DIFFERENTIAL KNOCKOUT OF AN ALLELE OF A HETEROZYGOUS RHODOPSIN GENE

20230173105 · 2023-06-08

Assignee

Inventors

Cpc classification

International classification

Abstract

RNA molecules comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and compositions, methods, and uses thereof

Claims

1-40. (canceled)

41. A method for inactivating a single mutant Rhodopsin (Rho) allele in a human cell, the method comprising delivering a composition comprising a) an RNA molecule comprising a guide sequence portion consisting of 17-24 nucleotides and targeting a sequence linked to SNP ID No. rs7984 based on the National Center for Biotechnology Information Database of Single Nucleotide Polymorphisms (dbSNP); and b) a CRISPR nuclease to a human cell that has a mutant Rho allele and a functional Rho allele, such that the mutant Rho allele is inactivated.

42. The method of claim 41, wherein the RNA molecule further comprises a portion having a sequence which binds to the CRISPR nuclease.

43. The method of claim 41, wherein the RNA molecule further comprises one or more linker portions.

44. The method of claim 41, wherein the RNA molecule is up to 300 nucleotides in length.

45. The method of claim 41, wherein the composition further comprises a second RNA molecule comprising a guide sequence portion that targets a SNP in an untranslated region (UTR) of the mutant Rho allele.

46. The method of claim 45, wherein the guide sequence portion of the second RNA molecule consists of 17-24 nucleotides and targets a sequence linked to SNP ID No. rs2855558 based on the National Center for Biotechnology Information Database of Single Nucleotide Polymorphisms (dbSNP).

47. The method of claim 45, wherein the 17-24 nucleotides of the guide sequence portion of the second RNA molecule are in a different sequence from the sequence of the guide sequence portion of the first RNA molecule.

48. The method of claim 45, wherein the second RNA molecule targets a sequence present in both a mutant Rho allele and a functional Rho allele.

49. The method of claim 45, wherein the second RNA molecule targets an exon of the mutant Rho allele.

50. The method of claim 45, wherein a region of the mutant Rho allele between the first and second RNA molecules is excised.

51. The method of claim 41, wherein the composition further comprises a tracrRNA molecule.

52. The method of claim 41, comprising subjecting the mutant allele to insertion or deletion by an error prone non-homologous end joining (NHEJ) mechanism, generating a frameshift in the mutant Rho allele sequence.

53. The method of claim 52, wherein the frameshift results in inactivation or knockout of the mutant Rho allele.

54. The method of claim 52, wherein, the frameshift creates an early stop codon in the mutant Rho allele.

55. The method of claim 41, wherein the frameshift results in nonsense-mediated mRNA decay of the transcript of the mutant Rho allele.

56. The method of claim 41, wherein the inactivating results in a truncated protein encoded by the mutant Rho allele and a functional protein encoded by the functional allele.

57. The method of claim 41, wherein the guide sequence portion of the RNA molecule comprises nucleotides in the sequence of 17-20 contiguous nucleotides set forth in SEQ ID NO: 219.

58. The method of claim 41, wherein the guide sequence portion of the RNA molecule comprises nucleotides in the sequence of 17-20 contiguous nucleotides set forth in SEQ ID NO: 220.

59-60. (canceled)

61. A method for editing a mutant Rhodopsin (Rho) allele in a human cell, the method comprising delivering a composition comprising a) an RNA molecule comprising a guide sequence portion consisting of 17-24 nucleotides and targeting a sequence in the mutant Rho allele linked to SNP ID No. rs7984 based on the National Center for Biotechnology Information Database of Single Nucleotide Polymorphisms (dbSNP); and b) a CRISPR nuclease, to a human cell that has a mutant Rho allele and a functional Rho allele, such that the mutant Rho allele is edited.

Description

DETAILED DESCRIPTION

Definitions

[0020] Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

[0021] It should be understood that the terms “a” and “an” as used above and elsewhere herein refer to “one or more” of the enumerated components. It will be clear to one of ordinary skill in the art that the use of the singular includes the plural unless specifically stated otherwise. Therefore, the terms “a,” “an” and “at least one” are used interchangeably in this application.

[0022] For purposes of better understanding the present teachings and in no way limiting the scope of the teachings, unless otherwise indicated, all numbers expressing quantities, percentages or proportions, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term “about.” Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0023] Unless otherwise stated, adjectives such as “substantially” and “about” modifying a condition or relationship characteristic of a feature or features of an embodiment of the invention, are understood to mean that the condition or characteristic is defined to within tolerances that are acceptable for operation of the embodiment for an application for which it is intended. Unless otherwise indicated, the word “or” in the specification and claims is considered to be the inclusive “or” rather than the exclusive or, and indicates at least one of, or any combination of items it conjoins.

[0024] In the description and claims of the present application, each of the verbs, “comprise,” “include” and “have” and conjugates thereof, are used to indicate that the object or objects of the verb are not necessarily a complete listing of components, elements or parts of the subject or subjects of the verb. Other terms as used herein are meant to be defined by their well-known meanings in the art.

[0025] The “guide sequence portion” of an RNA molecule refers to a nucleotide sequence that is capable of hybridizing to a specific target DNA sequence, e.g., the guide sequence portion has a nucleotide sequence which is fully complementary to said target DNA sequence. In some embodiments, the guide sequence portion is 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length, or approximately 17-24, 18-22, 19-22, 18-20, or 17-20 nucleotides in length. The guide sequence portion may be part of an RNA molecule that can form a complex with a CRISPR nuclease with the guide sequence portion serving as the DNA targeting portion of the CRISPR complex. When the DNA molecule having the guide sequence portion is present contemporaneously with the CRISPR molecule the RNA molecule is capable of targeting the CRISPR nuclease to the specific target DNA sequence. Each possibility represents a separate embodiment. An RNA molecule can be custom designed to target any desired sequence.

[0026] In embodiments of the present invention, an RNA molecule comprises a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010, 1-838, or 839-3010.

[0027] As used herein, “contiguous nucleotides” set forth in a SEQ ID NO refers to nucleotides in a sequence of nucleotides in the order set forth in the SEQ ID NO without any intervening nucleotides.

[0028] In embodiments of the present invention, the guide sequence portion may be 20 nucleotides in length and consists of 20 nucleotides in the sequence of 20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010. In embodiments of the present invention, the guide sequence portion may be less than 20 nucleotides in length. For example, in embodiments of the present invention the guide sequence portion may be 17, 18, or 19 nucleotides in length. In such embodiments the guide sequence portion may consist of 17, 18, or 19 nucleotides, respectively, in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010. For example, a guide sequence portion having 17 nucleotides in the sequence of 17 contiguous nucleotides set forth in SEQ ID NO: 1 may consist of any one of the following nucleotide sequences (nucleotides excluded from the contiguous sequence are marked in strike-through):

TABLE-US-00001 SEQ ID NO: 1 UGGGGUUUUUCCCAUUCCCA 17 nucleotide guide sequence 1: custom-character GGUUUUUCCCAUUCCCA 17 nucleotide guide sequence 2: custom-character GGGUUUUUCCCAUUCCCcustom-character 17 nucleotide guide sequence 3: custom-character GGGGUUUUUCCCAUUCCcustom-character 17 nucleotide guide sequence 4: UGGGGUUUUUCCCAUUCcustom-character

[0029] In embodiments of the present invention, the guide sequence portion may be greater than 20 nucleotides in length. For example, in embodiments of the present invention the guide sequence portion may be 21, 22, 23, or 24 nucleotides in length. In such embodiments the guide sequence portion comprises 20 nucleotides in the sequence of 20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and additional nucleotides fully complimentary to a nucleotide or sequence of nucleotides adjacent to the 3′ end of the target sequence, 5′ end of the target sequence, or both.

[0030] In embodiments of the present invention a CRISPR nuclease and an RNA molecule comprising a guide sequence portion form a CRISPR complex that binds to a target DNA sequence to effect cleavage of the target DNA sequence. CRISPR nucleases, e.g. Cpf1, may form a CRISPR complex comprising a CRISPR nuclease and RNA molecule without a further tracrRNA molecule. Alternatively, CRISPR nucleases, e.g. Cas9, may form a CRISPR complex between the CRISPR nuclease, an RNA molecule, and a tracrRNA molecule.

[0031] In embodiments of the present invention, the RNA molecule may further comprise the sequence of a tracrRNA molecule. Such embodiments may be designed as a synthetic fusion of the guide portion of the RNA molecule and the trans-activating crRNA (tracrRNA). (See Jinek (2012) Science). Embodiments of the present invention may also form CRISPR complexes utilizing a separate tracrRNA molecule and a separate RNA molecule comprising a guide sequence portion. In such embodiments the tracrRNA molecule may hybridize with the RNA molecule via basepairing and may be advantageous in certain applications of the invention described herein.

[0032] The term “tracr mate sequence” refers to a sequence sufficiently complementary to a tracrRNA molecule so as to hybridize to the tracrRNA via basepairing and promote the formation of a CRISPR complex. (See e.g., U.S. Pat. No. 8,906,616). In embodiments of the present invention, the RNA molecule may further comprise a portion having a tracr mate sequence.

[0033] A “gene,” for the purposes of the present disclosure, includes a DNA region encoding a gene product, as well as all DNA regions which regulate the production of the gene product, whether or not such regulatory sequences are adjacent to coding and/or transcribed sequences. Accordingly, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions.

[0034] “Eukaryotic” cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells and human cells.

[0035] The term “nuclease” as used herein refers to an enzyme capable of cleaving the phosphodiester bonds between the nucleotide subunits of nucleic acid. A nuclease may be isolated or derived from a natural source. The natural source may be any living organism. Alternatively, a nuclease may be a modified or a synthetic protein which retains the phosphodiester bond cleaving activity. Gene modification can be achieved using a nuclease, for example a CRISPR nuclease.

Embodiments

[0036] The present disclosure provides a method for utilizing at least one naturally occurring nucleotide difference or polymorphism (e.g., single nucleotide polymorphism (SNP)) for distinguishing/discriminating between two alleles of a gene, one allele bearing a mutation such that it encodes a mutated protein causing a disease phenotype (“mutated allele”), and the other allele encoding for a functional protein (“functional allele”). The method further comprises the step of knocking out expression of the mutated protein and allowing expression of the functional protein. In some embodiments, the method is for treating, ameliorating, or preventing a dominant negative genetic disorder.

[0037] According to embodiments of the present invention, there is provided a first RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010.

[0038] According to embodiments of the present invention, there is provided a first RNA molecule comprising a guide sequence portion having 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010.

[0039] According embodiments of the present invention, an RNA molecule may further comprise a portion having a sequence which binds to a CRISPR nuclease.

[0040] According to embodiments of the present invention, the sequence which binds to a CRISPR nuclease is a tracrRNA sequence.

[0041] According to embodiments of the present invention, an RNA molecule may further comprise a portion having a tracr mate sequence.

[0042] According to embodiments of the present invention, an RNA molecule may further comprise one or more linker portions.

[0043] According to embodiments of the present invention, an RNA molecule may be up to 300, 290, 280, 270, 260, 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, or 100 nucleotides in length. Each possibility represents a separate embodiment. In embodiments of the present invention, the RNA molecule may be 17 up to 300 nucleotides in length, 100 up to 300 nucleotides in length, 150 up to 300 nucleotides in length, 200 up to 300 nucleotides in length, 100 to 200 nucleotides in length, or 150 up to 250 nucleotides in length. Each possibility represents a separate embodiment.

[0044] According to some embodiments of the present invention, there is provided a composition comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and a CRISPR nuclease.

[0045] According to embodiments of the present invention, the composition may comprise a second RNA molecule comprising a guide sequence portion.

[0046] According to embodiments of the present invention, the guide sequence portion of the second RNA molecule comprises 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010.

[0047] According to embodiments of the present invention, the 17-20 nucleotides of the guide sequence portion of the second RNA molecule are in a different sequence from the sequence of the guide sequence portion of the first RNA molecule

[0048] Embodiments of the present invention may comprise a tracrRNA molecule.

[0049] According to some embodiments of the present invention, there is provided a method for inactivating a mutant Rho allele in a cell, the method comprising delivering to the cell a composition comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and a CRISPR nuclease.

[0050] According to some embodiments of the present invention, there is provided a method for treating retinitis pigmentosa, the method comprising delivering to a subject having retinitis pigmentosa a composition comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and a CRISPR nuclease.

[0051] According to embodiments of the present invention, the composition comprises a second RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010.

[0052] According to embodiments of the present invention, the 17-20 nucleotides of the guide sequence portion of the second RNA molecule are in a different sequence from the sequence of the guide sequence portion of the first RNA molecule

[0053] According to embodiments of the present invention, the CRISPR nuclease and the RNA molecule or RNA molecules are delivered to the subject and/or cells substantially at the same time or at different times.

[0054] According to embodiments of the present invention, the tracrRNA is delivered to the subject and/or cells substantially at the same time or at different times as the CRISPR nuclease and RNA molecule or RNA molecules.

[0055] According to embodiments of the present invention, the first RNA molecule targets a SNP or disease-causing mutation in an exon or promoter of a mutated allele, and wherein the second RNA molecule targets a SNP in the same or a different exon of the mutated allele, a SNP in an intron, or a sequence in an intron present in both the mutated or functional allele.

[0056] According to embodiments of the present invention, the first RNA molecule or the first and the second RNA molecules target a SNP in the promoter region, the start codon, or the untranslated region (UTR) of a mutated allele.

[0057] According to embodiments of the present invention, the first RNA molecule or the first and the second RNA molecules targets at least a portion of the promoter and/or the start codon and/or a portion of the UTR of a mutated allele.

[0058] According to embodiments of the present invention, the first RNA molecule targets a portion of the promoter, a first SNP in the promoter, or a SNP upstream to the promoter of a mutated allele and the second RNA molecule is targets a second SNP, which is downstream of the first SNP, and is in the promoter, in the UTR, or in an intron or in an exon of a mutated allele.

[0059] According to embodiments of the present invention, the first RNA molecule targets a SNP in the promoter, upstream of the promoter, or the UTR of a mutated allele and the second RNA molecule is designed to target a sequence which is present in an intron of both the mutated allele and the functional allele.

[0060] According to embodiments of the present invention, the first RNA molecule targets a sequence upstream of the promotor which is present in both a mutated and functional allele and the second RNA molecule targets a SNP or disease-causing mutation in any location of the gene.

[0061] According to embodiments of the present invention, there is provided a method comprising removing an exon containing a disease-causing mutation from a mutated allele, wherein the first RNA molecule or the first and the second RNA molecules target regions flanking an entire exon or a portion of the exon.

[0062] According to embodiments of the present invention, there is provided a method comprising removing multiple exons, the entire open reading frame of a gene, or removing the entire gene.

[0063] According to embodiments of the present invention, the first RNA molecule targets a SNP or disease-causing mutation in an exon or promoter of a mutated allele, and wherein the second RNA molecule targets a SNP in the same or a different exon of the mutated allele, a SNP in an intron, or a sequence in an intron present in both the mutated or functional allele.

[0064] According to embodiments of the present invention, the first RNA molecule or the first and the second RNA molecules target an alternative splicing signal sequence between an exon and an intron of a mutant allele.

[0065] According to embodiments of the present invention, the second RNA molecule targets a sequence present in both a mutated allele and a functional allele.

[0066] According to embodiments of the present invention, the second RNA molecule targets an intron.

[0067] According to embodiments of the present invention, there is provided a method comprising subjecting the mutant allele to insertion or deletion by an error prone non-homologous end joining (NHEJ) mechanism, generating a frameshift in the mutated allele's sequence.

[0068] According to embodiments of the present invention, the frameshift results in inactivation or knockout of the mutated allele.

[0069] According to embodiments of the present invention, the frameshift creates an early stop codon in the mutated allele.

[0070] According to embodiments of the present invention, the frameshift results in nonsense-mediated mRNA decay of the transcript of the mutant allele.

[0071] According to embodiments of the present invention, the inactivating or treating results in a truncated protein encoded by the mutated allele and a functional protein encoded by the functional allele.

[0072] According to some embodiments of the present invention, there is provided use of a composition comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and a CRISPR nuclease inactivating a mutant Rho allele in a cell, comprising delivering to the cell the RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and the CRISPR nuclease.

[0073] According to embodiments of the present invention, there is provided a medicament comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and a CRISPR nuclease for use in inactivating a mutant Rho allele in a cell, wherein the medicament is administered by delivering to the cell the composition comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and a CRISPR nuclease.

[0074] According to some embodiments of the present invention, there is provided use of a composition comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and a CRISPR nuclease for treating ameliorating or preventing retinitis pigmentosa, comprising delivering to a subject having or at risk of having retinitis pigmentosa the composition of comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and a CRISPR nuclease.

[0075] According to some embodiments of the present invention, there is provided a medicament comprising the composition comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and a CRISPR nuclease for use in treating ameliorating or preventing retinitis pigmentosa, wherein the medicament is administered by delivering to a subject having or at risk of having retinitis pigmentosa: the composition comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010 and a CRISPR nuclease.

[0076] According to some embodiments of the present invention, there is provided a kit for inactivating a mutant Rho allele in a cell, comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010, a CRISPR nuclease, and/or a tracrRNA molecule; and instructions for delivering the RNA molecule; CRISPR nuclease, and/or the tracrRNA to the cell.

[0077] According to some embodiments of the present invention, there is provided a kit for treating retinitis pigmentosa in a subject, comprising an RNA molecule comprising a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-3010, a CRISPR nuclease, and/or a tracrRNA molecule; and instructions for delivering the RNA molecule; CRISPR nuclease, and/or the tracrRNA to a subject having or at risk of having retinitis pigmentosa.

[0078] In embodiments of the present invention, the RNA molecule comprises a guide sequence portion having 17-20 nucleotides in the sequence of 17-20 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-838, SEQ ID NOs: 839-3010, or SEQ ID NOs 1-3010.

[0079] The compositions and methods of the present disclosure may be utilized for treating, preventing, ameliorating, or slowing progression of retinitis pigmentosa.

[0080] In some embodiments, a mutated allele is deactivated by delivering to a cell an RNA molecule which targets a SNP in the promoter region, the start codon, or the untranslated region (UTR) of the mutated allele.

[0081] In some embodiments, a mutated allele is inactivated by removing at least a portion of the promoter and/or removing the start codon and/or a portion of the UTR. In some embodiments, the method of deactivating a mutated allele comprises removing at least a portion of the promoter. In such embodiments one RNA molecule may be designed for targeting a first SNP in the promoter or upstream to the promoter and another RNA molecule is designed to target a second SNP, which is downstream of the first SNP, and is in the promoter, in the UTR, or in an intron or in an exon. Alternatively, one RNA molecule may be designed for targeting a SNP in the promoter, or upstream of the promoter, or the UTR and another RNA molecule is designed to target a sequence which is present in an intron of both the mutated allele and the functional allele. Alternatively, one RNA molecule may be designed for targeting a sequence upstream of the promotor which is present in both the mutated and functional allele and the other guide is designed to target a SNP or disease-causing mutation in any location of the gene e.g., in an exon, intron, UTR, or downstream of the promoter.

[0082] In some embodiments, the method of deactivating a mutated allele comprises an exon skipping step comprising removing an exon containing a disease-causing mutation from the mutated allele. Removing an exon containing a disease-causing mutation in the mutated allele requires two RNA molecules which target regions flanking the entire exon or a portion of the exon. Removal of an exon containing the disease-causing mutation may be designed to eliminate the disease-causing action of the protein while allowing for expression of the remaining protein product which retains some or all of the wild-type activity. As an alternative to single exon skipping, multiple exons, the entire open reading frame or the entire gene can be excised using two RNA molecules flanking the region desired to be excised.

[0083] In some embodiments, the method of deactivating a mutated allele comprises delivering two RNA molecules to a cell, wherein one RNA molecule targets a SNP or disease-causing mutation in an exon or promoter of the mutated allele, and wherein the other RNA molecule targets a SNP in the same or a different exon of the mutated allele, a SNP in an intron, or a sequence in an intron present in both the mutated or functional allele.

[0084] In some embodiments, an RNA molecule is used to target a CRISPR nuclease to an alternative splicing signal sequence between an exon and an intron of a mutant allele, thereby destroying the alternative splicing signal sequence in the mutant allele.

[0085] Any one of, or combination of, the above-mentioned strategies for deactivating a mutant allele may be used in the context of the invention.

[0086] Additional strategies may be used to deactivate a mutated allele. For example, in embodiments of the present invention, an RNA molecule is used to direct a CRISPR nuclease to an exon or a splice site of a mutated allele in order to create a double-stranded break (DSB), leading to insertion or deletion of nucleotides by an error-prone non-homologous end-joining (NHEJ) mechanism and formation of a frameshift mutation in the mutated allele. The frameshift mutation may result in: (1) inactivation or knockout of the mutated allele by generation of an early stop codon in the mutated allele, resulting in generation of a truncated protein; or (2) nonsense mediated mRNA decay of the transcript of the mutant allele. In further embodiments, one RNA molecule is used to direct a CRISPR nuclease to a promotor of a mutated allele.

[0087] In some embodiments, the method of deactivating a mutated allele further comprises enhancing activity of the functional protein such as by providing a protein/peptide, a nucleic acid encoding a protein/peptide, or a small molecule such as a chemical compound, capable of activating/enhancing activity of the functional protein.

[0088] According to some embodiments, the present disclosure provides an RNA sequence (RNA molecule') which binds to / associates with and/or directs the RNA guided DNA nuclease e.g., CRISPR nuclease to a sequence comprising at least one nucleotide which differs between a mutated allele and a functional allele (e.g., SNP) of a gene of interest (i.e., a sequence of the mutated allele which is not present in the functional allele).

[0089] In some embodiments, the method comprises the steps of: contacting a mutated allele of a gene of interest with an allele-specific RNA molecule and a CRISPR nuclease e.g., a Cas9 protein, wherein the allele-specific RNA molecule and the CRISPR nuclease e.g., Cas9 associate with a nucleotide sequence of the mutated allele of the gene of interest which differs by at least one nucleotide from a nucleotide sequence of a functional allele of the gene of interest, thereby modifying or knocking-out the mutated allele.

[0090] In some embodiments, the allele-specific RNA molecule and a CRISPR nuclease is introduced to a cell encoding the gene of interest. In some embodiments, the cell encoding the gene of interest is in a mammalian subject. In some embodiments, the cell encoding the gene of interest is in a plant.

[0091] In some embodiments, the cleaved mutated allele is further subjected to insertion or deletion (indel) by an error prone non-homologous end joining (NHEJ) mechanism, generating a frameshift in the mutated allele's sequence. In some embodiments, the generated frameshift results in inactivation or knockout of the mutated allele. In some embodiments, the generated frameshift creates an early stop codon in the mutated allele and results in generation of a truncated protein. In such embodiments, the method results in the generation of a truncated protein encoded by the mutated allele and a functional protein encoded by the functional allele. In some embodiments, a frameshift generated in a mutated allele using the methods of the invention results in nonsense-mediated mRNA decay of the transcript of the mutant allele.

[0092] In some embodiments, the mutated allele is an allele of the Rho gene. In some embodiments, the RNA molecule targets a SNP which co-exists with / is genetically linked to the mutated sequence associated with retinitis pigmentosa genetic disorder. In some embodiments, the RNA molecule targets a SNP which is highly prevalent in the population and exists in the mutated allele having the mutated sequence associated with retinitis pigmentosa genetic disorder and not in the functional allele of an individual subject to be treated. In some embodiments, a disease-causing mutation within a mutated Rho allele is targeted.

[0093] In some embodiments, the SNP is within an exon of the gene of interest. In such embodiments, a guide sequence portion of an RNA molecule may be designed to associate with a sequence of the exon of the gene of interest.

[0094] In some embodiments, SNP is within an intron or an exon of the gene of interest. In some embodiments, SNP is in close proximity to a splice site between the intron and the exon. In some embodiments, the close proximity to a splice site is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides upstream or downstream to the splice site. Each possibility represents a separate embodiment of the present invention. In such embodiments, a guide sequence portion of an RNA molecule may be designed to associate with a sequence of the gene of interest which comprises the splice site.

[0095] In some embodiments, the method is utilized for treating a subject having a disease phenotype resulting from the heterozygote Rho gene. In such embodiments, the method results in improvement, amelioration or prevention of the disease phenotype.

[0096] Embodiments referred to above refer to a CRISPR nuclease, RNA molecule(s), and tracrRNA being effective in a subject or cells at the same time. The CRISPR, RNA molecule(s), and tracrRNA can be delivered substantially at the same time or can be delivered at different times but have effect at the same time. For example, this includes delivering the CRISPR nuclease to the subject or cells before the RNA molecule and/or tracr RNA is substantially extant in the subject or cells.

[0097] In some embodiments, the cell is a retinal cell. In some embodiments, the cell is a photoreceptor cell. In some embodiments, the photoreceptor cell is a rod photoreceptor cell. In some embodiments, the photoreceptor cell is a cone photoreceptor cell.

Dominant Genetic Disorders.

[0098] One of skill in the art will appreciate that all subjects with any type of heterozygote genetic disorder (e.g., dominant genetic disorder) may be subjected to the methods described herein. In one embodiment, the present invention may be used to target a gene involved in, associated with, or causative of dominant genetic disorders such as, for example retinitis pigmentosa. In some embodiments, the dominant genetic disorder is retinitis pigmentosa. In some embodiments, the target gene is the Rho gene (Entrez Gene, gene ID No: 6010).

CRISPR nucleases and PAM recognition

[0099] In some embodiments, the sequence specific nuclease is selected from CRISPR nucleases, or a functional variant thereof. In some embodiments, the sequence specific nuclease is an RNA guided DNA nuclease. In such embodiments, the RNA sequence which guides the RNA guided DNA nuclease (e.g., Cpf1) binds to and/or directs the RNA guided DNA nuclease to the sequence comprising at least one nucleotide which differs between a mutated allele and its counterpart functional allele (e.g., SNP). In some embodiments, the CRISPR complex does not further comprise a tracrRNA. In a non-limiting example, in which the RNA guided DNA nuclease is a CRISPR protein, the at least one nucleotide which differs between the dominant mutated allele and the functional allele may be within the PAM site and/or proximal to the PAM site within the region that the RNA molecule is designed to hybridize to. A skilled artisan will appreciate that RNA molecules can be engineered to bind to a target of choice in a genome by commonly known methods in the art.

[0100] In embodiments of the present invention, a type II CRISPR system utilizes a mature crRNA:tracrRNA complex directs a CRISPR nuclease, e.g. Cas9, to the target DNA via Watson-Crick base-pairing between the crRNA and the protospacer on the target DNA next to the protospacer adjacent motif (PAM), an additional requirement for target recognition. The CRISPR nuclease then mediates cleavage of target DNA to create a double-stranded break within the protospacer. A skilled artisan will appreciate that each of the engineered RNA molecule of the present invention is further designed such as to associate with a target genomic DNA sequence of interest next to a protospacer adjacent motif (PAM), e.g., a PAM matching the sequence relevant for the type of CRISPR nuclease utilized, such as for a non-limiting example, NGG or NAG, wherein “N” is any nucleobase, for Streptococcus pyogenes Cas9 WT (SpCAS9); NNGRRT for Staphylococcus aureus (SaCas9); NNNVRYM for Jejuni Cas9 WT; NGAN or NGNG for SpCas9-VQR variant; NGCG for SpCas9-VRER variant; NGAG for SpCas9-EQR variant; NNNNGATT for Neisseria meningitidis (NmCas9); or TTTV for Cpf1. RNA molecules of the present invention are each designed to form complexes in conjunction with one or more different CRISPR nucleases and designed to target polynucleotide sequences of interest utilizing one or more different PAM sequences respective to the CRISPR nuclease utilized.

[0101] In some embodiments, an RNA-guided DNA nuclease e.g., a CRISPR nuclease, may be used to cause a DNA break at a desired location in the genome of a cell. The most commonly used RNA-guided DNA nucleases are derived from CRISPR systems, however, other RNA-guided DNA nucleases are also contemplated for use in the genome editing compositions and methods described herein. For instance, see U.S. Patent Publication No. 2015-0211023, incorporated herein by reference.

[0102] CRISPR systems that may be used in the practice of the invention vary greatly. CRISPR systems can be a type I, a type II, or a type III system. Non- limiting examples of suitable CRISPR proteins include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9, Casl0, Casl Od, CasF, CasG, CasH, Csyl1, Csy2, Csy3, Csel (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csbl , Csb2, Csb3,Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csz1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cul966.

[0103] In some embodiments, the RNA-guided DNA nuclease is a CRISPR nuclease derived from a type II CRISPR system (e.g., Cas9). The CRISPR nuclease may be derived from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Neisseria meningitidis, Treponema denticola, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difjicile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculumthermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, or any species which encodes a CRISPR nuclease with a known PAM sequence. CRISPR nucleases encoded by uncultured bacteria may also be used in the context of the invention. (See Burstein et al. Nature, 2017). Variants of CRIPSR proteins having known PAM sequences e.g., spCas9 D1135E variant, spCas9 VQR variant, spCas9 EQR variant, or spCas9 VRER variant may also be used in the context of the invention.

[0104] Thus, an RNA guided DNA nuclease of a CRISPR system, such as a Cas9 protein or modified Cas9 or homolog or ortholog of Cas9, or other RNA guided DNA nucleases belonging to other types of CRISPR systems, such as Cpf1 and its homologs and orthologs, may be used in the compositions of the present invention.

[0105] In certain embodiments, the CRIPSR nuclease may be a “functional derivative” of a naturally occurring Cas protein. A “functional derivative” of a native sequence polypeptide is a compound having a qualitative biological property in common with a native sequence polypeptide. “Functional derivatives” include, but are not limited to, fragments of a native sequence and derivatives of a native sequence polypeptide and its fragments, provided that they have a biological activity in common with a corresponding native sequence polypeptide. A biological activity contemplated herein is the ability of the functional derivative to hydrolyze a DNA substrate into fragments. The term “derivative” encompasses both amino acid sequence variants of polypeptide, covalent modifications, and fusions thereof. Suitable derivatives of a Cas polypeptide or a fragment thereof include but are not limited to mutants, fusions, covalent modifications of Cas protein or a fragment thereof. Cas protein, which includes Cas protein or a fragment thereof, as well as derivatives of Cas protein or a fragment thereof, may be obtainable from a cell or synthesized chemically or by a combination of these two procedures. The cell may be a cell that naturally produces Cas protein, or a cell that naturally produces Cas protein and is genetically engineered to produce the endogenous Cas protein at a higher expression level or to produce a Cas protein from an exogenously introduced nucleic acid, which nucleic acid encodes a Cas that is same or different from the endogenous Cas. In some cases, the cell does not naturally produce Cas protein and is genetically engineered to produce a Cas protein.

[0106] In some embodiments, the CRISPR nuclease is Cpf1. Cpf1 is a single RNA-guided endonuclease which utilizes a T-rich protospacer-adjacent motif. Cpf1 cleaves DNA via a staggered DNA double-stranded break. Two Cpf1 enzymes from Acidaminococcus and Lachnospiraceae have been shown to carry out efficient genome-editing activity in human cells. (See Zetsche et al. (2015) Cell.).

[0107] Thus, an RNA guided DNA nuclease of a Type II CRISPR System, such as a Cas9 protein or modified Cas9 or homologs, orthologues, or variants of Cas9, or other RNA guided DNA nucleases belonging to other types of CRISPR systems, such as Cpf1 and its homologs, orthologues, or variants, may be used in the present invention.

[0108] In some embodiments, the guide molecule comprises one or more chemical modifications which imparts a new or improved property (e.g., improved stability from degradation, improved hybridization energetics, or improved binding properties with an RNA guided DNA nuclease). Suitable chemical modifications include, but are not limited to: modified bases, modified sugar moieties, or modified inter-nucleoside linkages. Non-limiting examples of suitable chemical modifications include: 4-acetylcytidine, 5-(carboxyhydroxymethl)uridine, 2′-O-methylcytidine, 5-carboxyrn ethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, dihydrouridine, 2′-O-methylpseudouridine, “beta, D-galactosylqueuosine”, 2′-O-methylguanosine, inosine, N6-isopentenyladenosine, 1-methyladenosine, 1-methylpseudouridine, 1-methylguanosine, 1-methylinosine, “2,2-dimethylguanosine”, 2-methyladenosine, 2-methylguanosine, 3-methylcytidine, 5-methyleytidine, No-methyladenosine, 7-methylguanosine, 5-methylaminomethyluridine, methoxyaminomethyl-2-thiouridine, “beta, D-mannosyiqueuosine”, methoxycarbonylmethyl -2-thiouridine, 5-methoxy-carbonylmethyluridine, 5-methoxyuridine, 2-methyithio-N6-isopentenyiadenosine, N-((9-beta-D-ribofuranosyl-2-methylthiopurine-6-yl)carbamoyl)threonine, N-((9-(beta-D-ribofuranosylpurine-6-yl)N-methylcarbamoyl)threonine, uridine-5-oxyacetic acid-methylester, uridine-5-oxyacetic acid, wybutoxosine, queuosine, 2-thiocytidine, 5-methyl-2-thioutidine, 2-thiouridine, 4-thiouridine, 5-methyluridine, N-((9-beta-D-ribofuranosylpurine-6-yl)-carbarnoyl)threonine, 2′-O-methyl-5-methyluridine, 2′-O-tnethyluridine, wybutosine, “3-(3-amino-3-carboxy-propyl)uridine, (acp3)u”, 2′-0-methyl (M), 3′-phosphorothioate (MS), 3′-thioPACE (MSP), pseudouridine, or 1-methyl pseudo-uridine. Each possibility represents a separate embodiment of the present invention.

Guide sequences which specifically target a mutant allele

[0109] A given gene may contain thousands of SNPs. Utilizing a 24 base pair target window for targeting each SNP in a gene would require hundreds of thousands of guide sequences. Any given guide sequence when utilized to target a SNP may result in degradation of the guide sequence, limited activity, no activity, or off-target effects. Accordingly, suitable guide sequences are necessary for targeting a given gene. By the present invention, a novel set of guide sequences have been identified for knocking out expression of a mutated Rho protein, inactivating a mutant Rho gene allele, and treating retinitis pigmentosa.

[0110] The present disclosure provides guide sequences capable of specifically targeting a mutated allele for inactivation while leaving the functional allele unmodified. The guide sequences of the present invention are designed to, and are most likely to, specifically differentiate between a mutated allele and a functional allele. Of all possible guide sequences which target a mutated allele desired to be inactivated, the specific guide sequences disclosed herein are specifically effective to function with the disclosed embodiments.

[0111] Briefly, the guide sequences may have properties as follows: (1) target SNP/insertion/deletion/indel with a high prevalence in the general population, in a specific ethnic population or in a patient population is above 1% and the SNP/insertion/deletion/indel heterozygosity rate in the same population is above 1%; (2) target a location of a SNP/insertion/deletion/indel proximal to a portion of the gene e.g., within 5k bases of any portion of the gene, for example, a promoter, a UTR, an exon or an intron; and (3) target a mutant allele using an RNA molecule which targets a founder or common pathogenic mutations for the disease/gene. In some embodiments, the prevalence of the SNP/insertion/deletion/indel in the general population, in a specific ethnic population or in a patient population is above 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15% and the SNP/insertion/deletion/indel heterozygosity rate in the same population is above 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15%. Each possibility represents a separate embodiment and may be combined at will.

[0112] For each gene, according to SNP/insertion/deletion/indel any one of the following strategies may be used to deactivate the mutated allele: (1) Knockout strategy using one RNA molecule—one RNA molecule is utilized to direct a CRISPR nuclease to a mutated allele and create a double-strand break (DSB) leading to formation of a frameshift mutation in an exon or in a splice site region of the mutated allele; (2) Knockout strategy using two RNA molecules—two RNA molecules are utilized. A first RNA molecule targets a region in the promoter or an upstream region of a mutated allele and another RNA molecule targets downstream of the first RNA molecule in a promoter, exon, or intron of the mutated allele; (3) Exon(s) skipping strategy—one RNA molecule may be used to target a CRISPR nuclease to a splice site region, either at the 5′ end of an intron (donor sequence) or the 3′ end of an intron (acceptor sequence), in order to destroy the splice site. Alternatively, two RNA molecules may be utilized such that a first RNA molecule targets an upstream region of an exon and a second RNA molecule targets a region downstream of the first RNA molecule, thereby excising the exon(s). Based on the locations of identified SNPs/insertions/deletions/indels for each mutant allele, any one of, or a combination of, the above-mentioned methods to deactivate the mutant allele may be utilized.

[0113] When only one RNA molecule is used is that the location of the SNP is in an exon or in close proximity (e.g., within 20 basepairs) to a splice site between the intron and the exon. When two RNA molecules are used, guide sequences may target two SNPs such that the first SNP is upstream of exon 1 e.g., within the 5′ untranslated region, or within the promoter or within the first 2 kilobases 5′ of the transcription start site, and the second SNP is downstream of the first SNP e.g., within the first 2 kilobases 5′ of the transcription start site, or within intron 1, 2 or 3, or within exon 1, exon 2, or exon 3.

[0114] Guide sequences of the present invention may target a SNP in the upstream portion of the targeted gene, preferably upstream of the last exon of the targeted gene. Guide sequences may target a SNP upstream to exon 1, for example within the 5′ untranslated region, or within the promoter or within the first 4-5 kilobases 5′ of the transcription start site.

[0115] Guide sequences of the present invention may also target a SNP within close proximity (e.g., within 50 basepairs, more preferably with 20 basepairs) to a known protospacer adjacent motif (PAM) site.

[0116] Guide sequences of the present invention also may target: (1) a heterozygous SNP for the targeted gene; (2) a heterozygous SNPs upstream and downstream of the gene; (3) a SNPs with a prevalence of the SNP/insertion/deletion/indel in the general population, in a specific ethnic population, or in a patient population above 1%; (4) have a guanine-cytosine content of greater than 30% and less than 85%; (5) have no repeat of 4 or more thymine/uracil or 8 or more guanine, cytosine, or adenine; (6) having no off-target identified by off-target analysis; and (7) preferably target Exons over Introns or be upstream of a SNP rather than downstream of a SNP.

[0117] In embodiments of the present invention, the SNP may be upstream or downstream of the gene. In embodiments of the present invention, the SNP is within 4,000 base pairs upstream or downstream of the gene.

[0118] The at least one nucleotide which differs between the mutated allele and the functional allele, may be upstream, downstream or within the sequence of the disease-causing mutation of the gene of interest. The at least one nucleotide which differs between the mutated allele and the functional allele, may be within an exon or within an intron of the gene of interest. In some embodiments, the at least one nucleotide which differs between the mutated allele and the functional allele is within an exon of the gene of interest. In some embodiments, the at least one nucleotide which differs between the mutated allele and the functional allele is within an intron or an exon of the gene of interest, in close proximity to a splice site between the intron and the exon e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides upstream or downstream to the splice site.

[0119] In some embodiments, the at least one nucleotide is a single nucleotide polymorphisms (SNPs). In some embodiments, each of the nucleotide variants of the SNP may be expressed in the mutated allele. In some embodiments, the SNP may be a founder or common pathogenic mutation.

[0120] Guide sequences may target a SNP which has both (1) a high prevalence in the general population e.g., above 1% in the population; and (2) a high heterozygosity rate in the population, e.g., above 1%. Guide sequences may target a SNP that is globally distributed. A SNP may be a founder or common pathogenic mutation. In some embodiments, the prevalence in the general population is above 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15%. Each possibility represents a separate embodiment. In some embodiments, the heterozygosity rate in the population is above 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15%. Each possibility represents a separate embodiment.

[0121] In some embodiments, the at least one nucleotide which differs between the mutated allele and the functional allele is linked to/co-exists with the disease-causing mutation in high prevalence in a population. In such embodiments, “high prevalence” refers to at least 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. Each possibility represents a separate embodiment of the present invention. In one embodiment, the at least one nucleotide which differs between the mutated allele and the functional allele, is a disease-associated mutation. In some embodiments, the SNP is highly prevalent in the population. In such embodiments, “highly prevalent” refers to at least 10%, 11%, 12%, 13%, 14%, 15%, 20%, 30%, 40%, 50%, 60%, or 70% of a population. Each possibility represents a separate embodiment of the present invention.

[0122] Guide sequences of the present invention may satisfy any one of the above criteria and are most likely to differentiate between a mutated allele from its corresponding functional allele.

[0123] In some embodiments the RNA molecule targets a SNP/WT sequence linked to SNPs as shown in Table 1 below. The SNP details are indicated in the 1.sup.st column and include: SNP ID No. (based on NCBI's 2018 database of Single Nucleotide Polymorphisms (dbSNP)). For variants with no available rs number variants characteristic are indicated based on gnomAD 2018 browser database. The 2.sup.nd column indicates an assigned identifier for each SNP. The 3.sup.rd column indicates the location of each SNP on the Rho gene.

TABLE-US-00002 TABLE 1 Rho gene SNPs RSID SNP No. SNP location in the gene rs750171247 s1 Exon_5 of 5 rs2855558 s2 Exon_5 of 5 rs60645924 s3 Exon_5 of 5 rs9823319 s4 upstream −3163 bp rs2855557 s5 Intron_4 of 4 rs2713630 s6 upstream −3943 bp rs7984 s7 Exon_1 of 5 rs2625954 s8 upstream −1067 bp rs2625953 s9 upstream −1653 bp rs2625955 s10 upstream −682 bp rs58508862 s11 upstream −1801 bp rs2410 s12 Exon_5 of 5 rs6803468 s13 Intron_2 of 4 rs73204247 s14 Intron_2 of 4 rs6803484 s15 Intron_2 of 4 rs56295021 s16 upstream −2129 bp rs3774785 s17 upstream −2012 bp rs2713628 s18 upstream −2002 bp rs56120415 s19 Intron_2 of 4 rs56340615 s20 Intron_3 of 4 rs2071093 s21 Exon_5 of 5 rs73204245 s22 Intron_1 of 4 rs2269736 s23 Exon_1 of 5 rs9837743 s24 upstream −2395 bp rs2071092 s25 Intron_4 of 4 rs2855552 s26 Intron_1 of 4 rs73863103 s27 Intron_1 of 4 rs35822883 s28 Intron_2 of 4 rs55941599 s29 Exon_5 of 5 rs2713629 s30 upstream −2434 bp rs80263713 s31 Intron_2 of 4 rs77154523 s32 Intron_1 of 4 rs115345357 s33 Intron_1 of 4 rs146327704 s34 Intron_1 of 4 rs187923166 s35 Exon_5 of 5 rs78163008 s36 Exon_5 of 5 rs146987110 s37 upstream −1680 bp rs78872255 s38 Intron_1 of 4 rs60744548 s39 Intron_1 of 4

Delivery to Cells

[0124] The RNA molecule compositions described herein may be delivered to a target cell by any suitable means. RNA molecule compositions of the present invention may be targeted to any cell which contains and/or expresses a dominant negative allele, including any mammalian or plant cell. For example, in one embodiment the RNA molecule specifically targets a mutated Rho allele and the target cell is a retinal cell such as pigment epithelium (RPE), photoreceptors (e.g., rod and cone), glial cells (e.g., Muller), and ganglion cells. Further, the nucleic acid compositions described herein may be delivered as one or more DNA molecules, RNA molecules, Ribonucleoproteins (RNP), nucleic acid vectors, or any combination thereof.

[0125] In some embodiments, the RNA molecule comprises a chemical modification. Non-limiting examples of suitable chemical modifications include 2-0-methyl (M), 2′-0-methyl, 3′phosphorothioate (MS) or 2′-0-methyl, 3′thioPACE (MSP), pseudouridine, and 1-methyl pseudo-uridine. Each possibility represents a separate embodiment of the present invention.

[0126] Any suitable viral vector system may be used to deliver nucleic acid compositions e.g., the RNA molecule compositions of the subject invention. Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids and target tissues. In certain embodiments, nucleic acids are administered for in vivo or ex vivo gene therapy uses. Non-viral vector delivery systems include naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome or poloxamer. For a review of gene therapy procedures, see Anderson (1992) Science 256:808-813; Nabel & Felgner (1993) TIBTECH 11:211-217; Mitani & Caskey (1993) TIBTECH 11:162-166; Dillon (1993) TIBTECH 11:167-175; Miller (1992) Nature 357:455-460; Van Brunt (1988) Biotechnology 6(10):1149-1154; Vigne (1995)

[0127] Restorative Neurology and Neuroscience 8:35-36; Kremer & Perricaudet (1995) British Medical Bulletin 51(1):31-44; Haddada et al. (1995) in Current Topics in Microbiology and Immunology Doerfler and Bohm (eds.); and Yu et al. (1994) Gene Therapy 1:13-26.

[0128] Methods of non-viral delivery of nucleic acids and/or proteins include electroporation, lipofection, microinjection, biolistics, particle gun acceleration, virosomes, liposomes, immunoliposomes, lipid nanoparticles (LNPs), polycation or lipid:nucleic acid conjugates, artificial virions, and agent-enhanced uptake of nucleic acids or can be delivered to plant cells by bacteria or viruses (e.g., Agrobacterium, Rhizobium sp. NGR234, Sinorhizoboiummeliloti, Mesorhizobium loti, tobacco mosaic virus, potato virus X, cauliflower mosaic virus and cassava vein mosaic virus). (See, e.g., Chung et al. (2006) Trends Plant Sci. 11(1):1-4). Sonoporation using, e.g., the Sonitron 2000 system (Rich-Mar), can also be used for delivery of nucleic acids. Cationic-lipid mediated delivery of proteins and/or nucleic acids is also contemplated as an in vivo or in vitro delivery method. (See Zuris et al. (2015) Nat. Biotechnol. 33(1):73-80; see also Coelho et al. (2013) N. Engl. J. Med. 369, 819-829; Judge et al. (2006) Mol. Ther. 13, 494-505; and Basha et al. (2011) Mol. Ther. 19, 2186-2200).

[0129] Additional exemplary nucleic acid delivery systems include those provided by Amaxa™. Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Md.), BTX Molecular Delivery Systems (Holliston, Mass.) and Copernicus Therapeutics Inc., (see, e.g., U.S. Pat. No. 6,008,336). Lipofection is described in e.g., U.S. Pat. Nos. 5,049,386, 4,946,787; and 4,897,355, and lipofection reagents are sold commercially (e.g., Transfectam.™., Lipofectin.™. and Lipofectamine.™. RNAiMAX). Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Felgner, WO 91/17424, WO 91/16024. Delivery can be to cells (ex vivo administration) or target tissues (in vivo administration).

[0130] The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to one of skill in the art (See, e.g., Crystal (1995) Science 270:404-410; Blaese et al. (1995) Cancer Gene Ther. 2:291-297; Behr et al. (1994) Bioconjugate Chem. 5:382-389; Remy et al. (1994) Bioconjugate Chem. 5:647-654; Gao et al. (1995) Gene Therapy 2:710-722; Ahmad et al. (1992) Cancer Res. 52:4817-4820; U.S. Pat. Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787).

[0131] Additional methods of delivery include the use of packaging the nucleic acids to be delivered into EnGenelC delivery vehicles (EDVs). These EDVs are specifically delivered to target tissues using bispecific antibodies where one arm of the antibody has specificity for the target tissue and the other has specificity for the EDV. The antibody brings the EDVs to the target cell surface and then the EDV is brought into the cell by endocytosis. Once in the cell, the contents are released (See MacDiarmid et al (2009) Nature Biotechnology 27(7):643).

[0132] The use of RNA or DNA viral based systems for viral mediated delivery of nucleic acids take advantage of highly evolved processes for targeting a virus to specific cells in the body and trafficking the viral payload to the nucleus. Viral vectors can be administered directly to patients (in vivo) or they can be used to treat cells in vitro and the modified cells are administered to patients (ex vivo). Conventional viral based systems for the delivery of nucleic acids include, but are not limited to, retroviral, lentivirus, adenoviral, adeno-associated, vaccinia and herpes simplex virus vectors for gene transfer.

[0133] The tropism of a retrovirus can be altered by incorporating foreign envelope proteins, expanding the potential target population of target cells. Lentiviral vectors are retroviral vectors that are able to transduce or infect non-dividing cells and typically produce high viral titers.

[0134] Selection of a retroviral gene transfer system depends on the target tissue. Retroviral vectors are comprised of cis-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum cis-acting LTRs are sufficient for replication and packaging of the vectors, which are then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression. Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (See, e.g., Buchschacher et al. (1992) J. Virol. 66:2731-2739; Johann et al. (1992) J. Virol. 66:1635-1640; Sommerfelt et al. (1990) Virol. 176:58-59; Wilson et al. (1989) J. Virol. 63:2374-2378; Miller et al. (1991) J. Virol. 65:2220-2224; PCT/US94/05700).

[0135] At least six viral vector approaches are currently available for gene transfer in clinical trials, which utilize approaches that involve complementation of defective vectors by genes inserted into helper cell lines to generate the transducing agent.

[0136] pLASN and MFG-S are examples of retroviral vectors that have been used in clinical trials (Dunbar et al. (1995) Blood 85:3048-305; Kohn et al.(1995) Nat. Med. 1:1017-102;

[0137] Malech et al. (1997) PNAS 94:22 12133-12138). PA317/pLASN was the first therapeutic vector used in a gene therapy trial. (Blaese et al. (1995). Transduction efficiencies of 50% or greater have been observed for MFG-S packaged vectors. (Ellem et al. (1997) Immunol Immunother. 44(1):10-20; Dranoff et al. (1997) Hum. Gene Ther. 1:111-2).

[0138] Packaging cells are used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenovirus, AAV, and Psi-2 cells or PA317 cells, which package retrovirus. Viral vectors used in gene therapy are usually generated by a producer cell line that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host (if applicable), other viral sequences being replaced by an expression cassette encoding the protein to be expressed. The missing viral functions are supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy typically only possess inverted terminal repeat (ITR) sequences from the AAV genome which are required for packaging and integration into the host genome. Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences. The cell line is also infected with adenovirus as a helper. The helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid. The helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV. Additionally, AAV can be produced at clinical scale using baculovirus systems (see U.S. Pat. No. 7,479,554).

[0139] In many gene therapy applications, it is desirable that the gene therapy vector be delivered with a high degree of specificity to a particular tissue type. Accordingly, a viral vector can be modified to have specificity for a given cell type by expressing a ligand as a fusion protein with a viral coat protein on the outer surface of the virus. The ligand is chosen to have affinity for a receptor known to be present on the cell type of interest. For example, Han et al. (1995) Proc. Natl. Acad. Sci. USA 92:9747-9751, reported that Moloney murine leukemia virus can be modified to express human heregulin fused to gp70, and the recombinant virus infects certain human breast cancer cells expressing human epidermal growth factor receptor. This principle can be extended to other virus-target cell pairs, in which the target cell expresses a receptor and the virus expresses a fusion protein comprising a ligand for the cell-surface receptor. For example, filamentous phage can be engineered to display antibody fragments (e.g., FAB or Fv) having specific binding affinity for virtually any chosen cellular receptor. Although the above description applies primarily to viral vectors, the same principles can be applied to nonviral vectors. Such vectors can be engineered to contain specific uptake sequences which favor uptake by specific target cells.

[0140] Gene therapy vectors can be delivered in vivo by administration to an individual patient, typically by systemic administration (e.g., intravitreal, intravenous, intraperitoneal, intramuscular, subdermal, or intracranial infusion) or topical application, as described below. Alternatively, vectors can be delivered to cells ex vivo, such as cells explanted from an individual patient (e.g., lymphocytes, bone marrow aspirates, tissue biopsy) or universal donor hematopoietic stem cells, followed by reimplantation of the cells into a patient, usually after selection for cells which have incorporated the vector.

[0141] Ex vivo cell transfection for diagnostics, research, or for gene therapy (e.g., via re-infusion of the transfected cells into the host organism) is well known to those of skill in the art. In a preferred embodiment, cells are isolated from the subject organism, transfected with a nucleic acid composition, and re-infused back into the subject organism (e.g., patient). Various cell types suitable for ex vivo transfection are well known to those of skill in the art (See, e.g., Freshney et al. (1994) Culture of Animal Cells, A Manual of Basic Technique, 3rd ed, and the references cited therein for a discussion of how to isolate and culture cells from patients).

[0142] Suitable cells include, but are not limited to, eukaryotic cells and/or cell lines. Non-limiting examples of such cells or cell lines generated from such cells include COS, CHO (e.g., CHO-S, CHO-K1, CHO-DG44, CHO-DUXB11, CHO-DUKX, CHOK1SV), VERO, MDCK, WI38, V79, B14AF28-G3, BHK, HaK, NSO, SP2/0-Ag14, HeLa, HEK293 (e.g., HEK293-F, HEK293-H, HEK293-T), perC6 cells, any plant cell (differentiated or undifferentiated), as well as insect cells such as Spodopterafugiperda (Sf), or fungal cells such as Saccharomyces, Pichia and Schizosaccharomyces. In certain embodiments, the cell line is a CHO-K1, MDCK or HEK293 cell line. Additionally, primary cells may be isolated and used ex vivo for reintroduction into the subject to be treated following treatment with a guided nuclease system (e.g. CRISPR/Cas). Suitable primary cells include peripheral blood mononuclear cells (PBMC), and other blood cell subsets such as, but not limited to, CD4+ T cells or CD8+ T cells. Suitable cells also include stem cells such as, by way of example, embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells (CD34+), neuronal stem cells and mesenchymal stem cells.

[0143] In one embodiment, stem cells are used in ex vivo procedures for cell transfection and gene therapy. The advantage to using stem cells is that they can be differentiated into other cell types in vitro, or can be introduced into a mammal (such as the donor of the cells) where they will engraft in the bone marrow. Methods for differentiating CD34+cells in vitro into clinically important immune cell types using cytokines such a GM-CSF, IFN-gamma, and TNF-alpha are known (as a non-limiting example see, Inaba et al., J. Exp. Med. 176:1693-1702 (1992)).

[0144] Stem cells are isolated for transduction and differentiation using known methods. For example, stem cells are isolated from bone marrow cells by panning the bone marrow cells with antibodies which bind unwanted cells, such as CD4+ and CD8+ (T cells), CD45+ (panB cells), GR-1 (granulocytes), and Iad (differentiated antigen presenting cells) (as a non-limiting example see Inaba et al. (1992) J. Exp. Med. 176:1693-1702). Stem cells that have been modified may also be used in some embodiments.

[0145] Any one of the RNA molecule compositions described herein is suitable for genome editing in post-mitotic cells or any cell which is not actively dividing, e.g., arrested cells. Examples of post-mitotic cells which may be edited using a composition of the present invention include, but are not limited to, a photoreceptor cell, a rod photoreceptor cell, a cone photoreceptor cell, a retinal pigment epithelium (RPE), a glial cell, Muller cell, and a ganglion.

[0146] Vectors (e.g., retroviruses, liposomes, etc.) containing therapeutic nucleic acid compositions can also be administered directly to an organism for transduction of cells in vivo. Administration is by any of the routes normally used for introducing a molecule into ultimate contact with blood or tissue cells including, but not limited to, injection, infusion, topical application (e.g., eye drops and cream) and electroporation. Suitable methods of administering such nucleic acids are available and well known to those of skill in the art, and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route. According to some embodiments, the composition is delivered via sub-retinal injection. According to some embodiments, the composition is delivered via intravitreal injection.

[0147] Vectors suitable for introduction of transgenes into immune cells (e.g., T-cells) include non-integrating lentivirus vectors. See, e.g., U.S. Patent Publication No. 2009-0117617.

[0148] Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions available, as described below (See, e.g., Remington's Pharmaceutical Sciences, 17th ed., 1989).

[0149] In accordance with some embodiments, there is provided an RNA molecule which binds to/ associates with and/or directs the RNA guided DNA nuclease to a sequence comprising at least one nucleotide which differs between a mutated allele and a functional allele (e.g., SNP) of a gene of interest (i.e., a sequence of the mutated allele which is not present in the functional allele). The sequence may be within the disease associated mutation. The sequence may be upstream or downstream to the disease associated mutation. Any sequence difference between the mutated allele and the functional allele may be targeted by an RNA molecule of the present invention to inactivate the mutant allele, or otherwise disable its dominant disease-causing effects, while preserving the activity of the functional allele.

[0150] The disclosed compositions and methods may also be used in the manufacture of a medicament for treating dominant genetic disorders in a patient.

Examples of RNA Guide Sequences which Specifically Target Mutated Alleles of Rho Gene

[0151] Although a large number of guide sequences can be designed to target a mutated allele, the nucleotide sequences described in Tables 2 identified by SEQ ID NOs: 1-3010 below were specifically selected to effectively implement the methods set forth herein and to effectively discriminate between alleles.

[0152] Referring to columns 1-4, each of SEQ ID NOs. 1-3010 indicated in column 1 corresponds to an engineered guide sequence. The corresponding SNP details are indicated in column 2. The SNP details indicated in the 2nd column include the assigned identifier for each SNP corresponding to a SNP ID indicated in Table 1. Column 3 indicates whether the target of each guide sequence is the Rho gene polymorph or wild type (REF) sequence. Column 4 indicates the guanine-cytosine content of each guide sequence.

[0153] Table 2 shows guide sequences designed for use as described in the embodiments above to associate with different SNPs within a sequence of a mutated Rho allele. Each engineered guide molecule is further designed such as to associate with a target genomic DNA sequence of interest that lies next to a protospacer adjacent motif (PAM), e.g., a PAM matching the sequence NGG or NAG, where “N” is any nucleobase. The guide sequences were designed to work in conjunction with one or more different CRISPR nucleases, including, but not limited to, e.g. SpCas9WT (PAM SEQ: NGG), SpCas9.VQR.1 (PAM SEQ: NGAN), SpCas9.VQR.2 (PAM SEQ: NGNG), SpCas9.EQR (PAM SEQ: NGAG), SpCas9.VRER (PAM SEQ: NGCG), SaCas9WT (PAM SEQ: NNGRRT), NmCas9WT (PAM SEQ: NNNNGATT), Cpf1 (PAM SEQ: TTTV), or JeCas9WT (PAM SEQ: NNNVRYM). RNA molecules of the present invention are each designed to form complexes in conjunction with one or more different CRISPR nucleases and designed to target polynucleotide sequences of interest utilizing one or more different PAM sequences respective to the CRISPR nuclease utilized

TABLE-US-00003 TABLE 2 Guide sequences designed to associate with specific SNPs of the Rho gene SEQ SNP ID ID NO: (Table 1) Target (SNP/REF) % GC 1 s1 REF, SNP 50% 2 s1 REF, SNP 50% 3 s2 REF, SNP 60% 4 s2, s3 REF, REF, SNP 50% 5 s2, s3 REF, REF, SNP 50% 6 s2, s3 REF, REF 45% 7 s2, s3 REF, REF 55% 8 s2, s3 REF, REF 55% 9 s2, s3 REF, REF 55% 10 s2, s3 REF, REF 55% 11 s2, s3 REF, REF 55% 12 s2, s3 REF, REF 45% 13 s4 REF, SNP 60% 14 s4 REF, SNP 60% 15 s4 REF, SNP 55% 16 s5 REF, SNP 60% 17 s5 REF, SNP 45% 18 s7 REF, SNP 60% 19 s7 REF, SNP 60% 20 s7 REF, SNP 70% 21 s7 REF, SNP 65% 22 s8 REF, SNP 60% 23 s8 REF, SNP 55% 24 s9 REF, SNP 35% 25 s9 REF, SNP 55% 26 s9 REF, SNP 60% 27 s10 REF, SNP 60% 28 s10 REF, SNP 60% 29 s11 REF, SNP 65% 30 s11 REF, SNP 70% 31 s12 REF, SNP 60% 32 s12 REF, SNP 70% 33 s3 REF, SNP 65% 34 s3 REF, SNP 70% 35 s13 REF, SNP 60% 36 s13 REF, SNP 55% 37 s13, s14 REF, REF, SNP 65% 38 s13, s14 REF, REF 60% 39 s13, s14 REF, REF 60% 40 s13, s14 REF, REF 55% 41 s15 REF, SNP 55% 42 s15 REF, SNP 55% 43 s17 REF, SNP 35% 44 s17 REF, SNP 40% 45 s17, s18 REF, REF 50% 46 s17, s18 REF, REF 45% 47 s19 REF, SNP 60% 48 s19 REF, SNP 65% 49 s20 REF, SNP 55% 50 s20 REF, SNP 50% 51 s21 REF, SNP 65% 52 s21 REF, SNP 65% 53 s21 REF, SNP 60% 54 s22 REF, SNP 55% 55 s22 REF, SNP 50% 56 s22 REF, SNP 55% 57 s23 REF, SNP 60% 58 s23 REF, SNP 60% 59 s23 REF, SNP 60% 60 s24 REF, SNP 55% 61 s14 REF, SNP 60% 62 s25 REF, SNP 75% 63 s25 REF, SNP 55% 64 s26 REF, SNP 50% 65 s26 REF, SNP 45% 66 s26 REF, SNP 50% 67 s26 REF, SNP 55% 68 s27 REF, SNP 55% 69 s27 REF, SNP 55% 70 s27 REF, SNP 50% 71 s18 REF, SNP 60% 72 s18 REF, SNP 60% 73 s28 REF, SNP 35% 74 s28 REF, SNP 60% 75 s28 REF, SNP 65% 76 s28 REF, SNP 65% 77 s29 REF, SNP 45% 78 s29 REF, SNP 45% 79 s29 REF, SNP 40% 80 s31 REF, SNP 70% 81 s31 REF, SNP 70% 82 s32 REF, SNP 60% 83 s32 REF, SNP 65% 84 s32 REF, SNP 60% 85 s33 REF, SNP 40% 86 s34 REF, SNP 40% 87 s34 REF, SNP 40% 88 s34 REF, SNP 40% 89 s34 REF, SNP 45% 90 s34 REF, SNP 45% 91 s34 REF, SNP 40% 92 s34 REF, SNP 45% 93 s34 REF, SNP 40% 94 s34 REF, SNP 40% 95 s34 REF, SNP 45% 96 s34 REF, SNP 40% 97 s34 REF, SNP 45% 98 s34 REF, SNP 40% 99 s34 REF, SNP 40% 100 s34 REF, SNP 40% 101 s35, s1 REF, REF, SNP 65% 102 s35, s1 REF, REF, SNP 60% 103 s35, s1 REF, REF, SNP 65% 104 s35, s1 REF, REF, SNP 70% 105 s35, s1 REF, REF, SNP 65% 106 s35, s1 REF, REF, SNP 60% 107 s35, s1 REF, REF, SNP 65% 108 s35, s1 REF, REF, SNP 65% 109 s35, s1 REF, REF, SNP 65% 110 s35 REF, SNP 65% 111 s36 REF, SNP 60% 112 s37 REF, SNP 50% 113 s37 REF, SNP 55% 114 s37 REF, SNP 60% 115 s38 REF, SNP 65% 116 s38 REF, SNP 70% 117 s38 REF, SNP 70% 118 s2 REF 50% 119 s2 SNP 55% 120 s2 SNP 50% 121 s2 SNP 60% 122 s2 REF 55% 123 s2 REF 55% 124 s2 SNP 60% 125 s2 SNP 60% 126 s2 SNP 60% 127 s2 SNP 55% 128 s2 REF 55% 129 s2 SNP 60% 130 s2 SNP 55% 131 s2 REF 50% 132 s2 REF 50% 133 s2 SNP 55% 134 s2 SNP 60% 135 s2 REF 60% 136 s2 SNP 65% 137 s2 SNP 60% 138 s2 REF 55% 139 s2 SNP 60% 140 s2 SNP 60% 141 s2 SNP 55% 142 s2 SNP 55% 143 s2 REF 50% 144 s2 REF 50% 145 s2 SNP 55% 146 s2 SNP 50% 147 s4 SNP 70% 148 s4 SNP 60% 149 s4 SNP 65% 150 s4 REF 60% 151 s4 SNP 65% 152 s4 REF 65% 153 s4 SNP 70% 154 s4 SNP 65% 155 s4 SNP 65% 156 s4 REF 60% 157 s4 REF 60% 158 s4 SNP 65% 159 s4 SNP 65% 160 s4 SNP 65% 161 s4 REF 60% 162 s4 SNP 65% 163 s4 REF 60% 164 s5 REF 45% 165 s5 SNP 45% 166 s5 REF 55% 167 s5 SNP 55% 168 s5 REF 50% 169 s5 SNP 50% 170 s5 REF 40% 171 s5 SNP 40% 172 s5 REF 55% 173 s5 REF 55% 174 s5 SNP 55% 175 s5 REF 55% 176 s5 SNP 55% 177 s5 SNP 55% 178 s5 REF 55% 179 s5 SNP 60% 180 s5 REF 60% 181 s5 REF 55% 182 s5 SNP 55% 183 s5 REF 60% 184 s5 SNP 40% 185 s5 SNP 50% 186 s5 REF 50% 187 s5 REF 65% 188 s5 SNP 45% 189 s5 SNP 65% 190 s5 REF 45% 191 s5 SNP 60% 192 s5 REF 40% 193 s5 SNP 55% 194 s6 SNP 60% 195 s6 SNP 60% 196 s6 SNP 60% 197 s6 SNP 55% 198 s6 SNP 55% 199 s6 SNP 55% 200 s6 SNP 60% 201 s7 REF 70% 202 s7 SNP 75% 203 s7 REF 65% 204 s7 SNP 70% 205 s7 REF 70% 206 s7 REF 65% 207 s7 SNP 70% 208 s7 SNP 80% 209 s7 REF 75% 210 s7 SNP 75% 211 s7 REF 70% 212 s7 SNP 75% 213 s7 REF 75% 214 s7 SNP 80% 215 s7 REF 65% 216 s7 SNP 70% 217 s7 SNP 75% 218 s7 REF 70% 219 s7 REF 60% 220 s7 SNP 65% 221 s7 REF 70% 222 s7 SNP 75% 223 s8 SNP 60% 224 s8 REF 55% 225 s8 SNP 55% 226 s8 REF 50% 227 s8 SNP 65% 228 s8 REF 60% 229 s8 SNP 65% 230 s8 REF 50% 231 s8 SNP 55% 232 s8 SNP 70% 233 s8 REF 65% 234 s8 REF 50% 235 s8 SNP 55% 236 s8 REF 55% 237 s8 SNP 60% 238 s8 SNP 55% 239 s8 REF 50% 240 s8 REF 60% 241 s8 SNP 65% 242 s8 REF 60% 243 s9 REF 40% 244 s9 SNP 60% 245 s9 SNP 45% 246 s9 REF 55% 247 s9 REF 40% 248 s9 SNP 45% 249 s9 SNP 65% 250 s9 REF 60% 251 s9 SNP 60% 252 s9 REF 55% 253 s9 SNP 55% 254 s9 REF 50% 255 s9 REF 60% 256 s9 SNP 65% 257 s9 REF 50% 258 s9 SNP 55% 259 s9 REF 40% 260 s9 SNP 45% 261 s9 REF 55% 262 s9 SNP 60% 263 s9 REF 60% 264 s9 SNP 65% 265 s9 REF 55% 266 s9 SNP 60% 267 s9 REF 50% 268 s9 SNP 55% 269 s10 SNP 55% 270 s10 REF 60% 271 s10 SNP 60% 272 s10 REF 65% 273 s10 SNP 55% 274 s10 REF 60% 275 s10 REF 65% 276 s10 SNP 60% 277 s10 REF 60% 278 s10 SNP 55% 279 s10 SNP 60% 280 s10 REF 65% 281 s10 REF 65% 282 s10 SNP 60% 283 s10 REF 65% 284 s10 SNP 60% 285 s10 REF 55% 286 s10 REF 60% 287 s10 REF 65% 288 s10 SNP 60% 289 s10 REF 65% 290 s10 SNP 60% 291 s10 SNP 55% 292 s10 SNP 50% 293 s10 REF 55% 294 s10 SNP 50% 295 s10 REF 65% 296 s10 SNP 60% 297 s11 REF 70% 298 s11 SNP 65% 299 s11 SNP 65% 300 s11 REF 80% 301 s11 REF 70% 302 s11 SNP 65% 303 s11 SNP 75% 304 s11 REF 75% 305 s11 SNP 70% 306 s11 SNP 75% 307 s11 REF 80% 308 s11 REF 70% 309 s11 SNP 65% 310 s11 REF 70% 311 s11 REF 75% 312 s11 SNP 70% 313 s11 REF 75% 314 s11 SNP 70% 315 s11 REF 65% 316 s11 SNP 60% 317 s11 REF 70% 318 s11 SNP 65% 319 s12 SNP 70% 320 s12 REF 65% 321 s12 SNP 70% 322 s12 REF 65% 323 s12 SNP 70% 324 s12 REF 65% 325 s12 REF 70% 326 s12 SNP 75% 327 s12 REF 70% 328 s12 SNP 75% 329 s12 REF 70% 330 s12 SNP 75% 331 s12 SNP 80% 332 s12 REF 75% 333 s12 SNP 75% 334 s12 REF 70% 335 s12 SNP 75% 336 s12 REF 70% 337 s12 SNP 70% 338 s12 SNP 70% 339 s12 REF 65% 340 s12 SNP 70% 341 s12 REF 65% 342 s12 SNP 70% 343 s12 REF 65% 344 s12 SNP 70% 345 s12 REF 65% 346 s12 REF 70% 347 s12 SNP 75% 348 s12 REF 70% 349 s12 SNP 75% 350 s12 REF 70% 351 s12 SNP 75% 352 s12 REF 65% 353 s3 SNP 60% 354 s3 SNP 60% 355 s3 SNP 60% 356 s3 SNP 50% 357 s3 SNP 60% 358 s3 SNP 60% 359 s3 REF 70% 360 s3 SNP 75% 361 s3 SNP 75% 362 s3 REF 70% 363 s3 SNP 65% 364 s3 REF 60% 365 s3 SNP 50% 366 s13 SNP 55% 367 s13 REF 60% 368 s13 SNP 45% 369 s13 REF 50% 370 s13 REF 50% 371 s13 SNP 45% 372 s13 REF 50% 373 s13 SNP 45% 374 s13 SNP 55% 375 s13 REF 60% 376 s13 SNP 60% 377 s13 SNP 55% 378 s13 SNP 55% 379 s13 SNP 65% 380 s13 REF 70% 381 s13 SNP 45% 382 s13 REF 50% 383 s13 REF 50% 384 s13 SNP 45% 385 s13 SNP 50% 386 s15 SNP 50% 387 s15 REF 55% 388 s15 SNP 45% 389 s15 REF 50% 390 s15 REF 55% 391 s15 SNP 50% 392 s15 SNP 50% 393 s15 REF 55% 394 s15 SNP 50% 395 s15 REF 55% 396 s15 SNP 50% 397 s15 REF 55% 398 s15 SNP 50% 399 s15 REF 55% 400 s15 SNP 55% 401 s15 REF 60% 402 s15 REF 50% 403 s15 SNP 45% 404 s15 SNP 50% 405 s15 REF 55% 406 s15 REF 50% 407 s15 SNP 45% 408 s15 REF 55% 409 s15 SNP 50% 410 s15 REF 50% 411 s15 SNP 45% 412 s16 SNP 55% 413 s16 REF 50% 414 s16 SNP 65% 415 s16 REF 60% 416 s16 REF 60% 417 s16 SNP 65% 418 s16 SNP 60% 419 s16 SNP 60% 420 s16 REF 55% 421 s16 REF 55% 422 s16 SNP 60% 423 s16 SNP 65% 424 s16 REF 60% 425 s16 REF 50% 426 s16 SNP 55% 427 s16 REF 55% 428 s16 REF 55% 429 s16 SNP 60% 430 s16 SNP 60% 431 s16 REF 55% 432 s16 SNP 60% 433 s16 REF 55% 434 s16 SNP 60% 435 s16 REF 55% 436 s16 REF 55% 437 s16 SNP 60% 438 s39 SNP 45% 439 s39 SNP 45% 440 s39 SNP 45% 441 s39 SNP 45% 442 s39 SNP 45% 443 s39 SNP 45% 444 s39 SNP 45% 445 s39 SNP 45% 446 s39 SNP 45% 447 s39 SNP 45% 448 s39 SNP 45% 449 s39 SNP 45% 450 s39 SNP 45% 451 s39 SNP 45% 452 s39 SNP 45% 453 s39 SNP 45% 454 s39 SNP 45% 455 s17 REF 40% 456 s17 SNP 45% 457 s17 SNP 45% 458 s17 REF 40% 459 s17 REF 40% 460 s17 SNP 45% 461 s17 SNP 50% 462 s17 SNP 55% 463 s19 REF 60% 464 s19 SNP 55% 465 s19 REF 60% 466 s19 SNP 55% 467 s19 SNP 55% 468 s19 REF 60% 469 s19 SNP 55% 470 s19 REF 60% 471 s19 SNP 60% 472 s19 REF 65% 473 s19 SNP 60% 474 s19 REF 65% 475 s19 SNP 55% 476 s19 REF 60% 477 s19 REF 65% 478 s19 SNP 60% 479 s19 REF 65% 480 s19 SNP 60% 481 s19 REF 65% 482 s19 SNP 60% 483 s19 SNP 60% 484 s19 REF 65% 485 s19 SNP 65% 486 s19 SNP 60% 487 s19 REF 65% 488 s19 SNP 60% 489 s19 REF 65% 490 s19 SNP 55% 491 s19 REF 60% 492 s19 SNP 60% 493 s19 REF 65% 494 s19 REF 70% 495 s19 SNP 55% 496 s19 REF 60% 497 s19 SNP 60% 498 s19 REF 65% 499 s20 REF 65% 500 s20 SNP 60% 501 s20 REF 80% 502 s20 SNP 75% 503 s20 REF 75% 504 s20 SNP 70% 505 s20 SNP 55% 506 s20 SNP 75% 507 s20 REF 80% 508 s20 SNP 65% 509 s20 REF 70% 510 s20 SNP 65% 511 s20 REF 70% 512 s20 REF 60% 513 s20 REF 70% 514 s20 SNP 65% 515 s20 REF 70% 516 s20 SNP 65% 517 s20 REF 55% 518 s20 SNP 50% 519 s20 REF 80% 520 s20 SNP 75% 521 s20 REF 80% 522 s20 SNP 75% 523 s20 SNP 65% 524 s20 REF 70% 525 s20 REF 85% 526 s20 SNP 80% 527 s20 REF 70% 528 s20 SNP 65% 529 s20 REF 70% 530 s20 SNP 65% 531 s21 SNP 65% 532 s21 SNP 60% 533 s21 REF 65% 534 s21 REF 70% 535 s21 SNP 55% 536 s21 REF 60% 537 s21 REF 65% 538 s21 SNP 60% 539 s21 REF 55% 540 s21 REF 55% 541 s21 REF 65% 542 s21 SNP 60% 543 s21 REF 60% 544 s21 REF 65% 545 s21 SNP 60% 546 s21 SNP 55% 547 s21 SNP 50% 548 s21 SNP 50% 549 s21 SNP 55% 550 s21 REF 60% 551 s21 REF 60% 552 s21 SNP 55% 553 s21 REF 65% 554 s21 SNP 60% 555 s22 SNP 45% 556 s22 REF 50% 557 s22 SNP 50% 558 s22 REF 55% 559 s22 SNP 45% 560 s22 REF 50% 561 s22 REF 50% 562 s22 SNP 45% 563 s22 REF 60% 564 s22 SNP 50% 565 s22 REF 55% 566 s22 SNP 55% 567 s22 SNP 60% 568 s22 REF 65% 569 s22 REF 50% 570 s22 SNP 45% 571 s22 REF 55% 572 s22 SNP 50% 573 s23 SNP 50% 574 s23 REF 55% 575 s23 SNP 50% 576 s23 REF 55% 577 s23 REF 60% 578 s23 SNP 55% 579 s23 REF 60% 580 s23 SNP 55% 581 s23 SNP 50% 582 s23 REF 55% 583 s23 REF 60% 584 s23 SNP 55% 585 s23 SNP 50% 586 s23 REF 55% 587 s23 REF 60% 588 s23 SNP 55% 589 s23 SNP 55% 590 s23 REF 60% 591 s23 SNP 55% 592 s23 SNP 50% 593 s23 REF 55% 594 s23 REF 60% 595 s24 REF 50% 596 s24 SNP 45% 597 s24 REF 45% 598 s24 SNP 40% 599 s24 REF 35% 600 s24 SNP 30% 601 s24 REF 55% 602 s24 SNP 50% 603 s14 SNP 55% 604 s14 SNP 50% 605 s14 REF 55% 606 s14 SNP 50% 607 s14 REF 55% 608 s14 SNP 50% 609 s14 REF 55% 610 s14 SNP 50% 611 s14 REF 55% 612 s14 SNP 55% 613 s14 REF 65% 614 s14 SNP 60% 615 s14 REF 65% 616 s14 SNP 60% 617 s14 SNP 50% 618 s14 REF 60% 619 s14 SNP 55% 620 s25 REF 60% 621 s25 SNP 55% 622 s25 REF 50% 623 s25 SNP 45% 624 s25 REF 60% 625 s25 SNP 55% 626 s25 REF 65% 627 s25 SNP 60% 628 s25 REF 55% 629 s25 SNP 50% 630 s25 REF 75% 631 s25 SNP 70% 632 s25 REF 75% 633 s25 SNP 70% 634 s26 REF 50% 635 s26 SNP 55% 636 s26 REF 50% 637 s26 SNP 55% 638 s26 REF 50% 639 s26 REF 55% 640 s26 SNP 60% 641 s26 REF 50% 642 s26 SNP 55% 643 s26 SNP 55% 644 s26 REF 50% 645 s26 SNP 55% 646 s26 SNP 55% 647 s26 REF 50% 648 s26 REF 55% 649 s26 SNP 60% 650 s26 SNP 55% 651 s26 REF 50% 652 s26 SNP 55% 653 s26 REF 50% 654 s27 REF 55% 655 s27 SNP 50% 656 s27 REF 60% 657 s27 SNP 55% 658 s27 REF 65% 659 s27 SNP 60% 660 s27 REF 60% 661 s27 SNP 55% 662 s27 SNP 55% 663 s27 REF 60% 664 s27 REF 55% 665 s27 SNP 50% 666 s27 REF 55% 667 s27 SNP 50% 668 s27 SNP 50% 669 s27 REF 55% 670 s18 REF 50% 671 s18 REF 50% 672 s18 SNP 50% 673 s18 SNP 50% 674 s18 SNP 50% 675 s18 REF 50% 676 s18 SNP 55% 677 s18 REF 55% 678 s18 SNP 45% 679 s18 REF 50% 680 s18 SNP 50% 681 s18 REF 55% 682 s18 SNP 55% 683 s18 REF 50% 684 s18 SNP 50% 685 s18 REF 50% 686 s18 SNP 50% 687 s18 SNP 50% 688 s28 SNP 50% 689 s28 REF 45% 690 s28 SNP 70% 691 s28 REF 65% 692 s28 SNP 70% 693 s28 REF 55% 694 s28 SNP 60% 695 s28 SNP 70% 696 s28 REF 65% 697 s28 REF 65% 698 s28 REF 45% 699 s28 SNP 50% 700 s29 SNP 40% 701 s29 REF 50% 702 s29 SNP 45% 703 s29 REF 50% 704 s29 SNP 45% 705 s29 REF 50% 706 s29 REF 50% 707 s29 SNP 45% 708 s29 SNP 45% 709 s29 REF 50% 710 s29 SNP 45% 711 s29 REF 45% 712 s29 REF 50% 713 s29 SNP 40% 714 s29 REF 45% 715 s29 SNP 45% 716 s29 REF 50% 717 s29 SNP 45% 718 s29 REF 45% 719 s29 SNP 40% 720 s31 REF 65% 721 s31 SNP 60% 722 s31 REF 60% 723 s31 SNP 55% 724 s31 SNP 60% 725 s31 SNP 55% 726 s31 REF 60% 727 s31 REF 65% 728 s31 SNP 60% 729 s31 SNP 60% 730 s31 REF 65% 731 s31 REF 70% 732 s31 SNP 65% 733 s31 REF 65% 734 s31 REF 60% 735 s31 SNP 55% 736 s31 SNP 55% 737 s31 REF 60% 738 s32 REF 45% 739 s32 SNP 50% 740 s32 REF 55% 741 s32 SNP 60% 742 s32 REF 55% 743 s32 SNP 60% 744 s32 REF 50% 745 s32 SNP 55% 746 s32 SNP 45% 747 s32 REF 40% 748 s32 SNP 60% 749 s32 REF 55% 750 s32 REF 55% 751 s32 SNP 60% 752 s32 SNP 50% 753 s32 REF 45% 754 s32 REF 55% 755 s32 SNP 60% 756 s32 REF 55% 757 s32 SNP 60% 758 s32 REF 60% 759 s32 SNP 65% 760 s32 REF 45% 761 s32 SNP 50% 762 s32 SNP 65% 763 s32 SNP 50% 764 s32 REF 45% 765 s32 REF 60% 766 s33 REF 35% 767 s33 SNP 30% 768 s33 REF 40% 769 s33 SNP 35% 770 s33 REF 40% 771 s33 SNP 35% 772 s33 SNP 35% 773 s33 REF 40% 774 s33 SNP 35% 775 s33 REF 40% 776 s33 REF 40% 777 s33 SNP 35% 778 s33 REF 30% 779 s33 REF 30% 780 s33 REF 40% 781 s33 SNP 35% 782 s33 SNP 35% 783 s33 REF 40% 784 s35 SNP 60% 785 s35 SNP 55% 786 s35 SNP 60% 787 s35 SNP 65% 788 s35 SNP 60% 789 s35 SNP 55% 790 s35 SNP 60% 791 s35 SNP 60% 792 s35 SNP 60% 793 s36 REF 35% 794 s36 SNP 40% 795 s36 SNP 55% 796 s36 REF 50% 797 s36 REF 50% 798 s36 SNP 55% 799 s36 SNP 55% 800 s36 REF 50% 801 s36 SNP 55% 802 s36 REF 50% 803 s37 REF 55% 804 s37 SNP 55% 805 s37 REF 50% 806 s37 SNP 50% 807 s37 REF 55% 808 s37 SNP 55% 809 s37 SNP 50% 810 s37 REF 50% 811 s37 SNP 50% 812 s37 REF 50% 813 s37 SNP 50% 814 s37 REF 55% 815 s37 REF 50% 816 s37 SNP 55% 817 s37 SNP 55% 818 s37 REF 55% 819 s37 REF 50% 820 s37 SNP 50% 821 s37 REF 50% 822 s37 SNP 50% 823 s37 REF 55% 824 s37 SNP 55% 825 s37 REF 60% 826 s37 REF 45% 827 s37 SNP 45% 828 s37 SNP 60% 829 s38 REF 65% 830 s38 SNP 60% 831 s38 REF 70% 832 s38 SNP 65% 833 s38 SNP 65% 834 s38 REF 70% 835 s38 REF 70% 836 s38 SNP 65% 837 s38 SNP 60% 838 s38 REF 65% 839 s1 REF, SNP 40% 840 s1 REF, SNP 40% 841 s1 REF, SNP 45% 842 s1 REF, SNP 45% 843 s1 REF, SNP 55% 844 s1 REF, SNP 55% 845 s1 REF, SNP 50% 846 s1 REF, SNP 55% 847 s1 REF, SNP 50% 848 s1 REF, SNP 50% 849 s1 REF, SNP 50% 850 s1 REF, SNP 50% 851 s2 REF, SNP 60% 852 s2 REF, SNP 60% 853 s2 REF, SNP 60% 854 s2, s3 REF, REF, SNP 60% 855 s2, s3 REF, REF, SNP 65% 856 s2, s3 REF, REF, SNP 65% 857 s2, s3 REF, REF, SNP 70% 858 s2, s3 REF, REF, SNP 50% 859 s2, s3 REF, REF, SNP 50% 860 s2, s3 REF, REF 50% 861 s2, s3 REF, REF 55% 862 s2, s3 REF, REF 55% 863 s2, s3 REF, REF 55% 864 s2, s3 REF, REF 55% 865 s2, s3 REF, REF 55% 866 s2, s3 REF, REF 50% 867 s4 REF, SNP 60% 868 s4 REF, SNP 60% 869 s4 REF, SNP 60% 870 s4 REF, SNP 60% 871 s5 REF, SNP 45% 872 s5 REF, SNP 60% 873 s5 REF, SNP 45% 874 s5 REF, SNP 60% 875 s5 REF, SNP 45% 876 s5 REF, SNP 60% 877 s6 REF, SNP 55% 878 s6 REF, SNP 55% 879 s7 REF, SNP 55% 880 s7 REF, SNP 65% 881 s7 REF, SNP 60% 882 s7 REF, SNP 70% 883 s8 REF, SNP 65% 884 s8 REF, SNP 65% 885 s8 REF, SNP 60% 886 s8 REF, SNP 65% 887 s8 REF, SNP 70% 888 s8 REF, SNP 60% 889 s9 REF, SNP 55% 890 s9 REF, SNP 40% 891 s9 REF, SNP 55% 892 s9 REF, SNP 40% 893 s9 REF, SNP 45% 894 s10 REF, SNP 55% 895 s10 REF, SNP 55% 896 s10 REF, SNP 60% 897 s10 REF, SNP 55% 898 s10 REF, SNP 55% 899 s10 REF, SNP 60% 900 s11 REF, SNP 70% 901 s11 REF, SNP 65% 902 s11 REF, SNP 75% 903 s11 REF, SNP 70% 904 s11 REF, SNP 65% 905 s11 REF, SNP 65% 906 s12 REF, SNP 70% 907 s12 REF, SNP 60% 908 s12 REF, SNP 75% 909 s12 REF, SNP 75% 910 s12 REF, SNP 65% 911 s12 REF, SNP 55% 912 s3 REF, SNP 75% 913 s3 REF, SNP 70% 914 s13 REF, SNP 60% 915 s13 REF, SNP 65% 916 s13, s14 REF, REF, SNP 65% 917 s13, s14 REF, REF, SNP 60% 918 s13, s14 REF, REF, SNP 65% 919 s13, s14 REF, REF, SNP 60% 920 s13, s14 REF, REF, SNP 65% 921 s13, s14 REF, REF, SNP 60% 922 s13, s14 REF, REF, SNP 70% 923 s13, s14 REF, REF 60% 924 s13, s14 REF, REF 65% 925 s13, s14 REF, REF 65% 926 s13, s14 REF, REF 65% 927 s13, s14 REF, REF 65% 928 s13, s14 REF, REF 60% 929 s13, s14 REF, REF 55% 930 s15 REF, SNP 55% 931 s15 REF, SNP 50% 932 s15 REF, SNP 55% 933 s15 REF, SNP 55% 934 s15 REF, SNP 55% 935 s15 REF, SNP 55% 936 s16 REF, SNP 60% 937 s16 REF, SNP 60% 938 s16 REF, SNP 60% 939 s16 REF, SNP 60% 940 s16 REF, SNP 55% 941 s16 REF, SNP 60% 942 s16 REF, SNP 65% 943 s16 REF, SNP 60% 944 s17 REF, SNP 40% 945 s17 REF, SNP 40% 946 s17, s18 REF, REF, SNP 50% 947 s17, s18 REF, REF, SNP 50% 948 s17, s18 REF, REF, SNP 50% 949 s17, s18 REF, REF, SNP 55% 950 s17, s18 REF, REF, SNP 40% 951 s17, s18 REF, REF, SNP 45% 952 s17, s18 REF, REF, SNP 45% 953 s17, s18 REF, REF, SNP 40% 954 s17, s18 REF, REF 40% 955 s17, s18 REF, REF 45% 956 s17, s18 REF, REF 45% 957 s17, s18 REF, REF 45% 958 s17, s18 REF, REF 45% 959 s17, s18 REF, REF 50% 960 s17, s18 REF, REF 50% 961 s17, s18 REF, REF 45% 962 s17, s18 REF, REF 50% 963 s17, s18 REF, REF 50% 964 s17, s18 REF, REF 50% 965 s17, s18 REF, REF 50% 966 s17, s18 REF, REF 55% 967 s17, s18 REF, REF 55% 968 s17, s18 REF, REF 50% 969 s17, s18 REF, REF 40% 970 s17, s18 REF, REF 45% 971 s17, s18 REF, REF 45% 972 s19 REF, SNP 65% 973 s19 REF, SNP 65% 974 s19 REF, SNP 70% 975 s19 REF, SNP 65% 976 s19 REF, SNP 60% 977 s19 REF, SNP 60% 978 s20 REF, SNP 90% 979 s20 REF, SNP 60% 980 s20 REF, SNP 90% 981 s20 REF, SNP 95% 982 s20 REF, SNP 55% 983 s20 REF, SNP 85% 984 s21 REF, SNP 60% 985 s21 REF, SNP 55% 986 s21 REF, SNP 65% 987 s21 REF, SNP 65% 988 s21 REF, SNP 70% 989 s22 REF, SNP 50% 990 s22 REF, SNP 55% 991 s22 REF, SNP 55% 992 s22 REF, SNP 55% 993 s22 REF, SNP 60% 994 s23 REF, SNP 65% 995 s23 REF, SNP 60% 996 s23 REF, SNP 65% 997 s23 REF, SNP 65% 998 s23 REF, SNP 55% 999 s24 REF, SNP 50% 1000 s24 REF, SNP 30% 1001 s24 REF, SNP 35% 1002 s24 REF, SNP 30% 1003 s24 REF, SNP 55% 1004 s24 REF, SNP 35% 1005 s24 REF, SNP 50% 1006 s14 REF, SNP 55% 1007 s14 REF, SNP 55% 1008 s14 REF, SNP 50% 1009 s25 REF, SNP 70% 1010 s25 REF, SNP 55% 1011 s25 REF, SNP 75% 1012 s25 REF, SNP 55% 1013 s25 REF, SNP 75% 1014 s25 REF, SNP 55% 1015 s26 REF, SNP 50% 1016 s26 REF, SNP 55% 1017 s26 REF, SNP 60% 1018 s26 REF, SNP 55% 1019 s27 REF, SNP 35% 1020 s27 REF, SNP 40% 1021 s27 REF, SNP 50% 1022 s27 REF, SNP 35% 1023 s27 REF, SNP 45% 1024 s18 REF, SNP 55% 1025 s18 REF, SNP 55% 1026 s28 REF, SNP 60% 1027 s28 REF, SNP 30% 1028 s28 REF, SNP 35% 1029 s28 REF, SNP 35% 1030 s29 REF, SNP 40% 1031 s29 REF, SNP 45% 1032 s29 REF, SNP 40% 1033 s29 REF, SNP 35% 1034 s29 REF, SNP 40% 1035 s30 REF, SNP 30% 1036 s30 REF, SNP 40% 1037 s30 REF, SNP 30% 1038 s30 REF, SNP 50% 1039 s30 REF, SNP 45% 1040 s30 REF, SNP 30% 1041 s31 REF, SNP 65% 1042 s31 REF, SNP 70% 1043 s31 REF, SNP 60% 1044 s31 REF, SNP 70% 1045 s31 REF, SNP 65% 1046 s31 REF, SNP 70% 1047 s32 REF, SNP 55% 1048 s32 REF, SNP 55% 1049 s32 REF, SNP 55% 1050 s32 REF, SNP 65% 1051 s32 REF, SNP 55% 1052 s33 REF, SNP 35% 1053 s33 REF, SNP 40% 1054 s33 REF, SNP 40% 1055 s33 REF, SNP 40% 1056 s33 REF, SNP 45% 1057 s33 REF, SNP 50% 1058 s33 REF, SNP 35% 1059 s34 REF, SNP 35% 1060 s34 REF, SNP 40% 1061 s34 REF, SNP 35% 1062 s34 REF, SNP 45% 1063 s34 REF, SNP 40% 1064 s34 REF, SNP 40% 1065 s34 REF, SNP 45% 1066 s34 REF, SNP 45% 1067 s34 REF, SNP 45% 1068 s34 REF, SNP 40% 1069 s34 REF, SNP 40% 1070 s34 REF, SNP 40% 1071 s34 REF, SNP 40% 1072 s34 REF, SNP 40% 1073 s34 REF, SNP 45% 1074 s34 REF, SNP 40% 1075 s34 REF, SNP 35% 1076 s34 REF, SNP 40% 1077 s34 REF, SNP 35% 1078 s34 REF, SNP 40% 1079 s34 REF, SNP 40% 1080 s34 REF, SNP 40% 1081 s35, s1 REF, REF, SNP 60% 1082 s35, s1 REF, REF, SNP 60% 1083 s35, s1 REF, REF, SNP 65% 1084 s35, s1 REF, REF, SNP 50% 1085 s35, s1 REF, REF, SNP 60% 1086 s35, s1 REF, REF, SNP 65% 1087 s35, s1 REF, REF, SNP 70% 1088 s35, s1 REF, REF, SNP 60% 1089 s35, s1 REF, REF, SNP 55% 1090 s35, s1 REF, REF, SNP 65% 1091 s35, s1 REF, REF, SNP 60% 1092 s35, s1 REF, REF, SNP 70% 1093 s35, s1 REF, REF, SNP 70% 1094 s35, s1 REF, REF, SNP 60% 1095 s35, s1 REF, REF, SNP 65% 1096 s35, s1 REF, REF, SNP 60% 1097 s35, s1 REF, REF, SNP 65% 1098 s35, s1 REF, REF, SNP 65% 1099 s35, s1 REF, REF, SNP 60% 1100 s35, s1 REF, REF, SNP 55% 1101 s35, s1 REF, REF, SNP 50% 1102 s35, s1 REF, REF, SNP, SNP 55% 1103 s35, s1 REF, REF, SNP, SNP 50% 1104 s35, s1 REF, REF, SNP, SNP 50% 1105 s35, s1 REF, REF, SNP, SNP 45% 1106 s35 REF, SNP 70% 1107 s35 REF, SNP 70% 1108 s35 REF, SNP 65% 1109 s36 REF, SNP 65% 1110 s36 REF, SNP 35% 1111 s36 REF, SNP 35% 1112 s36 REF, SNP 40% 1113 s36 REF, SNP 65% 1114 s37 REF, SNP 45% 1115 s37 REF, SNP 60% 1116 s37 REF, SNP 60% 1117 s37 REF, SNP 55% 1118 s37 REF, SNP 55% 1119 s38 REF, SNP 60% 1120 s38 REF, SNP 65% 1121 s38 REF, SNP 65% 1122 s38 REF, SNP 65% 1123 s38 REF, SNP 65% 1124 s2 SNP 55% 1125 s2 SNP 55% 1126 s2 SNP 55% 1127 s2 REF 50% 1128 s2 REF 50% 1129 s2 SNP 55% 1130 s2 SNP 55% 1131 s2 SNP 60% 1132 s2 REF 55% 1133 s2 SNP 55% 1134 s2 SNP 60% 1135 s2 REF 50% 1136 s2 SNP 60% 1137 s2 SNP 60% 1138 s2 SNP 60% 1139 s2 SNP 60% 1140 s2 SNP 65% 1141 s2 REF 60% 1142 s2 SNP 60% 1143 s2 REF 55% 1144 s2 SNP 55% 1145 s2 REF 50% 1146 s2 SNP 60% 1147 s2 REF 55% 1148 s2 SNP 60% 1149 s2 REF 50% 1150 s2 SNP 55% 1151 s2 SNP 55% 1152 s2 REF 50% 1153 s2 SNP 55% 1154 s2 REF 50% 1155 s2 SNP 55% 1156 s2 REF 55% 1157 s4 SNP 65% 1158 s4 REF 60% 1159 s4 REF 60% 1160 s4 SNP 70% 1161 s4 SNP 65% 1162 s4 REF 60% 1163 s4 SNP 65% 1164 s4 SNP 70% 1165 s4 SNP 65% 1166 s4 SNP 65% 1167 s4 SNP 60% 1168 s4 SNP 65% 1169 s4 REF 60% 1170 s4 SNP 65% 1171 s4 REF 60% 1172 s4 SNP 70% 1173 s4 SNP 70% 1174 s4 REF 60% 1175 s4 SNP 75% 1176 s4 REF 65% 1177 s4 SNP 70% 1178 s4 SNP 70% 1179 s4 SNP 65% 1180 s4 REF 65% 1181 s4 SNP 70% 1182 s4 SNP 65% 1183 s4 SNP 70% 1184 s4 SNP 60% 1185 s4 SNP 70% 1186 s4 REF 55% 1187 s4 REF 55% 1188 s4 SNP 60% 1189 s4 SNP 70% 1190 s4 SNP 65% 1191 s4 SNP 70% 1192 s5 SNP 40% 1193 s5 SNP 45% 1194 s5 REF 45% 1195 s5 REF 60% 1196 s5 SNP 60% 1197 s5 SNP 55% 1198 s5 REF 55% 1199 s5 REF 45% 1200 s5 SNP 45% 1201 s5 REF 50% 1202 s5 SNP 50% 1203 s5 REF 40% 1204 s5 SNP 40% 1205 s5 REF 60% 1206 s5 SNP 60% 1207 s5 SNP 55% 1208 s5 REF 55% 1209 s5 SNP 60% 1210 s5 REF 60% 1211 s5 SNP 65% 1212 s5 REF 65% 1213 s5 SNP 60% 1214 s5 REF 60% 1215 s5 SNP 55% 1216 s5 REF 55% 1217 s5 SNP 50% 1218 s5 REF 50% 1219 s5 SNP 50% 1220 s5 REF 50% 1221 s5 REF 50% 1222 s5 SNP 50% 1223 s5 REF 60% 1224 s5 SNP 60% 1225 s5 REF 45% 1226 s5 SNP 45% 1227 s5 REF 60% 1228 s5 SNP 60% 1229 s5 SNP 60% 1230 s5 REF 60% 1231 s5 SNP 60% 1232 s5 REF 60% 1233 s5 REF 40% 1234 s5 SNP 50% 1235 s5 REF 50% 1236 s5 REF 50% 1237 s5 SNP 50% 1238 s5 SNP 55% 1239 s5 REF 55% 1240 s5 SNP 45% 1241 s5 REF 45% 1242 s6 SNP 55% 1243 s6 SNP 50% 1244 s6 SNP 50% 1245 s6 SNP 55% 1246 s6 SNP 50% 1247 s6 SNP 60% 1248 s6 REF 65% 1249 s6 REF 60% 1250 s6 SNP 55% 1251 s6 SNP 55% 1252 s6 SNP 55% 1253 s6 REF 65% 1254 s6 REF 60% 1255 s6 SNP 60% 1256 s6 SNP 55% 1257 s6 SNP 60% 1258 s6 SNP 55% 1259 s6 SNP 55% 1260 s6 SNP 50% 1261 s7 SNP 80% 1262 s7 REF 75% 1263 s7 REF 70% 1264 s7 REF 70% 1265 s7 SNP 75% 1266 s7 REF 70% 1267 s7 SNP 75% 1268 s7 SNP 75% 1269 s7 REF 70% 1270 s7 SNP 75% 1271 s7 REF 70% 1272 s7 SNP 75% 1273 s7 SNP 65% 1274 s7 REF 70% 1275 s7 SNP 75% 1276 s7 REF 70% 1277 s7 REF 70% 1278 s7 SNP 75% 1279 s7 SNP 70% 1280 s7 REF 65% 1281 s7 SNP 80% 1282 s7 REF 75% 1283 s7 REF 70% 1284 s7 SNP 75% 1285 s7 REF 70% 1286 s7 SNP 75% 1287 s7 REF 70% 1288 s7 SNP 75% 1289 s7 SNP 70% 1290 s7 SNP 75% 1291 s7 SNP 80% 1292 s7 REF 75% 1293 s7 REF 75% 1294 s7 SNP 80% 1295 s7 SNP 75% 1296 s7 REF 70% 1297 s7 SNP 80% 1298 s7 REF 75% 1299 s7 REF 75% 1300 s7 SNP 80% 1301 s7 REF 75% 1302 s7 SNP 80% 1303 s7 SNP 75% 1304 s7 REF 70% 1305 s7 REF 65% 1306 s7 REF 70% 1307 s7 SNP 75% 1308 s7 SNP 75% 1309 s7 REF 70% 1310 s7 SNP 75% 1311 s7 REF 70% 1312 s7 REF 60% 1313 s7 REF 70% 1314 s7 SNP 75% 1315 s7 REF 75% 1316 s7 SNP 80% 1317 s7 SNP 70% 1318 s7 REF 65% 1319 s8 REF 50% 1320 s8 REF 60% 1321 s8 SNP 65% 1322 s8 SNP 60% 1323 s8 REF 55% 1324 s8 SNP 50% 1325 s8 REF 45% 1326 s8 REF 55% 1327 s8 SNP 60% 1328 s8 REF 60% 1329 s8 SNP 65% 1330 s8 REF 50% 1331 s8 SNP 55% 1332 s8 REF 60% 1333 s8 SNP 65% 1334 s8 SNP 65% 1335 s8 REF 60% 1336 s8 REF 50% 1337 s8 REF 60% 1338 s8 SNP 65% 1339 s8 REF 60% 1340 s8 SNP 65% 1341 s8 SNP 65% 1342 s8 REF 60% 1343 s8 SNP 55% 1344 s8 REF 50% 1345 s8 REF 65% 1346 s8 SNP 70% 1347 s8 REF 50% 1348 s8 SNP 55% 1349 s8 SNP 55% 1350 s8 REF 50% 1351 s8 SNP 55% 1352 s8 REF 60% 1353 s8 SNP 65% 1354 s8 SNP 55% 1355 s8 REF 50% 1356 s8 SNP 55% 1357 s8 REF 55% 1358 s8 SNP 60% 1359 s8 REF 65% 1360 s8 SNP 70% 1361 s8 SNP 70% 1362 s8 REF 65% 1363 s8 REF 55% 1364 s8 SNP 60% 1365 s8 SNP 60% 1366 s8 REF 55% 1367 s8 SNP 60% 1368 s8 REF 55% 1369 s8 REF 45% 1370 s8 REF 60% 1371 s8 SNP 65% 1372 s8 SNP 50% 1373 s8 SNP 65% 1374 s8 SNP 65% 1375 s8 REF 60% 1376 s8 SNP 55% 1377 s8 REF 50% 1378 s8 REF 60% 1379 s9 REF 45% 1380 s9 SNP 50% 1381 s9 SNP 50% 1382 s9 REF 45% 1383 s9 REF 45% 1384 s9 SNP 50% 1385 s9 REF 50% 1386 s9 SNP 55% 1387 s9 REF 45% 1388 s9 SNP 50% 1389 s9 REF 45% 1390 s9 REF 45% 1391 s9 SNP 50% 1392 s9 REF 45% 1393 s9 SNP 65% 1394 s9 REF 60% 1395 s9 SNP 65% 1396 s9 SNP 50% 1397 s9 REF 45% 1398 s9 SNP 50% 1399 s9 SNP 65% 1400 s9 SNP 60% 1401 s9 REF 55% 1402 s9 SNP 55% 1403 s9 REF 50% 1404 s9 REF 60% 1405 s9 SNP 45% 1406 s9 REF 40% 1407 s9 REF 45% 1408 s9 SNP 50% 1409 s9 REF 50% 1410 s9 SNP 55% 1411 s9 REF 50% 1412 s9 SNP 55% 1413 s9 SNP 50% 1414 s9 REF 55% 1415 s9 SNP 60% 1416 s9 SNP 45% 1417 s9 REF 40% 1418 s9 SNP 60% 1419 s9 REF 55% 1420 s9 SNP 55% 1421 s9 REF 50% 1422 s9 SNP 55% 1423 s9 REF 50% 1424 s9 SNP 50% 1425 s9 REF 45% 1426 s9 SNP 55% 1427 s9 REF 50% 1428 s9 REF 55% 1429 s9 SNP 60% 1430 s9 REF 60% 1431 s9 SNP 45% 1432 s9 REF 40% 1433 s10 SNP 55% 1434 s10 REF 60% 1435 s10 SNP 60% 1436 s10 SNP 55% 1437 s10 REF 60% 1438 s10 SNP 55% 1439 s10 REF 60% 1440 s10 SNP 55% 1441 s10 REF 60% 1442 s10 REF 60% 1443 s10 SNP 55% 1444 s10 REF 60% 1445 s10 SNP 55% 1446 s10 SNP 60% 1447 s10 REF 65% 1448 s10 SNP 60% 1449 s10 REF 65% 1450 s10 SNP 60% 1451 s10 REF 65% 1452 s10 REF 65% 1453 s10 REF 70% 1454 s10 SNP 65% 1455 s10 SNP 65% 1456 s10 REF 70% 1457 s10 REF 70% 1458 s10 SNP 65% 1459 s10 SNP 65% 1460 s10 REF 70% 1461 s10 SNP 55% 1462 s10 REF 60% 1463 s10 SNP 60% 1464 s10 REF 65% 1465 s10 SNP 60% 1466 s10 REF 65% 1467 s10 REF 60% 1468 s10 SNP 55% 1469 s10 SNP 55% 1470 s10 REF 60% 1471 s10 REF 60% 1472 s10 SNP 55% 1473 s10 SNP 60% 1474 s10 REF 65% 1475 s10 SNP 55% 1476 s10 REF 60% 1477 s10 REF 60% 1478 s10 SNP 55% 1479 s10 REF 65% 1480 s10 SNP 60% 1481 s10 SNP 50% 1482 s10 REF 55% 1483 s10 SNP 50% 1484 s10 REF 55% 1485 s11 SNP 65% 1486 s11 REF 70% 1487 s11 SNP 70% 1488 s11 REF 75% 1489 s11 REF 75% 1490 s11 SNP 70% 1491 s11 SNP 75% 1492 s11 REF 80% 1493 s11 SNP 60% 1494 s11 REF 65% 1495 s11 SNP 70% 1496 s11 REF 75% 1497 s11 SNP 70% 1498 s11 REF 80% 1499 s11 SNP 75% 1500 s11 SNP 65% 1501 s11 REF 70% 1502 s11 SNP 70% 1503 s11 REF 75% 1504 s11 SNP 70% 1505 s11 SNP 70% 1506 s11 REF 75% 1507 s11 SNP 70% 1508 s11 REF 75% 1509 s11 SNP 70% 1510 s11 SNP 75% 1511 s11 REF 80% 1512 s11 REF 75% 1513 s11 REF 75% 1514 s11 REF 75% 1515 s11 REF 75% 1516 s11 SNP 70% 1517 s11 REF 75% 1518 s11 SNP 75% 1519 s11 REF 80% 1520 s11 REF 80% 1521 s11 REF 75% 1522 s11 SNP 70% 1523 s11 SNP 75% 1524 s11 SNP 75% 1525 s11 REF 80% 1526 s11 REF 75% 1527 s11 REF 75% 1528 s11 SNP 70% 1529 s11 REF 80% 1530 s11 SNP 75% 1531 s11 SNP 75% 1532 s11 REF 80% 1533 s11 REF 80% 1534 s11 REF 75% 1535 s11 SNP 70% 1536 s11 REF 80% 1537 s11 SNP 75% 1538 s11 SNP 75% 1539 s11 SNP 70% 1540 s11 SNP 65% 1541 s11 REF 70% 1542 s11 SNP 70% 1543 s12 REF 65% 1544 s12 SNP 75% 1545 s12 REF 70% 1546 s12 REF 70% 1547 s12 SNP 75% 1548 s12 REF 65% 1549 s12 SNP 70% 1550 s12 REF 65% 1551 s12 SNP 75% 1552 s12 REF 70% 1553 s12 SNP 75% 1554 s12 REF 70% 1555 s12 REF 65% 1556 s12 REF 70% 1557 s12 REF 70% 1558 s12 SNP 75% 1559 s12 SNP 75% 1560 s12 SNP 70% 1561 s12 SNP 70% 1562 s12 REF 65% 1563 s12 SNP 70% 1564 s12 REF 75% 1565 s12 SNP 80% 1566 s12 SNP 75% 1567 s12 REF 70% 1568 s12 SNP 70% 1569 s12 REF 65% 1570 s12 SNP 70% 1571 s12 SNP 75% 1572 s12 REF 70% 1573 s12 REF 65% 1574 s12 SNP 70% 1575 s12 SNP 75% 1576 s12 REF 70% 1577 s12 REF 65% 1578 s12 SNP 70% 1579 s12 SNP 75% 1580 s12 REF 70% 1581 s12 SNP 65% 1582 s12 REF 60% 1583 s12 SNP 65% 1584 s12 SNP 70% 1585 s12 REF 65% 1586 s12 REF 65% 1587 s12 SNP 70% 1588 s12 REF 60% 1589 s3 REF 65% 1590 s3 SNP 70% 1591 s3 REF 60% 1592 s3 SNP 65% 1593 s3 SNP 65% 1594 s3 REF 60% 1595 s3 SNP 70% 1596 s3 REF 65% 1597 s3 SNP 70% 1598 s3 REF 65% 1599 s3 SNP 60% 1600 s3 SNP 65% 1601 s3 SNP 60% 1602 s3 SNP 70% 1603 s3 SNP 60% 1604 s3 SNP 70% 1605 s3 SNP 75% 1606 s3 SNP 60% 1607 s3 SNP 60% 1608 s3 SNP 55% 1609 s3 SNP 80% 1610 s3 REF 65% 1611 s3 SNP 70% 1612 s3 REF 65% 1613 s3 SNP 70% 1614 s3 SNP 70% 1615 s3 REF 65% 1616 s3 SNP 70% 1617 s3 REF 65% 1618 s3 SNP 70% 1619 s3 REF 65% 1620 s3 REF 75% 1621 s3 SNP 80% 1622 s3 REF 65% 1623 s3 SNP 70% 1624 s3 SNP 70% 1625 s3 REF 65% 1626 s3 REF 65% 1627 s3 SNP 70% 1628 s3 SNP 70% 1629 s3 REF 65% 1630 s3 SNP 55% 1631 s3 SNP 75% 1632 s3 REF 60% 1633 s3 SNP 65% 1634 s3 SNP 65% 1635 s3 REF 60% 1636 s3 REF 75% 1637 s3 REF 70% 1638 s13 SNP 55% 1639 s13 SNP 60% 1640 s13 REF 65% 1641 s13 REF 55% 1642 s13 SNP 50% 1643 s13 SNP 50% 1644 s13 REF 55% 1645 s13 REF 60% 1646 s13 REF 55% 1647 s13 SNP 50% 1648 s13 SNP 60% 1649 s13 REF 65% 1650 s13 SNP 60% 1651 s13 SNP 55% 1652 s13 SNP 55% 1653 s13 SNP 60% 1654 s13 REF 65% 1655 s13 REF 60% 1656 s13 SNP 55% 1657 s13 SNP 65% 1658 s13 SNP 60% 1659 s13 SNP 65% 1660 s13 REF 70% 1661 s13 REF 70% 1662 s13 SNP 65% 1663 s13 SNP 60% 1664 s13 SNP 60% 1665 s13 REF 65% 1666 s13 SNP 60% 1667 s13 SNP 60% 1668 s13 REF 65% 1669 s13 SNP 60% 1670 s13 SNP 50% 1671 s13 REF 55% 1672 s13 REF 65% 1673 s13 SNP 60% 1674 s13 SNP 60% 1675 s13 REF 65% 1676 s13 SNP 55% 1677 s13 REF 65% 1678 s13 SNP 60% 1679 s13 SNP 45% 1680 s13 REF 50% 1681 s13 SNP 50% 1682 s13 REF 60% 1683 s13 SNP 55% 1684 s15 SNP 50% 1685 s15 SNP 45% 1686 s15 REF 50% 1687 s15 REF 55% 1688 s15 SNP 50% 1689 s15 REF 50% 1690 s15 SNP 45% 1691 s15 REF 55% 1692 s15 SNP 50% 1693 s15 REF 50% 1694 s15 REF 55% 1695 s15 SNP 50% 1696 s15 REF 55% 1697 s15 SNP 50% 1698 s15 REF 55% 1699 s15 SNP 50% 1700 s15 REF 55% 1701 s15 SNP 50% 1702 s15 SNP 50% 1703 s15 REF 55% 1704 s15 SNP 50% 1705 s15 SNP 45% 1706 s15 REF 50% 1707 s15 REF 55% 1708 s15 REF 55% 1709 s15 REF 60% 1710 s15 SNP 55% 1711 s15 SNP 50% 1712 s15 REF 55% 1713 s15 REF 55% 1714 s15 SNP 50% 1715 s15 SNP 50% 1716 s15 SNP 45% 1717 s15 REF 50% 1718 s15 SNP 45% 1719 s15 REF 50% 1720 s15 REF 55% 1721 s15 SNP 50% 1722 s15 SNP 45% 1723 s15 REF 50% 1724 s15 REF 50% 1725 s15 SNP 45% 1726 s15 SNP 45% 1727 s15 REF 50% 1728 s15 REF 55% 1729 s15 SNP 50% 1730 s15 REF 55% 1731 s15 SNP 50% 1732 s15 REF 55% 1733 s15 REF 55% 1734 s15 SNP 50% 1735 s15 SNP 45% 1736 s15 SNP 45% 1737 s15 REF 50% 1738 s16 REF 55% 1739 s16 REF 55% 1740 s16 SNP 60% 1741 s16 REF 60% 1742 s16 SNP 55% 1743 s16 REF 50% 1744 s16 SNP 60% 1745 s16 REF 60% 1746 s16 REF 55% 1747 s16 SNP 60% 1748 s16 SNP 65% 1749 s16 SNP 60% 1750 s16 REF 55% 1751 s16 SNP 55% 1752 s16 REF 50% 1753 s16 REF 55% 1754 s16 SNP 60% 1755 s16 SNP 60% 1756 s16 REF 55% 1757 s16 SNP 55% 1758 s16 SNP 65% 1759 s16 REF 60% 1760 s16 REF 55% 1761 s16 SNP 60% 1762 s16 SNP 55% 1763 s16 REF 50% 1764 s16 REF 55% 1765 s16 SNP 60% 1766 s16 SNP 55% 1767 s16 REF 50% 1768 s16 SNP 65% 1769 s16 SNP 60% 1770 s16 REF 55% 1771 s16 SNP 60% 1772 s16 REF 55% 1773 s16 REF 50% 1774 s16 SNP 55% 1775 s16 REF 50% 1776 s16 SNP 55% 1777 s16 SNP 60% 1778 s16 REF 55% 1779 s16 REF 50% 1780 s16 SNP 55% 1781 s16 REF 50% 1782 s16 SNP 55% 1783 s16 REF 55% 1784 s16 SNP 60% 1785 s16 SNP 55% 1786 s16 REF 50% 1787 s16 SNP 55% 1788 s16 REF 50% 1789 s16 SNP 55% 1790 s16 REF 50% 1791 s16 REF 50% 1792 s39 SNP 40% 1793 s39 SNP 40% 1794 s39 SNP 40% 1795 s39 SNP 40% 1796 s39 SNP 45% 1797 s39 SNP 40% 1798 s39 SNP 40% 1799 s39 SNP 40% 1800 s39 SNP 40% 1801 s17 SNP 45% 1802 s17 SNP 45% 1803 s17 SNP 50% 1804 s17 SNP 50% 1805 s17 SNP 50% 1806 s17 SNP 45% 1807 s17 REF 40% 1808 s17 SNP 40% 1809 s17 REF 35% 1810 s17 SNP 40% 1811 s17 SNP 55% 1812 s17 SNP 40% 1813 s17 SNP 55% 1814 s17 REF 35% 1815 s17 SNP 50% 1816 s17 SNP 50% 1817 s17 REF 35% 1818 s17 SNP 50% 1819 s17 SNP 55% 1820 s17 SNP 40% 1821 s17 REF 35% 1822 s17 SNP 40% 1823 s17 SNP 55% 1824 s17 REF 35% 1825 s17 SNP 50% 1826 s17 REF 45% 1827 s17 SNP 45% 1828 s17 SNP 50% 1829 s17 REF 45% 1830 s17 SNP 55% 1831 s17 SNP 50% 1832 s17 SNP 60% 1833 s17 SNP 45% 1834 s17 REF 40% 1835 s17 SNP 45% 1836 s17 SNP 60% 1837 s17 REF 40% 1838 s17 SNP 55% 1839 s17 SNP 55% 1840 s17 SNP 45% 1841 s17 SNP 50% 1842 s17 REF 35% 1843 s17 SNP 40% 1844 s17 SNP 45% 1845 s17 REF 40% 1846 s17 REF 40% 1847 s17 SNP 45% 1848 s17 SNP 50% 1849 s19 REF 60% 1850 s19 SNP 55% 1851 s19 REF 65% 1852 s19 SNP 60% 1853 s19 SNP 60% 1854 s19 REF 65% 1855 s19 SNP 60% 1856 s19 SNP 55% 1857 s19 REF 60% 1858 s19 REF 60% 1859 s19 SNP 55% 1860 s19 REF 65% 1861 s19 SNP 60% 1862 s19 REF 60% 1863 s19 SNP 55% 1864 s19 REF 60% 1865 s19 SNP 55% 1866 s19 SNP 60% 1867 s19 REF 65% 1868 s19 REF 65% 1869 s19 SNP 60% 1870 s19 REF 70% 1871 s19 SNP 65% 1872 s19 REF 70% 1873 s19 REF 65% 1874 s19 SNP 60% 1875 s19 REF 65% 1876 s19 SNP 60% 1877 s19 REF 65% 1878 s19 SNP 60% 1879 s19 REF 65% 1880 s19 SNP 55% 1881 s19 REF 60% 1882 s19 SNP 65% 1883 s19 SNP 65% 1884 s19 REF 70% 1885 s19 REF 65% 1886 s19 REF 65% 1887 s19 SNP 60% 1888 s19 REF 65% 1889 s19 SNP 60% 1890 s19 REF 60% 1891 s19 SNP 55% 1892 s19 SNP 60% 1893 s20 REF 75% 1894 s20 SNP 70% 1895 s20 SNP 75% 1896 s20 REF 80% 1897 s20 REF 90% 1898 s20 REF 80% 1899 s20 SNP 75% 1900 s20 SNP 50% 1901 s20 SNP 85% 1902 s20 SNP 75% 1903 s20 REF 80% 1904 s20 REF 65% 1905 s20 SNP 60% 1906 s20 SNP 50% 1907 s20 SNP 75% 1908 s20 REF 80% 1909 s20 SNP 80% 1910 s20 REF 85% 1911 s20 SNP 60% 1912 s20 SNP 70% 1913 s20 REF 75% 1914 s20 SNP 70% 1915 s20 REF 75% 1916 s20 REF 65% 1917 s20 SNP 85% 1918 s20 REF 90% 1919 s20 SNP 80% 1920 s20 REF 85% 1921 s20 SNP 65% 1922 s20 REF 70% 1923 s20 REF 95% 1924 s20 REF 55% 1925 s20 SNP 80% 1926 s20 REF 85% 1927 s20 SNP 60% 1928 s20 REF 65% 1929 s20 SNP 90% 1930 s20 REF 95% 1931 s20 REF 55% 1932 s20 REF 85% 1933 s20 SNP 80% 1934 s20 REF 85% 1935 s20 SNP 80% 1936 s20 REF 60% 1937 s20 SNP 55% 1938 s20 SNP 90% 1939 s20 REF 55% 1940 s20 SNP 50% 1941 s21 REF 55% 1942 s21 SNP 50% 1943 s21 SNP 50% 1944 s21 REF 55% 1945 s21 SNP 60% 1946 s21 REF 65% 1947 s21 REF 60% 1948 s21 SNP 55% 1949 s21 REF 60% 1950 s21 SNP 55% 1951 s21 SNP 55% 1952 s21 SNP 55% 1953 s21 REF 60% 1954 s21 REF 60% 1955 s21 SNP 60% 1956 s21 REF 65% 1957 s21 SNP 60% 1958 s21 REF 65% 1959 s21 SNP 60% 1960 s21 REF 65% 1961 s21 SNP 55% 1962 s21 REF 60% 1963 s21 REF 60% 1964 s21 SNP 55% 1965 s21 SNP 50% 1966 s21 REF 55% 1967 s21 SNP 60% 1968 s21 REF 65% 1969 s21 REF 70% 1970 s21 SNP 65% 1971 s21 REF 60% 1972 s21 SNP 55% 1973 s21 SNP 60% 1974 s21 REF 65% 1975 s21 REF 60% 1976 s21 REF 65% 1977 s21 SNP 60% 1978 s21 SNP 55% 1979 s21 REF 65% 1980 s21 SNP 60% 1981 s21 REF 65% 1982 s21 SNP 60% 1983 s21 SNP 55% 1984 s21 REF 60% 1985 s21 REF 65% 1986 s21 SNP 60% 1987 s21 SNP 60% 1988 s21 SNP 55% 1989 s21 REF 60% 1990 s21 REF 60% 1991 s21 SNP 55% 1992 s21 SNP 55% 1993 s21 REF 60% 1994 s21 REF 65% 1995 s21 SNP 50% 1996 s21 REF 55% 1997 s22 SNP 40% 1998 s22 REF 45% 1999 s22 SNP 50% 2000 s22 REF 60% 2001 s22 SNP 55% 2002 s22 REF 65% 2003 s22 SNP 60% 2004 s22 REF 45% 2005 s22 SNP 40% 2006 s22 REF 55% 2007 s22 SNP 50% 2008 s22 SNP 55% 2009 s22 REF 60% 2010 s22 SNP 55% 2011 s22 SNP 55% 2012 s22 REF 60% 2013 s22 SNP 55% 2014 s22 SNP 55% 2015 s22 REF 60% 2016 s22 REF 65% 2017 s22 SNP 60% 2018 s22 REF 60% 2019 s22 REF 60% 2020 s22 SNP 55% 2021 s22 REF 60% 2022 s22 REF 60% 2023 s22 SNP 55% 2024 s22 REF 65% 2025 s22 REF 55% 2026 s22 SNP 50% 2027 s22 REF 60% 2028 s22 SNP 55% 2029 s22 REF 55% 2030 s22 SNP 50% 2031 s22 REF 55% 2032 s22 REF 55% 2033 s22 SNP 50% 2034 s22 SNP 60% 2035 s22 REF 65% 2036 s22 REF 70% 2037 s22 SNP 65% 2038 s22 SNP 55% 2039 s22 REF 60% 2040 s22 REF 60% 2041 s22 SNP 55% 2042 s22 SNP 65% 2043 s22 REF 70% 2044 s22 SNP 55% 2045 s22 REF 60% 2046 s22 REF 50% 2047 s22 SNP 45% 2048 s22 REF 60% 2049 s22 REF 60% 2050 s22 SNP 55% 2051 s22 SNP 45% 2052 s22 REF 50% 2053 s22 SNP 55% 2054 s22 REF 60% 2055 s22 SNP 60% 2056 s22 REF 65% 2057 s22 SNP 60% 2058 s22 SNP 55% 2059 s23 REF 55% 2060 s23 SNP 50% 2061 s23 REF 60% 2062 s23 SNP 55% 2063 s23 SNP 55% 2064 s23 REF 55% 2065 s23 SNP 50% 2066 s23 REF 55% 2067 s23 SNP 50% 2068 s23 SNP 55% 2069 s23 REF 60% 2070 s23 REF 60% 2071 s23 SNP 55% 2072 s23 REF 55% 2073 s23 SNP 50% 2074 s23 SNP 55% 2075 s23 REF 55% 2076 s23 SNP 50% 2077 s23 REF 55% 2078 s23 SNP 50% 2079 s23 REF 60% 2080 s23 SNP 55% 2081 s23 REF 65% 2082 s23 REF 60% 2083 s23 SNP 55% 2084 s23 REF 60% 2085 s23 SNP 60% 2086 s23 REF 65% 2087 s23 REF 65% 2088 s23 SNP 60% 2089 s23 SNP 60% 2090 s23 REF 65% 2091 s23 REF 60% 2092 s23 REF 70% 2093 s23 SNP 55% 2094 s23 REF 60% 2095 s23 SNP 60% 2096 s23 REF 65% 2097 s23 REF 65% 2098 s23 SNP 60% 2099 s23 SNP 55% 2100 s23 REF 60% 2101 s23 SNP 65% 2102 s23 REF 70% 2103 s23 SNP 65% 2104 s23 REF 60% 2105 s23 SNP 55% 2106 s23 SNP 60% 2107 s23 SNP 60% 2108 s23 REF 65% 2109 s23 REF 65% 2110 s23 REF 65% 2111 s23 SNP 60% 2112 s23 SNP 60% 2113 s23 REF 65% 2114 s23 SNP 60% 2115 s23 SNP 50% 2116 s23 REF 55% 2117 s24 REF 50% 2118 s24 SNP 45% 2119 s24 REF 40% 2120 s24 SNP 35% 2121 s24 SNP 30% 2122 s24 REF 40% 2123 s24 SNP 35% 2124 s24 REF 35% 2125 s24 SNP 45% 2126 s24 REF 50% 2127 s24 REF 55% 2128 s24 REF 40% 2129 s24 SNP 35% 2130 s24 REF 55% 2131 s24 SNP 50% 2132 s24 REF 50% 2133 s24 SNP 45% 2134 s24 SNP 50% 2135 s24 REF 55% 2136 s24 SNP 35% 2137 s24 REF 40% 2138 s24 REF 30% 2139 s24 SNP 45% 2140 s24 REF 50% 2141 s24 SNP 30% 2142 s24 SNP 50% 2143 s24 SNP 30% 2144 s24 SNP 50% 2145 s24 REF 55% 2146 s24 REF 55% 2147 s24 REF 40% 2148 s24 SNP 35% 2149 s24 REF 35% 2150 s24 SNP 50% 2151 s24 REF 55% 2152 s24 SNP 50% 2153 s24 SNP 50% 2154 s24 REF 55% 2155 s24 SNP 45% 2156 s24 REF 50% 2157 s24 REF 55% 2158 s24 REF 45% 2159 s24 SNP 40% 2160 s24 SNP 35% 2161 s24 REF 40% 2162 s24 SNP 40% 2163 s24 REF 45% 2164 s24 REF 55% 2165 s24 SNP 50% 2166 s24 SNP 50% 2167 s24 REF 55% 2168 s24 SNP 40% 2169 s24 REF 45% 2170 s24 SNP 35% 2171 s24 REF 40% 2172 s24 REF 35% 2173 s24 REF 45% 2174 s24 SNP 40% 2175 s24 REF 35% 2176 s24 SNP 30% 2177 s24 SNP 50% 2178 s24 REF 55% 2179 s24 SNP 35% 2180 s24 REF 40% 2181 s24 SNP 40% 2182 s24 REF 45% 2183 s24 REF 35% 2184 s24 SNP 30% 2185 s24 SNP 50% 2186 s24 REF 30% 2187 s14 REF 60% 2188 s14 SNP 55% 2189 s14 REF 55% 2190 s14 REF 65% 2191 s14 SNP 60% 2192 s14 SNP 50% 2193 s14 SNP 60% 2194 s14 SNP 55% 2195 s14 SNP 55% 2196 s14 REF 60% 2197 s14 REF 55% 2198 s14 SNP 50% 2199 s14 REF 55% 2200 s14 REF 60% 2201 s14 SNP 55% 2202 s14 REF 65% 2203 s14 SNP 60% 2204 s14 SNP 60% 2205 s14 REF 65% 2206 s14 SNP 60% 2207 s14 REF 65% 2208 s14 SNP 60% 2209 s14 REF 65% 2210 s14 REF 55% 2211 s14 SNP 50% 2212 s14 SNP 55% 2213 s14 SNP 60% 2214 s14 SNP 50% 2215 s14 REF 55% 2216 s14 SNP 60% 2217 s14 SNP 60% 2218 s14 REF 65% 2219 s14 SNP 60% 2220 s14 SNP 60% 2221 s14 SNP 60% 2222 s14 REF 65% 2223 s14 SNP 60% 2224 s14 REF 65% 2225 s14 SNP 60% 2226 s14 SNP 55% 2227 s14 SNP 50% 2228 s14 REF 55% 2229 s14 REF 65% 2230 s14 SNP 60% 2231 s14 SNP 60% 2232 s14 REF 65% 2233 s14 SNP 55% 2234 s14 SNP 50% 2235 s14 SNP 50% 2236 s25 SNP 50% 2237 s25 SNP 60% 2238 s25 REF 65% 2239 s25 REF 55% 2240 s25 SNP 50% 2241 s25 REF 65% 2242 s25 SNP 60% 2243 s25 REF 75% 2244 s25 SNP 70% 2245 s25 REF 60% 2246 s25 SNP 55% 2247 s25 SNP 60% 2248 s25 REF 65% 2249 s25 REF 75% 2250 s25 SNP 55% 2251 s25 REF 60% 2252 s25 SNP 65% 2253 s25 REF 70% 2254 s25 SNP 55% 2255 s25 REF 60% 2256 s25 SNP 60% 2257 s25 REF 65% 2258 s25 SNP 50% 2259 s25 REF 55% 2260 s25 SNP 60% 2261 s25 REF 65% 2262 s25 REF 55% 2263 s25 REF 65% 2264 s25 SNP 60% 2265 s25 REF 75% 2266 s25 SNP 70% 2267 s25 REF 60% 2268 s25 SNP 55% 2269 s25 SNP 65% 2270 s25 REF 70% 2271 s25 SNP 55% 2272 s25 REF 60% 2273 s25 SNP 65% 2274 s25 REF 70% 2275 s25 REF 70% 2276 s25 SNP 65% 2277 s25 REF 60% 2278 s25 SNP 55% 2279 s25 SNP 70% 2280 s25 REF 75% 2281 s25 SNP 55% 2282 s25 REF 60% 2283 s25 REF 70% 2284 s25 SNP 65% 2285 s25 SNP 70% 2286 s25 REF 75% 2287 s25 REF 75% 2288 s25 SNP 70% 2289 s25 REF 75% 2290 s25 SNP 70% 2291 s25 SNP 45% 2292 s25 SNP 70% 2293 s25 REF 50% 2294 s25 REF 70% 2295 s25 SNP 65% 2296 s25 SNP 55% 2297 s25 REF 60% 2298 s25 SNP 70% 2299 s25 REF 75% 2300 s25 REF 65% 2301 s25 SNP 60% 2302 s26 REF 50% 2303 s26 SNP 55% 2304 s26 SNP 55% 2305 s26 REF 50% 2306 s26 REF 50% 2307 s26 SNP 55% 2308 s26 REF 50% 2309 s26 SNP 55% 2310 s26 REF 55% 2311 s26 SNP 60% 2312 s26 REF 50% 2313 s26 SNP 55% 2314 s26 REF 50% 2315 s26 SNP 55% 2316 s26 SNP 55% 2317 s26 REF 50% 2318 s26 REF 55% 2319 s26 SNP 60% 2320 s26 SNP 55% 2321 s26 REF 50% 2322 s26 REF 50% 2323 s26 SNP 55% 2324 s26 REF 55% 2325 s26 SNP 60% 2326 s26 REF 50% 2327 s26 SNP 55% 2328 s26 SNP 60% 2329 s26 REF 55% 2330 s26 SNP 55% 2331 s26 REF 50% 2332 s26 REF 50% 2333 s26 SNP 55% 2334 s26 SNP 55% 2335 s26 REF 50% 2336 s26 REF 50% 2337 s26 SNP 55% 2338 s26 SNP 55% 2339 s26 REF 50% 2340 s26 SNP 60% 2341 s26 SNP 60% 2342 s26 REF 55% 2343 s26 REF 55% 2344 s26 SNP 55% 2345 s26 REF 50% 2346 s26 REF 50% 2347 s26 SNP 55% 2348 s26 SNP 55% 2349 s26 SNP 55% 2350 s26 REF 50% 2351 s26 SNP 55% 2352 s26 REF 50% 2353 s26 SNP 60% 2354 s26 SNP 60% 2355 s26 REF 55% 2356 s26 REF 55% 2357 s26 REF 50% 2358 s26 REF 55% 2359 s26 SNP 60% 2360 s26 SNP 60% 2361 s26 REF 55% 2362 s27 SNP 45% 2363 s27 REF 55% 2364 s27 SNP 50% 2365 s27 REF 50% 2366 s27 SNP 45% 2367 s27 REF 60% 2368 s27 SNP 55% 2369 s27 REF 50% 2370 s27 SNP 45% 2371 s27 SNP 50% 2372 s27 REF 55% 2373 s27 REF 60% 2374 s27 REF 60% 2375 s27 SNP 55% 2376 s27 SNP 55% 2377 s27 REF 60% 2378 s27 SNP 60% 2379 s27 REF 65% 2380 s27 REF 55% 2381 s27 SNP 50% 2382 s27 SNP 55% 2383 s27 REF 60% 2384 s27 REF 60% 2385 s27 SNP 55% 2386 s27 REF 55% 2387 s27 SNP 50% 2388 s27 REF 55% 2389 s27 SNP 50% 2390 s27 SNP 50% 2391 s27 REF 55% 2392 s27 REF 60% 2393 s27 SNP 55% 2394 s27 REF 50% 2395 s27 SNP 55% 2396 s27 REF 60% 2397 s27 SNP 50% 2398 s27 REF 55% 2399 s27 REF 55% 2400 s27 SNP 50% 2401 s27 SNP 50% 2402 s27 REF 55% 2403 s27 SNP 55% 2404 s27 REF 60% 2405 s27 SNP 50% 2406 s27 REF 55% 2407 s27 SNP 55% 2408 s27 REF 60% 2409 s27 SNP 55% 2410 s27 REF 60% 2411 s27 REF 60% 2412 s27 SNP 55% 2413 s27 SNP 50% 2414 s27 REF 55% 2415 s27 REF 50% 2416 s27 SNP 45% 2417 s27 SNP 50% 2418 s27 REF 55% 2419 s27 SNP 55% 2420 s27 REF 60% 2421 s27 SNP 55% 2422 s27 REF 50% 2423 s27 SNP 45% 2424 s27 SNP 45% 2425 s27 REF 50% 2426 s18 SNP 40% 2427 s18 SNP 45% 2428 s18 SNP 40% 2429 s18 SNP 45% 2430 s18 SNP 45% 2431 s18 SNP 50% 2432 s18 REF 50% 2433 s18 SNP 50% 2434 s18 SNP 45% 2435 s18 SNP 45% 2436 s18 SNP 50% 2437 s18 SNP 50% 2438 s18 SNP 50% 2439 s18 SNP 50% 2440 s18 REF 50% 2441 s18 SNP 50% 2442 s18 SNP 50% 2443 s18 SNP 50% 2444 s18 SNP 55% 2445 s18 SNP 55% 2446 s18 REF 55% 2447 s18 REF 50% 2448 s18 SNP 50% 2449 s18 SNP 50% 2450 s18 SNP 50% 2451 s18 SNP 55% 2452 s18 SNP 55% 2453 s18 SNP 50% 2454 s18 REF 55% 2455 s18 SNP 55% 2456 s18 REF 55% 2457 s18 SNP 55% 2458 s18 SNP 45% 2459 s18 SNP 50% 2460 s18 REF 50% 2461 s18 REF 50% 2462 s18 SNP 50% 2463 s18 SNP 45% 2464 s28 REF 35% 2465 s28 SNP 45% 2466 s28 REF 40% 2467 s28 REF 45% 2468 s28 SNP 50% 2469 s28 REF 55% 2470 s28 SNP 60% 2471 s28 REF 65% 2472 s28 SNP 70% 2473 s28 REF 40% 2474 s28 REF 65% 2475 s28 SNP 70% 2476 s28 SNP 70% 2477 s28 SNP 45% 2478 s28 REF 65% 2479 s28 SNP 50% 2480 s28 REF 45% 2481 s28 SNP 65% 2482 s28 REF 60% 2483 s28 SNP 65% 2484 s28 REF 60% 2485 s28 SNP 50% 2486 s28 REF 45% 2487 s28 REF 45% 2488 s28 SNP 50% 2489 s28 SNP 40% 2490 s28 REF 45% 2491 s28 SNP 50% 2492 s28 REF 50% 2493 s28 SNP 55% 2494 s28 REF 60% 2495 s28 SNP 65% 2496 s28 REF 55% 2497 s28 SNP 60% 2498 s28 REF 60% 2499 s28 SNP 65% 2500 s28 REF 50% 2501 s28 SNP 55% 2502 s28 REF 45% 2503 s28 SNP 50% 2504 s28 REF 60% 2505 s28 SNP 65% 2506 s28 SNP 55% 2507 s28 REF 50% 2508 s28 REF 45% 2509 s28 SNP 50% 2510 s28 SNP 50% 2511 s28 REF 45% 2512 s28 SNP 40% 2513 s28 REF 35% 2514 s28 REF 45% 2515 s28 SNP 50% 2516 s28 SNP 50% 2517 s28 REF 45% 2518 s28 SNP 60% 2519 s28 REF 55% 2520 s28 SNP 60% 2521 s28 REF 55% 2522 s28 SNP 50% 2523 s28 REF 45% 2524 s28 SNP 65% 2525 s28 REF 60% 2526 s28 SNP 60% 2527 s28 REF 55% 2528 s28 SNP 55% 2529 s28 REF 50% 2530 s28 SNP 50% 2531 s28 REF 45% 2532 s29 REF 50% 2533 s29 SNP 45% 2534 s29 REF 50% 2535 s29 SNP 45% 2536 s29 SNP 45% 2537 s29 REF 50% 2538 s29 REF 50% 2539 s29 SNP 45% 2540 s29 SNP 45% 2541 s29 REF 50% 2542 s29 SNP 45% 2543 s29 REF 50% 2544 s29 SNP 45% 2545 s29 REF 50% 2546 s29 SNP 45% 2547 s29 REF 50% 2548 s29 SNP 45% 2549 s29 REF 50% 2550 s29 REF 50% 2551 s29 SNP 45% 2552 s29 REF 50% 2553 s29 SNP 45% 2554 s29 REF 50% 2555 s29 SNP 45% 2556 s29 SNP 40% 2557 s29 REF 45% 2558 s29 SNP 45% 2559 s29 REF 50% 2560 s29 REF 45% 2561 s29 SNP 40% 2562 s29 REF 50% 2563 s29 SNP 45% 2564 s29 SNP 45% 2565 s29 REF 50% 2566 s29 SNP 45% 2567 s29 REF 50% 2568 s29 REF 50% 2569 s29 SNP 45% 2570 s29 REF 50% 2571 s29 SNP 45% 2572 s29 REF 50% 2573 s29 SNP 45% 2574 s29 SNP 45% 2575 s29 REF 50% 2576 s29 SNP 45% 2577 s29 REF 50% 2578 s29 REF 50% 2579 s29 SNP 45% 2580 s29 SNP 40% 2581 s29 REF 45% 2582 s29 SNP 40% 2583 s29 REF 45% 2584 s29 REF 50% 2585 s29 SNP 45% 2586 s29 SNP 45% 2587 s29 REF 50% 2588 s29 REF 50% 2589 s29 SNP 45% 2590 s29 REF 45% 2591 s29 SNP 40% 2592 s30 REF 30% 2593 s30 REF 30% 2594 s30 REF 35% 2595 s30 SNP 30% 2596 s30 REF 30% 2597 s30 REF 35% 2598 s30 SNP 30% 2599 s30 REF 30% 2600 s30 SNP 30% 2601 s30 REF 35% 2602 s30 SNP 35% 2603 s30 REF 40% 2604 s30 SNP 35% 2605 s30 SNP 40% 2606 s30 REF 45% 2607 s30 REF 30% 2608 s30 REF 30% 2609 s30 REF 30% 2610 s30 SNP 30% 2611 s30 REF 35% 2612 s30 SNP 35% 2613 s30 REF 40% 2614 s31 REF 65% 2615 s31 SNP 60% 2616 s31 REF 70% 2617 s31 SNP 65% 2618 s31 REF 70% 2619 s31 SNP 55% 2620 s31 REF 60% 2621 s31 SNP 65% 2622 s31 REF 70% 2623 s31 SNP 65% 2624 s31 REF 60% 2625 s31 SNP 55% 2626 s31 REF 75% 2627 s31 SNP 60% 2628 s31 REF 65% 2629 s31 REF 60% 2630 s31 SNP 55% 2631 s31 SNP 60% 2632 s31 REF 65% 2633 s31 SNP 60% 2634 s31 REF 65% 2635 s31 REF 65% 2636 s31 SNP 60% 2637 s31 REF 60% 2638 s31 SNP 55% 2639 s31 SNP 60% 2640 s31 REF 65% 2641 s31 SNP 55% 2642 s31 REF 60% 2643 s31 SNP 60% 2644 s31 REF 65% 2645 s31 REF 65% 2646 s31 SNP 60% 2647 s31 SNP 70% 2648 s31 REF 75% 2649 s31 SNP 60% 2650 s31 SNP 65% 2651 s31 REF 70% 2652 s31 REF 65% 2653 s31 SNP 60% 2654 s31 SNP 60% 2655 s31 REF 65% 2656 s31 REF 65% 2657 s31 SNP 60% 2658 s31 SNP 55% 2659 s31 REF 60% 2660 s31 SNP 65% 2661 s31 REF 65% 2662 s31 SNP 60% 2663 s31 REF 65% 2664 s31 SNP 60% 2665 s31 REF 70% 2666 s31 REF 65% 2667 s31 REF 65% 2668 s31 SNP 60% 2669 s31 SNP 70% 2670 s31 SNP 60% 2671 s31 REF 65% 2672 s31 REF 65% 2673 s31 SNP 60% 2674 s31 SNP 60% 2675 s31 REF 65% 2676 s32 REF 55% 2677 s32 SNP 60% 2678 s32 REF 55% 2679 s32 REF 40% 2680 s32 SNP 45% 2681 s32 SNP 60% 2682 s32 REF 55% 2683 s32 REF 55% 2684 s32 SNP 60% 2685 s32 REF 45% 2686 s32 SNP 50% 2687 s32 REF 50% 2688 s32 SNP 55% 2689 s32 REF 50% 2690 s32 SNP 55% 2691 s32 SNP 60% 2692 s32 REF 55% 2693 s32 SNP 60% 2694 s32 REF 55% 2695 s32 SNP 60% 2696 s32 REF 55% 2697 s32 SNP 65% 2698 s32 SNP 60% 2699 s32 REF 55% 2700 s32 SNP 60% 2701 s32 REF 55% 2702 s32 SNP 55% 2703 s32 SNP 55% 2704 s32 REF 50% 2705 s32 REF 50% 2706 s32 REF 55% 2707 s32 REF 55% 2708 s32 SNP 60% 2709 s32 SNP 60% 2710 s32 REF 55% 2711 s32 SNP 60% 2712 s32 SNP 60% 2713 s32 REF 55% 2714 s32 REF 55% 2715 s32 SNP 60% 2716 s32 SNP 60% 2717 s32 REF 55% 2718 s32 SNP 60% 2719 s32 REF 60% 2720 s32 SNP 50% 2721 s32 REF 45% 2722 s32 SNP 60% 2723 s32 REF 55% 2724 s32 SNP 55% 2725 s32 REF 50% 2726 s32 REF 60% 2727 s32 SNP 65% 2728 s33 REF 40% 2729 s33 SNP 35% 2730 s33 SNP 30% 2731 s33 REF 35% 2732 s33 REF 40% 2733 s33 SNP 35% 2734 s33 REF 40% 2735 s33 SNP 35% 2736 s33 REF 35% 2737 s33 SNP 30% 2738 s33 SNP 35% 2739 s33 REF 40% 2740 s33 SNP 30% 2741 s33 REF 35% 2742 s33 SNP 30% 2743 s33 REF 35% 2744 s33 REF 35% 2745 s33 SNP 30% 2746 s33 SNP 35% 2747 s33 REF 40% 2748 s33 SNP 35% 2749 s33 REF 40% 2750 s33 REF 30% 2751 s33 REF 35% 2752 s33 SNP 30% 2753 s33 REF 30% 2754 s33 SNP 35% 2755 s33 REF 40% 2756 s33 SNP 30% 2757 s33 REF 35% 2758 s33 REF 40% 2759 s33 SNP 35% 2760 s33 REF 40% 2761 s33 SNP 35% 2762 s33 REF 30% 2763 s33 REF 35% 2764 s33 SNP 30% 2765 s33 SNP 30% 2766 s33 REF 40% 2767 s33 SNP 35% 2768 s33 SNP 35% 2769 s33 REF 40% 2770 s33 SNP 30% 2771 s33 REF 35% 2772 s33 REF 35% 2773 s33 REF 35% 2774 s33 SNP 30% 2775 s33 REF 30% 2776 s35 SNP 65% 2777 s35 SNP 55% 2778 s35 REF 60% 2779 s35 SNP 60% 2780 s35 REF 65% 2781 s35 SNP 55% 2782 s35 SNP 55% 2783 s35 SNP 60% 2784 s35 SNP 55% 2785 s35 SNP 60% 2786 s35 SNP 65% 2787 s35 SNP 60% 2788 s35 SNP 55% 2789 s35 REF 65% 2790 s35 SNP 55% 2791 s35 REF 60% 2792 s35 REF 70% 2793 s35 REF 65% 2794 s35 SNP 60% 2795 s35 SNP 60% 2796 s35 REF 65% 2797 s35 SNP 60% 2798 s35 REF 65% 2799 s35 SNP 60% 2800 s35 REF 70% 2801 s35 SNP 65% 2802 s35 SNP 55% 2803 s35 SNP 65% 2804 s35 SNP 50% 2805 s35 SNP 65% 2806 s35 SNP 60% 2807 s35 SNP 55% 2808 s35 SNP 45% 2809 s35 SNP 60% 2810 s35 SNP 55% 2811 s35 REF 65% 2812 s35 SNP 60% 2813 s35 SNP 60% 2814 s35 SNP 55% 2815 s35 SNP 50% 2816 s35 SNP 45% 2817 s36 REF 35% 2818 s36 REF 60% 2819 s36 SNP 65% 2820 s36 REF 45% 2821 s36 SNP 50% 2822 s36 REF 50% 2823 s36 SNP 55% 2824 s36 REF 65% 2825 s36 SNP 70% 2826 s36 SNP 55% 2827 s36 REF 50% 2828 s36 SNP 40% 2829 s36 REF 35% 2830 s36 SNP 50% 2831 s36 REF 45% 2832 s36 SNP 55% 2833 s36 REF 50% 2834 s36 REF 50% 2835 s36 SNP 55% 2836 s36 REF 55% 2837 s36 SNP 60% 2838 s36 SNP 70% 2839 s36 REF 35% 2840 s36 SNP 40% 2841 s36 SNP 40% 2842 s36 REF 60% 2843 s36 SNP 65% 2844 s36 REF 50% 2845 s36 SNP 55% 2846 s36 SNP 40% 2847 s36 REF 35% 2848 s36 REF 55% 2849 s36 SNP 60% 2850 s36 REF 40% 2851 s36 SNP 45% 2852 s36 SNP 55% 2853 s36 REF 50% 2854 s36 REF 50% 2855 s36 SNP 55% 2856 s36 REF 60% 2857 s36 SNP 65% 2858 s36 REF 45% 2859 s36 SNP 50% 2860 s36 REF 50% 2861 s36 SNP 55% 2862 s36 REF 65% 2863 s36 SNP 70% 2864 s36 SNP 60% 2865 s36 REF 55% 2866 s36 SNP 65% 2867 s36 REF 60% 2868 s36 SNP 45% 2869 s36 REF 40% 2870 s36 SNP 70% 2871 s36 REF 60% 2872 s36 SNP 65% 2873 s36 SNP 40% 2874 s36 REF 35% 2875 s36 SNP 50% 2876 s36 REF 45% 2877 s36 SNP 65% 2878 s36 REF 60% 2879 s36 REF 65% 2880 s36 SNP 65% 2881 s36 SNP 60% 2882 s36 REF 55% 2883 s36 REF 65% 2884 s36 SNP 65% 2885 s36 REF 60% 2886 s36 REF 60% 2887 s37 SNP 45% 2888 s37 SNP 55% 2889 s37 REF 55% 2890 s37 REF 45% 2891 s37 REF 50% 2892 s37 SNP 50% 2893 s37 SNP 50% 2894 s37 REF 50% 2895 s37 REF 60% 2896 s37 SNP 60% 2897 s37 SNP 55% 2898 s37 REF 55% 2899 s37 SNP 50% 2900 s37 REF 50% 2901 s37 SNP 50% 2902 s37 SNP 50% 2903 s37 SNP 60% 2904 s37 REF 60% 2905 s37 REF 50% 2906 s37 SNP 55% 2907 s37 REF 55% 2908 s37 SNP 60% 2909 s37 REF 60% 2910 s37 SNP 55% 2911 s37 REF 55% 2912 s37 REF 55% 2913 s37 SNP 55% 2914 s37 REF 60% 2915 s37 REF 55% 2916 s37 SNP 55% 2917 s37 REF 50% 2918 s37 SNP 50% 2919 s37 REF 60% 2920 s37 REF 50% 2921 s37 SNP 60% 2922 s37 SNP 50% 2923 s37 REF 50% 2924 s37 SNP 55% 2925 s37 REF 55% 2926 s37 SNP 60% 2927 s37 SNP 55% 2928 s37 SNP 60% 2929 s37 REF 60% 2930 s37 REF 55% 2931 s37 REF 55% 2932 s37 SNP 55% 2933 s37 REF 50% 2934 s37 SNP 50% 2935 s37 SNP 50% 2936 s37 SNP 60% 2937 s37 REF 60% 2938 s37 REF 50% 2939 s37 REF 50% 2940 s37 SNP 50% 2941 s38 SNP 65% 2942 s38 REF 60% 2943 s38 SNP 55% 2944 s38 REF 65% 2945 s38 SNP 60% 2946 s38 REF 70% 2947 s38 SNP 65% 2948 s38 SNP 65% 2949 s38 REF 70% 2950 s38 REF 65% 2951 s38 SNP 60% 2952 s38 SNP 65% 2953 s38 REF 70% 2954 s38 SNP 65% 2955 s38 REF 65% 2956 s38 SNP 60% 2957 s38 REF 70% 2958 s38 REF 70% 2959 s38 SNP 65% 2960 s38 REF 70% 2961 s38 REF 70% 2962 s38 SNP 65% 2963 s38 SNP 60% 2964 s38 REF 65% 2965 s38 REF 65% 2966 s38 SNP 60% 2967 s38 REF 70% 2968 s38 SNP 65% 2969 s38 SNP 65% 2970 s38 REF 70% 2971 s38 SNP 65% 2972 s38 REF 70% 2973 s38 SNP 65% 2974 s38 REF 70% 2975 s38 SNP 65% 2976 s38 REF 70% 2977 s38 REF 70% 2978 s38 SNP 65% 2979 s38 SNP 60% 2980 s38 REF 65% 2981 s38 REF 65% 2982 s38 SNP 60% 2983 s38 SNP 65% 2984 s38 REF 70% 2985 s38 REF 70% 2986 s38 REF 70% 2987 s38 SNP 65% 2988 s38 REF 70% 2989 s38 SNP 65% 2990 s38 REF 70% 2991 s38 SNP 65% 2992 s38 REF 70% 2993 s38 SNP 65% 2994 s38 REF 70% 2995 s38 SNP 60% 2996 s38 REF 65% 2997 s38 SNP 60% 2998 s38 REF 65% 2999 s38 SNP 65% 3000 s38 SNP 60% 3001 s38 REF 65% 3002 s38 REF 65% 3003 s38 SNP 60% 3004 s38 SNP 65% 3005 s38 SNP 60% 3006 s38 REF 65% 3007 s38 REF 70% 3008 s38 SNP 65% 3009 s38 SNP 55% 3010 s38 REF 60%

[0154] Examples are provided below to facilitate a more complete understanding of the invention. The following examples illustrate the exemplary modes of making and practicing the invention. However, the scope of the invention is not limited to specific embodiments disclosed in these Examples, which are for purposes of illustration only.

EXPERIMENTAL DETAILS

Example 1

Rho Correction Anaylsis

[0155] Guide sequences comprising 17-20 nucleotides in the sequences of 17-20 contiguous nucleotides set forth in SEQ ID NOs: 1-3010 are screened for high on target activity. On target activity is determined by DNA capillary electrophoresis analysis.

[0156] According to DNA capillary electrophoresis analysis, guide sequences comprising 17-20 nucleotides in the sequences of 17-20 contiguous nucleotides set forth in SEQ ID NOs: 1-3010 are found to be suitable for correction of the Rho gene.

Discussion

[0157] The guide sequences of the present invention are determined to be suitable for targeting the Rho gene.

REFERENCES

[0158] 1. Ahmad and Allen (1992) “Antibody-mediated Specific Binging and Cytotoxicity of Lipsome-entrapped Doxorubicin to Lung Cancer Cells in Vitro”, Cancer Research 52:4817-20 [0159] 2. Anders (1992) “Human gene therapy”, Science 256:808-13 [0160] 3. Basha et al. (2011) “Influence of Cationic Lipid Composition on Gene Silencing Properties of Lipid Nanoparticle Formulations of siRNA in Antigen-Presenting Cells”, Mol. Ther. 19(12):2186-200 [0161] 4. Behr (1994) Gene transfer with synthetic cationic amphiphiles: Prospects for gene therapy”, Bioconjuage Chem 5:382-89 [0162] 5. Blaese (1995) “Vectors in cancer therapy: how will they deliver”, Cancer Gene Ther. 2:291-97 [0163] 6. Blaese et al. (1995) “T lympocyte-directed gene therapy for ADA-SCID: initial trial results after 4 years”, Science 270(5235):475-80 [0164] 7. Buchschacher and Panganiban (1992) “Human immunodeficiency virus vectors for inducible expression of foreign genes”, J. Virol. 66:2731-39 [0165] 8. Burstein et al. (2017) “New CRISPR-Cas systems from uncultivated microbes”, Nature 542:237-41 [0166] 9. Chung et al. (2006) “Agrobacterium is not alone: gene transfer to plants by viruses and other bacteria”, Trends Plant Sci. 11(1):1-4 [0167] 10. Coelho et al. (2013) “Safety and Efficacy of RNAi Therapy for Transthyretin Amyloidosis”, N Engl J. Med 369:819-29 [0168] 11. Crystal (1995) “Transfer of genes to humans: early lessons and obstacles to success”, Science 270(5235):404-10 [0169] 12. Dillon (1993) “Regulation gene expression in gene therapy” Trends in Biotechnology [0170] 13. Dranoff et al. (1997) “A phase I study of vaccination with autologous, irradiated melanoma cells engineered to secrete human granulocyte macrophage colony stimulating factor”, Hum. Gene Ther. 8(1):111-23 [0171] 14. Dunbar et al. (1995) “Retrovirally marked CD34-enriched peripheral blood and bone marrow cells contribute to long-term engraftment after autologous transplantation”, Blood 85:3048-57 [0172] 15. Ellem et al. (1997) “A case report: immune responses and clinical course of the first human use of ganulocyte/macrophage-colony-stimulating-factor-tranduced autologous melanoma cells for immunotherapy”, Cancer Immunol Immunother 44:10-20 [0173] 16. Gao and Huang (1995) “Cationic liposome-mediated gene transfer” Gene Ther. 2(10):710-22 [0174] 17. Haddada et al. (1995) “Gene Therapy Using Adenovirus Vectors”, in: The Molecular Repertoire of Adenoviruses III: Biology and Pathogenesis, ed. Doerfler and Bohm, pp. 297-306 [0175] 18. Han et al. (1995) “Ligand-directed retro-viral targeting of human breast cancer cells”, Proc Natl Acad Sci U.S.A. 92(21):9747-51 [0176] 19. Inaba et al. (1992) “Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor”, J Exp Med. 176(6):1693-702 [0177] 20. Jinek et al. (2012) “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity,” Science 337(6096):816-21 [0178] 21. Johan et al. (1992) “GLVR1, a receptor for gibbon ape leukemia virus, is homologous to a phosphate permease of Neurospora crassa and is expressed at high levels in the brain and thymus”, J Virol 66(3):1635-40 [0179] 22. Judge et al. (2006) “Design of noninflammatory synthetic siRNA mediating potent gene silencing in vivo”, Mol Ther. 13(3):494-505 [0180] 23. Kohn et al. (1995) “Engraftment of gene-modified umbilical cord blood cells in neonates with adnosine deaminase deficiency”, Nature Medicine 1:1017-23 [0181] 24. Kremer and Perricaudet (1995) “Adenovirus and adeno-associated virus mediated gene transfer”, Br. Med. Bull. 51(1):31-44 [0182] 25. Macdiarmid et al. (2009) “Sequential treatment of drug-resistant tumors with targeted minicells containing siRNA or a cytotoxic drug”, Nat Biotehcnol. 27(7):643-51 [0183] 26. Malech et al. (1997) “Prolonged production of NADPH oxidase-corrected granulocyes after gene therapy of chronic granulomatous disease”, PNAS 94(22):12133-38 [0184] 27. Miller et al. (1991) “Construction and properties of retrovirus packaging cells based on gibbon ape leukemia virus”, J Virol. 65(5):2220-24 [0185] 28. Miller (1992) “Human gene therapy comes of age”, Nature 357:455-60 [0186] 29. Mitani and Caskey (1993) “Delivering therapeutic genes — matching approach and application”, Trends in Biotechnology 11(5):162-66 [0187] 30. Nabel and Felgner (1993) “Direct gene transfer for immunotherapy and immunization”, Trends in Biotechnology 11(5):211-15 [0188] 31. Remy et al. (1994) “Gene Transfer with a Series of Lipphilic DNA-Binding Molecules”, Bioconjugate Chem. 5(6):647-54 [0189] 32. Sentmanat et al. (2018) “A Survey of Validation Strategies for CRISPR-Cas9 Editing”, Scientific Reports 8:888, doi:10.1038/s41598-018-19441-8 [0190] 33. Sommerfelt et al. (1990) “Localization of the receptor gene for type D simian retroviruses on human chromosome 19”, J. Virol. 64(12):6214-20 [0191] 34. Van Brunt (1988) “Molecular framing: transgenic animals as bioactors” Biotechnology 6:1149-54 [0192] 35. Vigne et al. (1995) “Third-generation adenovectors for gene therapy”, Restorative Neurology and Neuroscience 8(1,2): 35-36 [0193] 36. Wilson et al. (1989) “Formation of infectious hybrid virion with gibbon ape leukemia virus and human T-cell leukemia virus retroviral envelope glycoproteins and the gag and pol proteins of Moloney murine leukemia virus”, J. Virol. 63:2374-78 [0194] 37. Yu et al. (1994) “Progress towards gene therapy for HIV infection”, Gene Ther. 1(1):13-26 [0195] 38. Zetsche et al. (2015) “Cpf1 is a single RNA-guided endonuclease of a class 2 CRIPSR-Cas system” Cell 163(3):759-71 [0196] 39. Zuris et al. (2015) “Cationic lipid-mediated delivery of proteins enables efficient protein based genome editing in vitro and in vivo” Nat Biotechnol. 33(1):73-80