect to the sample, such pretreatment methods are typically such that the nucleic acid(s) of interest remain in the test sample, preferably at a concentration proportional to that in an untreated test sample (e.g., namely, a sample that is not subjected to any such pretreatment method(s)). Depending on the type of sample used, additional processing and/or purification steps may be performed to obtain nucleic acid fragments of a desired purity or size, using processing methods including but not limited to sonication, nebulization, gel purification, PCR purification systems, nuclease cleavage, size-specific capture or exclusion, targeted capture or a combination of these methods. Optionally, cell-free DNA may be isolated from the sample prior to further analysis. In some embodiments, the sample is from the subject whose disease or condition is to be determined by the systems and methods of the invention, also referred as “a test sample.”
[0462] The term “MIP,” as used herein, refers to a molecular inversion probe (also known as a circular capture probe). As used herein, the term “primer”, “probe”, or “capture probe” also may refer to a MIP in the context of their ability to selectively bind to nucleic acid molecules. Molecular inversion probes are nucleic acid molecules that contain two targeting polynucleotide arms, one or more unique molecular tags (also known as unique molecular identifiers (UMID's)), and a polynucleotide linker (e.g., a universal backbone linker). A polynucleotide linker can range from 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 400, 500, 1000, 1500, 2000 or more bases. See, for example,
[0463] In the MIPs, the polynucleotide arms are designed to hybridize upstream and downstream of target sequences (or sites) in a genomic nucleic acid sample. These polynucleotide arms are substantially complementary to one or more repeat sequences in a genomic nucleic acid sample that flank a target sequence (herein referred to as a “gap sequence” or a “unique gap sequence”. In some embodiments, the gap sequences are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 100, 125, 150, 175, 200, 225, 250, 275, 300, 400, 500, 1000, 1500, 2000 bases or greater in length. When interrogating cell-free DNA, the gap sequences are generally less than 150 or 200 bases in length. In some embodiments, the targeting polynucleotide arms comprise a ligation sequence and an extension sequence. A MIP may comprise targeting polynucleotide arms that are substantially complementary to a plurality of repeat sequences in a DNA sample. For example, a MIP can hybridize to tens, hundreds, thousands, hundreds of thousands, or millions of target sequences of interest in a DNA sample (e.g., a sample comprising a human genome). In some embodiments, a MIP targets, for example, greater than 1,000, greater than 10,000, greater than 20,000, greater than 30,000, greater than 40,000, greater than 50,000, greater than 60,000, greater than 70,000, greater than 80,000, greater than 90,000, greater than 100,000, greater than 200,000, greater than 300,000, greater than 400,000, greater than 500,000, greater than 600,000, greater than 700,000, greater than 800,000, greater than 900,000, and/or greater than 1,000,000 target sequences of interest. In some embodiments, “substantially complementary” refers to 0 mismatches in both arms, or at most 1 mismatch in only one arm (e.g., when the targeting polynucleotide arms hybridize to the first and second regions in the nucleic acid that, respectively, flank a site of interest). In some embodiments, “substantially complementary” refers to at most a small number of mismatches in both arms, such as 1, 2, 3, 3, 5, 6, 7, or 8.
[0464] The terms “target sequence”, “sequence of interest”, and “target sequence of interest” are used interchangeably to refer to the sequence bound or captured by the primes or probes of the invention and comprise one or more CpG sites. The target sequences of interest are selected to, among other considerations, comprise at least one CpG site; however, not every nucleic acid sequence captured by the primers or probes of the invention comprises a CpG site. In some embodiments, 30% or more, 31% or more, 32% or more, 33% or more, 34% or more, 35% or more, 36% or more, 37% or more, 38% or more, 39% or more, 40% or more, 41% or more, 42% or more, 43% or more, 44% or more, 45% or more, 46% or more, 47% or more, 48% or more, 49% or more, 50% or more, 51% or more, 52% or more, 53% or more, 54% or more, 55% or more, 56% or more, 57% or more, 58% or more, 59% or more, 60% or more, 61% or more, 62% or more, 63% or more, 64% or more, 65% or more, 66% or more, 67% or more, 68% or more, 69% or more, 70% or more of the nucleic acid sequences captured by the primers or probes of the invention comprise one or more CpG sites. These target sequences of interest may include the repeat sequences to which the targeting polynucleotide arms hybridize, as well as the gap sequences flanked by the repeat sequences. In certain embodiments, the repeat sequences have 0, 1, 2, 3, 4, or more mismatches in hybridizing with the targeting polynucleotide arms. In some embodiments the same repeat sequences are found in a target sequence of interest, in which case the target polynucleotide arms are identical. In other embodiments, two different repeat sequences (e.g., repeat A and repeat B) are found in a target sequence of interest, in which case the target polynucleotide arms are not identical. In specific embodiments, the repeat sequences have 0 or 1 mismatches in hybridizing with the targeting polynucleotide arms. In some embodiments, a MIP binds to Alu repeats. In some embodiments, a MIP does not bind long interspersed nucleotide elements (LINE) in the genome.
[0465] In some embodiments, the unique molecular tags are short nucleotide sequences that are randomly generated. In certain embodiments, the unique molecular tags are not designed to hybridize to any sequence or site located on a genomic nucleic acid fragment or in a genomic nucleic acid sample. In certain embodiments, the unique molecular tag is any tag with a suitable detectable label that can be incorporated into or attached to a nucleic acid (e.g., a polynucleotide) that allows detection and/or identification of nucleic acids that comprise or attach to the tag. In certain embodiments, unique molecular tags of sufficient length are introduced at concentrations to ensure that each MIP comprises a unique combination of molecular tags, thereby making each capture event distinct. By tracking individual capture events, one is able to identify duplicates and reduce capture bias. Although the invention described herein already allows for nearly uniform capture efficiencies since the same capture probe is used to interrogate many sites across the genome, the ability to account for capture bias (i.e., normalizing for differences in capture efficiency), further improves the quantitative aspects of the assay, for example, when doing CNV analysis. In some embodiments the tag is incorporated into or attached to a nucleic acid during a sequencing method (e.g., by a polymerase). Non-limiting examples of tags include nucleic acid tags, nucleic acid indexes or barcodes, a radiolabel (e.g., an isotope), metallic label, a fluorescent label, a chemiluminescent label, a phosphorescent label, a fluorophore quencher, a dye, a protein (e.g., an enzyme, an antibody or part thereof, a linker, a member of a binding pair), the likes or combinations thereof. In some embodiments the tag (e.g., a nucleic acid index or barcode) is a unique, known and/or identifiable sequence of nucleotides or nucleotide analogues. In some embodiments the tags or UMID's help reduce or remove amplification errors and sequencing errors by allowing for the identification of unique molecules during bioinformatics analysis. In some embodiments tags are four, five, or six or more contiguous nucleotides. Unique molecular identifiers comprising oligonucleotides are described in U.S. patent application Ser. No. 11/186,636, which published as US20070020640A1, and the use of oligonucleotide unique molecular identifiers with MIPs is described in U.S. patent application Ser. No. 12/027,039, which published as US20080269068A1. A multitude of fluorophores are available with a variety of different excitation and emission spectra. Any suitable type and/or number of fluorophores can be used as a tag. In some embodiments 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 20 or more, 30 or more, 50 or more, 100 or more, 500 or more, 1000 or more, 10,000 or more, 100,000 or more, 10̂6 or more, 10̂7 or more, 10̂8 or more, 10̂9 or more, 10̂10 or more, 10̂11 or more, 10̂12 or more different tags are utilized in a method described herein (e.g., a nucleic acid detection and/or sequencing method). In some embodiments, one or two types of tags (e.g., fluorescent labels) are linked to each nucleic acid in a library. In some embodiments, chromosome-specific tags are used to make chromosomal counting faster or easier. Detection and/or quantification of a tag can be performed by a suitable method, machine or apparatus, non-limiting examples of which include flow cytometry, quantitative polymerase chain reaction (qPCR), gel electrophoresis, a luminometer, a fluorometer, a spectrophotometer, a suitable gene-chip or microarray analysis, Western blot, mass spectrometry, chromatography, cytofluorimetric analysis, fluorescence microscopy, a suitable fluorescence or digital imaging method, confocal laser scanning microscopy, laser scanning cytometry, affinity chromatography, manual batch mode separation, electric field suspension, a suitable nucleic acid sequencing method and/or nucleic acid sequencing apparatus, the like and combinations thereof. In particular embodiments, the tag is suitable for use with microarray analysis.
[0466] The MIPs are introduced to nucleic acids (e.g., nucleic acid fragments) to perform capture of target sequences or sites located on a nucleic acid sample (e.g., a genomic DNA). In some embodiments, for example, if genomic DNA is present in a sample, fragmenting may aid in capture of target nucleic acid by molecular inversion probes. As described in greater detail herein, after capture of the target sequence (e.g., locus) of interest, the captured target may further be subjected to an enzymatic gap-filling and ligation step, such that a copy of the target sequence is incorporated into a circle, which is herein referred to as a replicon. Capture efficiency of the MIP to the target sequence on the nucleic acid fragment can be improved by lengthening the hybridization and gap-filing incubation periods. (See, e.g., Turner E H, et al., Nat Methods. 2009 Apr. 6:1-2.).
[0467] MIP technology may be used to detect or amplify particular nucleic acid sequences in complex mixtures. One of the advantages of using the MIP technology is in its capacity for a high degree of multiplexing, which allows thousands of target sequences to be captured in a single reaction containing thousands of MIPs. Various aspects of MIP technology are described in, for example, Hardenbol et al., “Multiplexed genotyping with sequence-tagged molecular inversion probes,” Nature Biotechnology, 21(6): 673-678 (2003); Hardenbol et al., “Highly multiplexed molecular inversion probe genotyping: Over 10,000 targeted SNPs genotyped in a single tube assay,” Genome Research, 15: 269-275 (2005); Burmester et al., “DMET microarray technology for pharmacogenomics-based personalized medicine,” Methods in Molecular Biology, 632: 99-124 (2010); Sissung et al., “Clinical pharmacology and pharmacogenetics in a genomics era: the DMET platform,” Pharmacogenomics, 11(1): 89-103 (2010); Deeken, “The Affymetrix DMET platform and pharmacogenetics in drug development,” Current Opinion in Molecular Therapeutics, 11(3): 260-268 (2009); Wang et al., “High quality copy number and genotype data from FFPE samples using Molecular Inversion Probe (MIP) microarrays,” BMC Medical Genomics, 2:8 (2009); Wang et al., “Analysis of molecular inversion probe performance for allele copy number determination,” Genome Biology, 8(11): R246 (2007); Ji et al., “Molecular inversion probe analysis of gene copy alternations reveals distinct categories of colorectal carcinoma,” Cancer Research, 66(16): 7910-7919 (2006); and Wang et al., “Allele quantification using molecular inversion probes (MIP),” Nucleic Acids Research, 33(21): e183 (2005), each of which is hereby incorporated by reference in its entirety for all purposes. See also in U.S. Pat. Nos. 6,858,412; 5,817,921; 6,558,928; 7,320,860; 7,351,528; 5,866,337; 6,027,889 and 6,852,487, each of which is hereby incorporated by reference in its entirety for all purposes.
[0468] MIP technology has previously been successfully applied to other areas of research, including the novel identification and subclassification of biomarkers in cancers. See, e.g., Brewster et al., “Copy number imbalances between screen- and symptom-detected breast cancers and impact on disease-free survival,” Cancer Prevention Research, 4(10): 1609-1616 (2011); Geiersbach et al., “Unknown partner for USP6 and unusual SS18 rearrangement detected by fluorescence in situ hybridization in a solid aneurysmal bone cyst,” Cancer Genetics, 204(4): 195-202 (2011); Schiffman et al., “Oncogenic BRAF mutation with CDKN2A inactivation is characteristic of a subset of pediatric malignant astrocytomas,” Cancer Research, 70(2): 512-519 (2010); Schiffman et al., “Molecular inversion probes reveal patterns of 9p21 deletion and copy number aberrations in childhood leukemia,” Cancer Genetics and Cytogenetics, 193(1): 9-18 (2009); Press et al., “Ovarian carcinomas with genetic and epigenetic BRCA1 loss have distinct molecular abnormalities,” BMC Cancer, 8:17 (2008); and Deeken et al., “A pharmacogenetic study of docetaxel and thalidomide in patients with castration-resistant prostate cancer using the DMET genotyping platform,” Pharmacogenomics, 10(3): 191-199 (2009), each of which is hereby incorporated by reference in its entirety for all purposes.
[0469] MIP technology has also been applied to the identification of new drug-related biomarkers. See, e.g., Caldwell et al., “CYP4F2 genetic variant alters required warfarin dose,” Blood, 111(8): 4106-4112 (2008); and McDonald et al., “CYP4F2 Is a Vitamin K1 Oxidase: An Explanation for Altered Warfarin Dose in Carriers of the V433M Variant,” Molecular Pharmacology, 75: 1337-1346 (2009), each of which is hereby incorporated by reference in its entirety for all purposes. Other MIP applications include drug development and safety research. See, e.g., Mega et al., “Cytochrome P-450 Polymorphisms and Response to Clopidogrel,” New England Journal of Medicine, 360(4): 354-362 (2009); Dumaual et al., “Comprehensive assessment of metabolic enzyme and transporter genes using the Affymetrix Targeted Genotyping System,” Pharmacogenomics, 8(3): 293-305 (2007); and Daly et al., “Multiplex assay for comprehensive genotyping of genes involved in drug metabolism, excretion, and transport,” Clinical Chemistry, 53(7): 1222-1230 (2007), each of which is hereby incorporated by reference in its entirety for all purposes. Further applications of MIP technology include genotype and phenotype databasing. See, e.g., Man et al., “Genetic Variation in Metabolizing Enzyme and Transporter Genes: Comprehensive Assessment in 3 Major East Asian Subpopulations With Comparison to Caucasians and Africans,” Journal of Clinical Pharmacology, 50(8): 929-940 (2010), which is hereby incorporated by reference in its entirety for all purposes.
[0470] The term “capture” or “capturing”, as used herein, refers to the binding or hybridization reaction between a primer or probe (e.g., molecular inversion probe) and the corresponding targeting site.
[0471] The term “sensitivity”, as used herein, refers to a statistical measure of performance of an assay (e.g., method, test), calculated by dividing the number of true positives by the sum of the true positives and the false negatives.
[0472] The term “specificity”, as used herein, refers to a statistical measure of performance of an assay (e.g., method, test), calculated by dividing the number of true negatives by the sum of true negatives and false positives.
[0473] The term “amplicon”, as used herein, refers to a nucleic acid generated via capturing reactions or amplification reactions. In some embodiments, the amplicon is a single-stranded nucleic acid molecule. In some embodiments, the amplicon is a single-stranded circular nucleic acid molecule. In some embodiments, the amplicon is a double-stranded nucleic acid molecule. For example, a MIP captures or hybridizes to a target sequence or site. After the capturing reaction or hybridization, a ligation/extension mixture is introduced to extend and ligate the gap region between the two targeting polynucleotide arms to form a single-stranded circular nucleotide molecule, i.e., a MIP replicon. The gap-filled sequence in the replicon can be thought of as an “insert” or “insert sequence”. The MIP replicon may be amplified through a polymerase chain reaction (PCR) to produce a plurality of MIP amplicons, which are double-stranded nucleotide molecules. MIP replicons and amplicons can be produced from a first plurality of target sequences of interest (e.g., a sequence containing known or suspected CpG sites) and a second plurality of target sequences of interest (e.g., target sequences distributed throughout the genome).
[0474] The term “sequencing”, as used herein, is used in a broad sense and may refer to any technique known in the art that allows the order of at least some consecutive nucleotides in at least part of a nucleic acid to be identified, including without limitation at least part of an extension product or a vector insert. Sequencing also may refer to a technique that allows the detection of differences between nucleotide bases in a nucleic acid sequence. Exemplary sequencing techniques include targeted sequencing, single molecule real-time sequencing, electron microscopy-based sequencing, transistor-mediated sequencing, direct sequencing, random shotgun sequencing, Sanger dideoxy termination sequencing, targeted sequencing, exon sequencing, whole-genome sequencing, sequencing by hybridization (e.g., in an array such as a microarray), pyrosequencing, capillary electrophoresis, gel electrophoresis, duplex sequencing, cycle sequencing, single-base extension sequencing, solid-phase sequencing, high-throughput sequencing, massively parallel signature sequencing, emulsion PCR, co-amplification at lower denaturation temperature-PCR (COLD-PCR), multiplex PCR, sequencing by reversible dye terminator, paired-end sequencing, near-term sequencing, exonuclease sequencing, sequencing by ligation, short-read sequencing, single-molecule sequencing, sequencing-by-synthesis, real-time sequencing, reverse-terminator sequencing, ion semiconductor sequencing, nanoball sequencing, nanopore sequencing, 454 sequencing, Solexa Genome Analyzer sequencing, miSeq (Illumina), HiSeq 2000 (Illumina), HiSeq 2500 (Illumina), Illumina Genome Analyzer (Illumina), Ion Torrent PGM™ (Life Technologies), MinION™ (Oxford Nanopore Technologies), real-time SMRT™ technology (Pacific Biosciences), the Probe-Anchor Ligation (cPAL™) (Complete Genomics/BGI), SOLiD® sequencing, MS-PET sequencing, mass spectrometry, and a combination thereof. In some embodiments, sequencing comprises detecting the sequencing product using an instrument, for example but not limited to an ABI PRISM® 377 DNA Sequencer, an ABI PRISM® 310, 3100, 3100-Avant, 3730, or 3730xI Genetic Analyzer, an ABI PRISM® 3700 DNA Analyzer, or an Applied Biosystems SOLiD™ System (all from Applied Biosystems), a Genome Sequencer 20 System (Roche Applied Science), or a mass spectrometer. In certain embodiments, sequencing comprises emulsion PCR. In certain embodiments, sequencing comprises a high throughput sequencing technique, for example but not limited to, massively parallel sequencing (MPS).
[0475] The methods and compositions described herein may alternatively employ microarray technology to quantify MIPs products. “Microarray” or “array” refers to a solid phase support having a surface, preferably but not exclusively a planar or substantially planar surface, which carries an array of sites containing nucleic acids such that each site of the array comprises substantially identical or identical copies of oligonucleotides or polynucleotides and is spatially defined and not overlapping with other member sites of the array; that is, the sites are spatially discrete. The array or microarray can also comprise a non-planar interrogatable structure with a surface such as a bead or a well. The oligonucleotides or polynucleotides of the array may be covalently bound to the solid support, or may be non-covalently bound. Conventional microarray technology is reviewed in, e.g., Schena, Ed., Microarrays: A Practical Approach, IRL Press, Oxford (2000). “Array analysis”, “analysis by array” or “analysis by microarray” refers to analysis, such as, e.g., sequence analysis, of one or more biological molecules using a microarray. In some embodiments each sample is hybridized individually to a single microarray. In other embodiments, processing through-put can be enhanced by physically connecting multiple microarrays onto a single multi-microarray plate for convenient high-throughput handling. In certain embodiments, custom DNA microarrays, for example from Affymetrix Inc. (Santa Clara, Calif., USA), can be manufactured to specifically quantify products of the MIPs assay.
[0476] It will be understood by one of ordinary skill in the art that the compositions and methods described herein may be adapted and modified as is appropriate for the application being addressed and that the compositions and methods described herein may be employed in other suitable applications, and that such other additions and modifications will not depart from the scope hereof.
[0477] This invention will be better understood from the Experimental Details which follow. However, one skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the invention as described more fully in the embodiments that follow thereafter.
Methods for Detecting Methylation Status
[0478] Existing methods for detecting methylation status employ whole genome sequencing techniques, which inherently require a large amount of input DNA and large numbers of reads to achieve coverage of desired methylation sites. Embodiments of the present invention provide a solution to the problems of existing methylation detection methods. These embodiments replace previous library preparations with a capture method using a small number of oligonucleotide MIPs comprising targeting polynucleotide arms that hybridize to repeat sequences, said arms being arms attached to high performance universal backbone structures. These MIPs are designed to flank and incorporate uniquely aligning sequences over the entire human genome, but are enriched for targets pertinent to methylation (i.e., targets containing CpG sites). CpG sites are sites located throughout the genome where methylation occurs at the cytosine nucleotide of the site. By performing sulphonation, hydrolytic deamination and desulphonation (e.g., bisulfite conversion, or simply deamination), unmethylated cytosines are converted to uracils. By contrast, methylated cytosines are protected from this reaction, and, thus, remain cytosines. Therefore, by performing a bisulfite conversion or an alternative procedure that preserves methylated cytosines, and subsequently sequencing CpG sites, the embodiments described herein provide a method of detecting whether a CpG site was methylated or not. Contemplated methods of selecting capture molecules enable the selection of unique sequences in a desired area for quantitation, and do not rely on the presence of some unique sequences in the amplification of convenient repeat sequences.
[0479] The use of repeat sequences in the optimized capture method allows dense tiling of a target area with little or no interference of similar sequences in the production of barcoded targets for single molecule kinetics during library preparation. In some embodiments, the method has economic benefits over previous methods. In particular, these methods provide savings from the use of a small number of capture reagents (primers or probes) that still are capable of surveying genome-wide indices. Moreover, the capture reagents can provide information not only about methylation status, but also more generally about the sequences of the target sites. This information can be used to determine, for example, copy number variation or mutational landscape. This information also can be used to detect chromosomal abnormalities, e.g., aneuploidies such as trisomy, or tissue-specific methylation scores and patterns along with disease or condition-specific mutational landscapes or patterns, e.g., the presence of tissue-specific circulating tumor DNA (ctDNA) in blood.
[0480] In some embodiments, the methods also provide a rapid analysis with a low read count in an assay that is easily multiplexed. For example, multiple layers of unique molecular tags and/or barcodes can be used within the methods to identify specific primer species as well as to deconvolute multiplex data to trace signals back to individual samples. For example, a first population of MIPs can be used to obtain methylation status (and optionally, sequence information), while a second population of MIPs provides sequence information. Moreover, the methods can be used in ultra low coverage applications such as detecting trisomies in a 100% fetal sample, such as a product of conception, or a non-fetal diagnostic sample. A sample can be mixed (e.g., fetal vs. maternal or diseased vs. non-diseased) or not mixed (e.g., an individual suspected of having a disease or condition), in which case the “coverage” or read depth can be lower because the signal will be strong. In some embodiments, the methods also are fast as compared to whole genome sequencing, whole exome sequencing, and targeted sequencing. The methods described herein also offer the advantage of requiring relatively small amounts of input DNA as compared to whole genome bisulfite sequencing, which suffers from input DNA loss during the harsh bisulfite conversion process, whereas the methods described herein allow for the capture of bisulfite converted DNA after the conversion step thereby preserving input DNA and reducing bias. More specifically, most library prep kits require double-stranded input DNA for an adapter ligation step. Since bisulfite conversion denatures the DNA, the bisulfite conversion step needs to be performed after the adapter ligation step, but before PCR. The harsh bisulfite conversion can compromise some of the ligated molecules, and thereby make them unusable. Also, using conventional methods, the ligation adapters need to be methylated, otherwise the cytosines will be converted, which adds additional cost.
[0481] In some embodiments, the methods are related to the field of genetic analysis. In general, these methods can be used as a rapid and economical means to detect and quantify methylation status. Because the methylation status can be determined by sequencing, the sequence information obtained by the methods described herein allows for detection of mutations as well as detection of deletions and duplications of genetic features in a range extending from complete chromosomes and arms of chromosomes to microscopic deletions and duplications, submicroscopic deletions and deletions, and even single nucleotide features including single nucleotide polymorphisms, deletions, and insertions. In certain embodiments, these methods can be used to detect sub-chromosomal genetic lesions, e.g., microdeletions. Moreover, the methods can be used to determine mutations or other sequence elements that correlate to a disease or condition (e.g., by detecting a SNP or SNPs). Because the methods provide different types of information in a single assay, they are simpler, more efficient, and less expensive than current methods. In certain embodiments, the methods also provide a maximum likelihood estimate (k) which will allow for increased accuracy and an estimation of the probe capture efficiency and reduces need for extraneous sequencing during copy number variation (CNV) detection. This may result in a low coefficient of variation (CV) due to probe uniformity because a small number of probes (e.g., one, two or more) is used. These capture probes allow the combination of additional probes with no interference or cross assay reactions. Combining the information from several probes and their unique reads greatly reduces error in the system. Indeed, targeted probe addition can greatly enhance assay utility while reducing cost.
[0482] The methods provided by some embodiments have particular advantages as compared to targeted sequencing. In certain embodiments, the methods described herein use a simultaneous recognition of two sequence elements at the point of capture, and the two arms are limited by proximity. By contrast, a typical targeted sequencing method will allow a polymerase to initiate at a single site. The run on-product created by typical sequencing produces inefficiency, but may also produce internal or “off-target priming” with the second primer. The inherent “dual recognition” of the nucleic acids of some embodiments increases stringency, an effect which carries over into the quantitation by the molecular identifier element in the MIP structure. A unique molecular tag may be placed at one site in the MIP backbone, but in standard targeted sequencing using a molecular identifier, a random sequence is used in both primers. Also, the methods allow for lower reagent costs since coverage across the genome can be achieved with very few MIPs compared to the hundreds or thousands of multiplexed, PCR primers required for targeted sequencing. Nevertheless, the methods enjoy most, if not all, of the economic and performance advantages that targeted sequencing displays over shotgun methods.
[0483] In sum, the methods and nucleic acids of some embodiments offer clear advantages over previously described genetic methods. For example, whole genome sequencing and massively parallel signature sequencing generally require costly analysis of large, non-informative portions of the genome; whereas the present methods can produce similar answers using a fraction of the genome, thereby reducing assay costs and time. Other approaches rely on selectively assaying informative portions of the genome. While certain aspects share some similarity, the methods, in some embodiments, use a novel, comprehensive approach for identifying repeat, primer-binding sites that allow for greater assay design parameters (sequence agnostic—for example, not limited to repeat line elements), more candidate primers (e.g., because all potential primers are enumerated), simple, lower cost assays that are specific and sensitive enough for clinical utility, and a greater ability to multiplex.
[0484] The compositions and methods described herein can be used to assemble methylomes through the sequence analysis of plasma DNA. The ability to determine the placental or fetal methylome from maternal plasma provides a noninvasive method to determine, detect and monitor the aberrant methylation profiles associated with pregnancy-related conditions such as preeclampsia, intrauterine growth restriction, preterm labor and others. For example, the detection of a disease-specific aberrant methylation signature allows the screening, diagnosis and monitoring of such pregnancy-associated conditions. The measuring of the maternal plasma methylation level allows the screening, diagnosis and monitoring of such pregnancy-associated conditions. Besides the direct applications on the investigation of pregnancy-associated conditions, the approach could be applied to other areas of medicine where plasma DNA analysis is of interest. For example, the methylomes of cancers could be determined from plasma DNA of cancer patients. Cancer methylome analysis from plasma, as described herein, is potentially a synergistic technology to cancer genomic analysis from plasma (e.g., the detection of well-known cancer-associated somatic mutations).
[0485] For earlier cancer detection, the determination of a methylation state could be used to screen for cancer. When the methylation test ratio of a plasma sample shows aberrant levels compared with healthy controls (reference ratio), cancer may be suspected. Using the compositions and methods described herein, further confirmation and assessment of the type of cancer or tissue-of-origin of the cancer may be performed. The compositions and methods described herein also allow for the detection of tumor-associated copy number aberrations, chromosomal translocations and single nucleotide variants across the genome (mutational landscape). In some embodiments, radiological and imaging investigations (e.g. computed tomography, magnetic resonance imaging, positron emission tomography) or endoscopy (e.g. upper gastrointestinal endoscopy or colonoscopy) can be used to further investigate individuals who are suspected of having cancer based on the plasma methylation scores.
[0486] For cancer screening or detection, the determination of a methylation score of a plasma (or other biologic) sample can be used in conjunction with other modalities for cancer screening or detection such as prostate specific antigen measurement (e.g. for prostate cancer), carcinoembryonic antigen (e.g. for colorectal carcinoma, gastric carcinoma, pancreatic carcinoma, lung carcinoma, breast carcinoma, medullary thyroid carcinoma), alpha fetoprotein (e.g. for liver cancer or germ cell tumors), CA125 (e.g. for ovarian and breast cancer) and CA19-9 (e.g. for pancreatic carcinoma).
[0487] Additionally, other tissues may be sequenced to obtain a cellular methylome. For example, liver tissue can be analyzed to determine a methylation pattern specific to the liver, which may be used to identify liver pathologies. Other tissues which can also be analyzed include brain cells, bones, the lungs, the heart, the muscles and the kidneys, etc. The methylation profiles of various tissues may change from time to time, e.g. as a result of development, aging, disease processes (e.g. inflammation or cirrhosis or autoimmune processes (such as in systemic lupus erythematosus)) or treatment (e.g. treatment with demethylating agents such as 5-azacytidine and 5-azadeoxycytidine). The dynamic nature of DNA methylation makes such analysis potentially valuable for monitoring of physiological and pathological processes. For example, if one detects a change in the plasma methylome of an individual compared to a baseline value obtained when they were healthy, one could then detect disease processes in organs that contribute plasma DNA.
[0488] Also, the methylomes of transplanted organs could be determined from plasma DNA of organ transplantation recipients. As plasma DNA is generally regarded as a marker of cell death, an increase in the plasma level of DNA released from a transplanted organ could be used as a marker for increased cell death from that organ, such as a rejection episode or other pathologic processes involving that organ (e.g. infection or abscess). In the event that anti-rejection therapy is successfully instituted, the plasma level of DNA released by the transplanted organ will be expected to decrease.
[0489] Exemplary applications of the methods include the detection, diagnosis, prognosis, recurrence, minimum residual risk assessment of methylation-associated diseases and conditions. For example, applications might include a method of determining whether a subject has a predisposition to a disease or condition that is associated with the methylation state of a nucleic acid; a method of diagnosing a disease or condition in a subject, said disease or condition being associated with the methylation state of a nucleic acid; a method of detecting the state of a disease or condition in a subject, said disease or condition being associated with the methylation state of a nucleic acid. Particular diseases and conditions include, for example, cancers. A hallmark of cancer cells is that they divide more rapidly than non-cancer cells. Thus, cancer cells and non-cancer cells will have different methylation patterns. The embodiments and methods described herein provide an assay for methylation, CNV and mutational landscape status in tumor biopsy or circulating tumor DNA. In particular, the embodiments and methods can be used to provide a diagnosis, prognosis, staging, and/or likelihood of developing cancers such as, for example, prostate cancer, colorectal cancer, lung cancer, breast cancer, liver cancer, or bladder cancer. Certain embodiments provide a diagnosis, or staging or prognostic information about a cancer, or to inform a treatment decision, or to assess minimum residual risk and recurrence. Conditions known to be affected by methylation, or known to affect methylation, include but are not limited to, aging, diet, lifestyle, ethnicity, development, bipolar disorder, multiple sclerosis, diabetes, schizophrenia, cancer, neurodegenerative diseases, inflammation, lesion, infection, immune response, exposure to: drugs, alcohol, tobacco, pesticides, heavy metals, radiation, UV other environmental factors. In some embodiments, the methods provided herein may provide the methylation status and sequence information of circulating cell-free fetal DNA, for example, as a noninvasive prenatal test. A noninvasive prenatal test using the methods described herein can be used, for example, to determine a risk for preeclampsia or preterm parturition. Additional tests using the methods described herein include pediatric diagnosis of aneuploidy, testing for product of conception or risk of premature abortion, noninvasive prenatal testing (both qualitative and quantitative genetic testing, such as detecting Mendelian disorders, insertions/deletions, and chromosomal imbalances), testing preimplantation genetics, tumor characterization, postnatal testing including cytogenetics, and mutagen effect monitoring.
[0490] Another exemplary application of the methods includes a method of differentiating nucleic acid species originating from a subject and one or more additional individuals, said subject and one or more additional individuals having differing methylation states of a nucleic acid. For example, the subject may be a pregnant female and the one or more additional individuals may be an unborn fetus. In these embodiments, the blood sample may be maternal plasma or maternal serum. Alternatively, the subject may be a tissue transplant recipient, and the one or more additional individuals may be a tissue transplant donor.
[0491] Another exemplary application of the methods includes a method of differentiating nucleic acid species originating from different tissues in a subject. For example, the methods of the invention may be used to differentiate between a tissue of interest (e.g., a tissue of fetal, tumor, or disease origin) and other tissues (e.g., maternal, non-tumor, or disease-free origin). In some embodiments, the subject may be a pregnant female. In these embodiments, the blood sample may be maternal plasma or maternal serum. Alternatively, the subject may be a tissue transplant recipient or a cancer patient.
[0492] Another exemplary application of the methods includes a method of determining the age or “bio-age” or “methylation age” of a subject or group of subjects. More specifically, an individual's genetic material is known to change over time, and the methods described herein allow for the methylation-based age determination of genetic material from an individual by determining the methylation status of thousands or hundreds of thousands of CpG sites in a single assay. This has utility both for forensic purposes and for age-related pathologies such as Alzheimer's disease. The methods are also useful for determining the age of a specific tissue. As described further in the Examples, the methods are useful for determining the “bio-age” for specific tissues such as colorectal tissue or the gestational age of a fetus.
[0493] The capture primers and probes (e.g., MIPs) in some embodiments also have the benefit of increased binding stability as compared to conventional PCR primer pairs that are not part of the same molecule. In certain embodiments, the exact targeting arm sequences are somewhat short for PCR primers, and hence will have very low melting temperatures in a PCR context. However, in a MIPs configuration, the primers will enhance binding specificity by cooperating to stabilize the interaction. If one arm has a high binding efficiency, the capture is enhanced even if the opposite arm has a lower efficiency. The additive length of the pair improves the “on/off” equilibrium for capture because the lower efficiency arm is more often in proximity of its target in a MIP than it would be as a free PCR primer.
[0494] In some embodiments, a method is provided for determining whether a subject has a predisposition to a disease or condition that is associated with the methylation state of a nucleic acid. In some embodiments, the invention provides a method for diagnosing a disease or condition in a subject, said disease or condition being associated with the methylation state of a nucleic acid. In some embodiments, the invention provides a method for detecting the state of a disease or condition in a subject, said disease or condition being associated with the methylation state of a nucleic acid. In certain embodiments, these methods comprise:
[0495] a) obtaining a nucleic acid sample isolated from a blood sample from the subject;
[0496] b) performing bisulfite conversion of the nucleic acid sample;
[0497] c) capturing a plurality of target sequences of interest in the nucleic acid sample obtained in step b) by using one or more populations of molecular inversion probes (MIPs) to produce a plurality of replicons,
[0498] wherein each of the MIPs in the population of MIPs comprises in sequence the following components: [0499] first targeting polynucleotide arm-first unique molecular tag-polynucleotide linker-second unique molecular tag-second targeting polynucleotide arm;
[0500] wherein the first targeting polynucleotide arm in each of the MIPs is substantially complementary to a first repeat region, and the second targeting polynucleotide arm in each of the MIPs is substantially complementary to a second repeat region, further wherein the first and second repeat regions, respectively, flank each sequence in the plurality of target sequences of interest;
[0501] wherein the first and second unique targeting molecular tags in each of the MIPs in combination are distinct in each of the MIPs;
[0502] wherein each target sequence of interest in the plurality of target sequences of interest has one or more CpG sites;
[0503] wherein each CpG site has a corresponding known position within the target sequence of interest;
[0504] d) sequencing a plurality of MIPs amplicons that are amplified from the replicons obtained in step c);
[0505] e) determining the number of occurrences of cytosine nucleotides at each corresponding CpG site within the MIPs amplicons sequenced at step d);
[0506] f) determining a test ratio based on a first sum of the numbers of occurrences of cytosine nucleotides determined at step e) and a second sum of the known numbers of CpG sites in the plurality of target sequences of interest;
[0507] g) comparing the test ratio to a plurality of reference ratios that are computed based on reference nucleic acid samples isolated from reference subjects with the disease or condition that is associated with the methylation state of the nucleic acid; and
[0508] h) determining whether a subject is predisposed to the disease or condition, or diagnosing the disease or condition in the subject, or detecting the state of the disease or condition in the subject, based on the comparing in step g).
[0509] In some embodiments, a method is provided of differentiating nucleic acid species originating from a subject and one or more additional individuals, said subject and one or more additional individuals having differing methylation states of a nucleic acid, the method comprising:
[0510] a) obtaining a nucleic acid sample isolated from a blood sample from the subject, said blood sample comprising nucleic acids originating from the subject and one or more additional individuals;
[0511] b) performing bisulfite conversion of the nucleic acid sample;
[0512] c) capturing a plurality of target sequences of interest in the nucleic acid sample obtained in step b) by using one or more populations of molecular inversion probes (MIPs) to produce a plurality of replicons,
[0513] wherein each of the MIPs in the population of MIPs comprises in sequence the following components: [0514] first targeting polynucleotide arm-first unique molecular tag-polynucleotide linker-second unique molecular tag-second targeting polynucleotide arm;
[0515] wherein the first targeting polynucleotide arm in each of the MIPs is substantially complementary to a first repeat region, and the second targeting polynucleotide arm in each of the MIPs is substantially complementary to a second repeat region, further wherein the first and second repeat regions, respectively, flank each sequence in the plurality of target sequences of interest;
[0516] wherein the first and second unique targeting molecular tags in each of the MIPs in combination are distinct in each of the MIPs;
[0517] wherein each target sequence of interest in the plurality of target sequences of interest has one or more CpG sites;
[0518] wherein each CpG site has a corresponding known position within the target sequence of interest;
[0519] d) sequencing a plurality of MIPs amplicons that are amplified from the replicons obtained in step c);
[0520] e) determining the number of occurrences of cytosine nucleotides at each corresponding CpG site within the MIPs amplicons sequenced at step d);
[0521] f) determining a test ratio based on a first sum of the numbers of occurrences of cytosine nucleotides determined at step e) and a second sum of the known numbers of CpG sites in the plurality of target sequences of interest;
[0522] g) comparing the test ratio to a plurality of reference ratios that are computed based on reference nucleic acid samples isolated from individuals having differing methylation states of the nucleic acid; and
[0523] h) differentiating nucleic acid species originating from the subject and the one or more additional individuals based on the comparing in step g).
[0524] In some embodiments, a method is provided of differentiating nucleic acid species originating from a first tissue and one or more additional tissues in a subject, said first tissue and one or more additional tissues having differing methylation states of a nucleic acid, the method comprising:
[0525] a) obtaining a nucleic acid sample isolated from a cell-free bodily fluid sample from the subject, said cell-free bodily fluid sample comprising nucleic acids originating from the first tissue and the one or more additional tissues;
[0526] b) performing bisulfite conversion of the nucleic acid sample;
[0527] c) capturing a plurality of target sequences of interest in the nucleic acid sample obtained in step b) by using one or more populations of molecular inversion probes (MIPs) to produce a plurality of replicons,
[0528] wherein each of the MIPs in the population of MIPs comprises in sequence the following components: [0529] first targeting polynucleotide arm-first unique molecular tag-polynucleotide linker-second unique molecular tag-second targeting polynucleotide arm;
[0530] wherein the first targeting polynucleotide arm in each of the MIPs is substantially complementary to a first repeat region, and the second targeting polynucleotide arm in each of the MIPs is substantially complementary to a second repeat region, further wherein the first and second repeat regions, respectively, flank each sequence in the plurality of target sequences of interest;
[0531] wherein the first and second unique targeting molecular tags in each of the MIPs in combination are distinct in each of the MIPs;
[0532] wherein each target sequence of interest in the plurality of target sequences of interest has one or more CpG sites;
[0533] wherein each CpG site has a corresponding known position within the target sequence of interest;
[0534] d) sequencing a plurality of MIPs amplicons that are amplified from the replicons obtained in step c);
[0535] e) determining the number of occurrences of cytosine nucleotides at each corresponding CpG site within the MIPs amplicons sequenced at step d);
[0536] f) determining a test ratio based on a first sum of the numbers of occurrences of cytosine nucleotides determined at step e) and a second sum of the known numbers of CpG sites in the plurality of target sequences of interest;
[0537] g) comparing the test ratio to a plurality of reference ratios that are computed based on reference nucleic acid samples isolated from reference tissues having differing methylation states of the nucleic acid;
[0538] h) differentiating nucleic acid species originating from the first tissue and the one or more additional tissues based on the comparing in step g).
[0539] In some embodiments, a method is provided of determining the methylation state of a nucleic acid and detecting copy number variation in a subject, the method comprising:
[0540] a) obtaining a nucleic acid sample isolated from a blood sample from the subject;
[0541] b) performing bisulfite conversion of the nucleic acid sample;
[0542] c) capturing a plurality of target sequences of interest in the nucleic acid sample obtained in step b) by using one or more populations of molecular inversion probes (MIPs) to produce a plurality of replicons,
[0543] wherein each of the MIPs in the population of MIPs comprises in sequence the following components: [0544] first targeting polynucleotide arm-first unique molecular tag-polynucleotide linker-second unique molecular tag-second targeting polynucleotide arm;
[0545] wherein the first targeting polynucleotide arm in each of the MIPs is substantially complementary to a first repeat region, and the second targeting polynucleotide arm in each of the MIPs is substantially complementary to a second repeat region, further wherein the first and second repeat regions, respectively, flank each sequence in the plurality of target sequences of interest;
[0546] wherein the first and second unique targeting molecular tags in each of the MIPs in combination are distinct in each of the MIPs;
[0547] wherein the target sequence of interest in the plurality of target sequences of interest has one or more CpG sites;
[0548] wherein each CpG site has a corresponding known position within the target sequence of interest;
[0549] d) sequencing a plurality of MIPs amplicons that are amplified from the replicons obtained in step c);
[0550] e) determining the number of occurrences of cytosine nucleotides at each corresponding CpG site within the MIPs amplicons sequenced at step d) to determine the methylation state of a nucleic acid; and
[0551] f) determining the number of the unique MIPs amplicons sequenced at step d); determining a read density based at least in part on the number of unique MIP amplicon sequences; and detecting copy number variation by comparing the read density to a plurality of reference read densities that are computed based on reference nucleic acid samples isolated from reference subjects.
[0552] In a further embodiment, targeting molecular tags are used to remove duplicates and thereby improve analysis. In certain embodiments, the number of unique MIP amplicon sequences is determined for defined regions to determine read density.
[0553] In some embodiments, a method is provided of determining the methylation age of a subject, the method comprising:
[0554] a) obtaining a nucleic acid sample isolated from a blood sample from the subject;
[0555] b) performing bisulfite conversion of the nucleic acid sample;
[0556] c) capturing a plurality of target sequences of interest in the nucleic acid sample obtained in step b) by using one or more populations of molecular inversion probes (MIPs) to produce a plurality of replicons,
[0557] wherein each of the MIPs in the population of MIPs comprises in sequence the following components: [0558] first targeting polynucleotide arm-first unique molecular tag-polynucleotide linker-second unique molecular tag-second targeting polynucleotide arm;
[0559] wherein the first targeting polynucleotide arm in each of the MIPs is substantially complementary to a first repeat region, and the second targeting polynucleotide arm in each of the MIPs is substantially complementary to a second repeat region, further wherein the first and second repeat regions, respectively, flank each sequence in the plurality of target sequences of interest;
[0560] wherein the first and second unique targeting molecular tags in each of the MIPs in combination are distinct in each of the MIPs;
[0561] wherein each target sequence of interest in the plurality of target sequences of interest has one or more CpG sites;
[0562] wherein each CpG site has a corresponding known position within the target sequence of interest;
[0563] d) sequencing a plurality of MIPs amplicons that are amplified from the replicons obtained in step c);
[0564] e) determining the number of occurrences of cytosine nucleotides at each corresponding CpG site within the MIPs amplicons sequenced at step d);
[0565] f) determining a test ratio based on a first sum of the numbers of occurrences of cytosine nucleotides determined at step e) and a second sum of the known numbers of CpG sites in the plurality of target sequences of interest;
[0566] g) comparing the test ratio to a plurality of reference ratios that are computed based on reference nucleic acid samples isolated from reference subjects; and
[0567] h) determining the methylation age of the subject based on the comparing in step g).
[0568] In some embodiments, a method is provided of determining the methylation age of a tissue in a subject, the method comprising:
[0569] a) obtaining a nucleic acid sample isolated from a cell-free bodily fluid sample from the subject, said cell-free bodily fluid sample comprising nucleic acids originating from the tissue;
[0570] b) performing bisulfite conversion of the nucleic acid sample;
[0571] c) capturing a plurality of target sequences of interest in the nucleic acid sample obtained in step b) by using one or more populations of molecular inversion probes (MIPs) to produce a plurality of replicons,
[0572] wherein each of the MIPs in the population of MIPs comprises in sequence the following components: [0573] first targeting polynucleotide arm-first unique molecular tag-polynucleotide linker-second unique molecular tag-second targeting polynucleotide arm;
[0574] wherein the first targeting polynucleotide arm in each of the MIPs is substantially complementary to a first repeat region, and the second targeting polynucleotide arm in each of the MIPs is substantially complementary to a second repeat region, further wherein the first and second repeat regions, respectively, flank each sequence in the plurality of target sequences of interest;
[0575] wherein the first and second unique targeting molecular tags in each of the MIPs in combination are distinct in each of the MIPs;
[0576] wherein each target sequence of interest in the plurality of target sequences of interest has one or more CpG sites;
[0577] wherein each CpG site has a corresponding known position within the target sequence of interest;
[0578] d) sequencing a plurality of MIPs amplicons that are amplified from the replicons obtained in step c);
[0579] e) determining the number of occurrences of cytosine nucleotides at each corresponding CpG site within the MIPs amplicons sequenced at step d);
[0580] f) determining a test ratio based on a first sum of the numbers of occurrences of cytosine nucleotides determined at step e) and a second sum of the known numbers of CpG sites in the plurality of target sequences of interest;
[0581] g) comparing the test ratio to a plurality of reference ratios that are computed based on reference nucleic acid samples isolated from reference tissues; and
[0582] h) determining the methylation age of the tissue based on the comparing in step g).
[0583] In some embodiments, the method is a method of determining whether a subject has a predisposition to a disease or condition that is associated with the methylation state of a nucleic acid, the method comprising:
[0584] a) obtaining a genomic DNA sample from a blood sample from the subject;
[0585] b) performing bisulfite conversion of the genomic DNA sample;
[0586] c) adding the bisulfite-converted genomic DNA sample into each well of a multi-well plate, wherein each well of the multi-well plate comprises a probe mixture, wherein the probe mixture comprises a population of molecular inversion probes (MIPs) and a buffer;
[0587] wherein each MIP in the population of MIPs comprises in sequence the following components:
[0588] first targeting polynucleotide arm-first unique molecular tag-polynucleotide linker-second unique molecular tag-second targeting polynucleotide arm;
[0589] wherein the first targeting polynucleotide arm in each of the MIPs is substantially complementary to a first repeat region, and the second targeting polynucleotide arm in each of the MIPs is substantially complementary to a second repeat region, further wherein the first and second repeat regions, respectively, flank each sequence in a plurality of target sequences of interest;
[0590] wherein the first and second unique targeting molecular tags in each of the MIPs in combination are distinct in each of the MIPs;
[0591] wherein each target sequence of interest in the plurality of target sequences of interest has one or more CpG sites;
[0592] wherein each CpG site has a corresponding known position within the target sequence of interest;
[0593] d) incubating the bisulfite-converted genomic DNA sample with the probe mixture for the MIPs to capture the plurality of target sequences of interest;
[0594] e) adding an extension/ligation mixture to the sample of d) for the MIPs and the plurality of target sequences of interest to form a plurality of MIPs replicons, wherein the extension/ligation mixture comprises a polymerase, a plurality of dNTPs, a ligase, and buffer;
[0595] f) adding an exonuclease mixture to the targeting and control MIPs replicons to remove excess probes or excess genomic DNA;
[0596] g) adding an indexing PCR mixture to the sample of f) to add a pair of sequencing adapters comprising a unique molecular tag for multiplexed sequencing to the plurality of amplicons;
[0597] h) using a massively parallel sequencing method to determine the number of occurrences of cytosine nucleotides at each corresponding CpG site within the MIPs amplicons;
[0598] i) determining a test ration based on a first sum of the numbers of occurrences of cytosine nucleotides determined at step h) and a second sum of the known numbers of CpG sites in the plurality of target sequences of interest;
[0599] j) comparing the test ratio to a plurality of reference ratios that are computed based on reference nucleic acid samples isolated from reference subjects with the disease or condition that is associated with the methylation state of the nucleic acid; and
[0600] k) determining whether the subject is predisposed to the disease or condition based on the comparing in step j).
[0601] In some embodiments, the method is a method of diagnosing a disease or condition in a subject, the method comprising:
[0602] a) obtaining a genomic DNA sample from a blood sample from the subject;
[0603] b) performing bisulfite conversion of the genomic DNA sample;
[0604] c) adding the bisulfite-converted genomic DNA sample into each well of a multi-well plate, wherein each well of the multi-well plate comprises a probe mixture, wherein the probe mixture comprises a population of molecular inversion probes (MIPs) and a buffer;
[0605] wherein each MIP in the population of MIPs comprises in sequence the following components:
[0606] first targeting polynucleotide arm-first unique molecular tag-polynucleotide linker-second unique molecular tag-second targeting polynucleotide arm;
[0607] wherein the first targeting polynucleotide arm in each of the MIPs is substantially complementary to a first repeat region, and the second targeting polynucleotide arm in each of the MIPs is substantially complementary to a second repeat region, further wherein the first and second repeat regions, respectively, flank each sequence in a plurality of target sequences of interest;
[0608] wherein the first and second unique targeting molecular tags in each of the MIPs in combination are distinct in each of the MIPs;
[0609] wherein each target sequence of interest in the plurality of target sequences of interest has one or more CpG sites;
[0610] wherein each CpG site has a corresponding known position within the target sequence of interest;
[0611] d) incubating the bisulfite-converted genomic DNA sample with the probe mixture for the MIPs to capture the plurality of target sequences of interest;
[0612] e) adding an extension/ligation mixture to the sample of d) for the MIPs and the plurality of target sequences of interest to form a plurality of MIPs replicons, wherein the extension/ligation mixture comprises a polymerase, a plurality of dNTPs, a ligase, and buffer;
[0613] f) adding an exonuclease mixture to the targeting and control MIPs replicons to remove excess probes or excess genomic DNA;
[0614] g) adding an indexing PCR mixture to the sample of f) to add a pair of sequencing adapters comprising a unique molecular tag to the plurality of amplicons;
[0615] h) using a massively parallel sequencing method to determine the number of occurrences of cytosine nucleotides at each corresponding CpG site within the MIPs amplicons;
[0616] i) determining a test ratio based on a first sum of the numbers of occurrences of cytosine nucleotides determined at step h) and a second sum of the known numbers of CpG sites in the plurality of target sequences of interest;
[0617] j) comparing the test ratio to a plurality of reference ratios that are computed based on reference nucleic acid samples isolated from reference subjects with the disease or condition that is associated with the methylation state of the nucleic acid; and
[0618] k) diagnosing the disease or condition in the subject based on the comparing in step j).
[0619] In some embodiments, the method is a method of detecting the state of a disease or condition in a subject, said disease or condition being associated with the methylation state of a nucleic acid, the method comprising:
[0620] a) obtaining a genomic DNA sample from a blood sample from the subject;
[0621] b) performing bisulfite conversion of the genomic DNA sample;
[0622] c) adding the bisulfite-converted genomic DNA sample into each well of a multi-well plate, wherein each well of the multi-well plate comprises a probe mixture, wherein the probe mixture comprises a population of molecular inversion probes (MIPs) and a buffer;
[0623] wherein each MIP in the population of MIPs comprises in sequence the following components:
[0624] first targeting polynucleotide arm-first unique molecular tag-polynucleotide linker-second unique molecular tag-second targeting polynucleotide arm;
[0625] wherein the first targeting polynucleotide arm in each of the MIPs is substantially complementary to a first repeat region, and the second targeting polynucleotide arm in each of the MIPs is substantially complementary to a second repeat region, further wherein the first and second repeat regions, respectively, flank each sequence in a plurality of target sequences of interest;
[0626] wherein the first and second unique targeting molecular tags in each of the MIPs in combination are distinct in each of the MIPs;
[0627] wherein each target sequence of interest in the plurality of target sequences of interest has one or more CpG sites;
[0628] wherein each CpG site has a corresponding known position within the target sequence of interest;
[0629] d) incubating the bisulfite-converted genomic DNA sample with the probe mixture for the MIPs to capture the plurality of target sequences of interest;
[0630] e) adding an extension/ligation mixture to the sample of d) for the MIPs and the plurality of target sequences of interest to form a plurality of MIPs replicons, wherein the extension/ligation mixture comprises a polymerase, a plurality of dNTPs, a ligase, and buffer;
[0631] f) adding an exonuclease mixture to the targeting and control MIPs replicons to remove excess probes or excess genomic DNA;
[0632] g) adding an indexing PCR mixture to the sample of f) to add a pair of sequencing adapters comprising a unique molecular tag to the plurality of amplicons;
[0633] h) using a massively parallel sequencing method to determine the number of occurrences of cytosine nucleotides at each corresponding CpG site within the MIPs amplicons;
[0634] i) determining a test ratio based on a first sum of the numbers of occurrences of cytosine nucleotides determined at step h) and a second sum of the known numbers of CpG sites in the plurality of target sequences of interest;
[0635] j) comparing the test ratio to a plurality of reference ratios that are computed based on reference nucleic acid samples isolated from reference subjects with the disease or condition that is associated with the methylation state of the nucleic acid; and
[0636] k) detecting the state of the disease or condition in the subject based on the comparing in step j).
[0637] In certain alternative embodiments, the MIPs of the invention may not comprise any unique molecular tags. It is possible to determine the methylation score, copy number variation, mutational landscape, etc. using MIPs that do not contain unique molecular tags, according to the methods of the disclosure.
[0638] In alternative embodiments, the bisulfate conversion of any of the methods described herein may be replaced by another type of deamination reaction.
[0639] The above methods may also be used to detect aneuploidy in a fetal or non-fetal subject. In certain embodiments, as an alternative to detecting aneuploidy, the methods can be used to detect and quantify deletions and duplications of genetic features in arms of chromosomes, as well as microscopic deletions and duplications, submicroscopic deletions and deletions, and single nucleotide features including single nucleotide polymorphisms, deletions, and insertions.
[0640] In some embodiments, the methods of the invention use a single species of MIP. In alternative embodiments, the methods are useful with 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more species of MIPs. For example, multiple species of MIPs can be used to detect different diseases or conditions (e.g., cancer, pregnancy-related conditions such as preeclampsia or preterm parturition, or chromosomal abnormalities such as aneuploidy) in a single sample. In certain embodiments, a single MIP can be used to detect different diseases or conditions (e.g., cancer, pregnancy-related conditions such as preeclampsia or preterm parturition, or chromosomal abnormalities such as aneuploidy) in a single sample.
[0641] The skilled worker will appreciate that the lengths of the first and second targeting polynucleotide arms can be varied as appropriate to provide efficient hybridization between the targeting polynucleotide and the nucleic acid sample. For example the first and/or second targeting polynucleotide arms can be between 14 and 30 bases, e.g., 18-21 bases. In certain embodiments, the length of the first and/or second targeting polynucleotide arms is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases. In certain embodiments, the targeting polynucleotide arms have a melting temperature (T.sub.M) between 45° C. and 80° C. (e.g., 45° C., 46° C., 47° C., 48° C., 49° C., 50° C., 51° C., 52° C., 53° C., 54° C., 55° C., 56° C., 57° C., 58° C., 59° C., 60° C., 61° C., 62° C., 63° C., 64° C., or 65° C.) and/or a GC content between 10% and 80% (e.g., approximately 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 80%). In certain embodiments, the targeting polynucleotide arms have a T.sub.M between 45° C. and 55° C. and/or a GC content between 15% and 25%. In certain embodiments, the targeting polynucleotide arms have a T.sub.M between 45° C. and 66° C. and/or a GC content between 10% and 40%. In some embodiments, the sequence of the first targeting polynucleotide arm is CACTACACTCCAACCTAA (SEQ ID NO:4) or TTCTCCTACCTCAACCTC (SEQ ID NO:5). In some embodiments, the sequence of the second targeting polynucleotide arm is CAAAAAACTAAAACAAAA (SEQ ID NO:6) or CCAAACTAAAATACAATA (SEQ ID NO:7). In some embodiments, the targeting polynucleotide arms target, for example, greater than 1,000, greater than 10,000, greater than 20,000, greater than 30,000, greater than 40,000, greater than 50,000, greater than 60,000, greater than 70,000, greater than 80,000, greater than 90,000, greater than 100,000, greater than 200,000, greater than 300,000, greater than 400,000, greater than 500,000, greater than 600,000, greater than 700,000, greater than 800,000, greater than 900,000, and/or greater than 1,000,000 sequences of interest. In some embodiments, a MIP does not bind long interspersed nucleotide elements (LINE) in the genome.
[0642] Unique molecular tags provide a way to determine the number of capture events for a given amplicon. A MIP may comprise one or more unique molecular tags, e.g., 1, 2, 3, 4, or 5 unique molecular tags. In certain embodiments, the length of the first and/or second unique molecular tag is between 4 and 15 bases, e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 bases.
[0643] A polynucleotide linker bridges the gap between the two targeting polynucleotide arms. In some embodiments, the polynucleotide linker is located directly between the first and second unique molecular tags. In certain embodiments, the polynucleotide linker is not substantially complementary to any genomic region of the subject. In certain embodiments, the polynucleotide linker has a length of between 20 and 1,000 bases (e.g., 20, 25, 30, 35, 40, 45, 50, 55, 60 or 65 bases) and/or a melting temperature of between 45° C. and 85° C. (e.g., 45° C., 50° C., 55° C., 60° C., 65° C., 70° C., 75° C., 80° C., or 85° C.) and/or a GC content between 10% and 80% (e.g., approximately 10%, 15%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 80%). In certain embodiments, the polynucleotide linker comprises at least one amplification primer binding site, e.g., a forward amplification primer binding site. In some embodiments, the linker includes a reverse amplification primer binding site. In some embodiments, the reverse primer binding site will be generated after the first extension of the PCR with a forward amplification primer. For example, the sequence of the forward amplification primer can comprise the nucleotide sequence of CCGTAATCGGGAAGCTGAAG (SEQ ID NO:1) and/or the sequence of the reverse amplification primer can comprise the nucleotide sequence of GCACGATCCGACGGTAGTGT (SEQ ID NO:2). Thus, the nucleotide sequence of the polynucleotide linker can comprise the nucleotide sequence of CTTCAGCTTCCCGATTACGGGCACGATCCGACGGTAGTGT (SEQ ID NO:3).
[0644] In certain embodiments, the MIP comprises the nucleotide sequence of CACTACACTCCAACCTAA(N.sub.11-10)CTTCAGCTTCCCGATTACGGGCACGATCCGACGGTAGTGT(N.sub.11-20)CAAAAAACTAAAACAAAA (SEQ ID NO:8), wherein (N.sub.1-10) represents the first unique molecular tag and (N.sub.11-20) represents the second unique molecular tag. In some embodiments, the MIP comprises the nucleotide sequence of TTCTCCTACCTCAACCTC(N1-10)CTTCAGCTTCCCGATTACGGGCACGATCCGACGGTAGTGT(N11-20) CCAAACTAAAATACAATA (SEQ ID NO:9), wherein (N.sub.1-10) represents the first unique molecular tag and (N.sub.11-20) represents the second unique molecular tag. In some embodiments the MIP comprises a 5′ phosphate to facilitate ligation.
[0645] In some embodiments, the population of MIPs has a concentration between 10 fM and 100 nM, for example, 0.5 nM. In certain embodiments, the concentration of MIPs used will vary with the number of sequences being targeted, e.g., as calculated by multiplying the number of target sequences of interest by the number of genomic equivalents in a reaction (the “total target number”). In particular embodiments, the approximate ratio of the number of MIP molecules to the total target number is 1:50, 1:100, 1:150, 1:200, 1:250, 1:300, 1:350, 1:400, 1:450, 1:500, 1:550, 1:600, 1:650, 1:700, 1:750, 1:800, 1:850, 1:900, 1:950, or 1:1,000. In certain embodiments, each of the MIPs replicons and/or amplicons is a single-stranded circular nucleic acid molecule.
[0646] In some embodiments, the MIPs replicons are produced by: i) the first and second targeting polynucleotide arms, respectively, hybridizing to the first and second regions in the nucleic acid sample, respectively, wherein the first and second regions flank a target sequence of interest; and ii) after the hybridization, using a ligation/extension mixture to extend and ligate the gap region between the two targeting polynucleotide arms to form single-stranded circular nucleic acid molecules. In certain embodiments, a MIP amplicon is produced by amplifying a MIP replicon, e.g., through PCR.
[0647] In some embodiments, the sequencing step comprises a next generation sequencing method, for example, a massively parallel sequencing method, or a short read sequencing method. In some embodiments, sequencing may be by any method known in the art, for example, targeted sequencing, single molecule real-time sequencing, electron microscopy-based sequencing, transistor-mediated sequencing, direct sequencing, random shotgun sequencing, Sanger dideoxy termination sequencing, targeted sequencing, exon sequencing, whole-genome sequencing, sequencing by hybridization, pyrosequencing, capillary electrophoresis, gel electrophoresis, duplex sequencing, cycle sequencing, single-base extension sequencing, solid-phase sequencing, high-throughput sequencing, massively parallel signature sequencing, emulsion PCR, co-amplification at lower denaturation temperature-PCR (COLD-PCR), multiplex PCR, sequencing by reversible dye terminator, paired-end sequencing, near-term sequencing, exonuclease sequencing, sequencing by ligation, short-read sequencing, single-molecule sequencing, sequencing-by-synthesis, real-time sequencing, reverse-terminator sequencing, nanopore sequencing, 454 sequencing, Solexa Genome Analyzer sequencing, SOLiD® sequencing, MS-PET sequencing, mass spectrometry, and a combination thereof. In some embodiments, sequencing comprises an detecting the sequencing product using an instrument, for example but not limited to an ABI PRISM® 377 DNA Sequencer, an ABI PRISM® 310, 3100, 3100-Avant, 3730, or 3730xI Genetic Analyzer, an ABI PRISM® 3700 DNA Analyzer, or an Applied Biosystems SOLiD™ System (all from Applied Biosystems), a Genome Sequencer 20 System (Roche Applied Science), or a mass spectrometer. In certain embodiments, sequencing comprises emulsion PCR. In certain embodiments, sequencing comprises a high throughput sequencing technique, for example but not limited to, massively parallel signature sequencing (MPSS).
[0648] A sequencing technique that can be used in various embodiments includes, for example, Illumina® sequencing. Illumina® sequencing is based on the amplification of DNA on a solid surface using fold-back PCR and anchored primers. Genomic DNA is fragmented, and adapters are added to the 5′ and 3′ ends of the fragments. DNA fragments that are attached to the surface of flow cell channels are extended and bridge amplified. The fragments become double stranded, and the double stranded molecules are denatured. Multiple cycles of the solid-phase amplification followed by denaturation can create several million clusters of approximately 1,000 copies of single-stranded DNA molecules of the same template in each channel of the flow cell. Primers, DNA polymerase and four fluorophore-labeled, reversibly terminating nucleotides are used to perform sequential sequencing. After nucleotide incorporation, a laser is used to excite the fluorophores, and an image is captured and the identity of the first base is recorded. The 3′ terminators and fluorophores from each incorporated base are removed and the incorporation, detection and identification steps are repeated. Sequencing according to this technology is described in U.S. Pat. No. 7,960,120; U.S. Pat. No. 7,835,871; U.S. Pat. No. 7,232,656; U.S. Pat. No. 7,598,035; U.S. Pat. No. 6,911,345; U.S. Pat. No. 6,833,246; U.S. Pat. No. 6,828,100; U.S. Pat. No. 6,306,597; U.S. Pat. No. 6,210,891; U.S. Pub. 2011/0009278; U.S. Pub. 2007/0114362; U.S. Pub. 2006/0292611; and U.S. Pub. 2006/0024681, each of which are incorporated by reference in their entirety.
[0649] Some embodiments comprise, before sequencing (e.g., the sequencing step of d) as described above), a PCR reaction to amplify the MIPs amplicons for sequencing. This PCR reaction may be an indexing PCR reaction. In certain embodiments, the indexing PCR reaction introduces into each of the MIPs amplicons the following components: a pair of indexing primers comprising a unique sample barcode and a pair of sequencing adaptors. In particular embodiments, the barcoded targeting MIPs amplicons comprise in sequence the following components in a 5′ to 3′ orientation:
[0650] a first sequencing adaptor-a first sequencing primer binding site-the first unique targeting molecular tag-the first targeting polynucleotide arm-captured nucleic acid-the second targeting polynucleotide arm-the second unique targeting molecular tag-a second sequencing primer binding site-a unique sample barcode-a second sequencing adaptor.
[0651] In some embodiments, the target sequences of interest are on a single chromosome. In alternative embodiments, the target sequences of interest are on multiple chromosomes. In particular embodiments, the target sequences of interest are selected at particular sites where methylation status correlates with a disease or condition. Because a single MIP sequence can be used to target sequences of interest across an entire genome, in certain embodiments the methods of the invention provide the benefit of being able to detect methylation status of more than one chromosome at a time. By selecting MIPs that provide ample coverage across the genome, the methylation status of the sequences of interest may serve as a proxy for the methylation status of a genome. Moreover, because the MIPs provide sequence information as well as methylation status, the MIPs may be used to detect 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more conditions associated with methylation status and/or chromosomal or other sequence abnormalities.
[0652] In some embodiments, the methods provided include a method of selecting a molecular inversion probe (MIP) from a plurality of candidate MIPs for using to detect methylation in a subject, the method comprising:
[0653] a) receiving nucleic acid sequences of the plurality of candidate MIPs, wherein each of the MIPs in the plurality of candidate MIPs comprises in sequence the following components: [0654] first targeting polynucleotide arm-first unique molecular tag-polynucleotide linker-second unique molecular tag-second targeting polynucleotide arm;
[0655] b) for each respective MIP in the plurality of candidate MIPs, [0656] i) computing a first number (A) of unique CpG sites predicted, with no mismatch on the binding arm sequence, to be captured by the respective MIP; [0657] ii) computing a second number (C) of unique CpG sites predicted, with one mismatch on the binding arm sequence to be captured by the respective MIP; [0658] iii) computing a third number (E) of unique sites predicted, with no mismatch on the binding arm sequence, to be captured by the respective MIP across a genome; [0659] iv) computing a fourth number (G) of unique sites predicted, with one mismatch on the binding arm sequence, to be captured by the respective MIP across the genome; [0660] v) computing a fifth number (F) of non-unique sites predicted, with no mismatch on the binding arm sequence, to be captured by the respective MIP across the genome; [0661] vi) computing a sixth number (H) of non-unique sites predicted, with one mismatch on the binding arm sequence, to be captured by the respective MIP across the genome; [0662] vii) computing a seventh number (I) of CpG sites present on the first targeting polynucleotide arm; [0663] viii) computing an eighth number (J) of CpG sites present on the second targeting polynucleotide arm; [0664] ix) computing a performance metric for the respective MIP based at least in part on the first, second, third, fourth, fifth, sixth, seventh, and eighth numbers;
[0665] c) selecting a MIP, based at least in part on the performance metric computed in step b)ix) for each MIP in the plurality of candidate MIPs.
[0666] For example, in the method above, the MIP at step c) may be selected such that a sum of the seventh number (I) and the eighth number (J) is smaller than the corresponding sum for a remaining set of the candidate MIPs. In certain embodiments, a first sum is a sum of the first number (A) and the second number (C), a second sum is a sum of the third number (E), the fourth number (G), the fifth number (F), and the sixth number (H); and the MIP at step c) is selected such that a ratio between the first sum and the second sum is larger than the ratio for a remaining set of the candidate MIPs. In certain embodiments, a third sum is a sum of the third number (E) and the fourth number (G); a fourth sum is a sum of the third number (E), the fourth number (G), the fifth number (F), and the sixth number (H); and the MIP at step c) is selected such that a ratio between the third sum and the fourth sum is larger than the ratio for a remaining set of the candidate MIPs. In certain embodiments, the MIP at step c) is selected based on a ratio (K.sub.e) of an average capture coefficient of one mismatch sites (K.sub.1) on the binding arm sequence and an average capture coefficient of zero mismatch sites (K.sub.0):
and wherein the ratio (K.sub.e) is experimentally estimated. In certain embodiments, the performance metric at step b) includes a factor corresponding to a weighted sum of the first number (A) and the second number (C). In certain embodiments, the weighted sum corresponds to A+Ke×C. In certain embodiments, the performance metric at step b) includes a factor corresponding to a weighted sum of the third number (E) and the fourth number (G). In certain embodiments, the weighted sum corresponds to E+Ke×G. In certain embodiments, the MIP at step c) is selected such that a product between a first weighted sum of A+Ke×C and a second weighted sum of E+Ke×G is larger than the product for a remaining set of the candidate MIPs.
[0667] In some embodiments, a nucleic acid molecule comprising a nucleotide sequence of CACTACACTCCAACCTAA(N.sub.11-10)CTTCAGCTTCCCGATTACGGGCACGATCCGACGGTAGTGT(N.sub.11-20)CAAAAAACTAAAACAAAA (SEQ ID NO:8), wherein (N.sub.1-10) represents a first unique molecular tag and (N.sub.11-20) represents a second unique molecular tag, is provided. In some embodiments, a nucleic acid molecule comprising a nucleotide sequence of TTCTCCTACCTCAACCTC(N1-10)CTTCAGCTTCCCGATTACGGGCACGATCCGACGGTAGTGT(N11-20)CCAAACTAAAATACAATA (SEQ ID NO:9), wherein (N.sub.1-10) represents the first unique molecular tag and (N.sub.11-20) represents the second unique molecular tag, is provided. Additional MIP molecules of the invention include the following:
TABLE-US-00001 mROP208-F, (SEQ ID NO: 11) TCCTACCTCAACCTCCTA(6N)BB(6N)CCAAACTAAAATACAATA, (SEQ ID NO: 12) /5Phos/TCCTACCTCAACCTCCTANNNNNNCTTCAGCTTCCCGATTAC GGGCACGATCCGACGGTAGTGTNNNNNNCCAAACTAAAATACAATA mROP208-R, (SEQ ID NO: 13) CACTACACTCCAACCTAA(6N)BB(6N)CAAAAAACTAAAACAAAA, (SEQ ID NO: 14) /5Phos/CACTACACTCCAACCTAANNNNNNCTTCAGCTTCCCGATTAC GGGCACGATCCGACGGTAGTGTNNNNNNCAAAAAACTAAAACAAAA mROP206-F, (SEQ ID NO: 15 TTCTCCTACCTCAACCTC(6N)BB(6N)CCAAACTAAAATACAATA, (SEQ ID NO: 16) /5Phos/TTCTCCTACCTCAACCTCNNNNNNCTTCAGCTTCCCGATTAC GGGCACGATCCGACGGTAGTGtNNNNNNCCAAACTAAAATACAATA mROP206-R, (SEQ ID NO: 17) CACTACACTCCAACCTAA(6N)BB(6N)AAAACTAAAACAAAAAAA, (SEQ ID NO: 18) /5Phos/CACTACACTCCAACCTAANNNNNNCTTCAGCTTCCCGATTAC GGGCACGATCCGACGGTAGTGTNNNNNNAAAACTAAAACAAAAAAA
As used herein, “BB” refers to a backbone sequence. The skilled artisan will understand that any generic backbone sequence may be applicable here. As described above, in particular embodiments, a) the length of the first unique molecular tag is between 4 and 15 bases; and/or b) the length of the second unique molecular tag is between 4 and 15 bases.
Methods for Identifying MIPs
[0668]
[0669] The computing device 100 comprises at least one communications interface unit 108, an input/output controller 110, system memory, and one or more data storage devices. The system memory includes at least one random access memory (RAM 102) and at least one read-only memory (ROM 104). All of these elements are in communication with a central processing unit (CPU 106) to facilitate the operation of the computing device 100. The computing device 100 may be configured in many different ways. For example, the computing device 100 may be a conventional standalone computer or alternatively, the functions of computing device 100 may be distributed across multiple computer systems and architectures. In
[0670] The computing device 100 may be configured in a distributed architecture, wherein databases and processors are housed in separate units or locations. Some units perform primary processing functions and contain at a minimum a general controller or a processor and a system memory. In distributed architecture embodiments, each of these units may be attached via the communications interface unit 108 to a communications hub or port (not shown) that serves as a primary communication link with other servers, client or user computers and other related devices. The communications hub or port may have minimal processing capability itself, serving primarily as a communications router. A variety of communications protocols may be part of the system, including, but not limited to: Ethernet, SAP, SAS™, ATP, BLUETOOTH™, GSM and TCP/IP.
[0671] The CPU 106 comprises a processor, such as one or more conventional microprocessors and one or more supplementary co-processors such as math co-processors for offloading workload from the CPU 106. The CPU 106 is in communication with the communications interface unit 108 and the input/output controller 110, through which the CPU 106 communicates with other devices such as other servers, user terminals, or devices. The communications interface unit 108 and the input/output controller 110 may include multiple communication channels for simultaneous communication with, for example, other processors, servers or client terminals.
[0672] The CPU 106 is also in communication with the data storage device. The data storage device may comprise an appropriate combination of magnetic, optical or semiconductor memory, and may include, for example, RAM 102, ROM 104, flash drive, an optical disc such as a compact disc or a hard disk or drive. The CPU 106 and the data storage device each may be, for example, located entirely within a single computer or other computing device; or connected to each other by a communication medium, such as a USB port, serial port cable, a coaxial cable, an Ethernet cable, a telephone line, a radio frequency transceiver or other similar wireless or wired medium or combination of the foregoing. For example, the CPU 106 may be connected to the data storage device via the communications interface unit 108. The CPU 106 may be configured to perform one or more particular processing functions.
[0673] The data storage device may store, for example, (i) an operating system 112 for the computing device 100; (ii) one or more applications 114 (e.g., computer program code or a computer program product) adapted to direct the CPU 106 in accordance with the systems and methods described here, and particularly in accordance with the processes described in detail with regard to the CPU 106; or (iii) database(s) 116 adapted to store information that may be utilized to store information required by the program.
[0674] The operating system 112 and applications 114 may be stored, for example, in a compressed, an uncompiled and an encrypted format, and may include computer program code. The instructions of the program may be read into a main memory of the processor from a computer-readable medium other than the data storage device, such as from the ROM 104 or from the RAM 102. While execution of sequences of instructions in the program causes the CPU 106 to perform the process steps described herein, hard-wired circuitry may be used in place of, or in combination with, software instructions for embodiment of the processes of the present invention. Thus, the systems and methods described are not limited to any specific combination of hardware and software.
[0675] Suitable computer program code may be provided for performing one or more functions as described herein. The program also may include program elements such as an operating system 112, a database management system and “device drivers” that allow the processor to interface with computer peripheral devices (e.g., a video display, a keyboard, a computer mouse, etc.) via the input/output controller 110.
[0676] The term “computer-readable medium” as used herein refers to any non-transitory medium that provides or participates in providing instructions to the processor of the computing device 100 (or any other processor of a device described herein) for execution. Such a medium may take many forms, including but not limited to, non-volatile media and volatile media. Non-volatile media include, for example, optical, magnetic, or opto-magnetic disks, or integrated circuit memory, such as flash memory. Volatile media include dynamic random access memory (DRAM), which typically constitutes the main memory. Common forms of computer-readable media include, for example, a floppy disk, a flexible disk, hard disk, magnetic tape, any other magnetic medium, a CD-ROM, DVD, any other optical medium, punch cards, paper tape, any other physical medium with patterns of holes, a RAM, a PROM, an EPROM or EEPROM (electronically erasable programmable read-only memory), a FLASH-EEPROM, any other memory chip or cartridge, or any other non-transitory medium from which a computer can read.
[0677] Various forms of computer readable media may be involved in carrying one or more sequences of one or more instructions to the CPU 106 (or any other processor of a device described herein) for execution. For example, the instructions may initially be borne on a magnetic disk of a remote computer (not shown). The remote computer can load the instructions into its dynamic memory and send the instructions over an Ethernet connection, cable line, or even telephone line using a modem. A communications device local to a computing device 100 (e.g., a server) can receive the data on the respective communications line and place the data on a system bus for the processor. The system bus carries the data to main memory, from which the processor retrieves and executes the instructions. The instructions received by main memory may optionally be stored in memory either before or after execution by the processor. In addition, instructions may be received via a communication port as electrical, electromagnetic or optical signals, which are exemplary forms of wireless communications or data streams that carry various types of information.
[0678]
[0679] At step 202, a set of constraints is determined. The set of constraints may be determined, for example, by CPU 106 using software or application(s) implemented thereon. In some embodiments, the software or application(s) may also be used by CPU 106 to perform any one or more of the subsequent steps in process 200. For example, the software and application(s) may be used by CPU 106 to find abundant primer pairs in a given reference genome (e.g., HG19) based on the determined constraints, and to automatically create suffix-array-based index for the genome file.
[0680] In some embodiments, the set of constraints may alternatively be referred to as algorithm flags. For example, the constraints (or algorithm flags) may include a length of the left primer and right primers (or ligation and extension arms, respectively), a minimum frequency of the primer-pair, a maximum distance between primers (e.g., amplicon length), a minimum and/or maximum total frequency of the primer, a minimum GC-content per primer in percent, a minimum amount of non-identical amplicons in percent, a distribution of primers in genome, or any suitable combination thereof. In an illustrative embodiment, the following set of constraints may be used in designing primer pairs: [0681] Length of the left primer or ligation arm: 18, 19, 20, 21 bases [0682] Length of the right primer or extension arm: 18, 19, 20 21 bases [0683] Frequency of primer-pair: 100, 250, 500, 2500, 5000, 10,000, 100,000, 500,000, 1,000,000 [0684] Amplicon Length: 50-150 base pairs, e.g., less than 85 base pairs [0685] Minimum GC content per primer: 10%, 15%, 20%, 30%, 40% [0686] Amplicon uniqueness (percent of target sequences of interest that are unique): greater than about 40% [0687] Distribution of primers in genome: iteratively ran, with each bucket size (bs) ranging from 1 to 50%, and bucket-fill (bf) ranging from 1 to bs-1, wherein bucket size (bs) refers to bs % of genome long, and each bucket must contain bf % of all hits.
It is understood that the above set of constraints is merely illustrative in nature, and other sets of constraints may be used in probe selection processes.
[0688] At step 204, a set of primers are identified using the set of constraints determined at step 202. In particular, for each primer design, any combination of the following parameters may be provided: the left primer sequences (e.g., as well as the number of their occurrences on the positive and negative strands of the genome), the right primer sequences (e.g., as well as the number of their occurrences on the positive and negative strands of the genome), the frequency of the pair (e.g., the left primer sequence and the right primer sequence paired together with the amplicon length limited by a constraint) including both unique and non-unique pairs, the frequency and percentage of the uniquely occurring amplicons, and the amplicon sequences from unique and non-unique pairs. In some embodiments, each primer pair may be able to amplify multiple regions on the genome (e.g., more than hundreds, more than thousands, more than tens of thousands, more than hundreds of thousands, or more than millions).
[0689] In some embodiments, the predicted primer pairs are converted to target bisulfite converted genome. The generated primer pairs may identify or predict amplicon sites without allowing for any mismatches to occur in either the left primer sequence or in the right primer sequence (i.e., the left or right arms) on bisulfite converted genome. Alternatively, in order for additional amplicon sites to be identified or predicted, a small number of mismatches may be allowed, such as allowing for:
[0690] 1 mismatch in the left arm and 0 mismatches in the right arm
[0691] 0 mismatches in the left arm and 1 mismatch in the right arm
[0692] 1 mismatch in the left arm and 1 mismatch in the right arm
[0693] 2 mismatches in the left arm and 0 mismatches in the right arm, or
[0694] 0 mismatches in the left arm and 2 mismatch in the right arm.
[0695] In some embodiments, the amplicon prediction scheme described above provides the genomic coordinates of the predicted amplicons in the bisulfite converted genome. However, in some embodiments, it may be computationally intensive for the scheme that identifies the amplicon sites without allowing for any mismatches to occur to also provide the genomic coordinates of the predicted amplicons. In this case, the scheme may be divided into two parts. In a first part, the amplicon sites are identified without allowing for any mismatches to occur, and the genomic coordinates of the identified amplicon sites are not provided. In a second part, the amplicon sites that include a small number of mismatches (e.g., the set of mismatches enumerated above) are identified, and the genomic coordinates of these amplicon sites are provided, as well as the genomic coordinate of the no-mismatch amplicon sites. Splitting up the scheme into these two modular parts may save computational complexity. However, in general, it will be understood that the two parts may be combined to provide the set of no-mismatch amplicon sites, mismatch amplicon sites, and their genomic coordinates in a single function.
[0696] In some embodiments, one or more of the amplicon sites identified at step 204 may be removed (e.g., by a filtering operation). For example, in some embodiments, arm sequences containing CG dinucleotides are removed. The amplicon sites of those primers that passed the filtering operation (hereinafter referred to as “candidate primers”) should target multiple regions of the reference genome (e.g., typically 2500 or more). Additionally, in some embodiments, both the left and right arm sequences of the candidate primers have melting temperatures (T.sub.M) ranging from 40° C. to the high 60° s C. as computed by the nearest neighbor model of DNA binding stability, wherein empirical stability parameters are summed according to the nucleic acid sequence. See, e.g., Santa Lucia and Hicks 2004.
[0697] After the removal (or filtering) operation, the remaining amplicon sites will be further processed in order to generate a set of parameter values for each candidate primer. In some embodiments, the number of CpGs and the total number of amplicon sites that have passed the filtering operation will be calculated. For each candidate primer, the enrichment information (e.g., the calculated proportion), the associated amplicon sites information, and any other parameter values may be saved in a database, such as database 116.
[0698] At step 206, an optimization technique is performed to identify a primer with an optimal predicted performance. The optimization technique involves evaluating an objective function for each candidate primer. In particular, it may be desirable to use an objective function that minimizes a number of CpG sites on the extension and ligation arms of the MIP, maximizes a total number of captured CpG sites, maximizes a number of uniquely mappable sites, or any suitable combination thereof.
[0699] The objective function for each candidate MIP may, in some embodiments, be established based on the following matrices:
TABLE-US-00002 TABLE 1 Predicted CpG counts from predicted sites # CpG counts Unique Non-unique 0 mismatch A B 1 mismatch C D
TABLE-US-00003 TABLE 2 Predicted site count across the genome Site Counts Unique Non-unique 0 mismatch E F 1 mismatch G H
TABLE-US-00004 TABLE 3 Number of CpG counts on each arm # CpG counts Extension arm Ligation Arm # CpG counts I J
In the probe matrices above, rows labeled as “0 mismatch” indicates MIPs with perfect matches in both arms, and rows labeled as “1 mismatch” indicates primers that tolerates at most 1 mismatch in one of its arms in reference to bisulfite converted genome. Several intuitive objective functions can be readily deduced from these probe matrices. For example, an objective function that minimizes I+J (e.g., the sum of I and J is 0) would ensure that probe performance is not a function of an individual's methylation status (e.g., because there are CpG sites present in the arm sequence binding sites. In a second example, an objective function that maximizes (A+C)/(E+F+G+H) may produce reads that specifically target CpG sites. As a third example, an objective function that maximizes (E+G)/(E+F+G+H) selects primers that have significantly more unique capture sites than non-unique capture sites on bisulfite converted genome. To further illustrate this concept, three exemplary objective functions are explained in detail below.
A. Total Number of CpG Sites on the Extension and Ligation Arms (P1)
[0700] An exemplary objective function for each candidate primer or probe may be defined as the total number CpG sites on the extension arm and ligation arm of the probe:
P1=I+J (1)
B. Total Number of Useful CpG Sites (P2)
[0701] Another exemplary objective function for each candidate primer or probe may be defined as the total number of useful CpG sites that are captured:
P2=g(A,B,C . . . H;K.sub.0,K.sub.1) (2)
where K.sub.0 is the average capture coefficient of 0 mismatch sites and K.sub.1 is the average capture coefficient of 1 mismatch sites. More specifically:
P2=A+K.sub.eC (3)
where K.sub.e can be estimated from experimental data, and:
C. Total Number of Uniquely Mappable Reads (P3)
[0702] Another exemplary objective function for each candidate primer or probe may be defined as the total number of uniquely mappable reads across the bisulfite converted genome:
P3=g(A,B,C . . . H;K.sub.0,K.sub.1) (5)
where K.sub.0 and K.sub.1 are defined above. More specifically, P3 may be defined as:
P3=E+K.sub.eG (6)
where K.sub.e is defined in Equation (4).
D. Comprehensive Probe Performance Function
[0703] A comprehensive way to evaluate an objective function for each candidate primer or probe is to first remove any candidate primer or probe where P1 is not equal to zero. In other words, only candidate primers or probes where P1=0 may be considered, such that no CpG sites on the extension or ligation arms exist. In a second step, a performance function may correspond to:
P=P2×P3 (7)
[0704] Incorporating Equations (3) and (6), Equation (7) can be rewritten as:
P=((A+K.sub.eC)×(E+K.sub.eG))/((E+F)+K.sub.e(G+H)) (8)
Note that, as described above in relation to Equation (4), the value of K.sub.e can be estimated using experimental data. More particularly:
[0705] At step 208, a primer is selected from the set of candidate primers based on the optimization technique performed at step 206. For example, the selected primer may correspond to the primer with the optimal predicted performance, i.e., the primer that had P1=0 and that maximized the objective function as described in relation to step 206.
[0706] It is contemplated that the steps or descriptions of Process 200 may be used with any other embodiment of this disclosure. In addition, the steps and descriptions described in relation to
[0707]
[0708] The methylation score is calculated from the information contained in the sequencing reads encompassing CpG sites. Every time a CpG site is covered by a read, the information retrieved is considered as a count (methylated or unmethylated) in the formula below. A single read can generate multiple counts if it encompasses multiple CpG sites. Programs like the Bismark Methylation Extractor calculate methylation ratios as follows:
% methylation at CpG sites=100*[Methylated Cs at CpG/(Methylated Cs at CpG+Unmethylated Cs at CpG)] (11)
[0709] At step 302, sequencing data for a test subject is received. In particular, the test subject may have a disease state that is unknown, or a predisposition to a particular disease state. The received sequencing data is obtained by obtaining a nucleic acid sample from the test subject, treating the sample with bisulfite conversion, and using a population of primers, such as molecular inversion probes (MIPs), to capture a set of sites in the nucleic acid sample. As is described in detail in relation to
[0710] At step 304, a methylation ratio is computed for the test subject by evaluating a ratio between a number of methylated cytosine nucleotides within the target regions and a total number of known CpG sites. As is described in detail in relation to
[0711] At step 306, a set of methylation ratios for a set of reference subjects is received. In particular, the reference subjects may correspond to a group of people that exhibit a known disease state or a known predisposition to have a disease. The methylation ratios for the reference subjects are computed in the same manner as was described in relation to step 304, but for each reference subject.
[0712] At step 308, the methylation ratio for the test subject (computed at step 304) is compared to the methylation ratios for the reference subjects (obtained at step 306), and the disease state or predisposition for a particular disease of the test subject is predicted based on this comparison. In particular, a statistical test may be used to compare the test methylation ratio to the population of reference methylation ratios, and determine whether the test methylation ratio belongs in any cluster of reference methylation ratios associated with the same disease state or predisposition.
[0713]
[0714] The process 400 includes the steps of receiving sequencing data recorded from a sample that was treated with bisulfite-conversion (step 402), filtering the sequencing reads to remove known artifacts (step 406), aligning the reads to the bisulfite converted human genome (step 408), setting a CpG site iteration parameter k to 1 (step 412), and determining whether a cytosine nucleotide is present a the k-th CpG site (step 414). When all K CpG sites have been considered, the process 400 further includes the steps of computing a sum S of the numbers of cytosine nucleotides determined at step 414 (step 420), computing a methylation ratio S/K for the test sample (step 422, where K corresponds to a total number of CpG sites), and selecting a disease state for the test sample by comparing the methylation ratio for the test sample to a set of reference methylation ratios (step 424).
[0715] At step 402, data recorded from a test sample is received. The test subject has an unknown disease state. The sample may be a nucleic acid sample isolated from the test subject and treated with bisulfite-conversion. The data may include sequencing data obtained from the nucleic acid samples. In an example, the sequencing data is obtained by using a population of MIPs to amplify a set of sites in the nucleic acid sample to produce a set of MIPs amplicons. The MIPs amplicons may then be sequenced to obtain the sequencing data received at step 402.
[0716] At step 406, the sequencing reads for the test sample are filtered to remove known artifacts. In one example, the data received at step 402 may be processed to remove an effect of probe-to-probe interaction. In some embodiments, the ligation and extension targeting arms of all MIPs are matched to the paired-end sequence reads. Reads that failed to match both arms of the MIPs are determined to be invalid and discarded. In some implementations, at most one base pair mismatch in each arm is allowed, but any reads that have more mismatches may be discarded. The arm sequences for the remaining valid reads are removed, and the molecular tags from both ligation and extension ends may be also removed from the reads.
[0717] At step 408, the resulting trimmed reads are aligned to the human genome. In some embodiments, an alignment tool may be used to align the reads to a reference human genome. In particular, an alignment score may be assessed for representing how well does a specific read align to the reference. Reads with alignment scores above a threshold may be referred to herein as primary alignments, and are retained. In contrast, reads with alignment scores below the threshold may be referred to herein as secondary alignments, and are discarded. Any reads that aligned to multiple locations along the reference genome may be referred to herein as multi-alignments, and are discarded.
[0718] At step 412, a CpG site iteration parameter k is initialized to one. The numbers and positions of CpG sites are known.
[0719] At step 414, the k-th CpG site is examined to determine whether a cytosine nucleotide is present. As is described in detail in relation to
[0720] At step 422, a methylation ratio S/K is computed for the test sample. The methylation ratio corresponds to the total number of cytosine nucleotides present at the K CpG sites, normalized by K, and provides a proportional measure of the methylated cytosine nucleotides, compared to a total number of CpG sites.
[0721] At step 424, the methylation ratio for the test sample is then compared to a set of reference methylation ratios (that have been computed from reference subjects that have known disease states), and a statistical test is performed to select a predicted disease state for the test subject.
[0722] The order of the steps in
[0723] Since methylation changes are not randomly distributed among the genome, the methylation ratio can be calculated, in some embodiments, by filtering out or isolating targets close to key elements of the genome. For example, to increase the sensitivity of detection of hypomethylation in cancer samples, the targets in proximity to CpG islands can be filtered out since they tend to become hypermethylated. In a second instance, the methylation ratio may be calculated with targets contained in the intergenic regions since they are known to show higher levels of hypomethylation.
[0724] In some embodiments, the level of hypomethylation of a test sample can be determined by comparing its methylation density to a set of control samples (5, 10, 50, 100, 500, 1000, 10,000 or more control samples). The methylation density is defined as the average percentage of methylated C in a CpG context for a defined region or for a defined bin size (1,000, 10,000, 100,000, 1,000,000, 10,000,000 or more bases). For each bin, a Z-score is calculated as follow and the percentage of Z.sub.meth over a defined threshold is determined.
Z.sub.meth=MD.sub.test−MD.sub.controls
MD.sub.SD-controls (12)
where:
MD.sub.test is the methylation density for a defined bin for a test sample;
MD.sub.controls is the average of the methylation density for a defined bin for a set of control samples; and
MD.sub.SD-controls is the standard deviation of the methylation density for a set of control samples.
[0725] Also, CNVs, including CNAs, can be calculated the same way by replacing methylation density with read density.
[0726] A comparative analysis can also be performed to detect differential methylated CpG sites in a test sample group versus a control group. Methylkit is a R package for DNA methylation analysis (Altuna Akalin, Matthias Kormaksson, Sheng Li, Francine E. Garrett-Bakelman, Maria E. Figueroa, Ari Melnick, Christopher E. Mason. (2012). “methylKit: A comprehensive R package for the analysis of genome-wide DNA methylation profiles.” Genome Biology, 13:R87.) Methylkit can be used to perform sample correlation and clustering, as well as, differential methylation analysis. CpG sites with differential methylation between the test group and the control group can be identified. Some CpG sites may show differential methylation status only in a subset of the test samples. Therefore, identifying a combination of CpG sites with a defined “weight” may be more appropriate to generate an algorithm allowing to evaluate if an unknown samples belong to the tested groups.
[0727] It will be understood by one of ordinary skill in the art that the compositions and methods described herein may be adapted and modified as is appropriate for the application being addressed and that the compositions and methods described herein may be employed in other suitable applications, and that such other additions and modifications will not depart from the scope hereof.
[0728] The embodiments referred to above will be better understood from the Experimental Details which follow. However, one skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative them.
EXAMPLES
Example 1: MIP Design and Method for Capturing Target Sequences of Interest
[0729] Probe Design
[0730] A single targeted capture probe is created for a semi-redundant site in the genome pertaining to any repeat regions. Additional criteria are designed to target short (˜160 bp) circulating nucleic acids and have the number of said repeat sites per bisulfite converted human genome of >150,000 sites with either exact primer match or 1 mismatch. The probe arm melting temperature is between 42° C. and 50° C.
Probe Construction
[0731] A single oligonucleotide ranging in size between 80-105 bp (depending on the length of the repeat-targeting sequences) is synthesized such as that seen in
DNA Preparation
[0732] DNA can be extracted from a variety of sources depending on the downstream use, including genomic DNA from whole blood, fragmented plasma DNA or DNA extracted from formalin-fixed paraffin embedded (FFPE) tissues.
[0733] After extraction, the DNA is bisulfite converted via a standard workflow such as: Input DNA.fwdarw.Denature DNA.fwdarw.Incubate.fwdarw.Bisulfite Conversion.fwdarw.Incubate.fwdarw.Column-based sulphonation-hydrolytic deamination-desulphonatin.fwdarw.Elute to desired concentrations. Because the probe may be designed such that it is only amplifiable to the bisulfite converted genome, it allows for the capture of representative sites across the genome that have been bisulfite converted.
Site Capture Reaction
[0734] The capture probe (at an empirically determined concentration) is mixed with 10-20 ng bisulfite treated DNA extracted from a variety of sources. The mixture is incubated in a thermocycler at temperatures that have been optimized for annealing of probes to the template (98° C. for 5 min.fwdarw.touchdown from 98° C. to 50° C. for 24 min.fwdarw.50° C. for 120 min). During this incubation, the probe molecules anneal to the DNA template at specific chromosomal locations that are complementary to the probe sequence. The most easily predicted sites are those with sequences that are exactly complementary to the probe arms (invariant sites), but sites that have one or more variants in either arm are also targeted at somewhat lower efficiency. The optimal amount of probe for each reaction is dependent on four main considerations: 1) the number of genomes used as template, which can vary between samples, 2) the overall number of sites targeted by the specific probe, 3) the ratio of invariant sites to variant sites, and 4) the diversity of genomic CpG sites desired.
[0735] After the hybridization program is complete, a 5 μL mixture of enzymes and reagents is added and the mixture is incubated at 50° C. for 1 hr, then 72° C. for 20 min, then held at 4° C. During this step, DNA polymerase (preferably a polymerase with no strand displacement properties) fills in the gap and the probe is covalently circularized by a DNA ligase using the phosphate at the 5′ of the ligation arm (
Exonuclease Digestion
[0736] A cocktail of exonucleases is added. This removes remaining probes and genomic DNA by means of the exonuclease digestion. The exonucleases are then heat inactivated.
Captured Site Indexing and Amplification
[0737] 10 μL of the cleaned and captured probe mixture (i.e., replicons) is added to a 50 μL reaction mixture containing thermostable polymerase, dNTPS, PCR buffer, and universal primers that are complementary to the probe backbone (
Sequencing the Captured Sites
[0738] Next, the purified PCR products are pooled into a library. The library is sequenced using either single-end or paired-end sequencing, using 75-100 cycles in order to determine the full sequence of the site-specific gap. If single-end sequencing is used, the read will consist of the ligation arm followed by the molecular tag and the unique gap sequence that was filled in during the extension/ligation step. Sequencing into the extension arm is unnecessary because the sequence is known from the probe. For example, massively parallel sequencing is used to identify both the methylated pattern in this area (hypo or hyper), the type and amount of DNA damage (e.g., mutational landscape) incurred, and the count of the sites to assay for large chromosomal abnormalities or genomic instability. Reads from the sequencer are aligned to an in silico-converted genome to determine positions where C nucleotides are observed instead of the expected T (the bisulfite-conversion produces a U nucleotide, which is read out as a T nucleotide by the sequencing methods). The methylation ratio is calculated as the number of C's observed in CpG sites, divided by the total number CpG dinucleotides in the target sequences of interest. This identifies the ratio of unconverted (i.e., methylated) cytosine nucleotides in the target region. The average methylation ratio of the sample is then reported.
Removing PCR Duplicates
[0739] Described below is an example of the importance of identifying and removing PCR duplicate previous to site specific methylation analysis. The use of unique molecular identifiers allows for each capture event to be characterized. More specifically, these identifiers are used to bin reads resulting from the same capture event, remove duplicates and report a single consensus read.
[0740] A mixture of human genomic DNA (gDNA) extracted from the blood of twelve individuals was obtained from Promega (cat #G3041). One, five, ten or twenty nano grams of blood gDNA and two hundred nano grams of salmon sperm DNA carrier were bisulfite converted using the EZ-96 DNA Methylation-Gold following the vendor's manual. The MIP capture was performed as described herein. The subsequent PCR was also performed as described in the present Example with the exception that 40 ul of the exonuclease reaction was added instead of 10 ul, and the PCR was assembled in a final volume of 100 ul instead of 50 ul. The libraries were pooled and sequenced on a HiSEQ 2500 using paired-end reagent V2 chemistry. The sequencing data was processed according to the pipeline described in
[0741] To determine the robustness of the assay at low input gDNA, the differences in the methylation at CpG sites from the different input gDNA libraries were determined by comparing them to the 20 ng library control. First, the CpG sites with under 20× coverage were filtered out and the number of sites covered over 20× were determined (see Tables 4 and 5 below).
TABLE-US-00005 TABLE 4 Differential methylation observed between samples without PCR duplicate removal #CpG shared # CpG at >20x reads Input covered >20x with the 20 ng gDNA reads control Δ100% Δ80% Δ60% Δ50% Δ40% Δ30% 1 ng 119,691 118,496 0 1 16 90 437 2062 5 ng 251,595 243,108 0 0 1 10 109 766 10 ng 289,955 271,608 0 0 0 3 66 438 20 ng 243,189 243,189 0 0 0 3 37 398 20 ng 295,235 control
TABLE-US-00006 TABLE 5 Differential methylation observed between samples without PCR duplicate removal #CpG shared # CpG at >20x reads Input covered >20x with the 20 ng gDNA reads control Δ100% Δ80% Δ60% Δ50% Δ40% Δ30% 1 ng 14,865 14,863 0 0 0 4 13 85 5 ng 193,526 191,513 0 0 0 0 18 230 10 ng 261,554 249,496 0 0 0 1 33 216 20 ng 243,078 235,473 0 0 0 2 24 284 20 ng 282,059 control
[0742] Table 4 shows the data without PCR duplicate removal and Table 5 shows the data after duplicate removal. When only 4.5% of the CpG sites were lost by eliminating PCR duplicates for the 20 ng input samples (295,235 sites top table.fwdarw.282,059 sites bottom table), 87.5% of the sites were filtered out in the 1 ng samples (119,691 sites.fwdarw.14,865 sites) showing the increase of PCR duplicates at low input.
[0743] Next, the CpG sites with over 20× coverage were identified in both the 20 ng control samples and each corresponding input library. The number of sites shared are reported in column 3 of Tables 4 and 5. The CpG sites which lacked at least at 20× coverage in both the 20 ng library control and the corresponding libraries (20, 10, 5 or 1 ng) were filtered out. Finally, the number of CpG sites showing a differential in methylation over 100%, 80%, 60%, 50%, 40%, 30% between the control 20 ng library and the 20, 10, 5 or 1 ng were reported in columns 4-9. At 20 ng input, few sites show differential methylation over a differential of 30% when compared to 20 ng library control in both data sets with or without removing PCR duplicates. At 10 ng, the PCR duplicate removal slightly improved the reproducibility of the assay by about 2 times. At 5 ng and 1 ng inputs, removing PCR duplicates becomes a key element of the analysis. The number of CpG sites with discordant methylation status with the 20 ng control library was brought down by removing duplicates (top vs bottom table). However, eliminating PCR duplicates also greatly reduced the number of CpG sites with over 20× coverage in the low input DNA libraries.
[0744] In conclusion, detecting differential methylation in low input DNA can be improved by removing PCR duplicates prior to analysis, which can reduce the number of false positives.
Mutational Landscape
[0745] As described above, the PCR products generated using the compositions and methods described herein can be sequenced, and the sequence information can be informative of methylation status, CNV status and also provide a mutational landscape of the genome. All three of these measures can be hallmarks of different diseases and conditions, including cancer.
[0746] Cancer is a disease of deregulated cell growth caused by damage or alteration to a cell's DNA. As a cell evolves away from a state of regulated homeostasis, it acquires DNA alterations that disrupt key control pathways such as cell cycle regulation, cell death, and energy metabolism.
[0747] A more recently appreciated hallmark of cancer is the deregulation of genome stability and DNA repair processes. Deregulation of genome stability can occur via multiple pathways with different cancers having distinctive patterns of instability termed “mutational landscape”. For example, a colorectal tumor in one individual may have a different mutational landscape than a colorectal tumor from someone else. This landscape includes the summation of all single nucleotide substitutions or variations, small insertions and deletions and larger aneuploidies and chromosomal rearrangements. This pattern of mutational landscape has been proposed to differentiate treatment effectiveness in response to immunotherapies. See Rizvi et al. “Mutational landscape determines sensitivity to PD-1 blockade in non-small cell lung cancer” Science; 3 Apr. 2015: Vol. 348, Issue 6230, pp. 124-128.
[0748] The ability to detect and categorize the mutational landscape of tumors has clinical value, especially for improved prognosis. The compositions and methods described herein are particularly useful for determining mutational landscape. For example, after capturing and sequencing the DNA of interest, one can align the DNA to the genome using standard or custom methods, and proceed to apply a general variant caller. After application of the variant caller and additional methods to filter variants, the number of transitions, transversions, deletions and insertions can be binned into respective categories and enumerated per megabase of DNA analyzed. Since the location of DNA damage is spread across the genome, one does not need to focus on predetermined, targeted locations. Instead, a technology like that described herein that assays many repeat regions across the genome allows one to elucidate the mutational landscape in a single assay.
Example 2: Bioinformatics Workflow
[0749] Raw sequencing data must be processed in order for it to be useful in detecting methylation status. To start, sequencing reads are filtered to remove known artifacts such as probe-to-probe interaction, backbone sequences or adapter sequences. The ligation and extension arms of the MIP (i.e., the first and second targeting polynucleotide arms) are then matched to the sequence reads, allowing a maximum of one base pair mismatch in each arm. Reads that fail to meet this criterion are treated as invalid and discarded. At the same time, the molecular tags from both the ligation and the extension ends are kept separately for counting of the capture events in a later step—although in some embodiments the tags are kept together. The trimmed reads are aligned to the bisulfite-converted human genome (hg19) with the Bismark Bisulfite Mapper by Babraham Bioinformatics. The uniquely aligned reads (in sam/bam format files) are examined to count the unique molecular tags for each targeted site with a unique probe gap sequence. These counts are the initial number of probe-to-target hybridization events that are sequenced in the Next Generation Sequencing (NGS) platform (e.g., an Illumina HiSeq 2500 flowcell). Alternatively or additionally, massively parallel sequencing or sequencing by synthesis may be used. The uniquely aligned reads (in bam format files) are finally run through the Bismark's Methylation Extractor to determine the methylation status of the sample. For this step, only the gap sequence is used (i.e., the ligation and extension arm sequences are not included in the calculation). The repeat methylation ratio (or score) is reported as the ratio of methylated C's in CpG context throughout the sample. For example, the number of methylated C's in CpG can be divided by the sum of the methylated C's in CpG plus unmethylated C's in CpG.
[0750] Targets or regions that display an aberrantly high level of either technical variation or population baseline variation are screened depending on the disease or condition to give a lower coefficient of variation than could be obtained by other random methods of capture and sequencing.
Example 3: Determination of Methylation Status in Cancer Cell Lines
[0751] Using the methods described above, a total of 12 samples (the LNCaP and PC3 cancer cell lines, 5 healthy control female samples, and 5 healthy male samples) were processed. The methylation ratios were averaged into 1 Mb bins for visualization to yield methylation densities. The methylation densities of the 5 female samples were averaged for each bin. Similarly, the 5 male samples' methylation densities were averaged for each bin.
[0752] By then looking at the methylation index of the sample, differences were detected between the samples, as shown in the top plot of
[0753] Based on these data, one can use a MIP to detect from a blood draw the presence of, for example, colorectal cancer. Small fragmented DNA from tumors exists in the plasma component of blood, and this DNA can be isolated. After isolation of this DNA from the blood, the DNA can be interrogated by the methods described herein. A population-derived baseline can be calculated using information obtained after interrogating a variety of non-cancerous individuals.
[0754] By further sequencing a variety of individuals with, for example, colorectal cancer, a second disease state score can be established. Upon subsequent sequencing, one will be able to determine the best fit of the individual sample to either the disease state or the non-diseased state. These methods are ideal for this purpose for cancer (e.g., colorectal cancer) as the score can be derived and simultaneously calculated for multiple phenomena in the cancer. In particular, methylation status is given as a repeat methylation score, which corresponds to the methylation ratio. In general, a chromosomal aneuploidy score or another score may be used. The hallmarks of cancer include genomic instability (e.g., copy number variation) and global hypomethylation, especially in repeat regions as opposed to non-repeat regions that may contain context-specific hyper methylation. Using the methods described herein is advantageous because they reduce the noise of targeting the whole genome, resulting in a lower sample-to-sample variation within the specific repeat targeted by the MIP while simultaneously using less reads and lowering costs.
Example 4: Genomic Instability Analysis in Colorectal Samples
[0755] This example describes the use of compositions and methods of the invention to measure the methylation status of adenoma and adenocarcinoma isolated from the colon or the rectum. The same compositions and methods were also used to identify common CpG sites hypomethylated in the cancer samples. Finally, copy number alteration was detected from the same data set.
Materials
[0756] The following MIP capture probe and PCR primers were used:
TABLE-US-00007 Capture Probe: (SEQ ID NO: 16) :/5Phos/TTCTCCTACCTCAACCTCNNNNNNCTTCAGCTTCCCGATTAC GGGCACGATCCGACGGTAGTGTNNNNNNCCAAACTAAAATACAATA (Integrated DNA technologies (IDT), 4 nmole Ultramer ™ DNA oligo, standard desalting) 5′ Phosphorylation (IDT) PCR_Forward_Primer: (SEQ ID NO: 19) AATGATACGGCGACCACCGAGATCTACACATACGAGATCCGTAATC GGGAAGCTGAAG (IDT, 250 nmoles, Standard desalting) PCR_Reverse_Indexing_Primer: (SEQ ID NO: 20) CAAGCAGAAGACGGCATACGAGATNNNNNNNNACACGCACGATCC GACGGTAGTGT where N can be A, T, C, or G, which is different combinations for each index. (IDT, 100 nmoles, Standard desalting)
Methods
[0757] Human genomic DNA (hgDNA) was extracted from fresh frozen tissues from fourteen adenomas, and four adenocarcinomas as well as their corresponding normal adjacent tissues. Allprep DNA/RNA/Protein Mini Kit from Qiagen was used to extract hgDNA following the vendor's manual. The extracted hgDNA was quantified using a NanoDrop™ spectrophotometer and 10 ng of the samples and 200 ng of salmon sperm carrier were used for bisulfite conversion using the EZ-96 DNA Methylation-Gold following the vendor's manual.
[0758] The bisulfite converted DNA was added to the first target capture reaction (described in
[0759] Immediately after the capture, the annealed probe was extended at its 3′ end by a high fidelity DNA polymerase (see
[0760] Immediately after the extension/ligation step, the unligated probes and the gDNA were digested by exonucleases enzymes. This step is performed to avoid the formation of potential undesired products in the subsequent PCR amplification reaction. The exonuclease reaction was assembled in a final volume of 50 ul comprising 40 ul of the extension ligation reaction and final concentrations of 1× NEBuffer1 as well as 40 units of exonuclease I and 200 units of exonuclease III. This reaction was incubated at 37° C. for 55 minutes. Exonuclease enzyme were then inactivated at 90° C. for 40 minutes and held at 4° C. or −20° C. until processing to the PCR reaction.
[0761] The PCR reaction was assembled in a final volume of 50 ul using 10 ul of the exonuclease reaction and a final concentration of 1× Phusion® High-Fidelity buffer, 200 nM dNTP, 2 units of Phusion® Hot start flex DNA polymerase, 500 nM of PCR_Forward_Primer and 500 nM of a unique PCR_Reverse_Indexing_Primer. The PCR was conducted as follow: 1 cycle of 95° C. for 2 minutes follow by 21 cycles of 98° C. 15 seconds, 65° C. 15 seconds, 72° C. 15 seconds and 1 cycle of 72° C. 5 minutes and hold at 4° C. The PCR product was cleaned-up using AMPure XP beads at a ratio of 1.2× following the vendor's recommendations. The amplified libraries were quantified using Qubit® dsDNA HS Assay Kit. The libraries were pooled at an equimolar ratio at a final concentration of 4 nM.
[0762] The libraries were sequenced on a HiSeq2500 using fast run mode and custom primers for read 1 and 2, as well as for indexing read at a final concentration of 570 nM. A paired-end reads of 106 cycles were performed for read 1 and read 2 as well as an indexing read of 8 cycles. (See
[0763] The following steps were used for analysis as outlined in
[0764] Bismark Methylation Extractor was used with the following options: -p, --no_overlap, --ignore 18, --ignore_r2 18, --comprehensive, -bedGraph, --cytosine_report, where -p: paired-end analysis, --no_overlap: cytosine covered by read 1 and 2 are only reported once even if sequenced twice, --ignore 18: the sequence from the MIP in read 1 is excluded from the analysis, --ignore_r2 18: the sequence from the MIP in read 2 is excluded from the analysis, --comprehensive: display methylation status at CpG, CHG and CHH contexts merging all four possible strand-specific methylation info. Finally, the -bedGraph and --cytosine_report options were also used to generate coverage files (cov). The coverage output had the following features: <chromosome><start position><end position><methylation percentage> <count methylated><count unmethylated> and use a 1-based chromosome coordinates and report CpG context only. The BAM and the cov files were imported into Seqmonk (Simon Andrews, Babraham institute) for visualization of the methylation status and for further statistical analysis.
Results
[0765] The percentage methylation at CpG context was calculated and reported by Bismark Methylation Extractor as follows: % methylation at CpG=100*methylated Cs at CpG/(methylated Cs at CpG+unmethylated Cs at CpG). Table 1 shows the % methylation at CpG for the tumor and corresponding normal adjacent samples.
TABLE-US-00008 TABLE 6 Percent Methylated C in CpG context Normal ID Tissue type Location Age adjacent Tumor 815 Adenocarcinoma Cecum 74 85% 73% 861 Adenocarcinoma Ascending 76 83% 81% G1-21 Adenocarcinoma Ascending 57 86% 82% 781 Adenocarcinoma Descending 52 84% 81% 227 Adenoma Cecum 50 86% 79% 469 Adenoma Cecum 86 84% 82% 726 Adenoma Ascending 51 86% 86% 282 Adenoma Ascending 66 84% 79% 735 Adenoma Ascending 72 86% 80% 575 Adenoma Ascending 73 85% 74% 300 Adenoma Transverse 59 87% 82% 548 Adenoma Descending 54 87% 85% 772 Adenoma Rectum 79 86% 82% 236 FAP Ascending 26 85% 85% 664 FAP Cecum 52 86% 82% 610 Lynch Ascending 59 85% 82% 245 SSA Ascending 54 85% 84% 708 SSA Cecum 76 85% 84%
[0766] The level of hypomethylation of the tumor samples was determined by comparing the methylation density of tumor samples and normal samples. The methylation density is defined as the average percentage of methylated C in a CpG context for a defined one megabase bin. To perform this analysis, the coverage files obtained from the Bismark Methylation Extractor were imported into SeqMonk. The methylation density was determined by averaging the methylation status at every megabase bins with a minimum of 25 different counts. Every time a CpG site was covered by a read, the information retrieved was considered as a count. A single read can generate multiple counts if it encompasses multiple CpG. On average, 2 CpG sites were covered per read. The bins on the Y chromosome were filtered out and a total of 2852 bins were analyzed. For each bin, Zmeth was calculated as follows: [0767] Where ZDtumor is the methylation density in a bin of one megabase for a tumor sample; [0768] MDnormal is the average of the methylation density from a bin of one megabase for all the normal samples (n=18); and [0769] MDSD=the standard deviation of the methylation density from all the normal samples (n=18).
[0770] The Z.sub.meth was calculated for the valid 2852 bins. A bin was considered hypomethylated if the corresponding Zmeth was below −5. Table 2 depicts the percentage of the bins with significant hypomethylation.
TABLE-US-00009 TABLE 7 Percentage of bins with significant ID Tissue type Location Age hypomethylation 815 Adenocarcinoma Cecum 74 60.8% 861 Adenocarcinoma Ascending 76 12.9% G1-21 Adenocarcinoma Ascending 57 8.0% 781 Adenocarcinoma Descending 52 14.0% 227 Adenoma Cecum 50 36.1% 469 Adenoma Cecum 86 8.7% 726 Adenoma Ascending 51 0.6% 282 Adenoma Ascending 66 35.9% 735 Adenoma Ascending 72 23.7% 575 Adenoma Ascending 73 62.1% 300 Adenoma Transverse 59 5.4% 548 Adenoma Descending 54 0.5% 772 Adenoma Rectum 79 10.3% 236 FAP Ascending 26 0.4% 664 FAP Cecum 52 9.7% 610 Lynch Ascending 59 11.5% 245 SSA Ascending 54 0.9% 708 SSA Cecum 76 0.8%
[0771] Circos plots can also be used to visualized the hypomethylated state of a sample. In
TABLE-US-00010 TABLE 8 Common hypomethylated sites in thirteen samples with significant global hypomethylation % C methylated at % C methylated chr8: 116,160,339 chr8: 116,369,046 ID Tissue type Location Age Normal Tumor Normal Tumor 815 Adenocarcinoma Cecum 74 83 17 78 28 861 Adenocarcinoma Ascending 76 74 44 90 47 G1-21 Adenocarcinoma Ascending 57 89 59 91 56 781 Adenocarcinoma Descending 52 74 47 88 41 227 Adenoma Cecum 50 84 43 92 59 469 Adenoma Cecum 86 82 39 78 29 282 Adenoma Ascending 66 75 33 88 51 735 Adenoma Ascending 72 88 34 94 62 575 Adenoma Ascending 73 87 26 95 27 300 Adenoma Transverse 59 89 54 100 52 772 Adenoma Rectum 79 83 40 80 42 664 FAP Cecum 52 87 48 92 53 610 Lynch Ascending 59 88 17 91 42 726 Adenoma Ascending 51 82 79 77 86 548 Adenoma Descending 54 77 76 79 82 236 FAP Ascending 26 80 91 90 91 245 SSA Ascending 54 81 74 73 59 708 SSA Cecum 76 89 65 92 82
[0772] Copy number alterations present in the adenoma and the adenocarcinoma samples were determined by comparing the read density (RD) from tumor and normal samples. The read density is defined here as the total number of reads found in bins of one megabase. First, the reads were normalized for total number of reads to the samples with the highest total number of reads. A total of 3114 bins were created from the human genome hg19 (3,137,161,264 bases). The bins with less than 50 reads were removed from the analysis. A total of 2874 bins were preserved. The bins removed were mostly corresponding to the unknown bases in the hg19 assembly marked by ‘N’ (7.6%) (UCSC). Note that the proportion of bins removed from the analysis (2874/3114*100=7.7%) matched the unknown bases of the hg19 genome, suggesting that the assay target sites are well distributed throughout the usable hg19 genome. The bins on chromosome Y were also filtered out since some of the samples were females and had no reads mapping to chromosome Y. A total of 2867 bins were used to calculate and plot the log 2 ratio of the reads at every defined bin between the tumor and the normal adjacent samples (
[0773] Alternatively, specialized software like Nexus 8.0 from BioDiscovery can be used to calculate the copy number variations based on read depth.
TABLE-US-00011 TABLE 9 Detailed description of CNAs events and associated cancer related genes Chr Event Length Cytoband # Probes CancerGeneCensus-Sanger chr3 CN Gain 41,921,869 q25.2 - q29.sup. 235 GMPS, MLF1, EVI1, PIK3CA, SOX2, ETV5, EIF4A2, BCL6, LPP, TFRC chr5 CN Loss 48,154,516 q14.3 - q31.1 188 APC chr10 High Copy 8,353,661 p15.3 - p14.sup. 49 GATA3 Gain chr13 CN Gain 96,145,424 q11 - q34 435 CDX2, FLT3, BRCA2, LHFP, LCP1, RB1, ERCC5 chr17 CN Loss 5,493,187 p13.3 - p13.2 84 YWHAE, USP6 chr17 CN Loss 1,616,776 p13.1 24 TP53, PER1 chr18 CN Loss 47,300,916 q11.2 - q22.2 202 ZNF521, SS18, MALT1, BCL2 chr20 CN Gain 35,525,521 q11.1 - q13.33 294 ASXL1, MAFB, TOP1, SDC4, GNAS, SS18L1
[0774] The genome instability can be reported as the percentage of bins with significant CNAs (gains or losses). This genome instability index is calculated by first determining the reads density at every megabase bin for the tumor and the normal samples as described above. For each bin, ZCNA is calculated as follow: [0775] Where RDtumor is the read density in a bin of one megabase for a define tumor samples. [0776] RDnormal is the average of the read density in a bin of one megabase for all the normal samples (n=18)
RDSD=the standard deviation of the read density from all the normal samples (n=18)
[0777] A total of 2867 different Z.sub.CNA were calculated. The Z.sub.CNA less than −3 and greater than 3 were judged significantly different than the normal samples. The percentage of bins with significant CNAs was reported in Table 5.
TABLE-US-00012 TABLE 10 Percentage of bins with significant CNAs Percentage of bins with ID Tissue type Location Age significant CNAs 815 Adenocarcinoma Cecum 74 14.4% 861 Adenocarcinoma Ascending 76 6.4% G1-21 Adenocarcinoma Ascending 57 6.5% 781 Adenocarcinoma Descending 52 12.9% 227 Adenoma Cecum 50 6.9% 469 Adenoma Cecum 86 14.7% 726 Adenoma Ascending 51 0.9% 282 Adenoma Ascending 66 0.4% 735 Adenoma Ascending 72 2.8% 575 Adenoma Ascending 73 1.9% 300 Adenoma Transverse 59 0.3% 548 Adenoma Descending 54 0.4% 772 Adenoma Rectum 79 9.6% 236 FAP Ascending 26 0.1% 664 FAP Cecum 52 1.1% 610 Lynch Ascending 59 4.8% 245 SSA Ascending 54 0.4% 708 SSA Cecum 76 0.6%
[0778] Different methylation status at specific bases can also be assessed between the tumor and the normal samples. For example, coverage files were imported into Seqmonk and the methylation status were analyzed for CpG sites with a coverage of at least 30× for the normal and the tumor samples. A total of 191,490 CpG sites met that criteria for sample 781. A total of 811 CpG sites exhibited significant difference of at least 45% between the normal and the tumor sample. Also the 811 sites were less methylated in the tumor sample than the normal sample. No site was more methylated in the tumor sample than the normal sample for a 445%. Interestingly, most of the sites exhibiting hypomethylation in the tumor sample co-localized with the sites with a gain in copy number. The percentage of CpG sites with a 445% between the normal and the tumor were plotted for every chromosome arms with at least one hundred CpG sites analyzed. See
Example 5: Determining Tissue-of-Origin
[0779] The analysis of cell-free DNA (cfDNA) in plasma has been shown to be useful for different diagnostic purposes including, but not limited to, noninvasive prenatal testing and cancer detection; however, it has thus far proven difficult to determine the origin or location of different species of cfDNA in a mixture (e.g., to differentiate plasma cfDNA from hematopoietic cells vs. plasma cfDNA from liver cells) making the clinical utility of cfDNA assays somewhat limited.
[0780] Existing methods for determining the tissue-of-origin for cfDNA include the use of tissue-specific RNA expression patterns or tissue-specific methylation patterns. For example, Winston Koh et al. showed the RNA expression patterns of cell-free RNA in plasma can be correlated to certain tissue types (see Koh, et al. PNAS 2014 111 (20) 7361-7366). However, RNA is notoriously unstable, so when measured by RNASeq or RT-qPCR, it has so far proved and non-reliable for clinical use. Using tissue-specific methylation patterns to determine tissue-of-origin has previously relied on whole genome bisulfite sequencing. (See Sun et al. PNAS 2015 112 (40). This has shown tissue-of-origin can be determined from the methylation patterns of the cfDNA at specific loci in the genome. However, in order to get the required signal from whole genome bisulfite sequencing, deep sequencing is required which is time-consuming and expensive.
Experiment and Results
[0781] Using the compositions and methods described herein, one can determine the contributions of different tissues to a biological sample that includes a mixture of cell-free DNA from different tissues types, whereby one can analyze the methylation patterns of the DNA mixture (e.g., methylation levels at repeat sites in the genome) and determine the fractional makeup of various tissue types to the DNA mixture. In some embodiments, the methylation patterns of the tissue types that potentially contribute to the DNA mixture (candidate tissues) can be determined. Then, the methylation pattern of the DNA mixture of interest is determined. For example, methylation levels can be computed at various sites. Since the DNA mixture is composed of the DNA from the candidate tissues, the composition of the DNA mixture can be determined by comparing the methylation patterns of the DNA mixture and the candidate tissue types.
[0782] In some embodiments, a separation value (e.g., a subtracted difference or a ratio) in a contribution percentage of a particular tissue type in the DNA relative to a reference value can indicate a disease state. The reference value may correspond to a contribution percentage determined in a healthy individual, and a separation value greater than a threshold can determine a disease state, as the diseased tissue releases more cell-free DNA molecules than healthy tissue.
[0783] In a proof-of-concept study, the inventors were able to distinguish between DNA from the liver and from whole blood. Four samples with three replicates each of whole blood derived DNA and four sample with three replicates each of liver derived DNA were extracted. The methylation status for each of the samples was determined using the compositions and methods described herein. Specifically, the following MIP was used:
TABLE-US-00013 (SEQ ID NO: 16) /5Phos/TTCTCCTACCTCAACCTCNNNNNNCTTCAGCTTCCCGATTACG GGCACGATCCGACGGTAGTGTNNNNNNCCAAACTAAAATACAATA
Analysis and Results
[0784] Generally speaking, the pathway of analysis to determine tissue-of-origin is similar independent of biology or measurement. See
[0785] For the proof-of-concept study described here, a clustering analysis or principal component analysis of all of the CpG sites measured by the assay showed a distinct pattern of methylation between the different DNA species. As shown in
[0786] To see if the compositions and methods described herein could differentiate additional tissue types, DNA from differing tissue sources was obtained from different individuals. See
TABLE-US-00014 (SEQ ID NO: 21) /5Phos/TTCTCCTACCTCAACCTCNNNNNNNNNNCTTCAGCTTCCCGAT TACGGGCACGATCCGACGGTAGTGTNNNNNNNNNNCCAAACTAAAATACA ATA.
Example 6: Determination of Methylation Age
[0787] Methylation status is known to change over time with particular tissues becoming hyper- or hypomethylated at different rates depending on a range of factors, including exposure to environmental factors or the presence of disease. Therefore, determining the methylation status as described herein can provide a measure of “bio age”, which may provide an early indication of the presence of age-related pathologies. For example, using the compositions and methods described herein with the tissue samples described in Example 4, it was shown that overall methylation decreases with age of the subject. See
Gestational Age as Predicted by Global Methylation Index (GMI)
[0788] Using the compositions and methods described herein, 14 women over five time points during pregnancy had blood extracted into a Streck® tube. DNA from plasma was purified. Using the following MIP: [0789] /5Phos/TTCTCCTACCTCAACCTC CTTCAGCTTCCCGATTAC GGGCACGATCCGACGGTAGTG CCAAACTAAAATACAATA (SEQ ID NO:16), and
the methods described herein, the global methylation index (GMI) was determined for each sample at each of the five gestational age (GA) time points. As shown in
Example 7: Detection of 5′hydroxymethylation
[0790] 5′hydroxymethylcytosine (5hmC) originates from the oxidation of 5′ methylcytosine (5mC). The conversion of 5mC to 5hmC is an intermediate step in the active demethylation process. In cells, this reaction is catalyzed by the ten-eleven translocation enzyme family (TET). 5′hydroxymethylcytosine level is often dysregulated in cancer and may contribute to tumor development and progression.
[0791] Bisulfite conversion does not distinguish between 5hmC and 5mC. Both modifications prevent the conversion of cytosines to uracils. To discriminate 5hmC from 5mC using the compositions and methods described herein, gDNA is extracted from a sample and divided into 2 reactions: 1) regular bisulfite conversion and 2) denaturation of gDNA follow by oxidation of 5hmC to 5-formylcytosine using potassium perruthenate, followed by conversion of 5-formylcytosine to uracil with bisulfite. After MIP capture and sequencing as described herein, the sites of 5hmC are detected by comparing the data from reactions 1 and 2: In reaction 1, both 5hmC and 5mC are found as cytosines, whereas unmethylated cytosines are found as thymines. In reaction 2, 5mC are found as cytosines but the 5hmC and unmethylated cytosines are found as thymines. The hydroxymethylation status, as well as the hydroxymethylation density can be calculated as described in Example 4.