CDNA encoding enone oxidoreductase from mango
09790526 · 2017-10-17
Assignee
Inventors
- Vidya Shrikant Gupta (Pune, IN)
- Ram Shridhar Kulkarni (Pune, IN)
- Ashok Prabhakar Giri (Pune, IN)
- Keshav H. Pujari (Dapoli, IN)
Cpc classification
C12P17/04
CHEMISTRY; METALLURGY
International classification
Abstract
Disclosed herein are primers for amplifying enone oxidoreductase, having a sequence selected from the group consisting of SEQ ID Nos. 1 to 13, from mango. Also disclosed herein is a nucleotide sequence of SEQ ID No. 14 encoding enone oxidoreductase, for enzyme production in an artificial system thus generating the desired flavor in food products.
Claims
1. A bacterial host cell comprising a vector comprising a promoter operably linked to a cDNA comprising SEQ ID NO: 14.
2. The bacterial host cell of claim 1, wherein the bacterial host cell is an E. coli cell.
3. A method for semi-biosynthesis of flavors, comprising: expressing in vitro a cDNA comprising SEQ ID NO: 14 so as to yield an enone oxidoreductase; isolating the enone oxidoreductase; and contacting the isolated enone oxidoreductase with a substrate therefor under conditions for producing a mixture having a flavor as a result of conversion of the substrate to 4-hydroxy-2,5-dimethyl-3(2H)-furanone) by the enone oxidoreductase, wherein the conditions include the presence of a co-factor.
4. The method of claim 3, wherein the enone oxidoreductase is immobilized on a surface between the isolating and contacting steps.
5. A method for enzyme production, comprising: expressing in vitro the cDNA of claim 1 so as to yield an enone oxidoreductase.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
DETAILED DESCRIPTION OF THE INVENTION
(5) The invention will now be described in detail in connection with certain preferred and optional embodiments, so that various aspects thereof may be more fully understood and appreciated.
(6) In order to provide a clear and consistent understanding of the specification, the following definitions are provided. Unless otherwise defined herein, all technical and scientific terms used here have the same meaning as commonly understood by one skilled in the art to which the invention belongs.
(7) ‘Enone oxidoreductase’ refers to an enzyme that catalyzes reduction of an enone compound.
(8) MiEO in the specification refers to enyme Enone oxidoreductase derived from Mangifera indica
(9) In an embodiment, the present invention discloses a novel nucleotide sequence encoding enone oxidoreductase isolated from mango. The nucleotide sequence encoding enone oxidoreductase is useful for enzyme production in an artificial system, plays an important role in the biosynthesis of furaneol in mango. Further, the artificially synthesized enzyme can be mixed appropriately with the food product, thus generating the desired flavor. The nucleotide sequence is also useful in the flavor industry for semi-biosynthesis of flavors via various approaches such as enzyme immobilization, single cell culture, etc., as well as for improving other varieties of mango.
(10) Mature raw fruits of mango used in the present invention are collected from Dapoli, Deogad and Vengurle.
(11) In an embodiment, the present invention provides a primer sequence for amplifying enone oxidoreductase derived from mango selected from sequence having Seq. ID Nos. 1-13.
(12) In embodiment, the present invention discloses the complete open reading frame encoding enone oxidoreductase derived from mango as shown in
(13) Accordingly, the novel isolated nucleotide sequence encoding enone oxidoreductase comprises the sequence ID No. 14.
(14) In an embodiment, the present invention provides forward and reverse degenerate primers for enone oxidoreductase for amplification of the cDNA prepared from ripe fruits of mango.
(15) The degenerate primers (Seq. ID No. 1-7) designed for amplification of the mango cDNA are:
(16) TABLE-US-00001 Forward1 (Seq ID NO. 1) GTKGTKGCTGCWKCYVTTAAYC Forward2 (Seq ID NO. 2) AARGMYAYYGAYTCTCCYYTRC Forward3 (Seq ID NO. 3) GGVWSWTTRGCWGARTAYACHGC Forward4 (Seq ID NO. 4) GTTYTRRRWGGHGCTGGKGGWGTTGG Reverse1 (Seq ID NO. 5) GRATSGGRTAYAYRACYACYTTYCC Reverse2 (Seq ID NO. 6) GCYYTHTCHSKYTSYCCWAYTGC Reverse3 (Seq ID NO. 7) RGTRGCTGCTAYYTTDGAWGCACC
(17) In another embodiment, the present invention provides forward and reverse gene specific primers for enone oxidoreductase for amplification of the ends of cDNA by rapid amplification of cDNA ends (RACE).
(18) The gene specific primers (Seq ID NO. 8-11) designed for amplification of the ends of mango cDNA are:
(19) TABLE-US-00002 Forward1 (Seq ID NO. 8) CGAAGACAGGGCAAGTTCAAGGC Forward2 (Seq ID NO. 9) GGTGTTGGAAGCTTGGTGATTCAG Reverse1 (Seq ID NO. 10) GATTCTCCCCTCCCGACTGTTCC Reverse2 (Seq ID NO. 11) GGGTTCTCTGCTGGTAAATCTATTCT
(20) In yet another embodiment, the current invention provides primers corresponding to the terminal regions of the mRNA which are designed for enone oxidoreductase. These terminal primers are used for the PCR amplification with mango cDNA as a template.
(21) The terminal primers (Seq. ID NO. 12 and 13) designed for the PCR amplification are:
(22) TABLE-US-00003 Forward (Seq ID NO. 12) ATGAAAGCGTGGGTGTATGGAG Reverse (Seq ID NO. 13) TTAAGGAATTGGGTATATAACCACC
(23) The present invention further provides the process of isolating full-length nucleotide sequence (Seq ID no. 14) encoding enone oxidoreductase from ripe mangoes designated as MiEO. The process includes the following steps: i. isolating RNA by CTAB method; ii. treating total RNA with DNase and carrying out reverse transcription to obtain cDNA; iii. designing degenerate primers for enone oxidoreductase based on the alignment of data base entries reported in the NCBI database; iv. amplifying cDNA of step (ii) using the degenerate primers; v. designing gene specific primers for enone oxidoreductase based on the sequence of the fragments obtained in step (iv); vi. amplifying the ends of the cDNA using gene specific primers of step (v) by Rapid Amplification of cDNA Ends (RACE); vii. designing primers corresponding to the terminal regions of mRNA based on the alignment of 5′ and 3′ RACE fragments with the enone oxidoreductase sequences reported from other plants; and viii. amplifying mango cDNA using primers designed in step (vii) by PCR (polymerase chain reaction) to obtain a full length cDNA of a putative mango enone oxidoreductase.
(24) The process of isolating full-length sequence of enone oxidoreductase from ripe mangoes comprises isolation of RNA by CTAB method. After treating isolated RNA with DNase, reverse transcription is carried out. Based on the conserved regions in the nucleotide sequences of orthologous enone oxidoreductase (EO) reported in the NCBI database, designated as quinone oxidoreductases from Fragaria×ananassa (AY048861), Vigna radiate (U20808) and Helianthus annuus (AF384244), degenerate primers are designed. These primers are used for the amplification of cDNA prepared from ripe fruits of mango. This is followed by designing gene specific primers based on the sequence of the fragments obtained by amplification over the cDNA. The gene specific primers are used for amplification of the ends of the cDNA by rapid amplification of cDNA ends (RACE). Based on the alignments of the 5′ and 3′ RACE fragments with the respective sequences reported from the other plants, primers corresponding to the terminal regions of the mRNA are designed and are used for obtaining full-length sequence of MiEO.
(25) The degenerate primers designed in step (iii) of the process of isolating full-length nucleotide sequence encoding enone oxidoreductase from ripe mangoes are as follows;
(26) TABLE-US-00004 Forward1 (SEQ ID NO: 1) GTKGTKGCTGCWKCYVTTAAYC Forward2 (SEQ ID NO: 2) AARGMYAYYGAYTCTCCYYTRC Forward3 (SEQ ID NO: 3) GGVWSWTTRGCWGARTAYACHGC Forward4 (SEQ ID NO: 4) GTTYTRRRWGGHGCTGGKGGWGTTGG Reverse1 (SEQ ID NO: 5) GRATSGGRTAYAYRACYACYTTYCC Reverse2 (SEQ ID NO: 6) GCYYTHTCHSKYTSYCCWAYTGC Reverse3 (SEQ ID NO: 7) RGTRGCTGCTAYYTTDGAWGCACC
(27) The gene specific primers designed in step (v) of the process of isolating full-length nucleotide sequence encoding enone oxidoreductase from ripe mangoes are as follows;
(28) TABLE-US-00005 Forward1 (SEQ ID NO: 8) CGAAGACAGGGCAAGTTCAAGGC Reverse1 (SEQ ID NO: 9) GATTCTCCCCTCCCGACTGTTCC Forward2 (SEQ ID NO: 10) GGTGTTGGAAGCTTGGTGATTCAG Reverse2 (SEQ ID NO: 11) GGGTTCTCTGCTGGTAAATCTATTCT
(29) The terminal primers designed in step (vii) of the process of isolating full-length nucleotide sequence encoding enone oxidoreductase from ripe mangoes are as follows;
(30) TABLE-US-00006 Forward (SEQ ID NO: 12) ATGAAAGCGTGGGTGTATGGAG Reverse (SEQ ID NO: 13) TTAAGGAATTGGGTATATAACCACC
(31) The complete open reading frame (ORF) of MiEO (Sequence ID No. 14) thus obtained is 1143 base pair long and is flanked by a 40 base pair UTR at the 5′ end and by a 115 base pair UTR at the 3′ end. The ORF encodes a protein having 381 amino acids, a calculated molecular weight of 40.6 kD and a pI of 8.61.
(32) In another embodiment, the present invention studies the actual role of MiEO in forming the profiles of furanones observed during the ripening of mango fruit, where the transcripts of MiEO are profiled through various ripening stages. The highest expression of MiEO is detected at the 10 DAH (days after harvest) stage of the ripening fruits while a reduction in the expression of MiEO during the transition from 10 DAH to 15 DAH is observed.
(33) Since ripe mango fruits contain high amounts of the furanones, furaneol and mesifuran, and since MiEO produces furaneol in in vitro assays, it is observed that the most likely in planta function of MiEO is the biosynthesis of furaneol.
(34) Accordingly, in the ripening fruits of mango, the peak level of furanones is detected at the ripe stage (15 DAH); whereas, the highest expression of MiEO is seen at 10 DAH stage. This discrepancy can be attributed to the fact that peak transcript level and synthesis usually precedes the highest accumulation of a substance. However, in strawberry it has been shown that the expression of a similar gene, FaEO, is highly correlated with the furanone levels during fruit development. Several reasons can be given for the differences between strawberry and mango. Most importantly, strawberry is a non-climacteric fruit and mango a climacteric fruit and so there are notable differences in the ripening physiology of these two fruits and in the expression of various genes. Secondly, the level of furanones observed in mango is about 5 fold lower than in strawberry, while the precursor of furaneol, HMMF, is not detected in the mango fruits. The lack of a strong correlation between MiEO expression and furanone accumulation points towards involvement of MiEO in functions in addition to the biosynthesis of furaneol.
(35) In another embodiment, the present invention studies the similarity of the in silico translated amino acid sequence of MiEO with enzymes from other plants. The similarity of the in silico translated amino acid sequence of MiEO is 79% with the chloroplastic alkenal/one oxidoreductase (AOR) from Cucumissativus (CsAOR), 73% with the enone oxidoreductase (EO) from Solanumlycopersicon (SIEO), 72% with the EO from Fragaria×ananassa (FaEO) and 71% with the AOR from Arabidopsis thaliana (AtAOR). One such enzyme, CsAOR from Cucumissativus, which shows 79% sequence identity with MiEO, catalyses the reduction of α, β-unsaturated alkenals/alkenones in in vitro reactions. Similar oxidoreductase activity was also shown to be associated with an enzyme from Arabidopsis (AtAOR). The unsaturated aldehyde and ketone substrates of AORs, generated by lipid peroxidation, are highly reactive chemicals that can damage cellular activities by reacting with various biomolecules. Enzymes such as CsAOR and AtAOR are thought to be important for maintaining cellular processes by converting these harmful carbonyls into their saturated derivatives.
(36) The analysis of the putative amino acid sequence of MiEO, strongly suggests that this protein might be localized in chloroplasts. This prediction can also be supported by the fact that chloroplasts are rich in fructose-1,6-diphosphate, the starting substrate for furaneol biosynthesis, which is produced by various pathways. Chloroplasts are also a center for production of highly reactive chemicals because of the high metabolic activity of this organelle, which can mainly be attributed to the process of photosynthesis and associated reactions. The increased rate of chemical reactions in chloroplasts of the fruits also results from the physiological transition of these organelles into chromoplasts, a most remarkable feature of fruit ripening. This conversion is characterized by various cellular changes such as dismantling of the thylakoid membrane system, which is brought about by degradation of its membrane lipids and chlorophylls, biosynthesis of carotenoids, and reduction in the amount of the proteins involved in photosynthesis. Some of these metabolic processes, especially the degradation of membrane lipids, are known to yield highly reactive compounds such as unsaturated carbonyls and reactive oxygen species. Since the chloroplast-located enzymes from the other plants, CsAOR and AtAOR, which are highly similar to MiEO have been shown to be involved in scavenging of the reactive compounds, it is possible that MiEO also might be involved in such processes instead of or in addition to the biosynthesis of furaneol. This hypothesis is supported by the fact that HMMF, the precursor of furaneol, is not detected in mango fruits. This observation along with the report of MiEO-like transcripts in the plants which have till now not been reported to contain furaneol (Table 1), and the absence of correlation between the transcript abundance of MiEO and the level of furanones in the mango fruits might be taken to support an alternative function of MiEO and a different biosynthetic pathway to the furanones.
(37) TABLE-US-00007 TABLE 1 Uncharacterized sequences from the NCBI database showing high identity with MiEO Sequence Accession Putative identity number Plant annotation with MiEO XP_002525379 Ricinus communis Alcohol 94% dehydrogenase ABK96279 Populus trichocarpa × Unknown 90% Populus deltoides XP_002323668 Populus trichocarpa Unknown 90% ADN33837 Cucumis melo Alcohol 89% dehydrogenase
INDUSTRIAL ADVANTAGES
(38) Furaneol and mesifuran are the two important ripening-related flavor chemicals of Alphonso mango. Biosynthesis of furaneol is catalyzed by enone oxidoreductase which has been isolated from the Alphonso mango fruits in this study. Mango is only the third plant after strawberry and tomato from which such gene has been isolated and characterized. This coding sequences can be used for biotechnological production of the recombinant enone oxidoreductase enzyme which can be used for the production of furaneol. The degenerate primers described here have been designed by homology-based approach based on the putative gene sequences reported from the other plants. These primers can thus be used for isolating similar genes from the other plants also. Similar work is being attempted by the Inventors in case of Alphonso mango as well as other economically important fruits and crops.
(39) The novel nucleotide sequences of the present invention can be used for enzyme production in an artificial system and later this artificially synthesized enzyme can be mixed appropriately with any desired food product for generating the desired flavor. The nucleotide sequences can also be used for semi-biosynthesis of flavors via various approaches such as enzyme immobilization, single cell culture, etc., as well as to improve other varieties of mango. Also furaneol, the product of mango enone oxidoreductase, is an important flavor compound, which has huge application in the food industry.
REFERENCES CITED IN THE SPECIFICATION
(40) Cruz-Hernández A, Gómez-Lim M A. (1995). Alternative oxidase from mango (Mangifera indica, L.) is differentially regulated during fruit ripening. Planta; 197(4):569-76. Klein, D., Fink, B., Arold, B., Eisenreich, W. & Schwab, W. (2007). Functional characterization of enone oxidoreductases from strawberry and tomato fruit. Journal of Agricultural and Food Chemistry 55, 6705-6711. Pandit, S. S., Kulkarni, R. S., Giri, A. P., Koellner, T. G., Degenhardt, J., Gershenzon, J. & Gupta, V. S. (2010). Expression profiling of various genes during the fruit development and ripening of mango. Plant Physiology and Biochemistry (Paris) 48, 426-433. Reddy, Y. V., Srivastava, G. C., (2001) Ethylene biosynthesis and respiration during ripening in mango cultivars. Indian Journal of Plant Physiology. 6, 361-364.
EXAMPLES
(41) The following examples are given by way of illustration and therefore should not be construed to limit the scope of the present invention.
Example 1
(42) Plant Material
(43) Mature raw fruits of mango were collected from the orchards of Konkan Krishi Vidyapeeth at Dapoli (N17°45′ E73°11′) and Deogad (N16°31′ E73°20′) and from a private orchard at Vengurle (N15° 51′ E73° 39′). For each of the three localities, fruits were collected from four plants. After harvesting, fruits were put in the hay, carried to the laboratory and allowed to ripe at ambient temperature. At the interval of every five days, fruits were peeled, pulp was immediately frozen in the liquid nitrogen and stored at −80° C. until use. Thus, the experimental tissues of four ripening stages: 0, 5, 10 and 15 DAH (days after harvest) were obtained from each of the three localities.
(44) RNA Isolation and cDNA Synthesis
(45) RNA was isolated by CTAB method. After treating total RNA with DNase, reverse transcription was carried out over 1 μg of total RNA using Enhanced Avian RT First Strand Synthesis Kit (Sigma, St. Louis, Mo., USA).
(46) Based on the conserved regions in the nucleotide sequences of orthologous enone oxidoreductase (EO) reported in the NCBI database, degenerate primers were designed. These primers were used for the amplification over the cDNA prepared from ripe mango fruits. The gene specific primers designed based on the sequence of the fragments obtained were used for amplification of the ends of the cDNA by rapid amplification of cDNA ends (RACE) using a RACE kit (Clontech, USA). Based on the alignments of the 5′ and 3′ RACE fragments with the respective sequences reported from the other plants, primers corresponding to the terminal regions of the mRNA were designed and were used for the obtaining full-length sequence of Mangifera indica enone oxidoreductase (MiEO).
(47) The complete open reading frame (ORF) of MiEO thus obtained is 1143 base pair long (
(48) The in silico translated sequence of MiEO was alignment with the closest characterized sequences from other plants. The putative amino acid sequence of MiEO shows the presence of the conserved GxGxxG domain which is involved in binding with NADP. As shown in
(49) Similar to CsAOR, AtAOR and SIEO, the N-terminal region of the in silico translated MiEO was characterized by the presence of putative chloroplast targeting peptide as revealed by analysis of the sequence by ChloroP program, suggesting that the MiEO protein might be localized in the chloroplast, as was shown for CsAOR.
Example 2
(50) Expression Cloning and Recombinant Expression in E. coli
(51) Full length sequence of MiEO was amplified using Expand High Fidelity PCR System (La Roche, Basel, Switzerland) with the terminal primers. cDNA prepared from the ripe fruit was used as the template and the resulting fragments of MiEO was cloned in the pCRT7-NT/TOPO expression vector (Invitrogen). Ligation reaction was transformed in the E. coli cells (Top10F′, Invitrogen) and the transformants were selected on the LB-agar medium containing 100 μg/ml carbenicillin. The correct orientation of insert was confirmed by carrying out a PCR using forward T7 promoter primer and reverse gene specific primer, as well as by sequencing. The recombinant plasmids was transformed in BL21 (DE3) (Invitrogen) cells for recombinant expression. Starter culture (5 ml) grown for 48 hour at 18° C. in LB media was used as inoculum for the expression in 100 ml media with the Overnight Express Autoinduction System 1 (Novagen, USA). Cultures were grown for 24 hour at 18° C. and the pellet obtained after centrifugation was suspended in the buffer containing 25 mM MOPSO (pH 7.2) and 10% (v/v) glycerol. The cells were lysed by sonication and the (his).sub.6-tagged recombinant proteins were purified by passing the cleared lysate through Ni-NTA spin columns (Qiagen, Germany). Elution was carried out with the buffer containing 250 mM imidazole, 25 mM MOPSO (pH 7.2) and 10% (v/v) glycerol. Both crude lysate and the purified protein were checked for the presence and size determination of the recombinant protein by SDS-PAGE (Sambrook and Russell, 2001).
Example 3
(52) Assay for the Enzymatic Activity
(53) Purified protein was incubated overnight at 30° C. with 60 mg fructose-1,6-diphosphate and 3 mg NADH in 1 ml buffer containing 25 mM MOPSO and 10% glycerol (pH 7). The products formed were purified by solid phase extraction (SPE) using the DSC-18 columns having the capacity of 3 ml (Sigma, USA). The SPE column was first equilibrated with acetonitrile, followed by the assay buffer. After passing the incubation mixture, the products were eluted from the column with the help of dichloromethane and were analyzed by GC-MS. The product separation was carried out on the GsBP-5MS column having the dimensions of 30 m×0.32 mm i.d.×0.25 μm film thickness (General Separation Technologies, USA). Oven temperatures were programmed from 40° C. for 5 min, raised to 220° C. at 10° C. min-1 and held isothermal for 5 min. Injector and detector temperatures were 150 and 250° C., respectively. Helium was used as carrier gas at a flow rate 1 ml min-1. Mass spectra were obtained using Clarus 500 (Perkin Elmer) gas chromatograph-mass spectrometer at 70 eV with a scan time of 0.2 s. To enhance the selectivity of the detection, only the ion of m/z 128 of furaneol was monitored. In the separate analysis total ion chromatograph was also recorded and was used for examining the spectra of the furaneol formed in the test assays.
(54) Furaneol was detected in assays with the protein expressed from the plasmid having the reverse-oriented insert indicating that this activity is due to background proteins from the E. coli expression system. However, increasing the stringency of the wash solution to 40 mM imidazole during the purification of protein by affinity chromatography using Ni-NTA agarose spin columns resulted in diminishing of the oxidoreductase activity originating from E. coli.
(55) The MiEO protein purified and assayed with fructose-1,6-diphosphate clearly showed the presence of furaneol as a reaction product in the GC-MS analysis (
(56) Although fructose-1,6-diphosphate is not a direct natural precursor of furaneol, the enzyme from strawberry, FaEO was also shown to be able to covert fructose-1,6-diphosphate to furaneol via an intermediate, HMMF. The detection of furaneol in assays of purified MiEO with fructose-1,6-diphosphate as substrate combined with the absence of furaneol in the assays of boiled protein thus confirmed the furaneol forming activity of MiEO.
Example 4
(57) Quantitative PCR Analysis
(58) Quantitative PCR was performed with Brilliant SYBR Green QPCR Master Mix (Stratagene, USA) with elongation factor 1α (EF1α) as a normalizing gene. Primers used for amplifying a fragment of MiEO were: (forward) 5′-AGGTGCTGTAACACCTCCAGGCT-3′ (SEQ ID NO: 16) and (reverse) 5′-CCTGGCTGAAAGGAAATGGCCCC-3′(SEQ ID NO: 17). Transcript abundance was quantified with a Mx3000P Real Time PCR Thermocycler (Stratagene) using a program with 45 cycles of 95° C. for 30 seconds, 63° C. for 30 secondsand 72° C. for 30 seconds, followed by a melting curve analysis of transcripts. The relative transcript abundance of the raw stage (0 DAH) of mango was considered and the fold difference for the rest of the tissues was calculated. Each measurement was repeated with four independent biological replicates, each of which was represented by at least two technical replicates. Ripening stages were compared to each other for the relative transcript abundance of each of the genes between the ripening stages and localities by ANOVA with the aid of Fisher's LSD at p≦0.05 using StatView software, version 5.0 (SAS Institute Inc., USA).
(59) The highest expression of MiEO was detected at the 10 DAH (days after harvest) stage of the ripening fruits (