Primers for detecting serotypes of Shigella flexneri and multiplex amplifications using the same

09790560 · 2017-10-17

Assignee

Inventors

Cpc classification

International classification

Abstract

The present inventions relates to primers for identifying Shigella flexneri serotypes comprising the sequences of SEQ ID Nos. 1 and 2, SEQ ID Nos. 3 and 4, SEQ ID Nos. 5 and 6, SEQ ID Nos. 7 and 8, SEQ ID Nos. 9 and 10, SEQ ID Nos. 11 and 12, SEQ ID Nos. 13 and 14, SEQ ID Nos. 15 and 16. These primers are specific and have a common annealing temperature. The present invention further relates to a multiplex amplification-based identification method using the primers. The present invention further relates to the use of the primers for identifying Shigella flexneri serotypes for the preparation of identification agents. The present invention further relates to a kit for identifying Shigella flexneri comprising the above primers.

Claims

1. A method for identifying Shigella flexneri serotypes, comprising performing amplification on a sample using a set of primers comprising the following primer pair nucleic acid sequences: SEQ ID NOs:1 and 2, SEQ ID NOs: 3 and 4, SEQ ID NOs: 5 and 6, SEQ ID NOs: 7 and 8, SEQ ID NOs: 9 and 10, SEQ ID NOs: 11 and 12, SEQ ID NOs: 13 and 14, and SEQ ID NOs: 15 and 16.

2. The method according to claim 1, wherein the set of primers comprises the primer pair nucleic acid sequences of SEQ ID NOs: 17 and 18.

3. The method according to claim 1, wherein the amplification is a polymerase chain reaction.

4. The method according to claim 3, wherein the polymerase chain reaction is a multiplex polymerase chain reaction.

5. The method according to claim 4, further comprising performing singleplex PCR amplification on a sample using a pair of primers comprising the nucleic acid sequences of SEQ ID NOs: 17 and 18.

6. The method according to claim 1, further comprising performing a qualitative analysis after the amplification.

7. The method according to claim 6, wherein the qualitative analysis comprises visualization of the amplified products through gel electrophoresis.

8. The method according to claim 1, further comprising conducting a slide agglutination reaction using anti-group IV antisera to further differentiate between serotypes Xv and X.

9. The method according to claim 1, wherein the sample is obtained from an isolated Shigella flexneri strain.

10. The method according to claim 1, wherein the sample is an enriched or unenriched sample selected from the group consisting of: an excrement sample, an intestinal effusion sample, and a vomit sample.

11. The method according to claim 1, wherein the sample is an enriched or unenriched sample selected from the group consisting of: a water sample, a soil sample, a food sample, and a cosmetic sample.

12. The method according to claim 1, wherein Shigella flexneri serotype 7a or 7b is identified by the amplification step.

Description

DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the chemical composition and genes responsible for specific modifications of the O antigens of various Shigella flexneri serotypes.

(2) FIG. 2 shows the multiplex PCR amplification results of reference strains of 14 serotypes. The results were obtained by using the method of the present invention, wherein M1 and M2 are 150 bp and 100 bp DNA Ladder Markers (purchased from TaKaRa, Japan), respectively.

(3) FIG. 3 shows the specificity assay results of 50 non-Shigella flexneri strains. In the results, M: marker; C: positive control; 1-2: Shigella sonnei, phases I, II; 3-14: Shigella dysenteriae serotypes 1-12; 15-32: Shigella boydii serotypes 1-18; 33-34: Enteroaggregative E. coli; 35-37: Enterohemorrhagic E. coli 0157:H7; 38: Enteroinvasive E. coli; 39: Enteropathogenic E. coli; 40: Enterotoxigenic E. coli; 41: Uropathogenic E. coli; 42-43: E. coli K12; 44: L monocytogenes; 45: V. cholera; 46: Salmonella paratyphi A; 47-48: Salmonella paratyphi B; 49: Yersinia enterocolitica; 50: Salmonella choleraesuis.

DETAILED DESCRIPTION

(4) The present invention will be further described with reference to the following examples and the figures, for better understanding of the invention. The examples are only illustrative and are not in any way limiting the scope of the present invention. In the examples, any experimental methods without detailed conditions specified are conventional methods with conventional conditions well known in the art or conditions recommended by the manufacturer.

EXAMPLES

Materials and Methods

(5) Strains: 14 known Shigella flexneri serotypes (except serotype 5b, see Table 1 for details) were used in the examples to establish the conditions for performing the multiplex PCR method. 358 Shigella flexneri strains in total (Table 2) were used to evaluate the effectiveness of the multiplex PCR method of the present invention. In order to examine the cross-reactions of the primers in this study, 50 strains from different genera were examined (S. Sonnei (n=2), S. dysenteriae (n=12, including all 12 serotypes), S. boydii (n=18, including all 18 serotypes), Enteroaggregative E. coli (n=2), Enterohemorrhagic E. coli O 157:H7 (n=3), Enteroinvasive E. coli (n=1), Enteropathogenic E. coli (n=1), Enterotoxigenic E. coli (n=1), Uropathogenic E. coli (n=1), E. coli K12 (n=2), L. monocytogenes (n=1), V. cholera (n=1), Salmonella paratyphi A (n=1), Salmonella paratyphi B (n=2), Yersinia enterocolitica (n=1), and Salmonella choleraesuis (n=1)). The serotypes of all the Shigella flexneri strains were confirmed with polyvalent antisera (purchased from Denka Seiken, Japan) and monoclonal antibodies (purchased from Reagensia AB, Sweden). All Chinese strains used in the examples were isolated from diarrhea patients in Chinese and were preserved in the Microbiology Laboratory, National Institute for Communicable Disease Control and Prevention, Chinese Center for Disease Control and Prevention (China CDC). Other strains were purchased from National Collection of Type Cultures (NCTC), UK.

(6) Preparation of DNA Templates

(7) DNA templates were directly obtained from bacteria clones by the boiling method. A single colony from an overnight culture on an LB plate was firstly put into 30 μl distilled water, boiled at 100° C. for 10 min, placed into an ice bath for 5 min, and centrifuged at 13,000×g, 4° C. for 10 min. The supernatant was used as the templates for PCR amplification.

(8) PCR Primers

(9) The PCR primers used in the examples are listed in Table 3, the primers for amplification of the wzx gene were designed with reference to Yayue Li et al. (Li, Y., B. Cao, B. Liu, D. Liu, Q. Gao, X. Peng, J. Wu, D. A. Bastin, L. Feng, and L. Wang. 2009. Molecular detection of all 34 distinct O-antigen forms of Shigella. J Med Microbiol 58:69-81), and other primers were designed according to the sequences of Shigella flexneri serotype-specific genes gtrI, gtrIC, gtrII, oac, gtrIV, gtrV, and gtrX.

(10) All primers were synthesized by Sangon Biotech (Shanghai) as commissioned, and dissolved in TL buffer (10 mM Tris-Cl, 1 mM EDTA, pH 8.0) to have a final concentration of 50 μM.

(11) PCR Amplification and Identification

(12) Multiplex PCRs were carried out using a QIAGEN Multiplex PCR Kit (QIAGEN). Each PCR reaction mixture comprises 1×PCR Master Mix (containing HotStarTaq DNA polymerase, Multiplex PCR buffer, and dNTP Mix), primers (0.2 μM each) and 3 μl DNA templates, and is 50 μl in total. In the examples, PCR amplification was performed based on the PCR conditions provided by the kit instructions in which some multiplex PCR cycling parameters were further optimized, Le, pre-denaturation at 95° C. for 15 min; totally 30 cycles of denaturation at 94° C. for 30s, annealing at 55° C. for 90 s, extension at 72° C. for 60 s; and final extension at 72° C. for 10 min. The amplification was performed in a thermocycler from SENSO (Germany). 5 microliter of amplification products was mixed with loading buffer, electrophoresed on a 1.5% agarose gel, and visualized using EB staining for results. Where necessary, the PCR products were directly sequenced or cloned into a pMD20-T TA cloning vector (TaKaRa, Japan) for cloning and sequencing.

(13) Experimental Results

(14) In the examples, reference strains were firstly subjected to singleplex PCR with the primers, and as a results, every pair of primers can give the expected fragments after amplification, namely 783 bp (wzx.sub.1-5), 1122 bp (gtrI), 518 bp (gtrIC), 1268 bp (gtrII), 604 bp (oac), 378 bp (gtrIV), 905 bp (gtrV) and 425 bp (gtrX), respectively. Sequencing of the PCR amplification products proved that the amplified fragments were correct. Afterwards, multiplex PCR was carried out according to the protocols described above in Materials and Methods, in which we tried different annealing temperatures from 54° C. to 63° C. and found that the highest yield was obtained at 55° C. The results showed that different serotypes have different amplification patterns (see FIG. 2 and Table 1). The expected specific PCR products were obtained from the amplification of each serotype. The amplified fragments of different sizes can be well resolved on a 1.5% gel, and with two different DNA markers, each PCR product can be correctly identified by size. The amplification patterns of the reference strains are as follows: 1a (wzx.sub.1-5, gtrI), 1b (wzx.sub.1-5, gtrI, oac), 1c (wzx.sub.1-5, gtrI, gtrIC), 2a (wzx.sub.1-5, gtrII), 2b (wzx.sub.1-5, gtrII, gtrX), 3a (wzx.sub.1-5, oac, gtrX), 3b (wzx.sub.1-5, oac), 4a (wzx.sub.1-5, gtrIV), 4b (wzx.sub.1-5, gtrIV, oac), 5a (wzx.sub.1-5, gtrV), X/Xv (wzx.sub.1-5, gtrX) and Y (wzx.sub.1-5). wzx.sub.1-5 may also be used as a reference gene for PCR reactions since it is present in all Shigella flexneri serotypes except serotype F6, F6 is negative in the amplification as its O-antigen synthesizing genes are completely different from those of other serotypes, and does not have any genes for modifications (Cheah, K. C., D. W. Beger, and P. A. Manning. 1991. Molecular cloning and genetic analysis of the rfb region from Shigella flexneri type 6 in Escherichia coli K-12. FEMS Microbiol Lett 67:213-8; Simmons, D. A., and E. Romanowska., 1987. Structure and biology of Shigella flexneri O antigens. J Med Microbiol 23:289-302).

(15) In the examples, we attempted to incorporate a pair of specific primers for F6 in the reaction. However, the additional pair of primers increases the difficulty in optimization of the multiplex PCR since the reaction already contains 8 pairs of primers. Hence, no good results were obtained after experimentation with 3 pairs of such primers (designed according to the sequence of F6-specific O-antigen gene wzx.sub.6), and one should be cautious when interpreting a strain negative in the amplification as serotype F6. According to preferred embodiments of the present invention, a singleplex PCR was used to confirm F6, the primers for which can be seen in Table 3, and the length of the amplified product is 739 bp. Furthermore, since all strains have been verified with polyvalent antisera for Shigella and serogroup B, possibility of a false-positive F6 is very low.

(16) It is noteworthy that the primers for amplification of the oac gene were designed based on the conserved regions in oac and oac.sub.1b (which share 88% identity) to guarantee both can be amplified. Although a serotype 5b strain was not available, it can be predicted that the amplification pattern of serotype 5b is 905 bp (gtrV) and 425 bp (gtrX) according to the 0 antigen-modification characteristics of this serotype. As there are not any typical strains of serotype 1c, a serotype F1 strain (untypable), 06HN081 (this strain can react with the 1c-specific monoclonal antibody MASF1c), was used in the present invention to detect the serotype 1c-specific gene gtrIC. As compared to typical 1c strains (which react exclusively with MASF1c), this F1 strain (untypable) can react with both MASF1c and group 6 antisera. Accordingly, the genes gtrIC and oac that encode the antigen of MASF1c and the group 6 antigen were both identified as positive. These results indicate that this F1 (untypable) strain is converted from serotype 1b having its O-antigen modified by GtrIC, and is therefore a new serotype (see Table 1). This new serotype has the same serological reaction pattern as the strain of serotype 7b reported in Forster et al., and thus the serotype of 06HN081 should be 7b. It is to be noted that 1c is designated in Forster et al. as 7a (Foster, R. A., N. I. Carlin, M. Majcher, H. Tabor, L. K. Ng, and G. Widmalm. Structural elucidation of the O-antigen of the Shigella flexneri provisional serotype 88-893: structural and serological similarities with S. flexneri provisional serotype Y394 (1c). Carbohydr Res 346:872-6). Hence, these two new serotypes can be identified by the multiplex PCR of the present invention. The present invention further provides the use of the primers, the multiplex PCR method, and the kit for identifying these two new serotypes.

(17) Serotypes X and Xv have the same amplification pattern (wzx.sub.1-5 and gtrX). Thus, they are classified as the same serotype Xv/X by the multiplex PCR method.

(18) In order to evaluate the specificity of the primers, 50 non-Shigella flexneri strains were tested in the examples, including other Shigella serogroups and enteric pathogens. These bacteria all showed negative after the amplification (see FIG. 3), indicating the specificity of the method of the present invention is 100%.

(19) To determine whether the method of the present invention is applicable to all Shigella flexneri strains, and to assess the effectiveness of the method of the present invention, 358 Shigella flexneri strains of various serotypes were analyzed in the examples (see Table 2). The multiplex PCR results of nearly all tested strains (except 8 strains) are consistent with the slide agglutination results, with a concordance rate of 97.8%.

(20) TABLE-US-00001 TABLE 1 Serotype characteristics of S. flexneri reference strains by agglutination and multiplex PCR Serum Agglutination Reaction Type Antigen Group Antigen MASF Multiplex PCR Strain No. Serotype □ □ □ IV V □ 3,4 6 7,8 1c wzx gtrI gtrIC gtrII oac gtrIV gtrV gtrX 2000019 1a + − − − − − + − − − + + − − − − − − 1997020 1b + − − − − − + + − − + + − − + − − − 06HN081.sup.# — − − − − − − − + − + + + + − + − − − 301 2a − + − − − − + − − − + − − + − − − − NCTC4 2b − + − − − − − − + − + − − + − − − + 03HL12 3a − − + − − − − + + − + − − − + − − + 2002110 3b − − + − − − − + − − + − − − + − − − NCTC9725 4a − − − + − − + − − − + − − − − + − − NCTC9726 4b − − − + − − − + − − + − − − + + − − 51247 5a − − − − + − + − − − + − − − − − + − 2003036 Y − − − − − − + − − − + − − − − − − − 2001014 X − − − − − − − − + − + − − − − − − + 2002017 Xv − − − + − − − − + − + − − − − − − + 2000007 F6 − − − − − + − − − − − − − − − − − − .sup.#Atypical F1 type, positive for both MASF1c and group 6 antiserum

(21) TABLE-US-00002 TABLE 2 Correlation between the test results obtained from the multiplex PCR method and the slide agglutination method for 358 Shigella flexneri strains of various serotypes. Multiplex PCR No. of Target Gene serotype Serotype Strains wzx.sub.1-5 gtrI gtrIC gtrII oac gtrIV gtrV gtrX classification F1a 25 25 25 0 0 0 0 0 0 1a (25) F1b 14 14 14 0 0 14 0 0 0 1b (14) F2a 55 55 0 0 55 0 0 0 0 2a (55) F2b 50 50 0 0 50 0 0 0 50 2b (50) F3a 10 10 0 0 0 10 0 0 10 3a (10) F3b 2 2 0 0 0 2 0 0 0 3b (2)  F4a 5 5 0 0 0 0 5 0 0 4a (5)  F4b 5 5 0 0 0 5 5 0 0 4b (5)  F5a 4 4 0 0 0 1 0 4 0 5a (3), untypable (1) Y 36 36 0 0 5 0 0 0 0 Y (31), 2a (5) Xv 78 78 0 0 0 0 0 0 78 X or Xv (78) X 69 69 0 0 2 0 0 0 69 X or Xv (67), 2b (2) F6 5 0 0 0 0 0 0 0 0 F6

(22) TABLE-US-00003 TABLE 3  Primers Used in the Examples Length of Target Amplified Serotype Accession Gene Primer sequence (5′.fwdarw.3′) Fragments (bp) Specificity no. gtrI (F)CTGTTAGGTGATGATGGCTTAG 1122 (SEQ ID 1a, 1b, 1c AF139596 (SEQ ID No. 1) No. 19) (R)ATTGAACGCCTCCTTGCTATGC (SEQ ID No. 2) gtrII (F)ATTTATTGTTATTGGGGGTGGTTG 1268 (SEQ ID 2a, 2b AF021347 (SEQ ID No. 3) No. 20) (R)ATTTGTTCTTTATTTGCTGGTT (SEQ ID No. 4) oac (F)CTGTTCGGCTTTGAAAGTGCTG 604 (SEQ ID 1b, 3a, 3b, AF547987 (SEQ ID No. 5) No. 21) 4b (R)CGTAGGCGTACATAGCAAGCAAAGA (SEQ ID No. 6) gtrIV (F)ATGTTCCTCCTTCTTCCTTT 378 (SEQ ID 4a, 4b AF288197 (SEQ ID No. 7) No. 22) (R)TCCTGATGCTACCTTATCCA (SEQ ID No. 8) gtrV (F)AATACGATTCTCCTGGTGCTAAAC 905 (SEQ ID 5a, 5b U82619 (SEQ ID No. 9) No. 23) (R)TAGGGCATTGCTTGTATCTTTCAT (SEQ ID No. 10) gtrX (F)AATGCTGGATGGGATAATCACCTT 425 (SEQ ID 2b, 3a, 5b, L05001 (SEQ ID No. 11) No. 24) X, Xv (R)GAGACGGCTTCTCCATGTTTTGCT (SEQ ID No. 12) wzx.sub.1-5 (F) CACTTGTTGGGTATGCTGG 783 (SEQ ID 1-5, X, Xv, AE005674 (SEQ ID No. 13) No. 25) Y (R) CCGGCAAACAGATTAGAAA (SEQ ID No. 14) gtrIC (F) AGGGAATGGCATTAGGGATCGG 518 (SEQ ID 1c FJ905303 (SEQ ID No. 15) No. 26) (R) GCTGCAAGTGGTTTTTGTTGGA (SEQ ID No. 16) wzx.sub.6.sup.S (F) TTAAGAGCGATCATTTC 739 (SEQ ID F6 EU294165 (SEQ ID No. 17) No. 27) (R) CCATCCAAGCGGACATT (SEQ ID No. 18) .sup.SThe primer pair for wzx.sub.6 is used to conform serotype F6.

(23) The multiplex PCR method of the present invention may be employed to conduct biomolecular identification of Shigella flexneri serotypes in only one reaction, and can easily and specifically identify the majority of currently known serotypes (14 out of 15). In comparison with the conventional slide agglutination method (which requires as many as 10 independent reactions), the multiplex PCR method of the present invention is time-saving, does not require expensive antisera, and is especially suitable for high-throughput identification. Using this method, identification of 96 samples can be completed within 3.5 hours and costs only 25% of that of the slide agglutination method.