Modulators of ROR-gamma Receptors, Composition and Use Thereof

20170298090 · 2017-10-19

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention provides novel methods to treat disease by modulating retinoid-related orphan receptor gamma (ROR-gamma) in vitro and in vivo with ursolic acid analogs, and compositions thereof. The methods and compounds disclosed herein are useful for inhibiting the differentiation of a population of T cells, or treating a disease related to Th17 cell responses in a subject. Examples of such diseases include, but are not limited to, autoimmune diseases, multiple sclerosis, rheumatoid arthritis, psoriasis and diabetes.

    Claims

    1. A compound for modulating retinoid-related orphan receptor gamma (ROR-gamma), said compound has the structure of: ##STR00100## or a physiologically acceptable salt or hydrate or solvate thereof, wherein R.sub.1 is selected from the group consisting of: ##STR00101## ##STR00102##

    2. The compound of claim 1, wherein R.sub.1 is selected from the group consisting of: ##STR00103##

    3. A composition comprising the compound of claim 1, wherein the composition comprises at least one pharmaceutically acceptable carrier or diluent.

    4. The composition of claim 3, wherein the composition is in a form of a tablet, a capsule, an injectable composition, an ingestible composition, a nasal spray, an aerosol, or a suppository.

    5. A compound for modulating retinoid-related orphan receptor gamma (ROR-gamma), said compound has the structure of: ##STR00104## or a physiologically acceptable salt or hydrate or solvate thereof, wherein R.sub.2 is selected from the group consisting of: ##STR00105## ##STR00106##

    6. The compound of claim 5, wherein R.sub.2 is selected from the group consisting of: ##STR00107##

    7. A composition comprising the compound of claim 5, wherein the composition comprises at least one pharmaceutically acceptable carrier or diluent.

    8. The composition of claim 7, wherein the composition is in a form of a tablet, a capsule, an injectable composition, an ingestible composition, a nasal spray, an aerosol, or a suppository.

    9. A compound for modulating retinoid-related orphan receptor gamma (ROR-gamma), said compound has the structure of: ##STR00108## or a physiologically acceptable salt or hydrate or solvate thereof, wherein R.sub.4 is selected from the group consisting of: ##STR00109##

    10. A composition comprising the compound of claim 9, wherein the composition comprises at least one pharmaceutically acceptable carrier or diluent.

    11. A method of inhibiting differentiation of a population of T cells, comprising contacting said T cells with a composition comprising a compound having the structure of: ##STR00110## ##STR00111## ##STR00112## or a physiologically acceptable salt or hydrate or solvate thereof.

    12. The method of claim 11, wherein said T cells are Th17 cells.

    13. A method of treating a disease caused by Th17 cell activities in a subject in need of such treatment, said method comprises administering to said subject a composition comprising a therapeutically effective amount of a compound having the structure of: ##STR00113## ##STR00114## ##STR00115## or a physiologically acceptable salt or hydrate or solvate thereof.

    14. The method of claim 13, wherein the disease is an inflammatory disease, autoimmune disease, or a disease related to excessive function of Th17 cells.

    15. The method of claim 13, wherein the disease is autoimmune encephalomyelitis, collagen-induced arthritis, multiple sclerosis, rheumatoid arthritis, psoriasis, Crohn's disease, asthma, inflammatory bowel disease, arthritis, melanoma, systemic lupus erythematosus, allograft rejection, ankylosing spondilitis, scleroderma, Type I diabetes, psoriatic arthritis, osteoarthritis, or atopic dermatitis.

    16. The method of claim 13, wherein the composition is in a form of a tablet, a capsule, an injectable composition, an ingestible composition, a nasal spray, an aerosol, or a suppository.

    17. The method of claim 13, wherein the composition is administered in a route selected from the group consisting of mucosal, oral, nasal, topical, transdermal, intradermal, parenteral, intraperitoneal, intramuscular, intravenous, subcutaneous, rectal, intraarticular, intramedullary, intraocular, buccal, and sublingual application.

    18. The method of claim 13, wherein the compound is administered daily dosage of about 100 to 500 mg/kg body weight of the subject.

    19. The method of claim 13, wherein the method further comprises administering to said subject a second therapeutic agent or treatment for said disease.

    20. The method of claim 19, wherein said second therapeutic agent is a STAT3 inhibitor or IL-21 inhibitor.

    Description

    BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

    [0103] FIG. 1 shows that UA, KL001 and other UA analogs inhibited IL-17 and IL-17F expression in Th17 cells.

    [0104] FIG. 2 shows that KL001 dose-dependently inhibited Th17 differentiation with an IC50 value around 0.49 μM.

    [0105] FIG. 3 shows that UA and KL001 ameliorated experimental autoimmune encephalomyelitis (EAE) in a preventative disease model in mice.

    [0106] FIG. 4 shows that KL001 treatment, but not UA, ameliorated EAE in a therapeutic disease model in mice.

    [0107] FIG. 5 shows that KL001 treatment ameliorated psoriatic symptoms in a preventive imiquimod (IMQ)-induced psoriasis model.

    [0108] FIG. 6 shows the UA derived chemicals 201702-1 to 201702-4 and 201509-1 to 201509-3 inhibited Th17 differentiation in in vitro cultures.

    [0109] FIG. 7 shows the structure of ursolic acid, KL001, KL002, KL003, KL004 and KL005.

    DETAILED DESCRIPTION OF THE INVENTION

    [0110] Th17 cells have recently emerged as a major player in inflammatory and autoimmune diseases via the production of pro-inflammatory cytokines IL-17, IL-17F, IL-21 and IL-22. Th17 cells have been recently discovered as the third effector CD4+ T helper subset. Park, H., et al., A Distinct Lineage of CD4 T Cells Regulates Tissue Inflammation by Producing Interleukin 17, Nat Immunol. 6:1133-1141 (2005); Harrington, L. E., et al., Interleukin 17-Producing CD4+ Effector T Cells Develop via a Lineage Distinct From the T Helper Type 1 and 2 Lineages, Nat Immunol. 6:1123-1132 (2005). Th17 cells produce IL-17, IL-17F and IL-22. Dong, C., TH17 Cells in Development: An Updated View of Their Molecular Identity and Genetic Programming, Nat Rev Immunol. 8:337-348 (2008); Korn, T., et al., IL-17 and Th17 Cells, Annu Rev Immunol. 27:485-517 (2009). Although Th17 cells play important roles in host defense against bacterial and fungal infections, they have been also linked to many immune-related diseases, including psoriasis, rheumatoid arthritis, multiple sclerosis, inflammatory bowel diseases, periodontal diseases and asthma airway inflammatory diseases. Korn, T., et al., IL-17 and Th17 Cells, Annu Rev Immunol. 27:485-517 (2009); Tesmer, L. A., et al., Th17 Cells in Human Disease, Immunol Rev. 223:87-113 (2008). Recently, the anti-IL-17 and anti-IL-17RA antibodies were shown to have good efficacy in treatment of multiple human diseases in phase II or phase III clinical trials. Tse, M. T. IL-17 antibodies gain momentum, Nature reviews. Drug discovery 12, 815-816 (2013); Gaffen, S. L., Jain, R., Garg, A. V. and Cua, D. J. The IL-23-IL-17 immune axis: from mechanisms to therapeutic testing, Nature reviews Immunology 14: 585-600 (2014); Yang, J., Sundrud, M. S., Skepner, J. and Yamagata, T. Targeting Th17 cells in autoimmune diseases, Trends in pharmacological sciences 35: 493-500 (2014).

    [0111] In Th17 cells, the transcription of IL-17, IL-17F, IL-21 and IL-22 is mediated by Th17-specific transcriptional regulators RORγt and RORα, though the latter plays a less significant role in mice. Ivanov, I. I., et al., The Orphan Nuclear Receptor RORγt Directs the Differentiation Program of Proinflammatory IL-17+ T Helper Cells, Cell 126:1121-1133 (2006); Yang, X. O., et al., T Helper 17 Lineage Differentiation Is Programmed by Orphan Nuclear Receptors RORα and RORγt, Immunity 28:29-39 (2008). Mice deficient in RORγt and those deficient in both RORγt and RORα are defectively in production of IL-17, IL-17F, IL-21 and IL-22, and are resistant to experimental autoimmune encephalomyelitis (EAE), a mouse model for multiple sclerosis. Ivanov, I. I., et al., The Orphan Nuclear Receptor RORt Directs the Differentiation Program of Proinflammatory IL-17+ T Helper Cells, Cell 126:1121-1133 (2006); Yang, X. O., et al., T Helper 17 Lineage Differentiation Is Programmed by Orphan Nuclear Receptors RORα and RORγt, Immunity 28:29-39 (2008). In addition, the differentiation of Th17 cells and the associated cytokine production are directly controlled by RORγt together with a related transcription factor RORα. For example, it has been reported that the expression of IL-17 and development of Th17 cells are directly controlled by retinoid-related orphan receptor RORγt. Ivanov, I. I., et al., The Orphan Nuclear Receptor RORγt Directs the Differentiation Program of Proinflammatory IL-17+ T Helper Cells, Cell 126:1121-1133 (2006); Ivanov, I. I., et al., The Orphan Nuclear Receptor RORγt Directs the Differentiation Program of Proinflammatory IL-17+ T Helper Cells, Cell 126:1121-1133 (2006). Noteworthy, to date, although a number of RORγt inhibitors have been identified to inhibit Th17 differentiation in vitro or in vivo, their effect in clinical application in treatment of Th17-related diseases has not yet been reported. Yang, J., Sundrud, M. S., Skepner, J. and Yamagata, T. Targeting Th17 cells in autoimmune diseases, Trends in pharmacological sciences 35: 493-500 (2014).

    [0112] Moreover, until the present disclosure, there has been no effective therapy for controlling of excessive TH17 responses and related autoimmune diseases. Now, through the inhibition of RORγt via UA, KL001 and related analogs, it is shown that RORγt inhibitors can be useful to treat autoimmune disease, inflammation, cancer, and immunity disorders related to excellular bacteria, fungus, and viruses, and other diseases and disorders associated with the over expression of: IL-17; IL-17F; IL-21; and IL-21, the production of one or more of the pro-inflammatory cytokines: IL-17; IL-17F; IL-21; and IL-22, and/or generally excessive Th17 cell response. See e.g., Korn, T., et al., IL-17 and Th17 Cells, Annu Rev Immunol. 27:485-517 (2009). More specifically, through the inhibition of RORγt via UA, KL001 and related UA analogs, it is shown that RORγt inhibitors can be useful to treat multiple sclerosis, psoriasis, asthma, inflammatory bowel disease, arthritis, melanoma, rheumatoid arthritis, systemic lupus erythematosus, allograft rejection, ankylosing spondilitis, scleroderma, Type I diabetes, psoriatic arthritis, osteoarthritis, and atopic dermatitis.

    [0113] IL-21 regulates the differentiation of CD4+ T cells into TH17 cells in an autocrine manner. Expression of IL-21 is induced in T cells by IL-6 via STAT3 and is necessary in the generation of TH17 cells via STAT3-dependent upregulation of RORγt. IL-21 acts in an autocrine fashion in the differentiation of TH17 cells as IFN-γ does for TH1 cells and IL-4 for TH2 cells. Furthermore, the differentiation of TH17 cells can be modulated via the IL-21 signaling pathway. Moreover, any interruption to the pathway upstream of STAT3 will prevent the activation of STAT3, the differentiation of TH17 cells and ultimate expression of IL-21 and other cytokines expressed by the TH17 cells. US Pub. App. No. 2010/0247547 Paragraphs 53, 54, 55, 56, 57 and 58, and FIG. 12, incorporated herein by reference. As such, RORγt inhibitors taught herein suppress specific cytokine signaling pathways such as IL-21 and modulate the differentiation of THI7 cells. Moreover, the RORγt inhibitors may be useful in combination therapies, for example, with STAT3 small molecule inhibitors and IL-21 inhibitors to treat the diseases described herein.

    [0114] The phrase “therapeutically effective” is intended to qualify the amount of active ingredients used in the treatment of a disease or disorder. This amount will achieve the goal of reducing or eliminating the said disease or disorder. The term “patient” means all mammals including humans. Examples of patients include humans, cows, dogs, cats, goats, sheep, pigs, and rabbits. In one embodiment, the patient is a human.

    [0115] While it may be possible for the molecules which inhibit RORγt activity to be administered as the raw chemical, it is also possible to present them as a pharmaceutical formulation. Accordingly, the pharmaceutical formulation may include the molecule or a pharmaceutically acceptable a salt, ester, prodrug or solvate thereof, where appropriate, together with one or more pharmaceutically acceptable carriers thereof and optionally one or more other therapeutic ingredients. The carrier(s) must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof. Proper formulation is dependent upon the route of administration chosen. Any of the well-known techniques, carriers, and excipients may be used as suitable and as understood in the art; e.g., in Remington's Pharmaceutical Sciences.

    [0116] The formulations of use molecules include those suitable for oral, parenteral (including subcutaneous, intradermal, intramuscular, intravenous, intraarticular, and intramedullary), intraperitoneal, transmucosal, transdermal, rectal and topical (including dermal, buccal, sublingual and intraocular) administration although the most suitable route may depend upon for example the condition and disorder of the recipient. The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All methods may include the step of bringing into association the molecule or a pharmaceutically acceptable salt, ester, prodrug or solvate thereof (“active ingredient”) with the carrier which constitutes one or more accessory ingredients.

    [0117] In certain instances, as noted above, it may be appropriate to administer a RORγt inhibitor (or a pharmaceutically acceptable salt, ester, or prodrug thereof) in combination with another therapeutic agent such as a STAT3 inhibitor or IL-21 inhibitor. Or, by way of example only, the therapeutic effectiveness of the inhibitors provided herein may be enhanced by administration of an adjuvant (i.e., by itself the adjuvant may only have minimal therapeutic benefit, but in combination with another therapeutic agent such as a STAT3 inhibitor, the overall therapeutic benefit to the patient is enhanced). Or, by way of example only, the benefit of experienced by a patient may be increased by administering one molecule as described herein with another therapeutic agent (which also includes a therapeutic regimen) that also has therapeutic benefit.

    [0118] Multiple therapeutic agents may be administered in any order or even simultaneously. If simultaneously, the multiple therapeutic agents may be provided in a single, unified form, or in multiple forms (by way of example only, either as a single pill or as two separate pills). One of the therapeutic agents may be given in multiple doses, or both may be given as multiple doses.

    [0119] In previous studies, ursolic acid (UA), a natural carboxylic acid ubiquitously present in plants, has been identified as a strong and selective inhibitor for RORγt function and TH17 differentiation. UA inhibited IL-17 production not only in developing Th17 cells but also in mature Th17 cells. Xu, T., et al. Ursolic acid suppresses interleukin-17 (IL-17) production by selectively antagonizing the function of RORgamma t protein. The Journal of biological chemistry 286: 22707-22710 (2011). In addition, UA treatment ameliorated experimental autoimmune encephalomyelitis (EAE) in a preventative disease model. Xu, T., et al. Ursolic acid suppresses interleukin-17 (IL-17) production by selectively antagonizing the function of RORgamma t protein. The Journal of biological chemistry 286: 22707-22710 (2011). Based on these studies, a series of UA derived chemicals was generated, among which it was found that KL001, though inhibited Th17 differentiation in vitro at a comparable level to UA, behaved better than UA in treatment of EAE disease in both preventative and therapeutic disease models. In addition, it was found that KL001 can significantly reduce the disease symptoms in a mouse model of psoriasis. As such, it is shown that KL001 and other UA derived chemicals, through releasing UA as the major active ingredient and via targeting RORγt, are viable drug products for developing treatments against Th17-mediated inflammatory diseases and cancer.

    [0120] As described herein, UA, KL001 and other UA derived chemicals shown in Examples below can selectively and effectively blocked the function of RORγt and IL-17 expression in both differentiated and developing Th17 cells and can be used in diseases associated with IL-17 expression and differentiation of Th17 cells. UA is a relatively non-toxic natural small molecule having a long history in herbal medicine practice. UA can be useful for the treatment of liver diseases, skin cancer and non lymphatic leukemia. In addition, treatment with UA has been shown to ameliorate a mouse model of human multiple sclerosis. Liu, J. Pharmacology of Oleanolic Acid and Ursolic Acid, J Ethnopharmacol. 49:57-68 (1995). Since KL001 and other UA derived chemicals can release UA as the major active ingredient under in vitro and in vivo settings, these UA analogs can be also used in treatment of these listed UA-treatable diseases.

    [0121] As noted above, to date, the role of RORγt inhibitors in clinical application in treating Th17-related diseases has not been reported. Yang, J., Sundrud, M. S., Skepner, J. and Yamagata, T. Targeting Th17 cells in autoimmune diseases, Trends in pharmacological sciences 35: 493-500 (2014). Moreover, until the present disclosure, there has been no effective therapy for controlling of excessive TH17 responses and related autoimmune diseases. Now, through the inhibition of RORγt, it is postulated that RORγt inhibitors can treat multiple sclerosis, autoimmune disease, asthma, inflammatory bowel disease, inflammation, cancer, multiple sclerosis, arthritis, rheumatoid arthritis, asthma, systemic lupus erythematosus, allograft rejection, psoriasis, ankylosing spondilitis, scleroderma, Type I diabetes, psoriatic arthritis,osteoarthritis, and atopic dermatitis, and immunity disorders related to excellular bacteria, fungus, and viruses, and any disease associated with the over-expression of IL-17, IL-17F, IL-21 and IL-21, the production of one or more of the pro-inflammatory cytokines IL-17, IL-17F, IL-21 and IL-22, and/or generally excessive Th17 cell response.

    [0122] It has been demonstrated that UA, KL001 and other UA analogs inhibit TH17 differentiation under in vitro and in vivo animal disease models. By using both preventative and therapeutic EAE models, as well as IMQ-induced psoriasis model, it was demonstrated that RORγt inhibitors can be used to cure TH17-related diseases. More importantly, KL001 releases UA as the major active ingredient in these animal disease models, while UA is a natural product present in many medical herbs and human diet, and has already been demonstrated to be relatively non-toxic (LD50>600 mg/kg body weight in rodents for intraperitoneal injection. Gautam, R. & Jachak, S. et al., Recent Developments in Anti-Inflammatory Natural Products, Med. Res. Rev. 29:767-820 (2009). Indeed, it has been already recommended for skin cancer therapy in Japan. Muto, Y., et al., Present Status of Research on Cancer Chemoprevention in Japan, Japanese J. Clin. Oncology 20:219-224 (1990). The selective effect of KL001 or other UA analogs on Th17 cells, together with the low toxicity and long-term medical practice of their major active ingredient UA, provides KL001 and other UA analogs a great advantage over other non-UA related RORγt inhibitors in clinical applications for developing treatment of Th17 related-autoimmune diseases.

    [0123] Ursolic acid (UA) is a relatively non-toxic natural pentacyclictriterpenoid carboxylic acid present in numerous plants, medical herbs and even human diet. Gautam, R. & Jachak, et al., Recent Developments in Anti-Inflammatory Natural Products, Med. Res. Rev. 29:767-820 (2009). UA has been shown to have different pharmacological activities, including anti-tumor and anti-inflammation effects. Liu, J. Pharmacology of Oleanolic Acid and Ursolic Acid, J Ethnopharmacol. 49:57-68 (1995); Ikeda, Y., et al., Ursolic Acid: An Anti- and Pro-Inflammatory Triterpenoid, Mol Nutr Food Res. 52:26-42 (2008). While useful in a wide variety and number of different types of treatments and disease, for the first time, it was demonstrated that UA is also a specific and selective inhibitor for RORγt and TH17 cells. To search for more effective RORγt and TH17 inhibitors, a series of UA analogs was developed and examined their role in inhibiting TH17 cells in an in vitro differentiation system. As taught below, it was found that several of them including KL001, KL002 and KL005 showed comparable efficacy with UA in inhibiting TH17 differentiation (FIG. 1). After a further investigation, it was demonstrated that KL001 was superior to UA in ameliorating EAE diseases in both preventative and therapeutic disease models in mice (FIGS. 2 and 3), possibly due to better bio-availability in in vivo exposures.

    [0124] Taken together, these data strongly suggest UA, KL001 and UA related analogs disclosed immediately below in the examples are valuable drug candidates for treatment of Th17-related autoimmune diseases, as well as for the diseases targeted by UA in clinical application, including liver diseases and skin cancer. Liu, J. Pharmacology of Oleanolic Acid and Ursolic Acid, J Ethnopharmacol. 49:57-68 (1995).

    [0125] In one embodiment, the present invention provides a compound for modulating ROR-gamma. The compound has the structure of:

    ##STR00009##

    or a physiologically acceptable salt or hydrate, or solvate thereof, wherein R.sub.1 is selected from the group consisting of:

    ##STR00010## ##STR00011##

    or R.sub.1 is selected from the group consisting of:

    ##STR00012##

    In another embodiment, the compound has the structure of:

    ##STR00013##

    wherein R.sub.2 is selected from the group consisting of:

    ##STR00014## ##STR00015##

    or R.sub.2 is selected from the group consisting of:

    ##STR00016##

    In another embodiment, the compound has the structure of:

    ##STR00017##

    wherein R.sub.4 is selected from the group consisting of:

    ##STR00018##

    [0126] The present invention also provides a composition comprising any one of the compounds described above, wherein the composition comprises at least one pharmaceutically acceptable carrier or diluent.

    [0127] In one embodiment, the present invention provides a composition comprising any one of the compounds described above, in a form of a tablet, a capsule, an injectable composition, an ingestible composition, a nasal spray, an aerosol, or a suppository.

    [0128] In one embodiment, the present invention provides a method of inhibiting differentiation of a population of T cells or Th17 cells by contacting the T cells or Th17 cells with a composition containing a compound having the structure of:

    ##STR00019## ##STR00020## ##STR00021##

    or a physiologically acceptable salt, hydrate, or solvate thereof.

    [0129] In another embodiment, the present invention provides a method of treating a disease caused by Th17 cell activities in a subject in need of such treatment, said method comprises administering to said subject a composition comprising a therapeutically effective amount of a compound having the structure of:

    ##STR00022## ##STR00023## ##STR00024##

    or a physiologically acceptable salt, hydrate, or solvate thereof.

    [0130] In one embodiment, the present invention uses the aforementioned method to treat an inflammatory disease, autoimmune disease, or a disease related to excessive function of Th17 cells.

    [0131] In one embodiment, the present invention uses the described method to treat autoimmune encephalomyelitis, collagen-induced arthritis, multiple sclerosis, rheumatoid arthritis, psoriasis, Crohn's disease, asthma, inflammatory bowel disease, arthritis, melanoma, systemic lupus erythematosus, allograft rejection, ankylosing spondilitis, scleroderma, Type I diabetes, psoriatic arthritis, osteoarthritis, or atopic dermatitis.

    [0132] In one embodiment, the composition of the present invention is in the form of a tablet, capsule, injectable composition, ingestible composition, nasal spray, aerosol or a suppository.

    [0133] In one embodiment, the composition of the present invention is administered in a route selected from a group consisting of mucosal, oral, nasal, topical, transdermal, intradermal, parenteral, intraperitoneal, intramuscular, intravenous, subcutaneous, rectal, intraarticular, intramedullary, intraocular, buccal, and sublingual application.

    [0134] In one embodiment of the above method, the compound is administered in a daily dosage of about 100 to 500 mg/kg body weight of the subject. In another embodiment, the compound is administered in a daily dosage of about 500 mg/kg body weight. In another embodiment, the compound is administered in a daily dosage of about 50-250 mg/kg body weight.

    [0135] In one embodiment, the above method comprises administering a second therapeutic agent or treatment for the aforementioned diseases.

    [0136] In one embodiment of the above method, the method further comprises administering to the subject a second therapeutic agent or treatment for said disease. In one embodiment, the second therapeutic agent is a STAT3 inhibitor, an IL-21 inhibitor, or an IL-22 inhibitor.

    Methods of Preparation

    [0137] The compounds of the present invention may be prepared by methods as those illustrated in the following scheme I to II. Starting materials are commercially available or prepared by the methods as those illustrated in the following scheme III to V. Additional methods for making selected compounds of the present invention are provided below. Solvents, temperatures, pressures and other reaction conditions may readily be selected by one of ordinary skill in the art.

    EXAMPLE 1

    KL001

    [0138] ##STR00025##

    [0139] Step 1: To a solution of 16 grams 4,5-dimethyl-1,3-dioxol-2-one in CCl4 (250 mL) was added NBS (23.4 g, 131.5 mmol) and AIBN (1.3 g, 7.88 mmol), then the reaction mixture was heated to 80° C. and stirred for 2 hrs. Monitored the starting material gone by TLC. The mixture was filtered and the filtrate was washed with water and brine, the organic phase was dried over Na.sub.2SO.sub.4 and concentrated to give crude product as a yellow oil which was used directly next step (25.3 g, yield 93%).

    [0140] Step 2: K.sub.2CO.sub.3 (300 mg, 2 mmol) was added to a solution of 4-(bromomethyl)-5-methyl-1,3-dioxol-2-one (390 mg, 2 mmol) and Ursolic acid (460 mg, 1 mmol) in 20 mL acetone, then the reaction mixture was stirred at 55° C. for 24 hours. The mixture was concentrated to removed acetone, 100 mL water was added, the solid was filtered and washed with water, dried to give product. (385 mg, yield: 68%) as a white solid. .sup.1HNMR (CDCl3, 300 MHz): δ 5.25˜5.26 (t, 1H, J=4.8 Hz), 4.67˜4.87 (q, 2H), 3.18-3.24 (m, 1H), 2.19˜2.24 (m, 1H), 2.15˜2.16 (d, 3H), 1.18˜1.98 (m, 23H), 1.08 (s, 3H), 0.99 (s, 3H), 0.86˜0.88 (d, 3H), 0.85 (s, 3H), 0.77˜0.79 (d, 3H, J=8.4 Hz), 0.79 (s, 3H), 0.65 (s, 3H). ESI-MS m/z 569.4 [M+H].

    EXAMPLE 2

    [0141] ##STR00026##

    [0142] Step 1: To a solution of 2-bromoacetyl bromide (2.3 g, 11.4 mmol) in 50 mL DCM was added morpholine (1.22 g, 14 mmol) and Et.sub.3N (1.9 mL, 13.7 mmol). The reaction was stirred at room temperature for 1 hr. The mixture was washed with water, brine, dried and concentrated to give crude product used directly.

    [0143] Step 2: K.sub.2CO.sub.3 (300 mg, 2 mmol) was added to a solution of 2-bromo-1-morpholinoethan-1-one (412 mg, 2 mmol) and Ursolic acid (460 mg, 1 mmol) in 20 mL acetone, then the reaction mixture was stirred at room temperature for overnight. The mixture was concentrated to removed acetone, 100 mL water was added, the solid was filtered and washed with water, dried to give product. (408 mg, yield: 70%) as a white solid. .sup.1HNMR (CDCl3, 300 MHz): δ 5.16˜5.18 (t, 1H, J=4.8 Hz), 4.51˜4.62 (q, 2H), 3.5-3.6 (m, 8H), 3.11-3.18 (m, 1H), 2.90 (s, 3H), 2.88 (s, 3H), 2.13˜2.17 (m, 1H), 1.18˜1.98 (m, 23H), 1.01 (s, 3H), 0.92 (s, 3H), 0.86˜0.88 (d, 3H), 0.85 (s, 3H), 0.7˜0.79 (d, 3H, J=8.4 Hz). ESI-MS m/z 584.4 [M+H].

    EXAMPLE 3

    [0144] ##STR00027##

    [0145] Step 1: A mixture of Ursolic acid (1 g, 2.19 mmol), 1,2-dibromoethane (1 mL, 11.5 mmol) and K2CO3 (800 mg, 5.8 mmol) in 80 mL DMF was stirred at 50° C. in the seal tube for 8 hrs. The reaction mixture was concentrated, 400 mL water was added, the solid product was filtered and dried used directly.

    [0146] Step 2: K.sub.2CO.sub.3 (300 mg, 2 mmol) was added to step 1 product solution (560 mg, 1 mmol) and morpholine (175 mg, 2 mmol) in 100 mL acetone, then the reaction mixture was heated to 50° C. for 48 hrs. The mixture was filtered to remove the solid and the filtrate was concentrated and purified by flash column (Hexane/EA=5/1) to afford white solid 353 mg (62% yield). .sup.1HNMR (CDCl3, 300 MHz): δ 5.15˜5.17 (t, 1H, J=4.8 Hz), 4.04˜4.08 (t, 2H, J=8.0 Hz), 3.62˜3.65 (t, 2H, J=6.0 Hz), 3.12-3.17 (m, 1H), 2.52˜2.56 (t, 2H, J=8.0 Hz), 2.42˜2.45 (t, 2H, J=6.0 Hz), 2.12˜2.16 (m, 1H), 1.19˜1.97 (m, 23H), 1.00 (s, 3H), 0.93 (s, 3H), 0.86˜0.88 (d, 3H), 0.85 (s, 3H), 0.78˜0.80 (d, 3H, J=8.4 Hz), 0.72 (s, 3H), 0.69 (s, 3H). ESI-MS m/z 570.3 [M+H].

    EXAMPLE 4

    [0147] ##STR00028##

    [0148] Step 1: A mixture of Ursolic acid (46 mg, 0.11 mmol) and TFAA(0.056 mL) in 10 mL toluene was stirred at room temperature for 1 hr, then 2,3-dihydro-1H-inden-5-ol (17 mg, 0.12 mmol) was added and the reaction was refluxed for 24 hrs. The reaction mixture was concentrated, the solid crude product purified by Pre-TLC (PE/EA=1/1) to afford product as a white solid (47 mg, 75% yield). .sup.1HNMR (CDCl3, 300 MHz): δ 7.14˜7.16 (d, 1H, J=10.4 Hz), 6.84 (s, 1H), 6.71˜6.74 (dd, 1H, J=10.4 Hz), 5.30˜5.31(t, 1H, J=4.8 Hz), 3.20-3.25 (m, 1H), 2.84˜2.91 (q, 4H, J=9.6 Hz), 2.33˜2.37 (m, 1H), 1.20˜2.15 (m, 25H), 1.13 (s, 3H), 1.00 (s, 3H), 0.97˜0.99 (d, 3H), 0.94(s, 3H), 0.88˜0.90 (d, 3H, J=8.4 Hz), 0.90 (s, 3H), 0.79 (s, 3H). ESI-MS m/z 573.3 [M+H].

    EXAMPLE 5

    [0149] ##STR00029##

    [0150] Step 1: A mixture of ursolic acid (500 mg, 1.09 mmol), Ac.sub.2O (0.16 mL) and DMAP (25 mg) in 2.5 mL pyridine was stirred at room temperature for overnight. The reaction mixture was concentrated, 10 mL water was added, and adjust pH to 3˜4 with 0.1N HCl. The solid product was filtered and dried without further purification.

    [0151] Step 2: C.sub.2O.sub.2Cl.sub.2 (0.2 mL, 2.1 mmol) was added to a solution of step 1 product (300 mg, 0.6 mmol) in 30 mL DCM, the reaction was stirred at room temperature for overnight. The reaction solution was used directly in next step.

    [0152] Step 3: phenylmethanamine (1 eq) was added to a solution of step 2. The reaction was stirred at room temperature for overnight. The reaction solution was adjust pH=3˜4 with 1N HCl, and removed DCM in vacuum. The residue was dissolved in THF, added moderate amount MeOH, then drop-wise added 15% aq. NaOH. The reaction mixture was stirred at room temperature for overnight. Moderate amount water was added to reaction, adjust pH=3˜4 with 1N HCl, removed THF and MeOH. The precipitate solid was filtered, washed with a small amount MeOH to get product as white solid. .sup.1HNMR (CDCl3, 300 MHz): δ 7.26˜7.33 (m, 5H), 6.14˜6.18 (m, 1H), 5.21˜5.23 (m, 1H), 4.12˜4.61 (m, 2H), 3.20-3.24 (m, 1H), 1.28˜2.06 (m, 24H), 1.10 (s, 3H), 1.00 (s, 3H), 0.96 (s, 3H), 0.90(s, 3H), 0.85˜0.87 (d, 3H, J=8.8 Hz), 0.80 (s, 3H), 0.72 (s, 3H). ESI-MS m/z 546.3 [M+H].

    EXAMPLE 6

    [0153] ##STR00030##

    [0154] Step 1: A mixture of Ursolic acid (500 mg, 1.09 mmol), Ac.sub.2O (0.16 mL) and DMAP (25 mg) in 2.5 mL pyridine was stirred at room temperature for overnight. The reaction mixture was concentrated, 10 mL water was added, and adjust pH=3˜4 with 0.1N HCl, the solid product was filtered and dried to yield target compound as white solid. Yield: 580 mg.

    [0155] Step 2: DMF (10 ul), oxalyl chloride (0.46 mL, 5.45 mmol) was added to a solution of step 1 product (580 mg, 1.09 mmol) in 10 mL DCM, the reaction was stirred at room temperature overnight. The crude product was concentrated under vacuum used directly in the next step.

    [0156] Step 3: Sulfonamide (1 eq) was added to a solution of step 2 product in DCM (10 ml), TEA (5 eq) and DMAP (1.1 eq) were added to this solution. The reaction was stirred at 40° C. overnight, then washed with 10% Citric acid aqueous solution (3×10 mL). The organic phase was dried with Na.sub.2SO.sub.4 and concentrated under vacuum. The residue dissolved in MeOH, adjust pH˜12 with 15% aq. LiOH, then the reaction mixture was stirred at room temperature overnight. Moderate water was added to reaction, adjust pH=3˜4 with 1N HCl. After removing MeOH, precipitate solid was filtered, washed with a small amount MeOH get product. (1S,2R,4aS,6aS,6bR,10S,12aR,12bR,14bS)-10-hydroxy-1,2,6a,6b,9,9,12a-heptamethyl-N-(methylsulfonyl)-1,3,4,5,6,6a,6b,7,8,8a,9,10,11,12,12a,12b,13,14b-octadecahydropicene-4a(2H)-carboxamide is a white solid. ESI-MS m/z 534.2 [M+H], .sup.1HNMR (CDCl3): δ 8.19 (s, 1H), δ 5.42˜5.44 (t, 1H, J=4.8 Hz), 3.26 (s, 3H), 3.19-3.25 (m, 1H), 1.25˜2.11 (m, 25H), 1.12 (s, 3H), 1.00 (s, 3H), 0.97 (s, 3H), 0.94 (s, 3H), 0.87˜0.89 (d, 3H, J=8.4 Hz), 0.87 (s, 3H), 0.79 (s, 3H).

    TABLE-US-00001 No. Structure NMR/MS [00031]embedded image .sup.1H NMR (300 MHz, CDCl.sub.3) δ 5.15~5.18 (t, 1H, J = 4.8Hz), 3.53 (s, 3H), 3.11-3.16 (m, 1H), 2.13~2.17 (m, 1H), 1.18~1.98 (m, 23H), 1.01 (s, 3H), 0.92 (s, 3H), 0.86~0.88 (d, 3H), 0.85 (s, 3H), 0.77~0.79 (d, 3H, J = 8.4 Hz), 0.71 (s, 3H), 0.67 (s, 3H). ESI-MS m/z 562.3 [M + H]. [00032]embedded image .sup.1H NMR (CDCl3): δ 8.28 (s, 1H), 8.03~8.06 (m, 2H), 7.48~7.64 (m, 3H), 5.37~5.40 (t, 1H, J = 4.8Hz), 3.17-3.23 (m, 1H), 1.16~2.20 (m, 24H), 1.06 (s, 3H), 0.98 (s, 3H), 0.94 (d, 3H), 0.90 (s, 3H), 0.84~0.86 (d, 3H, J = 8.4Hz), 0.78 (s, 3H), 0.43 (s, 3H). ESI-MS m/z 596.3 [M + H].

    EXAMPLE 7

    [0157] ##STR00033##

    [0158] Step 1: To a solution of Ursolic acid (1 g, 2.18 mmol) in DMF (10 mL), 2-bromo ethanol (817 mg, 6.54 mmol) and potassium carbonate (904 mg, 6.54 mmol) were added and the mixture was stirred at room temperature for overnight. Water (50 mL) was added into the filtrate and the obtained mixture was stirred for additional 0.5 h. The precipitate was collected by filtration and washed with water to give the title compound as a white solid 1.1 g.

    [0159] Step 2: To a solution of step 1 product (400 mg, 0.8 mmol, 1 equiv) in dry CH2Cl2 (20 mL), Boc-L-valine (1.5 equiv), dicyclohexylcarbodiimide (DCC) (1.2 equiv), and 4-dimethyl-aminopyridine (DMAP) (0.5 equiv) were added and the mixture was stirred at room temperature for overnight. After filtration, the filtrate was evaporated to give a crude product which was purified by column chromatography (PE/EtOAc=10:1-8:1) to yield Boc-amino acid ethyl esters as a white solid (400 mg, 71.4%).

    [0160] Step 3: Dry hydrogen chloride gas was bubbled into a solution of step 2 product (88 mg, 0.125 mmol) in dry ether (3 mL) overnight. The precipitate was collected by filtration and washed with dry ether to give the final product, a white solid (50 mg, 62.8%). ESI-MS m/z 600.3 [M+H], .sup.1HNMR (CDCl3): δ 8.92 (s, 3H), 5.24 (s, 1H), 3.94-4.48 (m, 5H), 3.18˜3.25 (m, 1H), 1.27˜2.23 (m, 25H), 1.18 (s, 6H), 1.09 (s, 3H), 1.00 (s, 3H), 0.96 (s, 3H), 0.92 (s, 3H), 0.85˜0.87 (d, 3H, J=8.4 Hz), 0.79 (s, 3H), 0.74 (s, 3H).

    EXAMPLE 8

    [0161] ##STR00034##

    [0162] Step 1: To a solution of starting material (197 mg, 0.25 mmol, followed example 7 to make) in dry CH2Cl2 (10 mL), BBr3 (126 ul, 4N, 5 mmol) were drop wise added at −78° C. under Aragon gas and the mixture was stirred at room temperature for overnight. Saturation NaHCO3 (10 ml) was then added drop wise at −20° C. and stirred 0.5 h. The organic phase was dried with anhydrous Na2SO4, and filtrated. Concentrated under vacuum and purified by Pre-TLC get product as white solid. ESI-MS m/z 664.3 [M+H], .sup.1HNMR (CDCl3): δ 8.92 (s, 3H), 5.24 (s, 1H), 3.94-4.48 (m, 5H), 3.18˜3.25 (m, 1H), 1.27˜2.23 (m, 25H), 1.18 (s, 6H), 1.09 (s, 3H), 1.00 (s, 3H), 0.96 (s, 3H), 0.92 (s, 3H), 0.85˜0.87 (d, 3H, J=8.4 Hz), 0.79 (s, 3H), 0.74 (s, 3H).

    EXAMPLE 9

    [0163] ##STR00035## ##STR00036##

    [0164] Step 1: To a solution of Ursolic acid (3 g, 6.56 mmol) in DMF (20 mL), 1-bromopropan-2-one (1 mg, 7.3 mmol) and potassium carbonate (2.7 mg, 19.68 mmol) were added and the mixture was stirred at room temperature for overnight. Water (100 mL) was added into the filtrate and the obtained mixture was stirred for additional 0.5 h. The precipitate was collected by filtration and washed with water to give the title compound 2 as a white solid (3.3 g, 98%).

    [0165] Step 2: To a solution of compound 2 (3.3 g, 6.43 mmol) and pyridinium p-toluenesulfonate (0.017 g, 0.069 mmol) in CH.sub.2Cl.sub.2 (40 mL) a solution of 3,4-dihydro-2H-pyran (2.63 g, 31.25 mmol) in CH.sub.2Cl.sub.2 (20 mL) was added drop wise. The solution was stirred for 3 hours at room temperature, washed by saturated NaHCO.sub.3 aqueous solution (40 mL×3) and saturated NaCl aqueous solution (40 mL×3) respectively, dried with anhydrous Na2SO4, and filtrated. Concentrated under vacuum to get compound 3 used directly in next step (4.6 g, yellow oil).

    [0166] Step 3: A solution of compound 3 (4.6 g, 6.43 mmol) in methanol (150 mL) was cooled to 0° C., and then NaBH.sub.4 (2.4 g, 64.3 mmol) was added. The mixture was stirred for overnight at room temperature, and then concentrated to remove methanol. The residue was dissolved in EtOAc (50 mL) and washed with water (40 mL×3) and saturated NaCl aqueous solution (40 mL×3), respectively. The organic phase was dried with anhydrous Na.sub.2SO.sub.4, and filtrated. Concentrated under vacuum to get compound 4 used directly in the next step (4.9 g, yellow oil).

    [0167] Step 4: Compound 4 (4.9 g, 6.43 mmol), Boc-Val (2.1 g, 9.64 mmol), DCC (1.59 g, 7.71 mmol), catalytic amount of DMAP were dissolved in CH.sub.2Cl.sub.2 (25 mL) and stirred overnight at room temperature. The mixture was then filtrated and the filtrate was evaporated to give a crude product which was purified by column chromatography (PE/EtOAc=10:1-5:1) to compound 5 as white solid 2.8 g, (54.5%).

    [0168] Step 5: To a solution of compound 5 (2.8 g, 3.5 mmol) in methanol (25 mL) was added catalytic amount of p-toluenesulfonic acid and then the solution was stirred for overnight at room temperature. The mixture was evaporated to remove the solvent, and the residue was dissolved in EtOAc (35 mL). The solution was washed with saturated NaHCO3 aqueous solution (40 mL×3) and saturated NaCl aqueous solution (40 mL×3), respectively. The organic phase was dried with anhydrous Na2SO4, and filtrated, concentrated under vacuum to get compound 6 used directly in next step (2.57 g, white solid).

    [0169] Step 6: Dry hydrogen chloride gas was bubbled into a solution of compound 6 (2 g, 2.8 mmol) in dry ether for overnight. The precipitate was collected by filtration and washed with cold dry ether to give compound 7 (1.87 g, light yellow solid). ESI-MS m/z 615.1 [M+H], .sup.1HNMR (CDCl3): δ 8.91 (s, 3H), 5.23 (s, 1H), 5.17˜5.19 (m, 1H), 4.08 (s, 1H), 3.88-3.90 (m,1H), 3.19˜3.24 (m, 1H), 2.46˜2.49 (m, 1H), 2.18˜2.22 (d, 1H), 1.33˜2.02 (m, 28H), 1.18 (s, 6H), 1.08 (s, 3H), 0.99 (s, 3H), 0.95 (s, 3H), 0.92 (s, 3H), 0.84˜0.87 (d, 3H, J=8.4 Hz), 0.78 (s, 3H), 0.73 (s, 3H).

    [0170] Step 7: Compound 7 (500 mg, 0.77 mmol), Boc-Val (200 mg, 0.92 mmol), DCC (190 mg, 0.92 mmol), catalytic amount of DMAP were dissolved in CH.sub.2Cl.sub.2 (25 mL) and stirred overnight at room temperature. The mixture was then filtrated and the filtrate was evaporated to give a crude product which was purified by column chromatography (PE/EtOAc=8:1) to get compound 8 (white solid, 190 mg. 29.0%).

    [0171] Step 8: Dry hydrogen chloride gas was bubbled into a solution of compound 8 (190 mg, 0.22 mmol) in dry ether for overnight. The precipitate was collected by filtration and washed with cold dry ether to give compound 9 (white solid, 160 mg, 92.4%). ESI-MS m/z 714.1 [M+H], .sup.1HNMR (CDCl3): δ 8.37 (s, 3H), 5.24 (s, 1H), 5.17 (m, 1H), 4.37˜4.40 (m, 1H), 3.97-4.08 (m, 2H), 3.20˜3.24 (m, 1H), 1.26˜2.44 (m, 39H), 1.09 (s, 3H), 1.00 (s, 3H), 0.96 (s, 3H), 0.92 (s, 3H), 0.86 (s, 3H), 0.79 (s, 3H), 0.74 (s, 3H).

    [0172] The following compounds were prepared using a procedure similar to that described above.

    TABLE-US-00002 No. Structure NMR/MS 1 [00037]embedded image .sup.1H NMR (300 MHz, CDCl.sub.3) δ 5.15~5.18 (t, 1H, J = 4.8Hz), 3.53 (s, 3H), 3.11-3.16 (m, 1H), 2.13~2.17 (m, 1H), 1.18~1.98 (m, 23H), 1.01 (s, 3H), 0.92 (s, 3H), 0.86~0.88 (d, 3H), 0.85 (s, 3H), 0.77~0.79 (d, 3H, J = 8.4Hz), 0.71 (s, 3H), 0.67 (s, 3H). ESI-MS m/z 47.12 [M + H]. 2 [00038]embedded image .sup.1H NMR (300 MHz, CDCl.sub.3) δ 5.15~5.17 (t, 1H, J = 4.8Hz), 3.94~4.01 (q, 2H, J = 9.4Hz), 3.12-3.16 (m, 1H), 2.13~2.17 (m, 1H), 1.18~1.98 (m, 23H), 1.12~1.17 (t, 3H, J = 9.4Hz), 1.00 (s, 3H), 0.92 (s, 3H), 0.86~0.88 (d, 3H), 0.85 (s, 3H), 0.77~0.79 (d, 3H, J = 8.4Hz), 0.71 (s, 3H), 0.69 (s, 3H). ESI-MS m/z 485.2 [M + H]. 3 [00039]embedded image ESI-MS m/z 499.2 [M + H]. 4 [00040]embedded image .sup.1H NMR (300 MHz, CDCl.sub.3) δ 5.16~5.18 (t, 1H, J = 4.8Hz), 4.80~4.88 (m, 1H), 3.11-3.17 (m, 1H), 2.13~2.17 (m, 1H), 1.18~1.98 (m, 23H), 1.09~1.14 (q, 6H), 1.01 (s, 3H), 0.92 (s, 3H), 0.86~0.88 (d, 3H), 0.85 (s, 3H), 0.77~0.79 (d, 3H, J = 8.4Hz), 0.71 (s, 3H), 0.71 (s, 3H). ESI-MS m/z 499.2 [M + H]. 5 [00041]embedded image ESI-MS m/z 513.3 [M + H]. 6 [00042]embedded image ESI-MS m/z 513.3 [M + H]. 7 [00043]embedded image ESI-MS m/z 525.3 [M + H]. 8 [00044]embedded image ESI-MS m/z 539.3 [M + H]. 9 [00045]embedded image .sup.1H NMR (300 MHz, CDCl.sub.3) δ 7.30 (m, 5H), 5.19~5.21 (t, 1H, J = 4.8Hz), 4.92~5.10 (q, 2H), 3.11-3.18 (m, 1H), 2.13~2.17 (m, 1H), 1.18~1.98 (m, 23H), 1.01 (s, 3H), 0.92 (s, 3H), 0.86~0.88 (d, 3H), 0.85 (s, 3H), 0.77~0.79 (d, 3H, J = 8.4Hz), 0.71 (s, 3H), 0.67 (s, 3H). ESI-MS m/z 547.3 [M + H]. 10 [00046]embedded image ESI-MS m/z 548.3 [M + H]. 11 [00047]embedded image .sup.1H NMR (300 MHz, CDCl.sub.3) δ 5.22~5.24 (t, 1H, J = 4.8Hz), 4.12~4.16 (t, 2H, J = 8.0Hz), 3.19-3.24 (m, 1H), 2.58~2.61 (t, 2H, J = 8Hz), 2.32 (s, 6H), 2.20~2.24 (m, 1H), 1.25~2.04 (m, 23H), 1.08 (s, 3H), 0.99 (s, 3H), 0.93~0.95 (d, 3H), 0.92 (s, 3H), 0.85~0.87 (d, 3H, J = 8.4Hz), 0.79 (s, 3H), 0.76 (s, 3H). ESI-MS m/z 528.3 [M + H]. 12 [00048]embedded image ESI-MS m/z 554.3 [M + H]. 13 [00049]embedded image .sup.1H NMR (300 MHz, CDCl.sub.3) δ 5.15~5.17 (t, 1H, J = 4.8Hz), 4.04~4.08 (t, 2H, J = 8.0Hz), 3.62~3.65 (t, 2H, J = 6.0Hz), 3.12-3.17 (m, 1H), 2.52~2.56 (t, 2H, J = 8.0Hz), 2.42~2.45 (t, 2H, J = 6.0Hz), 2.12~2.16 (m, 1H), 1.19~1.97 (m, 23H), 1.00 (s, 3H), 0.93 (s, 3H), 0.86~0.88 (d, 3H), 0.85 (s, 3H), 0.78~0.80 (d, 3H, J = 8.4Hz), 0.72 (s, 3H), 0.69 (s, 3H). ESI-MS m/z 570.3 [M + H]. 14 [00050]embedded image ESI-MS m/z 568.3 [M + H]. 15 [00051]embedded image ESI-MS m/z 619.4 [M + H]. 16 [00052]embedded image ESI-MS m/z 533.3 [M + H]. 17 [00053]embedded image .sup.1H NMR (300 MHz, CDCl.sub.3) δ 7.14~7.16 (d, 1H, J = 10.4Hz), 6.84 (s, 1H), 6.71~6.74 (dd, 1H, J = 10.4Hz), 5.30~5.31 (t, 1H, J = 4.8Hz), 3.20-3.25 (m, 1H), 2.84~2.91 (q, 4H, J = 9.6Hz), 2.33~2.37 (m, 1H), 1.20~2.15 (m, 25H), 1.13 (s, 3H), 1.00 (s, 3H), 0.97~0.99 (d, 3H), 0.94 (s, 3H), 0.88~0.90 (d, 3H, J = 8.4Hz), 0.90 (s, 3H), 0.79 (s, 3H). ESI-MS m/z 573.3 [M + H]. 18 [00054]embedded image ESI-MS m/z 605.4 [M + H]. 19 [00055]embedded image .sup.1H NMR (300 MHz, CDCl.sub.3) δ 5.25~5.26 (t, 1H, J = 4.8Hz), 4.67~4.87 (q, 2H), 3.18-3.24 (m, 1H), 2.19~2.24 (m, 1H), 2.15~2.16 (d, 3H), 1.18~1.98 (m, 23H), 1.08 (s, 3H), 0.99 (s, 3H), 0.86~0.88 (d, 3H), 0.85 (s, 3H), 0.77~0.79 (d, 3H, J = 8.4Hz), 0.79 (s, 3H), 0.65 (s, 3H). ESI-MS m/z 569.4 [M + H]. 20 [00056]embedded image .sup.1H NMR (300 MHz, CDCl.sub.3) δ 5.16~5.18 (t, 1H, J = 4.8Hz), 4.51~4.62 (q, 2H), 3.11-3.18 (m, 1H), 2.90 (s, 3H), 2.88 (s, 3H), 2.13~2.17 (m, 1H), 1.18~1.98 (m, 23H), 1.01 (s, 3H), 0.92 (s, 3H), 0.86~0.88 (d, 3H), 0.85 (s, 3H), 0.77~0.79 (d, 3H, J = 8.4Hz), 0.71 (s, 3H), 0.67 (s, 3H). ESI-MS m/z 542.3 [M + H]. 21 [00057]embedded image ESI-MS m/z 598.4 [M + H]. 22 [00058]embedded image .sup.1H NMR (300 MHz, CDCl.sub.3) δ .16~5.18 (t, 1H, J = 4.8Hz), 4.51~4.62 (q, 2H), 3.5-3.6 (m, 8H), 3.11-3.18 (m, 1H) 2.90 (s, 3H), 2.88 (s, 3H), 2.13~2.17 (m, 1H), 1.18~1.98 (m, 23H), 1.01 (s, 3H), 0.92 (s, 3H), 0.86~0.88 (d, 3H), 0.85 (s, 3H), 0.7~0.79 (d, 3H, J = 8.4Hz). ESI-MS m/z 584.4 [M + H]. 23 [00059]embedded image ESI-MS m/z 568.4 [M + H]. 24 [00060]embedded image ESI-MS m/z 529.3 [M + H]. 25 [00061]embedded image ESI-MS m/z 597.4 [M + H]. 26 [00062]embedded image ESI-MS m/z 655.4 [M + H]. 27 [00063]embedded image ESI-MS m/z 599.4 [M + H]. 28 [00064]embedded image ESI-MS m/z 544.3 [M + H]. 29 [00065]embedded image ESI-MS m/z 620.4 [M + H]. 30 [00066]embedded image ESI-MS m/z 456.2 [M + H]. 31 [00067]embedded image ESI-MS m/z 470.3 [M + H]. 32 [00068]embedded image ESI-MS m/z 524.3 [M + H]. 33 [00069]embedded image ESI-MS m/z 500.3 [M + H]. 34 [00070]embedded image ESI-MS m/z 553.3 [M + H]. 35 [00071]embedded image ESI-MS m/z 570.3 [M + H]. 36 [00072]embedded image .sup.1H NMR (300 MHz, CDCl.sub.3) δ 7.26~7.33 (m 5H), 6.14~6.18 (m, 1H), 5.21~5.23 (m, 1H), 4.12~4.61 (m, 2H), 3.20-3.24 (m, 1H), 1.28~2.06 (m, 24H), 1.10 (s, 3H), 1.00 (s, 3H), 0.96 (s, 3H), 0.90 (s, 3H), 0.85~0.87 (d, 3H, J = 8.8Hz), 0.80 (s, 3H), 0.72 (s, 3H). ESI-MS m/z 546.3 [M + H]. 37 [00073]embedded image ESI-MS m/z 560.3 [M + H]. 38 [00074]embedded image ESI-MS m/z 560.3 [M + H]. 39 [00075]embedded image ESI-MS m/z 560.3 [M + H]. 40 [00076]embedded image ESI-MS m/z 564.3 [M + H]. 41 [00077]embedded image ESI-MS m/z 564.3 [M + H]. 42 [00078]embedded image ESI-MS m/z 564.3 [M + H]. 43 [00079]embedded image ESI-MS m/z 576.3 [M + H]. 44 [00080]embedded image ESI-MS m/z 576.3 [M + H]. 45 [00081]embedded image ESI-MS m/z 576.3 [M + H]. 46 [00082]embedded image ESI-MS m/z 580.3 [M + H]. 47 [00083]embedded image ESI-MS m/z 580.3 [M + H]. 48 [00084]embedded image ESI-MS m/z 571.3 [M + H]. 49 [00085]embedded image ESI-MS m/z 606.4 [M + H]. 50 [00086]embedded image ESI-MS m/z 547.3 [M + H]. 51 [00087]embedded image .sup.1H NMR (300 MHz, CDCl.sub.3) δ 7.18~7.33 (m, 5H), 5.83~5.88 (m, 1H), 4.89 (s, 1H), 3.72-3.81 (m, 1H), 3.14~3.23 (m, 2H), 2.69~2.89 (m, 2H), 1.20~2.01 (m, 24H), 0.96 (s, 3H), 0.90 (s, 3H), 0.86 (s, 3H), 0.80 (s, 3H), 0.72~0.74 (d, 3H, J = 8.8Hz), 0.71 (s, 3H), 0.54 (s, 3H). ESI-MS m/z 560.3 [M + H]. 52 [00088]embedded image .sup.1H NMR (300 MHz, CDCl.sub.3) δ 7.01~7.04 (d, 2H, J = 11.6Hz), 6.77~6.80 (d, 2H, J = 11.6Hz), 5.78~5.80 (m, 1H), 4.81~4.83 (m, 1H), 3.73 (s, 1H), 3.60~3.71 (m, 1H), 3.10-3.15 (m, 1H), 3.02-3.06 (m, 1H), 2.54-2.75 (m, 2H), 1.15~1.90 (m, 24H), 0.96 (s, 3H), 0.90 (s, 3H), 0.86 (s, 3H), 0.80 (s, 3H), 0.73~0.75 (d, 3H, J = 8.8Hz), 0.70 (s, 3H), 0.53 (s, 3H). ESI- MS m/z 590.4 [M + H]. 53 [00089]embedded image ESI-MS m/z 532.3 [M + H]. 54 [00090]embedded image ESI-MS m/z 499.3 [M + H]. 55 [00091]embedded image ESI-MS m/z 527.3 [M + H]. 56 [00092]embedded image ESI-MS m/z 556.3 [M + H]. 57 [00093]embedded image 58 [00094]embedded image 59 [00095]embedded image 60 [00096]embedded image 61 [00097]embedded image 62 [00098]embedded image 63 [00099]embedded image

    Biological Activity Assays

    [0173] T-cell Isolation and Differentiation—Mouse T cell differentiation was performed and analyzed by intracellular staining as described. Xu, T., et al. Ursolic acid suppresses interleukin-17 (IL-17) production by selectively antagonizing the function of RORgamma t protein. The Journal of biological chemistry 286: 22707-22710 (2011); Wang, X., et al. Transcription of Il17 and Il17f is controlled by conserved noncoding sequence 2. Immunity 36: 23-31 (2012). Briefly, mouse naïve CD4.sup.+ T cells (CD4.sup.+CD25.sup.−CD62L.sup.hi-CD44.sup.lo) were isolated from spleens and lymph nodes by FACS sorting. Th17 differentiation was performed with 15 ng ml.sup.− IL-6 and 2.5 ng ml.sup.− TGF-β in the presence of 1 μg ml.sup.− anti-CD3 (plate bound) and 1 μg ml.sup.− anti-CD28 (plate bound) for 4 days. When indicated, different concentrations of UA, KL001, other UA analogs or small molecules (dissolved in DMSO) were added at the beginning of Th17 differentiation. The mature Th17 cells were restimulated with 50 ng ml.sup.− PMA (phorbol 12-myristate 13-acetate) and 500 ng ml.sup.− inomycin in the presence of BD GolgiStop™ for 6 hrs, stained intracellularly for IL-17 and IL-17F, and then analyzed by flow cytometry.

    [0174] MOG-induced Experimental Autoimmune Encephalomyelitis (EAE)—EAE induction were performed by immunizing mice twice with MOG35-55 peptide (amino acids 35-55; MEVGWYRSPFSROVHLYRNGK) emulsified in CFA followed by pertussis toxin injection with slight modifications, and analyzed as previously described. Xu, T., et al. Ursolic acid suppresses interleukin-17 (IL-17) production by selectively antagonizing the function of RORgamma t protein. The Journal of biological chemistry 286: 22707-22710 (2011); Wang, X., et al. Transcription of Il17 and Il17f is controlled by conserved noncoding sequence 2. Immunity 36: 23-31 (2012). Briefly, the disease scores were assigned on a scale of 0-5 as follows: 0, none; 1, limp tail or waddling gait with tail tonicity; 2, wobbly gait; 3, hindlimb paralysis; 4, hindlimb and forelimb paralysis; 5, death. In the preventative EAE model, UA and KL001 were dissolved in DMSO, and given to mice at a dose of ˜100 mg/Kg body weight by intraperitoneal injection (i.p.) every other day after first MOG immunization; In the therapeutic EAE model, UA and KL001 were dissolved in 0.5% MC (methyl cellulose), and given to mice at a dose of ˜250 mg/Kg body weight by gavage twice daily after the second MOG immunization.

    [0175] IMQ-induced psoriasis model—The mouse psoriasis model was induced according to previous described with minor modifications. van der Fits L, et al. (2009) Imiquimod-induced psoriasis-like skin inflammation in mice is mediated via the IL-23/IL-17 axis. J Immunol 182(9):5836-5845. Briefly, 7-9 weeks old female C57BL/6 mice were used to induce psoriasis. On day 0, the hair was removed from the dorsal skin of the mice after anaesthetizing with pentobarbital (˜0.2 ml/20 g body weight by i.p.). On day 1, psoriasis was induced at day 3 by applying 62.5 mg 5% imiquimod cream to the dorsal skin after anaesthesia on a daily base. In the preventative disease model, KL001 (dissolved in 0.5% methylcellulose (MC)) or 0.5% MC (control group) was orally administrated into C57BL/6 mice by gavage at a dosage of ˜250 mg/kg body weight twice daily starting 2 days before induction of psoriasis (Day −2). The mice were then sacrificed on Day 5, and the skin tissues were then removed for H&E staining and mRNA expression analysis. For mRNA expression analysis, total RNA was prepared from the skin samples with TriZol reagent (Invitrogen) after homogenization, and cDNA was synthesized with reverse transcriptase and oligo(dT) primers. The expression of Il17, Il17f and Rorc (encoding RORγt) were then quantified by realtime PCR and normalized to Actb gene by using the following primers: Actb, F: TGGAATCCTGTGGCATCCATGAAAC/R (SEQ ID NO.1): TAAAACGCAGCTCAGTAACAGTCCG (SEQ ID NO.2); Il17,F: CTCCAGAAGGCCCTCAGACTAC/R (SEQ ID NO.3): GGGTCTTCATTGCGGTGG (SEQ ID NO.4); Il17f, F: CCCATGGGATTACAACATCACTC/R (SEQ ID NO.5): CACTGGGCCTCAGCGATC (SEQ ID NO.6); Rorc, F: CCGCTGAGAGGGCTTCAC/R (SEQ ID NO.7): TGCAGGAGTAGGCCACATTACA (SEQ ID NO.8).

    [0176] Calculations and Statistic Analysis. Most in vitro and in vivo data were repeated for 2-3 times with consistent results. When indicated, the statistic significance was determined by student's t-test. (* represents P<0.05; ** represents P<0.03; *** represents P<0.01).

    Results

    [0177] UA and its analogs KL001 to KL005, 201702-1 to 201702-4, and 201509-1 to 201509-3 inhibit TH17 differentiation. Mouse naïve CD4+ T cells were cultured under Th17 polarizing condition in the presence of above chemicals (2-10 μM) or DMSO control (Ctrl) for 4 days and then restimulated for IL-17 and IL-17F staining (FIG. 1). Consistent with previous findings, Xu, T., et al. Ursolic acid suppresses interleukin-17 (IL-17) production by selectively antagonizing the function of RORgamma t protein. The Journal of biological chemistry 286: 22707-22710 (2011), 2 μM UA inhibited ˜80% IL-17 expression and ˜50% IL-17F expression, both of which were reported to contribute TH17-mediated autoimmune diseases Yang, X. O., Chang, S. H., Park, H. et al. Regulation of inflammatory responses by IL-17F. The Journal of experimental medicine, 205: 1063-1075 (2008). Interestingly, it was found that several UA derived analogs, including KL001, KL002 and KL005 inhibited TH17 differentiation at comparable level to UA. (FIG. 1), whereas other UA analogs inhibited TH17 differentiation at a less degree (FIG. 1 and FIG. 6). Moreover, a titration of inhibitory assay showed the IC50 value of KL001 is ˜0.49 μM in inhibiting Th17 differentiation, as determined by the readout of IL-17 staining data (FIG. 2), and this is comparable to that of UA (IC50=0.68 μM) as examined in our previous studies, Xu, T., et al. Ursolic acid suppresses interleukin-17 (IL-17) production by selectively antagonizing the function of RORgamma t protein. The Journal of biological chemistry 286: 22707-22710 (2011), further demonstrating that KL001 released UA as the major active ingredient in inhibiting Th17 differentiation.

    [0178] KL001 showed better efficacy than UA in reducing EAE in a preventative disease model: Previous studies showed that UA can effectively ameliorate EAE in a preventative disease model in mice. Xu, T., et al. Ursolic acid suppresses interleukin-17 (IL-17) production by selectively antagonizing the function of RORgamma t protein. The Journal of biological chemistry 286: 22707-22710 (2011). To test the in vivo effect of UA derived analogs, EAE was induced in mice by MOG immunization and PTX injection as described. Xu, T., et al. Ursolic acid suppresses interleukin-17 (IL-17) production by selectively antagonizing the function of RORgamma t protein, The Journal of biological chemistry 286: 22707-22710 (2011); Wang, X., et al. Transcription of Il17 and Il17f is controlled by conserved noncoding sequence 2, Immunity 36: 23-31 (2012). UA (n=4), KL001 (n=3) and DMSO (n=5) were given to mice by IP injection every other day at a dosage of 100 mg/kg body weight after first MOG immunization. The results showed that KL001 inhibited EAE at greater degree than UA in this preventative EAE disease model (FIG. 3). In addition, the T cells infiltrated into the central nerve system of EAE mice showed significantly reduced IL-17 expression upon either UA or KL001 treatment (FIG. 3). These results show that KL001 is better than UA in inhibiting TH17 differentiation and TH17-induced autoimmunity.

    [0179] KL001 showed better efficacy in treating EAE in a therapeutic disease model: As stated above, KL001 was able to inhibit TH17 differentiation in vitro and in vivo, and KL001 showed better efficacy in inhibiting TH17-mediated autoimmunity in a preventative disease model. To test the therapeutic potential of KL001, EAE was first induced by MOG immunization and PTX injection as described. Xu, T., et al. Ursolic acid suppresses interleukin-17 (IL-17) production by selectively antagonizing the function of RORgamma t protein, The Journal of biological chemistry 286: 22707-22710 (2011); Wang, X., et al. Transcription of Il17 and Il17f is controlled by conserved noncoding sequence 2, Immunity 36: 23-31 (2012). At Day 9 after the first MOG immunization when the TH17 response was fully induced in vivo, UA (n=11), KL001 (n=12) or control vehicle (0.5% methyl cellulose) (n=12) were given to mice twice daily by gavage administration at a dosage of ˜250 mg/kg body weight. Although UA treatment did not affect the EAE disease, KL001 administration significantly reduced the disease severity of EAE, and the average disease scores were reduced by 50% when compared with the control group (FIG. 4). Taken together, these results show that the UA-derived analogs, such as KL001, were able to inhibit TH17 differentiation in vitro and in vivo, as well as to ameliorate EAE disease in mice in both preventative and therapeutic disease models. These findings demonstrate that KL001 or other UA-derived analogs can be used as potential drug candidates in the clinical application in treatment of various TH17- or IL-17-related inflammation and autoimmune diseases.

    [0180] KL001 effectively ameliorated IMQ-induced psoriasis in a preventative disease model: Aberrant Th17 responses are known to cause many chronic inflammatory and autoimmune diseases, including multiple sclerosis, psoriasis, rheumatoid arthritis, inflammatory bowel diseases, periodontal diseases and asthma airway inflammatory diseases. Korn, T., et al., IL-17 and Th17 Cells, Annu Rev Immunol. 27:485-517 (2009); Tesmer, L. A., et al., Th17 Cells in Human Disease, Immunol Rev. 223:87-113 (2008). In the above studies, it was showed that KL001, a small molecule derived from ursolic acid, can inhibit Th17-mediated EAE disease, a mouse model of human multiple sclerosis, in both preventative and therapeutic experimental settings. To determine whether KL001 has therapeutic potential in additional Th17-related diseases, the role of KL001 in imiquimod (IMQ)-induced mouse disease model of psoriasis was then examined. Briefly, KL001 was dissolved in 0.5% methylcellulose (MC), and then orally administrated into C57BL/C mice by gavage at a dosage of ˜250 mg/kg body weight twice daily during the process of experiment, with equal volume of 0.5% MC treatment group as the control. Psoriasis was induced at day 3 by applying 62.5 mg 5% imiquimod cream daily to the dorsal skin after anaesthetizing with pentobarbital (˜0.2 ml/20 g body weight by i.p.) and hair removal, as described previously. van der Fits L, et al. (2009) Imiquimod-induced psoriasis-like skin inflammation in mice is mediated via the IL-23/IL-17 axis. J Immunol 182(9):5836-5845. The mice were then sacrificed 3.5 days after induction of psoriasis, and the skin tissues were then removed for histology and mRNA analysis. Compared with control group, treatment of KL001 visually and greatly reduced the redness and roughness of the skin in psoriasis model (FIG. 5). In addition, the expression of IL-17, but not RORγt, was also notably reduced in the skin samples of KL001 treated mice. The success of KL001 in alleviating Th17-mediated inflammation in distinct mouse disease models such as EAE and psoriasis via targeting RORγt indicates potential applications of this and other UA analogs in treatment of various Th17- or RORγt-dependent human autoimmune diseases.

    [0181] It was noted that KL001 releases UA as the major active ingredient, which in turn then targets RORγt to inhibit RORγt-directed TH17 program and TH17-related diseases. It is known that UA contains many pharmacological activities, including strong hepatoprotective, antitumor and anti-inflammation effects partly through targeting NF-κB and STAT3. Liu, J. Pharmacology of Oleanolic Acid and Ursolic Acid, J Ethnopharmacol. 49:57-68 (1995); Ikeda, Y., et al., Ursolic Acid: An Anti- and Pro-Inflammatory Triterpenoid, Mol Nutr Food Res. 52:26-42(2008); Huang, H. C., et al., Ursolic Acid Inhibits IL-1β or TNF-α-Induced C6 Glioma Invasion Through Suppressing the Association ZIP/p62 with PKCand Downregulating the MMP-9 Expression, Mol Carcinog. 48:517-531 (2009); Shishodia, S., et al., Ursolic Acid Inhibits Nuclear FactorActivation Induced by Carcinogenic Agents through Suppression of IκBα Kinase and p65 Phosphorylation: Correlation with Down-Regulation of Cyclooxygenase 2, Matrix Metalloproteinase 9, and Cyclin D1, Cancer Res. 63:4375-4383 (2003); Pathak, A. K., et al., Ursolic Acid Inhibits STAT3 Activation Pathway Leading to Suppression of Proliferation and Chemosensitization of Human Multiple Myeloma Cells, Mol Cancer Res. 5:943-955 (2007). In previous studies, Xu, T., et al. Ursolic acid suppresses interleukin-17 (IL-17) production by selectively antagonizing the function of RORgamma t protein. The Journal of biological chemistry 286: 22707-22710 (2011), it was demonstrated that UA has a higher affinity for RORγt (˜0.7 μM) than for NF-κB and STAT3, and 2 μM of UA effectively blocked the activity of RORγt and RORγt-direct IL-17 expression, whereas the inhibitory activity of UA on NF-κB and STAT3 was only observed when used at a concentration higher than 25 μM. In addition, PK studies suggest that the UA concentration in the blood of EAE mice receiving either UA or KL001 was far below 25 μM, demonstrating that UA and KL001 inhibit EAE through targeting RORγt rather than NF-κB and STAT3.

    [0182] As a natural small molecule ubiquitously present in plants and even human diets, UA is relatively non-toxic and is well tolerated orally and topically in both human and rodents. The acute toxicity (LD50) of UA in rodents was determined to be >637 mg/kg for intraperitoneal injection and 8330 mg/kg for oral administration. Lee, A. W., et al., Ursolic Acid Induces Allograft Inflammatory Factor-1 Expression via a Nitric Oxide-Related Mechanism and Increases Neovascularization, J Agric Food Chem. 58:12941-12949 (2010). In addition, UA has been identified as a major effective component in many medical herbs which have a long history in clinic practice in ancient China and Asian countries. Liu, J. Pharmacology of Oleanolic Acid and Ursolic Acid, J Ethnopharmacol. 49:57-68 (1995). Due to its important pharmacological activities, UA has been used for treatment of liver diseases and skin cancer. Liu, J. Pharmacology of Oleanolic Acid and Ursolic Acid, J Ethnopharmacol. 49:57-68 (1995). These clinical practices and its relatively low toxicity provide UA and UA-derived analogs that release UA as the major active ingredient a great advantage over other RORγt inhibitors in developing therapeutics against Th17-mediated autoimmune diseases.

    [0183] Considering the broad functionality of the Th17 cell, particularly in inflammatory diseases and cancer, the therapeutic effects of KL001 and other UA related analogs as described herein via inhibition of RORγt and ultimately Th17 cell function can serve a wide variety of therapeutic applications. Since KL001 and other UA related analogs release UA as the major active ingredient, these UA-derived analogs can be potentially used to replace UA in treating UA-treatable diseases, such as liver diseases and skin cancer. Liu, J. Pharmacology of Oleanolic Acid and Ursolic Acid, J Ethnopharmacol. 49:57-68 (1995).