Rhizobium and use and bacterial preparation thereof, and method for restoring rare-earth tailing soil or silica ore tailing waste

Abstract

Provided is a type of Rhizobium with the classified nomenclature of BradyRhizobium sp. KTMS 0001 or BradyRhizobium sp. KTMS 0002, and the deposit number of CCTCC No. M2017580 or CCTCC No. M2017581. Also provided are a bacterial preparation containing the Rhizobium, a method for restoring rare-earth tailings soil and a use of the Rhizobium.

Claims

1. A Rhizobium, wherein the Rhizobium has a classified nomenclature of Bradyrhizobium sp. KTMS 0001 or Bradyrhizobium sp. KTMS 0002, and has deposit number of China Center for Type Culture Collection (CCTCC) No. M2017580 or CCTCC No. M2017581, wherein said Rhizobium is cultured in a YMB medium to obtain a culture solution with a Rhizobium concentration of 100×10.sup.9 Colony Forming Units (CFU) per mL, used in restoration of rare earth tailings soil or silicon ore tailings waste.

2. A Rhizobium bacterial preparation, wherein the Rhizobium bacterial preparation comprises a culture medium consisting of the YMB culture medium and/or a MAG culture medium, and the Rhizobium according to claim 1, wherein the Rhizobium bacterial preparation further comprises an auxiliary agent, which comprises a surfactant and a solid carrier; wherein the surfactant comprises at least one of sodium ligninsulfonate and polycondensate of sodium alkylnaphthalene sulfonate; and the solid carrier comprises at least one of peat, vermiculite, rice bran flour, wheat bran, kaolin, diatomite, white carbon black, talc and fine sand, wherein in the Rhizobium bacterial preparation the amount of the Rhizobium is (2-20)×10.sup.9 CFU per gram of the bacterial preparation, and wherein a dosage form of the Rhizobium bacterial preparation is a seed soaking solution, dry powder or mud-like substance.

3. A method for restoring rare earth tailings soil or silicon ore tailings waste, comprising: seeding legumes on the rare earth tailings soil or silicon ore tailings waste; and inoculating the seeded soil or waste with the Rhizobium according to claim 1.

4. The method according to claim 3, wherein the legume comprises at least one of Arachis hypogaea, Cassia tora, Stylosanthes guianensi and Medicago Sativa.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The drawings are provided for further understanding of the present invention and constitute a part of the specification, together with the following detailed description serve to explain the embodiments of the present invention, but not limit the present invention. In the drawings:

(2) FIG. 1 is a comparison chart of the growth of Cassia tora (4-6th from left) treated with the Rhizobium with deposit number of CCTCC No. M2017581 and Cassia tora (1-3th from left) treated with a sterilized 10 mM magnesium sulfate aqueous solution, after being planted in the rare-earth tailings soil for 9 months.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(3) Hereinafter, specific embodiments of the present invention will be described in detail with reference to the drawings. It should be understood that the specific embodiments described herein are only intended to illustrate the present invention and are not intended to limit the present invention.

(4) In one aspect, the present invention provides a Rhizobium. The Rhizobium has the classified nomenclature of Bradyrhizobium sp. KTMS 0001 or Bradyrhizobium sp. KTMS 0002, and the Rhizobium is deposited in CCTCC with the deposit number of CCTCC No. M2017580 or CCTCC No. M2017581.

(5) The Rhizobium with the deposit number of CCTCC No. M2017580 is one of 15 strains of rhizobia separated from a rare-earth tailings sample from Guangdong by a plant capture method. The Rhizobium with the deposit number of CCTCC No. M2017581 is one of 15 strains of rhizobia separated from a rare-earth tailings sample from Jiangxi by the plant capture method.

(6) In a further aspect, the present invention provides the Rhizobium bacterial preparation comprising a culture medium and the above-mentioned Rhizobium.

(7) Wherein, the dosage form of the Rhizobium bacterial preparation may be a seed soaking solution, dry powder or mud-like substance.

(8) Optionally, in the Rhizobium bacterial preparation, the number of the Rhizobium is (2-20)×10.sup.9 CFU per gram of the bacterial preparation.

(9) Optionally, the culture medium comprises a YMB (yeast mannitol broth) culture medium and/or a MAG (magnesium) culture medium.

(10) Optionally, the Rhizobium bacterial preparation further comprises an auxiliary agent, and the auxiliary agent comprises a surfactant and/or a solid carrier; the surfactant comprises at least one of sodium dodecyl benzene sulfonate, sodium ligninsulfonate and polycondensate of sodium alkylnaphthalene sulfonate; and the solid carrier comprises at least one of peat, vermiculite, bran flour, wheat bran, kaolin, diatomite, white carbon black, talc and fine sand.

(11) Preferably, the Rhizobium with the deposit number of CCTCC No. M2017580 or CCTCC No. M2017581 can be cultured in a YMB medium to obtain a culture solution with a bacterial concentration of 100×10.sup.9 CFU/mL, and then the culture solution and the auxiliary agent (sodium dodecyl benzene sulfonate and kaolin) are mixed to prepare the bacterial preparation. The amount of sodium dodecyl benzene sulfonate is 50-200 g per liter of the culture solution, and the amount of kaolin is 200-400 g per liter of the culture solution.

(12) In a further aspect, the present invention also provides a method for restoring rare-earth tailings soil or silicon ore tailings waste. The method includes seeding legume on the rare-earth tailings soil or silicon ore tailings waste, and inoculating the above-mentioned Rhizobium.

(13) Optionally, the inoculation amount of the Rhizobium is (1-10)×10.sup.9 CFU per square meter of bare surface of the rare-earth tailings soil or the silicon ore tailings waste.

(14) Optionally, the legume includes at least one of Arachis hypogaea, Cassia tora, Stylosanthes guianensi and Medicago Sativa.

(15) In a further aspect, the present invention also provides an application of the Rhizobium in restoration of rare-earth tailings soil or silicon ore tailings waste.

(16) Optionally, in the above-mentioned application, the legume is sown on the rare-earth tailings soil or silicone ore tailings waste, and the Rhizobium is inoculated.

(17) Hereinafter, the present invention is described in detail based on embodiments. In the following embodiments, a polluted rare-earth tailings soil is a sample from Qingyuan, Guangdong.

Embodiment 1

(18) In embodiment 1, a soil restoration experiment is performed on the rare-earth tailings soil by using the Rhizobium with the deposit number of CCTCC No. M2017580.

(19) The test plants are legume, in particular, Stylosanthes guianensi Arachis hypogaea, Medicago Sativa, and Cassia tora. Each kind of the plant is divided into 10 inoculating groups and 3 control groups. The seeds are sterilized by sterilizing with ethanol for 30 mM and washing with aseptic water for 5 times. The seeds of the inoculating groups are soaked in a 100×10.sup.9 CFU/ml solution of the Rhizobium with the deposit number of CCTCC No. M2017580 (Rhizobium 1) and 9 strains of Rhizobium (Rhizobium 2-10) separated with the above Rhizobium together. Control Group 1 adopts a sterilized 10 mM magnesium sulfate aqueous solution instead of the Rhizobium solution, and the rest condition is the same. Control Group 2 adopts a 100×10.sup.9 CFU/ml solution of a commercial Rhizobium bacterial preparation produced by Panzhihua Xiyu biotech Co., Ltd. instead of the Rhizobium solution. Control Group 3 adopts a 100×10.sup.9 CFU/ml solution of a commercial EM bacterial preparation produced by Ningdu Junmima biotech Co., Ltd. instead of the Rhizobium solution. The seeds are sown into flowerpots filled with the polluted rare-earth tailings soil, then the flowerpots are moved to a greenhouse for cultivation, and the same amount of water is irrigated to keep the soil moist. The dry weights of the aerial part and the underground part in each flowerpot are measured after 9 months, respectively, and the result is shown in Table 1. According to the Table 1, compared with the treatment with aseptic water, the dry weights of the aerial part and the underground part of Cassia tora grown in the rare-earth tailings soil treated by using the Rhizobium with the deposit number of CCTCC No. M2017580 (Rhizobium 1) for 9 months are increased by 13.2 times and 11.6 times, respectively. FIG. 1 representatively shows the growth comparison of the Cassia tora (4-6th from left) treated with the Rhizobium with the deposit number of CCTCC No. M2017580 (Rhizobium 1) and the Cassia tora (1-3th from the left) treated with sterilized magnesium sulfate aqueous solution after being planted in the rare-earth tailings soil for 9 months. And, compared with the 9 strains of Rhizobium (Rhizobium 2-10) separated with the Rhizobium together, the commercial Rhizobium bacterial preparation produced by Panzhihua Xiyu biotech Co., Ltd. and the commercial EM bacterial preparation produced by Ningdu Junmima biotech Co., Ltd., the Rhizobium with the deposit number of CCTCC No: M2017580 (Rhizobium 1) has a significantly enhanced capacity to promote the plant growth.

(20) TABLE-US-00001 TABLE 1 Dry weight (g) Stylosanthes guianensi Arachis hypogaea Cassia tora Medicago Sativa Soaking Aerial Underground Aerial Underground Aerial Underground Aerial Underground solution part part part part part part part part Sterilized 10 mM 1.2 0.8 1.1 0.5 0.9 1.1 0.8 0.5 magnesium sulfate aqueous solution Rhizobium 1 15.3 13.4 6.0 4.2 11.9 12.8 3.1 2.2 Rhizobium 2 8.3 8.4 3.3 3.0 8.3 8.4 2.0 0.9 Rhizobium 3 7.2 7.0 4.0 3.2 3.8 6.0 1.8 0.8 Rhizobium 4 9.4 6.8 3.8 3.2 7.5 8.0 2.1 1.2 Rhizobium 5 5.2 1.4 2.6 2.2 6.5 7.2 1.9 1.1 Rhizobium 6 7.5 3.2 3.6 3.1 4.6 7.3 1.8 1.0 Rhizobium 7 8.3 5.7 3.2 3.9 5.6 6.8 2.0 1.0 Rhizobium 8 9.5 8.5 3.5 3.0 8.8 9.8 2.2 1.0 Rhizobium 9 9.8 4.6 3.8 3.0 6.7 7.8 2.1 1.2 Rhizobium 10 8.6 5.0 4.1 3.3 5.9 7.0 1.6 0.8 Control Group 2 8.8 5.2 2.3 1.8 4.5 3.8 1.5 0.7 Control Group 3 1.5 0.7 2.0 1.2 2.2 1.0 0.9 0.5

Embodiment 2

(21) In embodiment 2, a soil restoration experiment is performed on the rare-earth tailings soil by using the Rhizobium with the deposit number of CCTCC No. M2017581.

(22) The test plants are legume, in particular, Stylosanthes guianensi Arachis hypogaea, Medicago Sativa, and Cassia tora. Each kind of the plant is divided into 10 inoculating groups and one control group. The seeds are sterilized by sterilizing with ethanol for 30 min and washing with aseptic water for 5 times. The seeds of the inoculating groups are soaked in a 100×10.sup.9 CFU/ml solution of the Rhizobium with the deposit number of CCTCC No. M2017581 (Rhizobium 11) and 9 strains of Rhizobium (Rhizobium 12-20) separated with the above Rhizobium together. Control Group 1 adopts a sterilized 10 mM magnesium sulfate aqueous solution instead of the Rhizobium solution. Control Group 2 adopts a 100×10.sup.9 CFU/ml solution of a commercial Rhizobium bacterial preparation produced by Panzhihua Xiyu biotech Co., Ltd. instead of the Rhizobium solution. Control Group 3 adopts a 100×10.sup.9 CFU/ml solution of a commercial EM bacterial preparation produced by Ningdu Junmima biotech Co., Ltd. instead of the Rhizobium solution. The seeds are sown into flowerpots filled with the polluted rare-earth tailings soil, then the flowerpots are moved to a greenhouse for cultivation, and the same amount of water is irrigated to keep the soil moist. The dry weights of the aerial part and the underground part in each flowerpot are measured after 9 months, respectively, and the result is shown in Table 2. According to the Table 2, compared with the treatment with aseptic water, the dry weights of the aerial part and the underground part of Cassia tora grown in the rare-earth tailings soil treated by using the Rhizobium with the deposit number of CCTCC No. M2017581 (Rhizobium 11) for 9 months are increased by 12.9 times and 14.8 times, respectively. And, compared with the 9 strains of Rhizobium (Rhizobium 12-20) separated with the 11th Rhizobium together, the commercial Rhizobium bacterial preparation produced by Panzhihua Xiyu biotech Co., Ltd. and the commercial EM bacterial preparation produced by Ningdu Junmima biotech Co., Ltd., the deposit number of CCTCC No: M2017581 (Rhizobium 11) has a significantly enhanced capacity to promote the plant growth.

(23) TABLE-US-00002 TABLE 2 Dry weight (g) Stylosanthes guianensi Arachis hypogaea Cassia tora Medicago Sativa Soaking Aerial Underground Aerial Underground Aerial Underground Aerial Underground solution part part part part part part part part Sterilized 10 mM 1.2 0.9 1.0 0.5 1.4 1.3 0.8 0.6 magnesium sulfate aqueous solution Rhizobium 11 15.5 13.3 6.1 4.1 11.4 12.5 3.0 2.2 Rhizobium 12 8.4 8.3 3.4 2.9 8.2 8.5 2.0 0.9 Rhizobium 13 7.3 6.9 4.1 3.1 3.8 6.1 1.8 0.8 Rhizobium 14 9.5 6.7 3.9 3.1 7.4 8.1 2.1 1.2 Rhizobium 15 5.3 1.4 2.7 2.2 6.4 7.3 1.9 1.1 Rhizobium 16 7.6 3.2 3.7 3.0 4.6 7.4 1.8 1.0 Rhizobium 17 8.4 5.6 3.3 3.8 5.5 6.9 2.0 1.0 Rhizobium 18 9.6 8.4 3.6 2.9 8.7 9.9 2.2 1.0 Rhizobium 19 9.9 4.6 3.9 2.9 6.6 7.9 2.1 1.2 Rhizobium 20 8.7 5.0 4.2 3.2 5.8 7.1 1.8 0.8 Control Group 2 7.8 5.8 2.0 1.7 5.0 4.0 1.9 0.9 Control Group 3 1.2 1.0 1.8 0.9 3.1 1.8 0.7 0.5

Embodiment 3

(24) The embodiment is used for illustrating the application of the Rhizobium with the deposit number of CCTCC No. M2017580 (Rhizobium 1) and the 11th Rhizobium with the deposit number of CCTCC No. M2017581 (Rhizobium 11) in the rare-earth tailings for soil restoration and re-greening.

(25) Firstly, the Rhizobium with the deposit number of CCTCC No. M2017580 and the Rhizobium with the deposit number of CCTCC No. M2017581 are cultured in YMB culture medium to obtain a culture solution with bacterial concentration of 100×10.sup.9 CFU/ml, respectively, and then the culture solution is mixed with the auxiliary agent (sodium dodecyl benzene sulfonate and kaolin) to prepare the bacterial preparation. For each liter of the culture solution, the amount of sodium dodecyl benzene sulfonate is 100 g, and the amount of kaolin is 300 g.

(26) Rare-earth tailings are used for soil restoration and re-greening by finishing, punching, planting, inoculation and fertilization in sequence, wherein the punching step includes digging 10 cm×10 cm pits at a distance of 40 cm; the planting step includes sowing 3-20 Stylosanthes seeds; the inoculation step includes applying 1 g bacterial preparation to each pit; and the fertilization step includes filling the pits to the soil surface with soil. For each pit, 0.5 kg organic fertilizer is applied completely and uniformly without piling up. Experimental Group 1 is a bacterial preparation prepared from the culture solution of the Rhizobium with the deposit number of CCTCC No. M2017580, and Experimental Group 2 is a bacterial preparation prepared from the culture solution of the Rhizobium with the deposit number of CCTCC No. M2017581. Control Group 1 only adopts aseptic water instead of the culture solution. Control Group 2 adopts a commercial Rhizobium bacterial preparation produced by Xiyu biotech Co., Ltd. instead of the bacterial preparation. Control Group 3 adopts a commercial EM bacterial preparation produced by Junmima biotech Co., Ltd. instead of the bacterial preparation.

(27) After 9 months of restoration and regreening, the fresh weight of all vegetations on the rare-earth tailings soil per unit area of restoration are measured. The result shows that the fresh weight of all vegetations per square meter of rare-earth tailings soil in Experimental Group 1 is 112.1 kg, and the fresh weight thereof in Experimental Group 2 is 109.3 kg, but the fresh weight thereof in Control Groups 1-3 are only 65.3 kg, 80.2 kg and 70.5 kg, respectively. Thus, the Rhizobium with the deposit number of CCTCC No. M2017580 and the Rhizobium with the deposit number of CCTCC No. M2017581 can efficiently and long-termly restore the rare-earth tailings soil.

(28) The rhizosphere soils of Stylosanthes planted in Experimental Groups 1, 2 and Control Groups 1-3 are selected, and 16S rDNA library construction and microbial diversity analysis are performed on the soil microorganisms, and the scheme is as follows:

(29) Construction of 16S rDNA Cloning Library

(30) The total DNA of extracted soil microorganisms is amplified by using 16S rDNA primer, which includes primer 27F with a sequence of AGAGTTTGATCCTGGCTCAG shown as SEQ ID NO.1 and primer 1483R with a sequence of GGTTACCTTGTTACGACTT shown as SEQ ID NO.2, 16S bands are recovered, and the target fragment is connected with the vector by using a pMD19-T vector kit to obtain recombinant plasmid DNA. The recombinant plasmid DNA solution is added into suspension of competent cells (JM109 E. coli), transformation is performed, Amp resistance screening is carried out, screened single colonies are selected to be subjected to culturing in an LB liquid culture medium under shaking overnight. Plasmids are extracted by using a plasmid extraction kit. Then positive plasmids from cloning are sequenced to obtain the sequence of 16S rDNA.

(31) The obtained 16S rDNA sequence is compared online by NCBI Blast to find the most similar sequence of each sequence in GenBank. Then the reference sequence is selected, and is compared by ClustalX program together with the 16SrDNA sequence. The phylogenetic tree is constructed by using MEGA 5.0 software via the Neighbor-Joining method, and the phylogenetic tree is inspected with repeat number of 1000. The soil microbial diversity index is calculated according to the Shannon-wiener diversity index method. The soil microbial diversity indexes of the rhizosphere soil of Stylosanthes planted in Experimental Groups 1, 2 and Control Groups 1-3 are shown in Table 3. According to the data in Table 3, the microbial diversity of Experimental Groups 1 and 2 is significantly higher than that of Control Groups 1-3. Thus, the Rhizobium with the deposit number of CCTCC No. 2017580 and the Rhizobium with the deposit number of CCTCC No. 2017581 can efficiently and long-termly restore the microbial diversity of the rare-earth tailings soil.

(32) TABLE-US-00003 TABLE 3 Restored soil Soil microbial diversity index Experimental Group 1 6.12 Experimental Group 2 6.08 Control Group 1 2.27 Control Group 2 4.21 Control Group 3 3.82

(33) After restoration and re-greening for 9 months, the nitrogen/phosphorus and heavy metals contents of rhizosphere soil of Stylosanthes are detected, and the heavy metal content of the aerial part of Stylosanthes is detected. The results are shown in Tables 4 and 5.

(34) TABLE-US-00004 TABLE 4 Element content in rhizosphere soil (mg/kg) Total Total Restored soil nitrogen phosphorus Cd Hg As Pb Cr Cu Experimental Group 1 205 343 0.112 0.0056 3.54 23.54 43.33 52.48 Experimental Group 2 266 351 0.117 0.0056 4.07 25.81 44.21 52.64 Control Group 1 78 279 0.193 0.0152 5.52 40.85 46.72 53.66 Control Group 2 114 311 0.122 0.0058 5.21 24.42 44.18 58.14 Control Group 3 103 306 0.125 0.0097 5.13 26.07 49.07 54.47

(35) TABLE-US-00005 TABLE 5 Element content of aerial part of Stylosanthes (mg/kg) Total Total Restored soil nitrogen phosphorus Cd Hg As Pb Cr Cu Experimental Group 1 19878 1207 0.140 0.0015 0.166 2.250 4.85 4.16 Experimental Group 2 16271 990 0.130 0.0014 0.063 2.807 4.50 3.73 Control Group 1 10803 578 0.220 0.0015 0.444 2.962 5.60 6.07 Control Group 2 15735 820 0.262 0.0023 0.187 5.082 4.85 5.76 Control Group 3 13748 830 0.261 0.0014 0.514 2.918 8.40 8.22

(36) According to the data in Tables 4 and 5, the Rhizobium with the deposit number of CCTCC No. 2017580 and the Rhizobium with the deposit number of CCTCC No. 2017581 can effectively enrich nitrogen and phosphorus in the rhizosphere soil, but not enrich heavy metals, and also not enrich heavy metals of the aerial part of Stylosanthes, so that they can be used as feed. Thus, the Rhizobium with the deposit number of CCTCC No. 2017580 and the Rhizobium with the deposit number of CCTCC No. 2017581 can also bring considerable economic benefits to soil restoration.

(37) The preferred embodiments of the present invention have been described in detail with reference to the accompanying drawings. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, the technical schemes of the present invention can be subjected to simple modifications, and these simple modifications all belong to the protection scope of the present invention.

(38) Further to be noted that, in various specific features of the above-described specific embodiments described, may be combined in any suitable manner without conflict. To avoid unnecessary repetition, the present invention will not further descript the various possible combinations.

(39) Further, among various embodiments of the present invention may be arbitrarily combined as long as it does not violate the spirit of the invention, which should also be considered as the disclosure of the present invention.