Method for increasing ETEC CS6 antigen presentation on cell surface and products obtainable thereof
09790257 · 2017-10-17
Assignee
Inventors
Cpc classification
G01N33/56916
PHYSICS
C12N15/70
CHEMISTRY; METALLURGY
A61K39/001102
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A61K2039/545
HUMAN NECESSITIES
International classification
A01N63/00
HUMAN NECESSITIES
Abstract
A method for increasing the presentation of ETEC CS6 antigen on cell surface, comprising the step of contacting cells expressing said antigen with an aqueous solution comprising 0.6-2.2 percent phenol by weight, such that the presentation of said antigen is increased by at least 100%. A method for the manufacture of a killed whole cell vaccine for immunization against CS6-expressing ETC. Cells and vaccines obtainable by the above methods.
Claims
1. A phenol-treated cell having an amount of enterotoxigenic Escherichia coli “ETEC” Coli surface antigen 6 “CS6” antigen presented on a cell surface that is at least 100% greater than an untreated cell, wherein said 100% greater CS6 antigen presentation corresponds to at least 0.6 μg/10.sup.9 bacteria.
2. The cell according to claim 1, wherein the amount of said antigen on the cell surface is at least 200% greater than an untreated cell and corresponds to at least 1.2 μg/10.sup.9 bacteria.
3. The cell according to claim 2, wherein the amount of said antigen on the cell surface is at least 300% greater than an untreated cell and corresponds to at least 1.8 μg/10.sup.9 bacteria.
4. The cell according to claim 1, wherein the cell was treated with 0.6 to 2.0 percent phenol by weight for a duration of 1 to 72 h.
5. The cell according to claim 4, wherein the cell was treated for a duration of 1.5 to 42 h.
6. The cell according to claim 1, wherein the cell was treated with 0.6 to 2.0 percent phenol by weight at a temperature of 18 to 42° C.
7. The cell according to claim 4, wherein the cell was treated at a temperature of 18 to 42° C.
8. The cell according to claim 7, wherein the cell was treated at a temperature of 18 to 38° C.
9. The cell according to claim 8, wherein the cell was treated at a temperature of 18 to 22° C.
10. The cell according to claim 8, wherein the cell was treated at a temperature of is 36 to 38° C.
11. The cell according to claim 6, wherein the cell was treated with a phenol concentration of 0.8-2.0 percent by weight.
12. The cell according to claim 11, wherein the cell was treated with a phenol concentration of 1.0-2.0 percent by weight.
13. The cell according to claim 6, wherein the cell was treated with a phenol concentration of 0.6-2.0 percent by weight, for a time of 6-72 h and at temperature of 18-22° C.
14. The cell according to claim 13, wherein the cell was treated at a phenol concentration of 0.75-0.85 percent by weight, for a time of 40±2 h and at a temperature of 20±1° C.
15. The cell according to claim 1, wherein the cell is an Escherichia coli cell.
16. The cell according to claim 1, wherein the antigen is recombinantly overexpressed by the cells.
17. The cell according to claim 1, wherein the cell is a killed whole cell.
18. The cell according to claim 17, wherein the cell is an Escherichia coli cell.
19. An immunogenic composition, comprising the cell according to claim 1.
20. The immunogenic composition according to claim 19, wherein the cell is an Escherichia coli cell.
21. The immunogenic composition according to claim 20, wherein the cell is a killed whole cell.
22. An immunogenic composition, comprising the cell according to claim 14.
23. The immunogenic composition according to claim 22, wherein the cell is an Escherichia coli cell.
24. The immunogenic composition according to claim 23, wherein the cell is a killed whole cell.
25. A phenol treated cell having an amount of enterotoxigenic Escherichia coli “ETEC” Coli surface antigen 6 “CS6” antigen presented on a cell surface greater than an untreated cell, wherein the amount of surface CS6 antigen presented is at least 0.6 μg/10.sup.9 bacteria, and wherein the cell was treated with 0.6 to 2.0% phenol by weight for a duration of 1 to 72 hours at a temperature of 18 to 42° C.
26. A phenol treated cell having an amount of enterotoxigenic Escherichia coli “ETEC” Coli surface antigen 6 “CS6” antigen presented on a cell surface greater than an untreated cell, wherein the amount of surface CS6 antigen presented is at least 0.6 μg/10.sup.9 bacteria, and wherein the cell was treated at a temperature of 20±1° C. with: 0.6% phenol by weight for a duration of 40 hours; 0.8% phenol by weight for a duration of 16 hours; 0.8% phenol by weight for a duration of 40 hours; 1.0% phenol by weight for a duration of 6 hours; 1.0% phenol by weight for a duration of 16 hours; 1.0% phenol by weight for a duration of 40 hours; 1.2% phenol by weight for a duration of 6 hours; 1.2% phenol by weight for a duration of 16 hours; 1.2% phenol by weight for a duration of 40 hours; 1.5% phenol by weight for a duration of 6 hours; 1.5% phenol by weight for a duration of 16 hours; 1.5% phenol by weight for a duration of 40 hours; 2.0% phenol by weight for a duration of 6 hours; or 2.0% phenol by weight for a duration of 16 hours.
27. A phenol treated cell having an amount of enterotoxigenic Escherichia coli “ETEC” Coli surface antigen 6 “CS6” antigen presented on a cell surface greater than an untreated cell, wherein the amount of surface CS6 antigen presented is at least 0.6 μg/10.sup.9 bacteria, and wherein the cell was treated with 1.0 to 1.5% phenol by weight for a duration of 6 to 40 hours at a temperature of 20±1° C.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
SUMMARY OF THE INVENTION
(4) In a first aspect, there is disclosed a method for increasing the presentation of ETEC CS6 antigen on cell surface, comprising the step of contacting cells expressing said antigen with an aqueous solution comprising 0.6-2.2 percent phenol by weight, such that the presentation of said antigen is increased by at least 100%, preferably at least 200%, more preferably at least 300%.
(5) Preferably, the duration of the contacting step is 1 to 72 h. More preferably, the duration of the contacting step is 1.5 to 42 h.
(6) Preferably, the temperature during the contacting step is 18 to 42° C., more preferably 18 to 38° C., even more preferably 18-22° C. or 36-38° C.
(7) Preferably, the phenol concentration is 0.8-2.0 percent by weight, more preferably 1.0-2.0 percent by weight.
(8) Preferably, the cells comprise Escherichia coli cells. Preferably, the antigen is recombinantly overexpressed by the cells.
(9) Preferably, the method of the first aspect further comprises the step of comparing the presentation of the antigen by the cells to the presentation of CS6-antigen by untreated but otherwise comparable cells by means of an inhibition ELISA or dot blot, preferably inhibition ELISA.
(10) In a second aspect, there is also disclosed a method for the manufacture of a killed whole cell vaccine for immunization against CS6-expressing ETEC, comprising the method according to any of the preceding claims, wherein the phenol concentration, the contacting temperature and the contacting time are chosen such that at least 10.sup.7-fold inactivation of the cells occurs concomitantly with the increase in CS6 antigen presentation.
(11) Preferably, in the method of the second aspect, the phenol concentration is 0.6-2.0 percent by weight, the contacting time is 6-72 h and the contacting temperature is 18-22° C. More preferably, the phenol concentration is 0.75-0.85 percent by weight, the contacting time is 40±2 h and the contacting temperature is 20±1° C.
(12) In a third aspect, there is disclosed a cell obtainable by the method according to the first or the second aspects.
(13) In a fourth aspect, there is disclosed a vaccine for immunization against CS6-expressing ETEC, comprising cells of the third aspect.
DETAILED DESCRIPTION
(14) Method for Increasing Presentation of CS6-Antigen
(15) In a first aspect, the present invention provides a method for increasing the presentation of ETEC CS6 antigen on a cell surface, characterized by that it comprises the step of contacting a cell or cells expressing said antigen with an aqueous solution comprising 0.6-2.2 percent phenol by weight, at a suitable temperature and for a suitable time, such that the presentation of said antigen is increased by at least 20%. By the at least 20% increase in antigen presentation is meant that the amount of antigen present of the cell surface and detectable by suitable methods (see below for details) is at least doubled compared to cells not having been subjected to the method but which are otherwise comparable. Preferably, the increase in antigen presentation is at least 30%, 40%, 50%, 60%, 70%, 80% or 90%, more preferably at least 100%, 125%, 150%, 175%, 200%, 250% or 300%. Most preferably, the increase is at least 100%.
(16) The aqueous solution may e.g. be phosphate buffered saline (PBS) with added phenol, but many different aqueous buffers are suitable. It is preferable that the pH of the buffers is 5-9, more preferably 6-8, most preferably 6.5 to 7.5. The salt concentration of the buffer is preferably 50-200 mM, more preferably 100-150 mM and most preferably about 137 mM. A suitable PBS buffer can be as follows: 8 g NaCl, 0.2 g KCl, 1.44 g Na.sub.2HPO.sub.4, 0.24 g KH.sub.2PO.sub.4, in 1 liter, pH 7.4.
(17) The variables phenol concentration, temperature and time exhibit a certain degree of interdependency. If the temperature is increased, lower phenol concentration and/or shorter time is required to achieve the increased presentation (and vice versa). If the treatment time is lengthened, lower phenol concentration and/or lower temperature can be utilized (and vice versa). Aided by the guidance from the teachings herein, the skilled person will be able to use routine experimentation without significant burden to adapt the combination of phenol concentration, time and temperature to the needs at hand.
(18) Suitable duration for the treatment may be 0.1 to 240 h or 1 to 240 h. Preferably, the treatment time may be 1 to 72 h. More preferably, the treatment time may be 1.5 to 42.0 h. Most preferably, the treatment time is 2.0-40.0 h.
(19) Suitable temperature for the treatment is in the range of 1-45° C. or 4-45° C. Preferably, the temperature may be 18 to 42° C. From practical point of view, it may be preferable to perform the method at ambient (room) temperature to avoid the need for specialized equipment to maintain the temperature. Thus one preferred temperature range is 18-25° C., even more preferably 18-22° C., most preferably about 20° C. It may also be preferable to perform the method at an elevated temperature to shorten the process duration and/or to reduce the required phenol concentration. Thus another preferred temperature range is 35-42° C., even more preferably 36-38° C., most preferably about 37° C.
(20) The phenol concentration may preferably be in the range of 0.7 to 2.0 percent by weight, more preferably 0.75-2.0 percent by weight, yet more preferably 0.8-2.0 percent by weight, still more preferably 0.85-2.0 percent by weight, even more preferably 0.9-2.0 percent by weight, and most preferably 1.0-2.0 percent by weight. In one preferred embodiment, the phenol concentration is 0.6-2.0 percent by weight, the contacting time is 6-72 h and the contacting temperature is 18-22° C. In another preferred embodiment, the phenol concentration is 0.6-2.0 percent by weight, the contacting time is 2-4 h and the contacting temperature is 36-38° C.
(21) The cells in the above method may be Escherichia coli cells. This may be advantageous from practical point of view since E. coli is readily grown and genetically manipulated in the laboratory. Furthermore, the principal purpose of the method is to provide vaccines against ETEC, whereby it may be advantageous to use an E. coli host for the antigen to provide a more natural context for the antigen being presented. Preferably, the cells are non-toxigenic E. coli cells. Nevertheless, it should be understood the method can be used with other CS6-expressing cells as well.
(22) The cell concentration is not crucial within reasonable limits. Any concentration up to 10.sup.12 cells/ml is considered feasible. A practical preferable cell concentration range may be 10.sup.8-10.sup.12 cells/ml. The most preferable range is 10.sup.9 to 2.Math.10.sup.10 cells/ml.
(23) The ETEC CS6 antigen production may be recombinantly induced in the cell, by way of genetic engineering (see Example 1). This facilitates the production of high levels of the antigen per cell, advantageous for minimizing the number of cells needed for a vaccine dose, leading to minimized adverse effects. Nevertheless, the method can also be used with cells that natively (i.e. without any genetic engineering) express the CS6 antigen. Preferably however, the cells of the method are non-toxigenic E. coli host cells that overexpress CS6-antigen as a result of transformation with a CS6-expressing plasmid. Preferably, the plasmid has a non-antibiotic selection marker, i.e. a selection marker that does not require the use of antibiotics for its function. Most preferably, the host cells are auxotrophic for thymidine and the CS6-overexpressing plasmid carriers a thymidinylate synthetase (ThyA) complementating factor, whereby the selection can be carried out using a medium devoid of thymidine. Preferably the CS6-overexpression is driven by a tac-promoter or a similar strong inducible promoter well known in the art.
(24) In terms of measuring the increased presentation of the CS6 antigen as a result of the method of the invention, useful methods are disclosed herein and are also known from the literature. Preferably, the determination is performed using an inhibition ELISA assay as disclosed herein (see Example 2 and the associated Materials and Methods), or by means of a dot blot also disclosed herein (see Example 2). Preferably, the method of the first aspect comprises the further steps of analyzing the amount of presentation of the CS6-antigen by the cells (e.g. using the above techniques) and comparing the amount presented to the amount of CS6-antigen presented by cells which were not subjected to the treatment with aqueous solution comprising phenol but which are otherwise comparable. Suitably, a portion of cells is taken aside and stored before the contacting step to serve as such a control sample.
(25) Method for Manufacture of a Vaccine
(26) In a second aspect, the present disclosure provides a method for the manufacture of a killed whole cell vaccine for immunization against CS6-expressing ETEC, comprising the method according to the first aspect, wherein the phenol concentration, contacting temperature and contacting time are chosen such that at least 10.sup.7-fold inactivation of the cells occurs concomitantly with the increase in CS6 antigen presentation. Preferably, the degree of inactivation is at least 10.sup.8-fold, more preferably 10.sup.9-fold, yet more preferably 10.sup.10-fold and most preferably there are no viable cells present after the treatment. Cell inactivation can be determined by any common means well known in the art. A suitable method is disclosed herein in the section titled Materials and Methods.
(27) The utilization of phenol for cell inactivation as well as increasing antigen presentation may be advantageous since this reduces the number of process steps in vaccine manufacture. The phenol inactivation also solves the problem resulting from the propensity of the CS6-antigen being destroyed the normally preferable inactivation method, formalin treatment (see Example 2).
(28) Preferably, in the method of the second aspect, the phenol concentration is 0.6-2.0 percent by weight, the contacting time is 6-72 h and the contacting temperature is 18-22° C. Alternative preferred set of conditions is where the phenol concentration is 0.6-2.0 percent by weight, the contacting time is 2-4 h and the contacting temperature is 36-38° C. Yet another preferred set of conditions is where the phenol concentration is 1.1-1.3 percent by weight, the contacting time is 16±3 h and the contacting temperature is 20±2° C. Still another preferred set of conditions is where the phenol concentration is 1.1-1.3 percent by weight, the contacting time is 40±8 h and the contacting temperature is 20±2° C. Further preferred set of conditions is where the phenol concentration is 1.4-1.6 percent by weight, the contacting time is 6±2 h and the contacting temperature is 20±2° C. Yet further preferred set of conditions is where the phenol concentration is 0.75-0.85 percent by weight, the contacting time is 40±2 h and the contacting temperature is 20±1° C.
(29) Cells and Vaccines Obtainable Thought the Method of the Invention
(30) In a third aspect, a cell obtainable by the method according the first or second aspects is provided. The phenol treatment results in an apparent change in the structure of the cell wall and/or the antigen such that more of the antigen is more available for detection (both in vitro e.g. by antibodies and in vivo by the immune system). In other words, the bacterial cell thus treated has acquired a novel structure by way of the method of the first or second aspects, although it is not feasible to describe the change in structure in structural terms.
(31) In a fourth aspect there is provided a vaccine for immunization against CS6-expressing ETEC, comprising cells according to the third aspect.
EXAMPLES
(32) For details on the experimental procedures relating to the examples, the reader is referred to the section titled Materials and Methods.
Example 1: Expression of CS6 in E. Coli C600-CS6
(33) A DNA fragment carrying the structural genes (cssA, cssB, cssC, cssD) for CS6, prepared from a wild-type ETEC strain with surface expression of CS6, was amplified by PCR and cloned to construct the expression vector pJT-CS6-ThyA, as depicted in
Example 2: Inactivation of Bacteria Without Destroying the CS6 Antigen Properties
(34) With the aim to kill the CS6 expressing bacteria while preserving the CS6 antigen properties on their surface, the effects of formaldehyde and phenol were compared. Preliminary studies showed that treating the bacteria with 0.3% or 0.6% formaldehyde, while safely killing the bacteria, resulted in a complete loss of detectable CS6 antigen (data not shown). In contrast, treating the bacteria with 0.5% phenol not only killed the tested bacteria, but also preserved the CS6 antigen (data not shown); a lower tested concentration of phenol, 0.25%, on the other hand did not result in complete killing of the bacteria. These results indicated that phenol treatment could be useful for inactivating the bacteria while preserving the CS6 antigen. To work out an optimal inactivation method, different concentrations of phenol were therefore tested for inactivation of both the recombinant C600-CS6 strain and for comparison another CS6 over-expressing strain (TOP10-CS6-Amp). As seen in Table 2, with both strains tested with 0.5%, 0.8%, 1%, and 1.6%, but not with 0.25%, of phenol inactivated the bacteria and also preserved the surface CS6, as tested by inhibition ELISA. The maximal level of CS6 was found when the bacteria were inactivated with 0.8% phenol, which treatment did in fact reproducibly increase the estimated amounts of CS6 antigen surface compared to the untreated bacteria (Table 2). Based on these results, phenol at the concentration of 0.8% was therefore used to inactivate both C600-CS6 and the reference strain E11881/23, which resulted in killed bacteria with 6-fold larger amounts of CS6 on the recombinant strain than on the reference strain, as tested by inhibition ELISA. These inactivated bacteria were then used for oral immunizations of mice.
(35) TABLE-US-00001 TABLE 2 Surface CS6 levels and lack of growth of C600- CS6 and TOP10-CS6-Amp strains, after inactivation with different concentrations of phenol. CS6 (μg/10.sup.9 bacteria) .sup.a Growth .sup.b Phenol C600-CS6 TOP10-CS6-Amp C600-CS6 TOP10-CS6-Amp 0 0.61 ± 0.038 0.39 ± 0.054 + + 0.25% 0.55 ± 0.037 0.30 ± 0.06 + + 0.5% 0.53 ± 0.046 0.77 ± 0.084 − − 0.8% 2.03 ± 0.23 2.36 ± 0.206 − − 1.0% 1.92 ± 0.18 1.87 ± 0.13 − − 1.6% 1.15 ± 0.11 0.89 ± 0.082 − − .sup.a Levels of surface CS6 were measured by inhibition ELISA as described in materials and methods; values mean ± SE of four determinations. .sup.b Following inactivation with phenol, the treated bacteria were tested for sterility (i.e. lack of growth) as described in materials and methods; − indicates no growth, and + indicates growth.
Example 3: Immunogenicity of Phenol-Killed C600-CS6 in Mice
(36) In a first test of the immunogenicity of the recombinant strain C600-CS6 we immunized groups of both Balb/C and C57 Bl/6 mice with the same number of phenol-killed bacteria, and the serum antibody responses to CS6, as measured by ELISA, were compared. Although significant anti-CS6 responses were induced in both types of mice, the antibody responses in C57 Bl/6 mice were substantially higher than in the Balb/C mice (data not shown). We therefore used C57 Bl/6 mice for the further oral immunization studies in which the immunogenicity of orally administered phenol-killed vaccine preparation of C600-CS6 and the reference strain E11881/23 were compared. The results showed that all immunized mice responded with production of serum IgG+IgM antibodies against CS6, and that the titers of antibodies against CS6 on average were more than 60-fold higher in mice immunized with C600-CS6 bacteria than those in mice immunized with the reference strain E11881/23 (
Example 4: Optimization of Phenol Treatment Increasing CS6 Antigen-Presentation at 20° C.
(37) The C600-CS6 strain was cultured for overnight (16-18 h) in a rotary shaker (150 rpm) at 37° C. Aliquots of the overnight culture was diluted 1/100 and the resulting culture incubated for 2 h as above, after which IPTG was added to a final concentration of 1 mM to induce expression of CS6. The culture was then further incubated at the same conditions for an additional 6 h. The bacteria were then harvested, washed twice with PBS (to avoid presence of any residues from the medium), and re-suspended in PBS to a density of OD600=16 (corresponding to approximately 2×10.sup.10 bacteria/mil).
(38) The induced, OD-adjusted bacterial culture was divided into 8 flasks of 250 ml, each containing 25 ml of the bacterial culture. As time zero (i.e. non-treated bacteria) a portion was taken for viable counting. Twenty five (25) ml of phenol to the final concentration (percent by weight) of 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.5, or 2.0 were added into the flasks, followed by incubation of all the flasks for 1 h, 2 h, 6 h, 16 h, and 40 h, at room temperature with 80 rpm. After each time point, 1 ml of each bacterial suspension (with phenol) was removed from each flask to an eppendorf tube. The bacteria were harvested, washed thoroughly twice with PBS (to avoid presence of any residues from the phenol), and re-suspended with 1 ml of PBS. The suspensions were stored at 4° C. and used for inhibition ELISA. The results are shown in Table 3.
(39) TABLE-US-00002 TABLE 3 Surface CS6 levels on C600-CS6 strain, after inactivation with different concentrations of phenol for different times at 20° C. CS6 (μg/10.sup.9 bacteria) .sup.a Incubation times Phenol 0 h 6 h 16 h 40 h 0 0.3 0.6% 0.17 0.28 0.73 0.8% 0.28 0.77 0.89 1.0% 1.1 0.93 1.06 1.2% 1.67 2.2 1.36 1.5% 2.75 1.71 1.14 2.0% 1.57 0.91 0.37 .sup.a Levels of surface CS6 were measured by inhibition ELISA as described in materials and methods. Values are the mean of two determinations.
Example 5: Phenol Treatment Increasing CS6 Antigen-Presentation and Simultaneously Inactivating Bacteria in Industrial Scale
(40) A 500 liter fermentor was inoculated with an E. coli strain overexpressing the CS6 antigen (ETEX 24). After induction of expression by IPTG the fermentation was continued for 8 hours. The bacteria were harvested and washed over a 500 kD ultrafilter and finally dispensed at a concentration of 20×10.sup.9 bacteria/ml. Phenol was added to a final concentration of 0.8% (w/v) and the suspension was kept at 20° C. for 40 hours under constant stirring. The suspension was washed over a 500 kD ultrafiltration membrane in phosphate buffered saline and stored at 4° C.
(41) During the inactivation procedure samples were taken before inactivation after 1, 2, 18 and 40 hours of inactivation to test for viability. Briefly, samples taken were washed by centrifugation and resuspended in the original volume in PBS whereafter dilutions were made in PBS and plated on Colonisation Factor Agar (CFA agar). Plates were incubated at 37° C. and counted the following day.
(42) Inhibition ELISA to quantitate the amount of CS6 antigen was done on fresh material before inactivation and washed inactivated material.
(43) It is clearly apparent that efficient cell inactivation and increased CS6 antigen presentation can be achieved simultaneously in industrial production scale (Table 4).
(44) TABLE-US-00003 TABLE 4 Time course for inactivation at 20° C. Inactivation time (h) 0 1 2 18 40 Total CS6 2.51 Nd Nd Nd 5.36 (μg/10.sup.9 cells) Bound CS6 1.01 Nd Nd Nd 2.90 (μg/10.sup.9 cells) Viable cells (cfu/ml) 1.64 × 10.sup.10 1.5 × 10.sup.5 1.2 × 10.sup.3 0 0 Nd = not determined
(45) Materials and Methods
(46) Bacterial strains and culture. The bacterial strains used in this study are listed in Table 1. A non-toxigenic C600-ΔthyA E. coli strain, which is auxotrophic to thymine (N. I. A. Carlin and M. Lebens, unpublished) was used for construction of the vaccine candidate strain C600-CS6. The ETEC strain E11881/23, which had previously been used as a CS4+CS6 expressing strain in the CF-ETEC+CTB vaccine, was used as a reference strain. For expression of CS6, bacteria were grown in CFA medium (Evans D G, Evans D J Jr., Clegg S, Pauley J A. Purification and characterization of the CFA/I antigen of enterotoxigenic Escherichia coli. Infect Immun 1979; 25:738-48), supplemented with ampicillin (100 μg/ml) when necessary.
(47) TABLE-US-00004 TABLE 1 List of strains, plasmids, and primers used in this study Strains, plasmid and primers Relevant characteristic Reference/source Strains: ETEC GB35 CS6.sup.+, LT.sup.+, Nicklasson et al. Microb Pathog. 2008;44:246-54. E. coli E11881/23 CS4.sup.+ CS6.sup.+, LT.sup.-, ST.sup.- Tobias et al. Vaccine 2008;26:5373-80 TOP10-CS6-Amp TOP10 expressing CS6, Amp.sup.r NIA Carlin and M Lebens E. coli C600-ΔthyA Auxotrophic to thymine; Kan.sup.r This study C600-CFA/I C600-ΔthyA/pJT-CFA/I-ThyA This study C600-CS6 C600-ΔthyA/pJT-CS6-ThyA Plasmid: pJT-CFA/I-Cm 9041 bp Tobias et al. Vaccine 2010;28:6977-84. pNC-4 5086 bp; thyA NIA Carlin pJT-CFA/I-ThyA 8879 bp; thyA This study pJT-CS6-ThyA 7973 bp, thyA This study Primers: P1 5′-CGGTCTCCCTAGGCCTCCTTACCTATGGTGATC (SEQ ID NO: 1) P2 5′-CGGTCTCCTCGAGCGACTCTAGACCTAACCG (SEQ ID NO: 2) P3 5′-CGGTCTCGAATTCTAATGGIGTTATATGAAGAAAACAATTG (SEQ ID NO: 3) P4 5′-CGGTCTCAAGCTTAACATTGTTTATTTACAACAGATAATTGTTTG (SEQ ID NO: 4)
(48) Construction of expression vector pJT-CS6-ThyA. For construction of the C600-CS6 recombinant strain, the plasmid pJT-CFA/I-ThyA was first generated. The plasmid pJT-CFA/I-Cm (Tobias J, Holmgren J, Hellman M, Nygren E, Lebens M, Svennerholm A-M. Over-expression of major colonization factors of enterotoxigenic Escherichia coli, alone or together, on non-toxigenic E. coli bacteria. Vaccine 2010; 28:6977-84.) was digested with XhoI and AvrII to remove the chloramphenicol resistance gene (cat). The plasmid pNC-4 (N. I. A. Carlin; unpublished) was then used in a PCR reaction to amplify the thyA gene (from Vibrio cholerae). The forward primer P1 (SEQ ID NO: 1) was homologous to a sequence starting 98 bp upstream of thyA and had restriction sites for Eco31I and AvrII, and the reverse primer P2 (SEQ ID NO: 2) was homologous to a sequence ending 75 bp downstream of thyA, and had restriction sites for Eco31I and XhoI, at the 5′ end (Table 1). PCR conditions were as follows: 95° C. for 5 min, 31 cycles of 94° C. for 15 s, 58° C. for 30 s and 72° C. for 50 sec, with a final extension of 7 min at 72° C. The resulting 1065 bp fragment containing thyA was then gel-extracted and cleaved with XhoI and AvrII. Ligation of the amplified and digested thyA with the digested pJT-CFA/I-Cm resulted in pJT-CFA/I-ThyA (
(49) The plasmid pJT-CS6-ThyA was then constructed in two steps (
(50) Expression of CS6. The CS6 expressing strains were cultured in CFA medium, overnight (16-18 h) in a rotary shaker (150 rpm) at 3° C. Aliquots of the overnight cultures were diluted 1/100 in CFA medium and the resulting cultures were incubated for 2 h as above. Into the culture of the recombinant strain, IPTG was added to a final concentration of 1 mM to induce expression of CS6, and then cultures were further incubated at the same conditions for an additional 6 h. The bacteria were then harvested and re-suspended in PBS to a density of OD600=0.8 (corresponding to approximately 10.sup.9 bacteria/ml).
(51) Quantification of CS6 on the recombinant strain. A specific monoclonal antibody (MAb 2a:14) against CS6 (Helander A, Grewal H M, Gaastra W, Svennerholm A-M. Detection and characterization of the coli surface antigen 6 of enterotoxigenic Escherichia coli strains by using monoclonal antibodies. J Clin Microbiol 1997; 35:867-72) was used to quantify the level of expression of CS6 by the recombinant C600-CS6 and the ETEC reference E11881/23 strains, using dot-blot and inhibition ELISA methods, as described (Tobias J, Holmgren J, Hellman M, Nygren E, Lebens M, Svennerholm A-M. Over-expression of major colonization factors of enterotoxigenic Escherichia coli, alone or together, on non-toxigenic E. coli bacteria. Vaccine 2010; 28:6977-84 and Tobias J, Lebens M, Bölin I, Wiklund G, Svennerholm A-M. Construction of non-toxic Escherichia coli and Vibrio cholerae strains expressing high and immunogenic levels of enterotoxigenic E. coli colonization factor I fimbriae. Vaccine 2008; 26:743-52.)
(52) Preparation of inactivated bacteria. Formaldehyde and phenol were tested and compared for inactivation of the CS6 expressing strains. Formaldehyde, in final concentrations of 0.3% (w/v; 0.1M) or 0.6% (0.2M), and phenol in final concentrations of 0.25%-1.6% (w/v; 0.026-0.17M), were added to bacterial cultures at a density of 10.sup.10 bacteria/ml in PBS. The suspensions were incubated for 2 h at 37° C. with shaking at 60 rpm, and then kept at 4° C. for 3 days without agitation. The bacterial suspensions were then centrifuged, washed, and re-suspended in the same volume of PBS and kept at 4° C. until use. In both inactivation methods, 0.1 ml of each suspension was spread onto blood agar and incubated at 37° C. for up to one week to check for lack of growth. Before being used for oral immunization, the level of CS6 on the inactivated bacteria was checked by inhibition ELISA.
(53) Mouse immunizations and sample collection. Groups of female Balb/C and C57 Bl/6 mice (Charles River; 6-8 weeks of age; 5 mice/group) were used for oral (intragastric) immunizations. All mice were given two doses of 3×10.sup.8 phenol-killed bacteria (inactivated, using 0.8% concentration of phenol) of either C600-CS6 or the reference strain together with 7.5 μg CT two days apart in 0.3 ml 3% sodium bicarbonate solution intragastrically through a baby feeding catheter (first round of immunization), followed two weeks later by two identical immunizations two days apart in a second round of immunization. Bleedings were performed before the first immunization and two weeks after the last immunization, at which times fecal pellets (FPs) were also collected and extracts prepared as described previously (Nygren E, Holmgren J, Attridge S R. Murine antibody responses following systemic or mucosal immunization with viable or inactivated Vibrio cholerae. Vaccine 2008; 26:6784-90). In addition, at the later time point when the mice were sacrificed, they were perfused with a heparin-PBS solution to remove blood from the tissues, and small intestinal tissue collected and extracted with a 2% (w/v) Saponin-PBS solution (the Perfext method) as described previously Villavedra M, Carol H, Hjulstrom M, Holmgren J, Czerkinsky C. “PERFEXT”: a direct method for quantitative assessment of cytokine production in vivo at the local level. Res Immunol 1997; 148:257-66).
(54) ELISAs. IgG+IgM and IgA antibody titers against CS6 were determined in sera, fecal and intestinal extracts, by ELISA, as described previously (Rudin A, Svennerholm A-M. Colonization factor antigens (CFAs) of enterotoxigenic Escherichia coli can prime and boost immune responses against heterologous CFAs. Microb Pathog 1994; 16:131-9). CS6, for use as coating antigen (at the final concentration of 0.7 μg/ml) in ELISAs, was purified from the previously described TOP10-CS6 over-expressing strain (Tobias J, Lebens M, Källgård S, Nicklasson M, Svennerholm A-M. Vaccine 2008; 26:5373-80.), by sequential ammonium sulphate precipitation and gel filtration. Sera from individual mice were tested using low-binding microtiter plates (Greiner), and samples were initially diluted 1/100 followed by serial three-fold dilutions. Fecal pellet extracts and small intestine tissue extracts were tested in high-binding microtiter plates (Greiner) in 3-fold serial dilutions from a starting dilution of 1/3. Antibody titers were calculated as the reciprocals of the sample dilutions which gave an A450 absorbance of 0.4 above the background value. In the fecal and intestinal extract samples, total IgA was also measured by ELISA as described (Nygren E, Holmgren J, Attridge S R. Vaccine 2008; 26:6784-90), and antigen-specific IgA antibody values were expressed as IgA titer units per μg of total IgA.
(55) Statistical analysis. All ELISA experiments were done at least twice on different occasions. Statistical analyses were conducted by Student's t-test, and P<0.05 (two-tailed) was regarded as a significant difference.