Production of metabolites
09822374 · 2017-11-21
Assignee
Inventors
- Michael Patrik Katz (Malmo, SE)
- Thomas Durhuus (Copenhagen, DK)
- Hans Peter Smits (Holte, DK)
- Jochen Förster (Copenhagen V, DK)
Cpc classification
C12N9/1029
CHEMISTRY; METALLURGY
International classification
C12N9/00
CHEMISTRY; METALLURGY
Abstract
A recombinant micro-organism such as Saccharomyces cerevisiae which produces and excretes into culture medium a stilbenoid metabolite product when grown under stilbenoid production conditions, which expresses in above native levels a ABC transporter which transports said stilbenoid out of said micro-organism cells to the culture medium. The genome of the Saccharomyces cerevisiae produces an auxotrophic phenotype which is compensated by a plasmid which also expresses one or more of said enzymes constituting said metabolic pathway producing said stilbenoid, an expression product of the plasmid is genetically modified to include a ubiquitination tag sequence. Expression of an enzyme participating in catabolism of phenylalanine by the Ehrlich pathway is optionally reduced compared to its native expression level.
Claims
1. A recombinant Saccharomyces cerevisiae micro-organism which produces and excretes into culture medium resveratrol, wherein the micro-organism comprises: (a) a resveratrol producing metabolic pathway comprising a phenylalanine ammonia lyase (PAL) or a tyrosine ammonia lysase (TAL), a cinnamate 4-hydroxylase (C4H), a 4-coumarate-CoA ligase (4CL) and a stilbene synthase; (b) a greater than native expression level of SNQ2, (c) a functionally disabled or deleted ARO10, and (d) a greater than native expression level of an acetyl coenzymeA carboxylase (ACC1) enzyme, and wherein the micro-organism is capable of producing above 4,000 mg/L of resveratrol when cultured for a time and under conditions wherein the recombinant micro-organism produces resveratrol.
2. The recombinant micro-organism of claim 1, wherein said SNQ2 is an expression product of the gene SNQ2 of Saccharomyces cerevisiae.
3. The recombinant micro-organism of claim 1, wherein a gene expressing said SNQ2 is endogenous and is present in a higher copy number than in the native micro-organism.
4. The recombinant micro-organism of claim 1, wherein the stilbene synthase is a resveratrol synthase.
5. The recombinant micro-organism of claim 4, wherein the resveratrol synthase is from Vitis pseudoreticulata.
6. The recombinant micro-organism of claim 4, wherein the resveratrol synthase is from Vitis vinifera.
7. The recombinant micro-organism of claim 1, in which the gene products of the Saccharomyces cerevisiae genes Aro4 and Aro7 are expressed at levels in excess of those produced in the wild type of the micro-organism by replacing a native promoter of the Aro4 and Aro7 genes with a strong promoter providing a higher level of expression.
8. The recombinant micro-organism of claim 7, wherein the strong promoter providing a higher level of expression is TDH3, TEF1, TPI1, ADH1 or TEF2.
9. The recombinant micro-organism of claim 7, wherein the Aro4 gene is encoded by SEQ ID NO.:138 and the Aro7 gene is encoded by SEQ ID NO.:139.
10. The recombinant micro-organism of claim 1, wherein the micro-organism is capable of producing over 5,000 mg/L of resveratrol when cultured for a time and under conditions wherein the recombinant micro-organism produces resveratrol.
11. The recombinant micro-organism of claim 1, wherein the micro-organism is capable of producing at least about 4,000 mg/L of resveratrol to about 5,000 mg/L of resveratrol when cultured for a time and under conditions wherein the recombinant micro-organism produces resveratrol.
12. The recombinant micro-organism of claim 1, wherein said SNQ2 gene is exogenous or is endogenous to said micro-organism and is expressed at a level higher than the native expression level in the micro-organism by replacing a native promoter of a gene expressing said SNQ2 gene with a strong promoter providing a higher level of expression in the micro-organism.
13. The recombinant micro-organism of claim 12, wherein the strong promoter providing a higher level of expression is TDH3, TEF1, TPI1, ADH1 or TEF2.
14. A dried biomass of the recombinant micro-organism of claim 1.
15. An animal feed comprising the recombinant micro-organism of claim 1 or the dried biomass of claim 14.
Description
(1) The invention will be further described with reference to the accompanying drawings in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19) As shown in
(20) A stilbenoid pathway may be provided in a micro-organism such as Saccharomyces cerevisiae by providing the genes needed to express the enzymes shown in the pathways of these figures.
(21) A preferred recombinant Saccharomyces cerevisiae FS09258-51-53-32B-44 combining the various aspects of the invention will now be described in detail.
(22) The recipient microorganism is a Saccharomyces cerevisiae with genotype MATalpha ura3-52 his3 MAL2-8c SUC2]. The following plasmids are introduced.
(23) TABLE-US-00004 Introduced genetic material Introduced Vectors/Plasmids FS09258-51-53- Plasmids/Strains 32B-44 RHO 0051 + RHO0053 + RHO0032B + RHO0044 + + Plasmid expressed in strain; FS09258-51-53-32B-44 contains three multicopy plasmids that contain the plant heterologous resveratrol pathway genes.
(24) The three plasmids vectors, RHO0053, RHO0032B and RHO0044, are based on Stratagene PESC-vectors, PESC-URA, PESC-HIS and PESC-LEU (www.stratagene.com) and have been modified by replacing the original inducible galactose promoters with yeast constitutive promoters. The three plasmids vectors, RHO0053, RHO0032B and RHO0044 further contain the plant resveratrol pathway genes, with the full set of resveratrol pathway genes included in each plasmid (see plasmids maps further below). The heterologous plant genes come from the non-pathogenic Arabidopsis thaliana and Vitis vinifera (grape) (resveratrol, synthase).
(25) The plasmid Rho51 is also based on the Stratagene vector (pesc-trp) and also has strong constitutive promoters. In addition the 2-micron region, which signals self-replication and multi copy, has been removed, and thus this plasmid can only replicate as a single copy integrated in the yeast genome.
(26) The plasmid RHO51 contains an over expression of a resveratrol transporter SNQ2. SNQ2 is as a plasma membrane ATP-binding cassette (ABC) transporter, multidrug transporter involved in multidrug resistance and has resistance to singlet oxygen species. SNQ2 was cloned between the BamHI and KpnI restriction sites of vector PSF57-TRP1 to generate vector RHO0051 (see plasmid features and map) under the control of TDH3 promoter. By cutting this vector with Hind III (which cuts in the end of TRP1 marker) and transforming a TRP-auxotrophic yeast the integrative vector integrates into chromosome of the deleted TRP1 promoter and restores the non-functional TRP1.
(27) Further detail of the plasmids appears below:
(28) TABLE-US-00005 Plasmid RHO0053 - see also FIG. 4 Features Rho0053 Name Type Region CYC1 Terminator 4987 . . . 5107 ADH1 Terminator complement(157 . . . 321) ADH1 Terminator complement(6884 . . . 7048) CYC1 Terminator 14786 . . . 14906 F1 Replication origin complement(6482 . . . 6788) pUC origin Replication origin 14936 . . . 15603 2mu Replication origin 16745 . . . 17900 TDH3 Promoter complement(2190 . . . 2844) TEF1 Promoter 3134 . . . 3534 TDH3 Promoter complement(9365 . . . 10019) TEF1 Promoter 10309 . . . 10709 Tag 2 Promoter 6169 . . . 6216 4CL2 ORF complement(507 . . . 2177) VST1 ORF 3547 . . . 4725 URA3 with ORF 5365 . . . 6219/note = Length: 807 TAG2 PAL2 Codon opt. ORF complement(7199 . . . 9352) Bla ORF complement(15751 . . . 16623) C4H-CYB5- ORF 10722 . . . 14540 ATR2
(29) TABLE-US-00006 Plasmid RHO0032b see also FIG. 5 Features Rho0032b Name Type Region CYC1 Terminator 8094 . . . 8214 ADH1 Terminator complement(157 . . . 321) pUC Replication origin 14999 . . . 15666 2 mu Replication origin 16808 . . . 17963 F1 origin Replication origin 9613 . . . 9919 TEF1 Promoter 12996 . . . 13396 TDH3 Promoter complement(12052 . . . 12706) TDH3 Promoter complement(2673 . . . 3327) TEF1 Promoter 3617 . . . 4017 VST1 ORF 13409 . . . 14587 4CL2 ORF complement(10369 . . . 12039) HIS3 ORF 8562 . . . 9221 Bla ORF complement(15814 . . . 16674) PAL2 ORF complement(507 . . . 2660) C4H-CYB5-ATR2 ORF 4030 . . . 7848
(30) TABLE-US-00007 Plasmid RHO0044 - see also FIG. 6 Features Rho0044 Name Type Region LEU2_terminator Terminator 9721 . . . 10171 CYC1 Terminator 7985 . . . 8105 CYC1 Terminator 15627 . . . 15747 ADH1 Terminator complement(48 . . . 212) ADH1 Terminator complement(10797 . . . 10961) 2 mu Replication 17586 . . . 18741 origin PUC origin Replication 15777 . . . 16444 origin TDH3 Promoter 13514 . . . 14180 TEF Promoter complement(12824 . . . 13236) LEU2_promoter Promoter 8234 . . . 8613 TEF Promoter 3502 . . . 3914 TDH3 Promoter complement(2558 . . . 3223) VST1 ORF 14187 . . . 15368 4CL2 ORF complement(11147 . . . 12817) LEU2 ORF 8614 . . . 9720 C4H::Cyb5::AR2codopt ORF 3957 . . . 8105 PAL2codopt ORF complement(398 . . . 2551) BLA ORF complement(16592 . . . 17464)
(31) TABLE-US-00008 Plasmid RHO0051 - see also FIG. 7 Features Rho0051 Name Type Region PTRP1 Promoter 187 . . . 468 TDH3 Promoter 2865 . . . 3514 TEF Promoter complement(2164 . . . 2564) SNQ2 ORF 3521 . . . 8026 TRP1 ORF 469 . . . 1140
(32) FS09258-51-53-32B-44 carries a deletion in the gene ARO10, Ura3, His3, Leu2, Trp1 and an over expression of the gene ACC1:
(33) Over Expression of ACC1 by Promoter Exchange
(34) ACC1 was over expressed using the native constitutive S. cerevisiae promoter TPI1 (Triose-phosphate isomerase). The TPI-ACC1 is a chromosomal up-regulation of the ACC1 gene by replacing the natural weak promoter of ACC1 with the constitutive native S. cerevisiae TPI promoter from the TPI gene (YDR050c) which encodes an abundant glycolytic enzyme, triose phosphate isomerase. The method used for promoter switch is described in (Erdeniz et al, 1997). ACC1 (YNR016c) encodes an enzyme, acetyl-CoA carboxylase, that catalyzes the carboxylation of acetyl-CoA to form malonyl-CoA. Malonyl-CoA is normally required for de novo biosynthesis of long-chain fatty acids in yeast and is also needed in for resveratrol synthesis (Resveratrol synthase reaction: 3 malonyl-CoA+4-coumaroyl-CoA=4 CoA+3,4′,5-trihydroxy-stilbene+4 CO2).
(35) Gene Deletion
(36) Deletion of genes was performed using a cre-lox system (Gueldener et al, 2002) that leaves a short loxP-sequence in the shortened DNA.
(37) In the following the deletions are further described: Ura3-52 is a common and well characterized auxotrophic marker and means that the natural Ura3 gene (or systematic gene name YEL021w) has been mutated by an insertion of a TY1 (transposable) element. The Ura3 gene encodes an enzyme, orotidine-5′-phosphate (OMP) decarboxylase, that catalyzes the sixth enzymatic step in the de novo biosynthesis of pyrimidines. This mutation is a non-reverting mutation (Rose and Winston, 1984).
(38) His3 is also a common and well characterized marker and means that the His3 gene (YOR202w) is a non-reverting mutated form to render it auxotrophic. His3 encodes an enzyme, Imidazoleglycerol-phosphate dehydratase, that catalyzes the sixth step in histidine biosynthesis.
(39) The leu2 is a common auxotrophic marker. Usually this auxotrophic markers consists of mutations and frame shift mutations in position leu2-3,112 (Meira et al, 1995). However, in this strain we have ourselves deleted major parts of the LEU2 gene using the method described previously (Erdeniz et al, 1997) to render the strain auxotrophic for Leu2 to avoid mutation strategies in our strains.
(40) The Trp1 is a common auxotrophic marker in laboratory S. cerevisiae strains. We deleted major parts of the TRP1 gene using the method described, previously (Erdeniz et al, 1997) to render the strain auxotrophic for TRP1 to avoid mutation strategies in our strains.
(41) ARO10 (YDR380w) encodes an enzyme, phenylpyruvate decarboxylase, that catalyzes the decarboxylation of phenylpyruvate to phenylacetaldehyde, in the Ehrlich pathway (also called fusel alcohol pathway), which means the generation of alcohols from amino acids by transamination, followed by a decarboxylation and a final reduction step. (transaminase=>decarboxylase=>reductase/dehydrogenase).
(42) Resveratrol Pathway
(43) The inserted heterologous genes encode enzymes involved in the phenylpropanoid pathway. This pathway involves the consumption of L-phenylalanine via cinnamic acid to coumaric acid to coumaryl-CoA. Finally the formation of resveratrol is made possible via resveratrol synthase from grape. The formed product resveratrol is a nutraceutical with anticarcinogenic and antioxidant properties. The genes are as follows: a) Codon optimized phenylalanine ammonia lyase (PAL2) from Arabidopsis thaliana for expression in S. cerevisiae catalysing the deamination of phenylalanine into cinnamic acid. b) A fused DNA fragment consisting of three genes (parts): Part i) a cinnamate 4-hydroxylase gene (C4H) from Arabidopsis thaliana codon optimized for expression in S. cerevisiae; Part ii) Electron carrier Cytochrome b5 CYB5 encoded by S. cerevisiae native ORF YNL111c; Part iii) a cytochrome p450 reductase gene (AR2) from Arabidopsis thaliana, codon optimized for expression in S. cerevisiae.
(44) The three parts have been fused in such a way that they are expressed as one single enzyme and the orientation of the fused DNA fragment is >Start codon C4H::CYB5::AR2 stop codon<(where :: means fused genes in frame). This fusion constructs enables higher catalytic activities of the hydroxylation step (conversion of cinnamic acid into coumaric acid), than when C4H is expressed alone. c) A non-codon-optimized 4-coumaroyl CoA-ligase (4CL2) from Arabidopsis thaliana catalyzing the activation of coumaric acid into coumaroyl-CoA while consuming ATP and acetyl-CoA. d) Codon optimized resveratrol synthase from grape (Vitis vinifera) catalyzing the ring-folding reaction of one coumaroyl-CoA and 3 malonyl-CoA into resveratrol.
The Regulatory Sequences Permitting the Expression of Solely the Gene(s) of Interest. TEF1 promoter from S. cerevisiae (Mumberg et al, 1995), which is the promoter of the gene YBR118w. This gene encodes a Translational elongation factor EF-1 alpha TDH3 promoter from S. cerevisiae (Mumberg et al, 1995), which is the promoter of the gene YGR192c. This gene encodes a glyceraldehydes 3-phosphate dehydrogenase. CYC1 terminator from the S. cerevisiae gene YJR048w which encodes cytochrome C isoform 1 ADH1 terminator from the S. cerevisiae gene YOL086c which encodes alcohol dehydrogenase 1 LEU2 terminator from the S. cerevisiae gene YCL018W which encodes beta-isopropylmalate dehydrogenase
The Nucleotide Sequences Needed for Vector Maintenance. Ori F for replication and subcloning in E. coli (however has no function in S. cerevisiae) 2 micron on for replication in S. cerevisiae Ampicillin resistance gene for selection in E. coli (however has no function and is not expressed in S. cerevisiae) Amino acid auxotrophic markers URA3 and HIS3 and LEU2 and TRP1 for selection and maintenance in S. cerevisiae.
(45) The invention will be further described and illustrated by the following examples.
(46) In this work certain methods have been used which will be briefly described here.
(47) Infusion Technology
(48) Vector constructs were generated either using i) the standard restriction enzyme based cloning in combination with ligation using T4 DNA ligase or ii) the Infusion Technology (In-Fusion™ Dry-Down PCR Cloning Kit) from Clontech (Clontech, Mountain View, Calif.). This In-Fusion technology allows homologous recombination between a linearized plasmid and an insert generated by PCR containing homologous overhangs to the linearized vector. The linearized vector was either generated by restriction digest or by PCR using the Herculase® II Fusion DNA Polymerase (Agilent Technologies—Stratagene, La Jolla, Calif.) and primers with a melting temperature of 60 degree Celsius.
(49) Bipartite Method of Over-Expression of Native Yeast Genes by Gene Targeting Method Based on Kluyveromyces lactis URA-Marker.
(50) Over-expression of native yeasts genes with constitutive yeast promoters is carried out by means of a promoter-replacement method based on a linear, PCR-generated gene-targeting substrate and using K. lactis URA3 as a recyclable marker described previously (Erdeniz et al, 1997). This method includes the generation of an intermediate yeast strain, where the Kluyveromyces lactis URA3 marker gene is integrated in combination with two copies of the strong constitutive promoter sequence as a direct repeat on each side of the marker gene. The marker gene is then looped out through recombination mediated by the direct repeat, an event which is selected for by plating the intermediate strain on medium containing 5-fluoroorotic acid (5-FOA), which is toxic to cells expressing the URA3 gene. The result is a yeast strain, in which the native promoter has been replaced with the strong constitutive promoter. Integration of the above described promoter sequence and marker gene is directed to the correct location in the genome by means of PCR-generated target sequences.
(51) The above described gene-targeting substrate can be constructed by means of multiple rounds of fusion-PCR. However, to avoid introduction of PCR-generated mutations, it is beneficial to use a bi-partite or even a quadruple gene-targeting substrate (Erdeniz et al, 1997).
(52) For example, to over express a gene with the strong ADH1 promoter, this promoter has been introduced into intermediate working vectors on either side of K. lactis URA3, resulting in the vectors pWAD1, pWAD2, (WO2005/118814). With these vectors as templates, fragments can be amplified that contain (in the 5′ to 3′ direction) 1) the ADH1 coupled to two thirds of K. lactis URA3 towards the 5′ end, using the primers AD-fw and Int3′, and 2) two thirds of K. lactis URA3 towards the 3′ end coupled to the ADH1, using the primers Int5′ and AD-rv. Target sequences corresponding to a 300-500 bp sequence upstream of the gene to be overexpressed and a 300-500 bp starting with ATG of the gene to be over expressed, are amplified from genomic yeast DNA using suitable primers. The reverse primer used for amplification of the upstream target sequence contains a 5′ overhang that allows fusion to fragment 1 described above. The forward primer used for amplification of the target sequence starting with ATG contains a 5′ overhang that allows fusion with fragment 2 described above. Following fusion by PCR of the upstream target sequence with fragment 1, and fusion by PCR of fragment 2 with the target sequence starting with ATG, the two linear substrates that are ready for transformation.
(53) Cre/Lox Method for Gene Deletion
(54) Deletion of target genes was carried out by means of a method based on a linear, PCR-generated gene-targeting substrate using auxotrophic or antibiotic resistance marker flanked by a 34 bp sequences called loxP sites, together with a recombinase containing plasmid (Johansson and Hahn-Hägerdal, 2002, Yoon et al., 1998).
(55) The method utilizes a cre-recombinase originating from the Bacteriophage P1 which recognizes and facilitates a recombination event between loxP sequences causing loss of the marker sequence between these sites. This method includes the generation of an intermediate yeast strain, where the chosen marker gene is integrated in combination with two copies of the loxP targeting sequences as a direct repeat on each side of the marker gene. The intermediate strain also contains an autonomously replicating plasmid bearing an auxotrophic or antibiotic resistance marker and a Cre-recombinase gene controlled by the galactose inducible promoter GAL1. The marker gene is then looped out through recombination mediated by the Cre-recombinase targeting the loxP sites, an event activated by galactose metabolism. The result is a yeast strain, in which the coding sequence of the target gene has been replaced by one loxP site.
(56) The above described gene-targeting substrate can be constructed by means of fusion-PCR. However, to avoid introduction of PCR-generated mutations, it is beneficial to use a bi-partite or even a quadruple gene-targeting substrate (Erdeniz et al, 1997).
(57) For example, to delete a target gene using a chosen marker, say K. lactis URA3 flanked by loxP sites, two 34 bp sites have been introduced into a working vector on either side, resulting in the vector pUG72 (Johansson and Hahn-Hägerdal, 2002). With this vector as template, fragments can be amplified that contain (in the 5′ to 3′ direction) i) the loxP sequence coupled to two thirds of K. lactis URA3 towards the 5′ end, using the primers URA3_R 5′-ATACATTTGCCTTTTGAAAAC and X1_F 5′-GTCAGCGGCCGCATCCCTGCTACGCTGCAGGTCGACAA, and ii) two thirds of K. lactis URA3 towards the 3′ end coupled to a loxP sequence, using the primers X2_R 5′-CACGGCGCGCCTAGCAGCGGAGGCCACTAGTGGATCTGATAT and URA3_F 5′-CCAACAATGATGATATCTGATC.
(58) Target sequences corresponding to a 300-500 bp sequence upstream of the gene to be deleted and a 300-500 bp from the stop codon of the gene to be deleted, are amplified from genomic yeast DNA using suitable primers. The reverse primer used for amplification of the upstream target sequence contains a 5′ overhang that allows fusion to fragment 1 described above. The forward primer used for amplification of the target sequence starting with the stop codon contains a 5′ overhang that allows fusion with fragment 2 described above. Following fusion by PCR of the upstream target sequence with fragment 1, and fusion by PCR of fragment 2 with the target sequence starting with the stop codon, the two linear substrates are ready for transformation.
(59) Yeast Transformations and Nomenclature
(60) The transformation of yeast cells is conducted in accordance with methods known in the art, for instance by using lithium acetate transformation method (Gietz and Schiestl, 1991) followed by plating on selective medium, synthetic complete agar plates lacking amino acids corresponding to the markers on the vectors and the auxotrophy of the yeast mutants. In general, unless stated in the specific Examples, the resulting strains after transformation were given the following strain nomenclature FSX-Y-Z-V-W, where X is the strain background and Y, Z, V, W indicate vectors, integrative and 2 micron multicopy self-replicative, that have been transformed into that strain background X. For instance, taking strains Examples for FS01529-9-28 and FS09258-53-32-44-51 that appear in the following Examples, for strain FS01529-9-28, the strain background yeast strain X is 01529 and contains vectors Y and Z, which are vector RHO009 and RHO028. For strain FS09258-53-32-44-51, the strain background X is 09258 and the strain contains the vectors, Y, Z, V, W, which are RHO053, RHO032, RHO044 and RHO051, respectively.
(61) Lipid Extraction from Yeast
(62) Prior to lipid extraction, an estimation of dry-weight (DW) concentration of the culture was done and the culture either diluted or concentrated in dH.sub.2O, such that a suspension with a dry-weight concentration of approximately 8 mg/ml was obtained.
(63) The cells for extraction were prepared by transferring 1 ml cell suspension (ca 8 mg dry weight) to a trans-methylation tubes (100×16 mm) with “red” PTFE-lined “black” screw-on caps micro tube with screw cap (SciLabware Limited, Staffordshire, United Kingdom), centrifuged at 8000 rpm for 4 min and removing the supernatant. 50 μl internal standard was added (C23:0 FFA, >99% p.a., Larodan) with 1 ml methanol, 1 ml methanolic HCL and 600 μl heptane (with 0.02% BHT), the samples were vortexed and incubated for 60 min at 100° C. with thoroughly hand-shaking for 5 sec every 20 min. After incubation, the samples were allowed to cool down below room temperature in an ice bath. Subsequently, 2 ml of milli-Q H.sub.2O was added and vortexed briefly and the sample spun at 1730 rpm for 2 min. About 150 μl of the upper heptane phase was transferred to a GC vial with an insert (200 μl) and stored at −20° C. until GC analysis.
(64) Gas Chromatography with FID Detection
(65) FAME were analysed on a gas chromatograph (GC) (Agilent 7890A, Agilent) coupled to a flame-ionisation-detector (FID). The GC-FID was operated with an auto-injector (GC-Pal, CTC Analytics) and GC software, EZChrom Elite (version 3.3.1).
(66) Sample injection volumes was 1 μl (2-6 mg/mL) and the split ratio 200:1 operated at an injector temperature of 250° C. Number of rinses with sample prior to injection was 1 and after injection the number of rinses with solvent was 5. Samples were separated on a DB-Wax column (10m×0.1 mmID, 0.1 μm film thickness) (J&W Scientifics). The column was fitted to a flame-ionization-detector (FID) for identification and quantification. Hydrogen was used as carrier gas and operated at a linear velocity of 30 ml/min
(67) Based on the polar nature of the column coating (100% DB-Wax) and an optimized temperature programme (see below), FAME were separated according to differences in polarity and boiling point. Oven temperature was initially set at 190° C. Immediately after injection it was increased to 230° C. at 40° C./min, then increased to 240° C. at 12° C./min and finally increased to 260° C. at 60° C./min and kept there for 0.5 min. Total run time was 3.0667 min.
(68) On the FID side, nitrogen was used as makeup gas (25 mL/min) and the air/hydrogen ratio set at 13.33:1 (400:30 ml/min). The FID-detector was set at 275° C.
(69) The FAME were identified based on relative retention time (RRT). Using the GC software (EzChrom Elite), RRTs were produced and updated using an array of commercially available FAME standards (GLC reference standard 68D, 409 and 85, Nu-Chek-Prep) and C22:4 (n-6), C23:0, C22:5 (n-3) and C18:4 (n-3) (Sigma, Larodan and Avanti). A quantitative FAME standard (GLC 68D, Nu-Chek-Prep) was run routinely to monitor the condition of the column and overall GC performance.
(70) Fatty Acid Quantification and Yield
(71) Quantification was based on FID data auto-integrated by the GC software and manually corrected for potential artefacts. Amounts of individual fatty acids (FA) and total FA (mg) were calculated based on the ISTD (C23:0 FFA), added during lipid extraction. The ISTD was made up in a solution of chloroform:methanol (2:1, v/v) and a suitable amount was added to represent 5-10% of total FA. FA yield (mg FA/g DW) was determined by calculation based on the ISTD and divided by the dry weight (DW) of the biomass in 1 ml of the initial cell suspension.
EXAMPLE 1
Isolation of Resveratrol Pathway Genes Encoding PAL2, C4H, ATR2, 4CL2, 4CL1 and VST1
(72) Phenylalanine ammonia lyase (PAL2 gene) codon optimised for S. cerevisiae from Arabidopsis thaliana (Cochrane et al., 2004) (SEQ ID NO 14), cinnamate 4-hydroxylase (C4H gene) codon optimised for S. cerevisiae from Arabidopsis thaliana (Mizutani et al, 1997) (SEQ ID NO 15), cytochrome P450 reductase (ATR2 gene) codon optimised for S. cerevisiae from Arabidopsis thaliana (Mizutani and Ohta, 1998) (SEQ ID NO 16), 4-coumarate:coenzymeA ligase (4CL1) codon optimised for S. cerevisiae from Arabidopsis thaliana (Hamberger and Hahlbrock 2004; Ehlting et al., 1999) (SEQ ID NO 17), and resveratrol synthase (VST1 gene) from Vitis vinifera (grapevine) (Hain et al., 1993) (SEQ ID NO 18) codon optimized for expression in S. cerevisiae was synthesized by GenScript Corporation (Piscataway, N.J.). The synthetic codon optimized genes were delivered inserted in E. coli pUC57 vector. The synthetic genes were reamplified with PCR using the pUC57 vectors as templates. After DPN1 digestion the PCR products were purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen).
(73) 4-coumarate:coenzymeA ligase (4CL2) (Hamberger and Hahlbrock 2004; Ehlting et al., 1999) (SEQ ID NO 19) was isolated via PCR from A. thaliana cDNA (BioCat, Heidelberg, Germany) using the forward primer 5′-GC GAATTC TT ATGACGACAC AAGATGTGAT AGTCAATGAT (SEQ ID NO 20) containing the underlined restriction site EcoRI and the reverse primer 5′-GC ACTAGT ATC CTA GTT CAT TAA TCC ATT TGC TAG TCT TGC T (SEQ ID NO 21) containing the underlined restriction site SpeI.
(74) Resveratrol Producing Vector Construction
EXAMPLE 2
Construction of a Yeast Vector for Galactose Induced Expression of PAL2 and C4H:ATR2 Fusion Gene
(75) The gene encoding PAL2 from A. thaliana was reamplified via PCR from Genscript vector pUC-57-PAL2 using forward primer 5-CTC ACT AAA GGG CGG CCG CAT GGA CCA AAT TGA AGC AAT-3 (SEQ ID NO 22) containing the restriction site ECoRI and reverse primer containing the restriction site BGLII 5-TAA GAG CTC AGA TCT TTA GCA GAT TGG AAT AGG TG-3 (SEQ ID NO 23).
(76) The gene encoding C4H from A. thaliana was reamplified via PCR from Genscript vector pUC-57-C4H using forward primer 5-GAA GAA GAC CTC GAG ATG GAT TTG TTA TTG CTG GA-3 (SEQ ID NO 24) and reverse primer 5-AGT AGA TGG AGT AGA TGG AGT AGA TGG AGT AGA TGG ACA ATT TCT GGG TTT CAT GA-3 (SEQ ID NO 25). ATR2 from A. thaliana was reamplified via PCR from Genscript vector pUC-57-ATR2 using forward 5-CCA TCT ACT CCA TCT ACT CCA TCT ACT CCA TCT ACT AGG AGG AGC GGT TCG GGC-3 (SEQ ID 26) and reverse primer 5-GCT AGC CGC GGT ACC TTA CCA TAC ATC TCT CAG ATA T-3 (SEQ ID NO 27).
(77) The amplified PCR products C4H and ATR2 were used as templates for the creation of the fusion gene C4H:ATR2 using the forward primer 5-GAA GAA GAC CTC GAG ATG GAT TTG TTA TTG CTG GA-3 (SEQ ID NO 28) and the reverse primer 5-GCT AGC CGC GGT ACC TTA CCA TAC ATC TCT CAG ATA T-3 (SEQ ID NO 29).
(78) The fusion gene C4H:ATR2 gene was digested with XhoI/KpnI and ligated into XhoI/KpnI digested pESC-URA-PAL2. The resulting plasmid, pESC-URA-PAL2-C4H:ATR2 (RHO003), contained the genes encoding PAL2 and C4H:ATR2 under the control of the divergent galactose induced <=GAL1/GAL10=> promoters. The sequence of the gene encoding C4H:ATR2 was verified by sequencing of two different clones of RHO003.
EXAMPLE 3
Construction of a Yeast Vector for Galactose Induced Expression of PAL2 and C4H:CYB5:ATR2 Fusion Gene
(79) The gene encoding PAL2 from A. thaliana was reamplified via PCR from Genscript vector pUC-57-PAL2 using forward primer 5-CTC ACT AAA GGG CGG CCG CAT GGA CCA AAT TGA AGC AAT-3 (SEQ ID NO 30) containing the restriction site ECoRI and reverse primer containing the restriction site BGLII 5-TAA GAG CTC AGA TCT TTA GCA GAT TGG AAT AGG TG-3 (SEQ ID NO 31).
(80) The amplified PAL2 PCR-product was digested with EcoR1/BGLII and ligated into EcoR1/BGLII digested pESC-URA vector (Stratagene), resulting in vector pESC-URA-PAL2. Two different clones of pESC-URA-Pal2 were sequenced to verify the sequence of the cloned gene.
(81) PAL2 from A. thaliana was reamplified via PCR from Genscript vector pUC-57-PAL2 using forward primer 5-GAA GAA GAC CTC GAG ATG GAT TTG TTA TTG CTG GA-3 (SEQ ID NO 32) and reverse primer 5-ACC TAG AGC ACC ACC ACA ATT TCT GGG TTT CAT GAC T-3 (SEQ ID NO 33). ATR2 from A. thaliana was reamplified via PCR from Genscript vector pUC-57-ATR2 using forward 5-GGT GCT ATT CTA GTT GGT AGG AGG AGC GGT TCG GGC-3 (SEQ ID NO 34) and reverse primer 5-GCT AGC CGC GGT ACC TTA CCA TAC ATC TCT CAG ATA T-3 (SEQ ID NO 35). CYB5 (encoded by S. cerevisiae gene YNL111c) was amplified using purified genomic DNA from S. cerevisiae as template using forward primer 5-CCA GCT CAA TCA GTT CCA GCT CTT TCA GTT CCT AAA GTT TAC AGT TAC C-3 (SEQ ID NO 36) and reverse primer 5-AAC TAG AAC TGA TTG AGC AGT TGG TGA TGG TTT ACT TTG GTT TTC AGA GG-3 (SEQ ID NO 37).
(82) The amplified PCR products C4H, CYB5 and ATR2 were used as templates for the creation of the fusion gene C4H:CYB5:ATR2 using the forward primer 5-GAA GAA GAC CTC GAG ATG GAT TTG TTA TTG CTG GA-3 (SEQ ID NO 38) and the reverse primer 5-GCT AGC CGC GGT ACC TTA CCA TAC ATC TCT CAG ATA T-3 (SEQ ID NO 39).
(83) The fusion gene C4H:CYB5:ATR2 gene was digested with XhoI/KpnI and ligated into XhoI/KpnI digested pESC-URA-PAL2. The resulting plasmid, pESC-URA-PAL2-C4H:CYB5:ATR2 (RHO004), contained the genes encoding PAL2 and C4H:CYB5:ATR2 under the control of the divergent galactose induced <=GAL1/GAL10=> promoters. The sequence of the gene encoding C4H:ATR2 was verified by sequencing of two different clones of (RHO004).
EXAMPLE 4
Construction of a Yeast Vector for Galactose Induced Expression of 4CL2 and VST1
(84) The gene encoding 4CL2 was isolated as described in Example 5. The amplified 4CL2 PCR-product was digested with EcoR1/Spe1 and ligated into EcoR1/Spe1 digested pESC-HIS vector (Stratagene), resulting in vector pESC-HIS-4CL2. Two different clones of pESC-HIS-4CL2 were sequenced to verify the sequence of the cloned gene.
(85) The gene encoding VST1 was reamplified from Genscript vector puc57-VST1 via PCR using the forward primer 5′-CC GGATCC ATG GCA TCC GTA GAG GAG TTC AGA A-3′ (SEQ ID NO 40) containing the underlined BamHI restriction site and the reverse primer 5′-CG CTCGAG TCA TTA GTT AGT GAC AGT TGG AAC AGA GT-3′ (SEQ ID NO 41) containing the underlined restriction site for XHOI. The amplified synthetic VST1 gene was digested with BamH1/Xho1 and ligated into BamH1/Xho1 digested pESC-HIS-4CL2. The resulting plasmid, pESC-HIS-4CL2-VST1 (Rh0043), contained the genes encoding 4CL2 and VST1 under the control of the divergent galactose induced <=GAL1/GAL10=> promoters. The sequence of the gene encoding VST1 was verified by sequencing of two different clones of pESC-HIS-4CL2-VST1.
EXAMPLE 5
Construction of a Yeast Vector for Galactose Induced Expression of 4CL1 and VST1
(86) The gene encoding 4CL1 was isolated via PCR from the puc57-4CL1 vector using the forward primer 5′-TTGAAAATTCGAATTC ATGGCCCCCCAAGAA-3′ (SEQ ID NO 42) containing the underlined restriction site EcoRI and the reverse primer 5′-GCGAAGAATTGTTAATTAA TTAAAGACCGTTTGCTAGTTT-3′ (SEQ ID NO 43) containing the underlined restriction site for PACI. The amplified 4CL1 PCR-product was digested with EcoR1/PAC1 and ligated into EcoR1/PAC1 digested pESC-HIS vector (Stratagene), resulting in vector pESC-HIS-4CL1. Two different clones of pESC-HIS-4CL1 were sequenced to verify the sequence of the cloned gene.
(87) The gene encoding VST1 was reamplified from Genscript vector puc57-VST1 via PCR using the forward primer 5′-CC GGATCC ATG GCA TCC GTA GAG GAG TTC AGA A-3′ (SEQ ID NO 40) containing the underlined BamH1 restriction site and the reverse primer 5′-CG CTCGAG TCA TTA GTT AGT GAC AGT TGG AAC AGA GT-3′ (SEQ ID NO 45) containing the underlined restriction site for XHOI. The amplified synthetic VST1 gene was digested with BamH1/Xho1 and ligated into BamH1/Xho1 digested pESC-HIS-4CL1. The resulting plasmid, pESC-HIS-4CL1-VST1 (RhO001), contained the genes encoding 4CL1 and VST1 under the control of the divergent galactose induced <=GAL1/GAL10=> promoters. The sequence of the gene encoding VST1 was verified by sequencing of two different clones of pESC-HIS-4CL1-VST1 (RHO001).
EXAMPLE 6
Construction of Strong Constitutive Promoter Fragment TDH3
(88) The 600 base pair TDH3 (GPD) promoter was amplified from S. cerevisiae genomic DNA using the forward primer 5′-GC GAGCTC AGT TTA TCA TTA TCA ATA CTC GCC ATT TCA AAG-3′ (SEQ ID NO 46) containing a Sac1 restriction site and the reverse primer 5′-CG TCTAGA ATC CGT CGA AAC TAA GTT CTG GTG TTT TAA AAC TAA AA-3′ (SEQ ID NO 47) containing a Xba1 restriction site. The amplified TDH3 fragment was digested with Sac1/Xba1 and ligated into Sac1/Xba1 digested plasmid pRS416 (Sikorski and Hieter, 1989) as described previously (Mumberg et al, 1995) resulting in plasmid pRS416-TDH3.
EXAMPLE 7
Construction of Constitutive Strong Promoter Fragment TEF2
(89) The 400 base pair TEF2 promoter was amplified from S. cerevisiae genomic DNA using the forward primer 5′-GC GAGCTC ATA GCT TCA AAA TGT TTC TAC TCC TTT TTT ACT CTT-3′ (SEQ ID NO 48) containing a Sac1 restriction site and the reverse primer 5′-CG TCTAGA AAA CTT AGA TTA GAT TGC TAT GCT TTC TTT CTA ATG A-3′ (SEQ ID NO 49) containing a Xba1 restriction site. The amplified TEF2 fragment was digested with Sac1/Xba1 and ligated into Sac1/Xba1 digested plasmid pRS416 (Sikorski and Hieter, 1989) as described previously (Mumberg et al, 1995) resulting in plasmid pRS416-TEF2.
EXAMPLE 8
Construction of Fused Divergent Constitutive TEF and TDH3 Promoter Fragment
(90) A divergent fusion fragment between TEF2 promoter and TDH3 promoter was constructed starting from PRS416-TEF and PRS416-TDH3.
(91) The 600 base pair TDH3 fragment was reamplified from PRS416-TDH3 using the forward primer 5′ TTGCGTATT GGGCGCTCTTCC GAG CTC AGT TTA TCA TTA TCA ATA CTC GC-3′ (SEQ ID NO 50) containing the underlined overhang for fusion PCR to TEF2 fragment and the reverse primer 5′ AT GGATCC TCT AGA ATC CGT CGA AAC TAA GTT CTG-3′ (SEQ ID NO 51) containing the underlined BamH1 restriction site. This resulted in a fragment ready for fusion to the below TEF2 fragment.
(92) The 400 base pair TEF2 fragment including a 277 base pair spacer upstream of the Sac1 restriction site was reamplified from PRS416-TEF2 using the forward primer 5′ AT GAATTC TCT AGA AAA CTT AGA TTA GAT TGC TAT GCT TTC-3′ (SEQ ID NO 52) containing the underlined EcoR1 restriction site and the reverse primer 5′ TGA TAA TGA TAA ACT GAG CTC GGA AGA GCG CCC AAT ACG CAA AC-3′ (SEQ ID NO 53) containing the underlined overhang for fusion to the TDH3 fragment. This resulted in a 680 base pair fragment ready for fusion to the TDH3 fragment.
(93) The 680 base pair TEF2 fragment and the 600 base pair TDH3 fragments were joined together (fused) using fusion PCR with the forward primer 5′ AT GAATTC TCT AGA AAA CTT AGA TTA GAT TGC TAT GCT TTC-3′ (SEQ ID NO 54) and the reverse primer 5′ AT GGATCC TCT AGA ATC CGT CGA AAC TAA GTT CTG-3′ (SEQ ID NO 55), resulting in the divergent promoter fragment <=TEF2/TDH3=> (SEQ ID NO 56).
EXAMPLE 9
Construction of a Yeast Vector for Constitutive Expression of PAL2 and C4H:ATR2 Fusion Gene
(94) The vector pESC-URA-PAL2-C4H:ATR2 with divergent galactose inducible promoters GAL1/GAL10 was sequentially digested with NotI and BsiWI to remove the GAL1/GAL10 promoters.
(95) The divergent constitutive <=TEF2/TDH3=> promoter fragment (Example 8) was re-amplified with forward primer 5-GC GCGGCCGC TCT AGA AAA CTT AGA TTA GAT TGC TAT GCT TTC-3 (SEQ ID NO 57) and reverse primer 5-ATT CGTACG TCT AGA ATC CGT CGA AAC TAA GTT CTG-3 (SEQ ID NO 58). The resulting PCR product was sequentially digested with NotI and BsiWI and ligated into the above vector without the GAL1/Ga110 fragment. This resulted in a vector pESC-URA-TDH3-PAL2-TEF1-C4H:ATR2 (RHO0019) with replaced promoters, from GAL1/Ga110 to TEF2/TDH3.
EXAMPLE 10
Construction of a Yeast Vector for Constitutive Expression of PAL2 and C4H:CYB5:ATR2 Fusion Gene
(96) The vector pESC-URA-PAL2-C4H:CYB5:ATR2 with divergent galactose inducible promoters GAL1/GAL10 was sequentially digested with NotI and BsiWI to remove the GAL1/GAL10 promoters.
(97) The divergent constitutive <=TEF2/TDH3=> promoter fragment (Example 8) was re-amplified with forward primer 5-GC GCGGCCGC TCT AGA AAA CTT AGA TTA GAT TGC TAT GCT TTC-3 (SEQ ID NO 57) and reverse primer 5-ATT CGTACG TCT AGA ATC CGT CGA AAC TAA GTT CTG-3 (SEQ ID NO 58). The resulting PCR product was sequentially digested with NotI and BsiWI and ligated into the above vector without the GAL1/Gal10 fragment. This resulted in a vector pESC-URA-TDH3-PAL2-TEF1-C4H:CYB5:ATR2 (RHO0025) with replaced promoters, from GAL1/GA110 to TEF2/TDH3.
EXAMPLE 11
Construction of a Yeast Vector for Constitutive Expression Induced of 4CL2 and VST1
(98) The vector pESC-HIS-4CL2-VST1 with divergent galactose inducible promoters GAL1/GAL10 was sequentially digested with EcoR1 and BamH1 to remove the GAL1/GAL10 promoters.
(99) The divergent constitutive <=TEF2/TDH3=> promoter fragment (Example 8) was sequentially digested with EcoR1 and BamH1 and ligated into the above linearized vector without the GAL1/GAL10 fragment. This resulted in a vector pesc-HIS3-TEF2-4CL2-TDH3-VST1 (RHO0011) with replaced promoters, from GAL1/GA110 to TEF2/TDH3.
EXAMPLE 12
Generation of Control Vectors RHO0020 and RHO0022
(100) Vectors pESC-URA3 and pESC-HIS3 (Stratagene) were digested with BamH1 and EcOR1 to remove the divergent GAL1/Gal10 galactose promoters. The divergent TEF/TDH3 promoters were cut out from vector RHO009 and ligated into two opened Stratagene vector backbones to generate the empty control vectors pESC-URA3-TEF/TDH3 (RHO0020) and pESC-HIS3-TEF/TDH3 (RHO0022).
EXAMPLE 13
Generation of Vector RHO0028 from RHO0025 (Marker Exchange)
(101) The URA3 marker in vector RHO0025 was exchanged for the HIS3 marker using the Infusion Technology. The RHO0025 vector backbone except for the URA3 marker cassette was linearized with PCR using the Herculase II polymerasae with the forward primer 5′-ATGCGTAAGGAGAAAATACCGCATCAGG-3′ (SEQ ID NO 59) and the reverse primer 5′-CTC TCA GTA CAA TCT GCT CTG ATG CCG-3′ (SEQ ID NO 60). The HIS3 marker cassette was reamplified from pESC-HIS (Stratagene) using the forward primer 5′ CAGAGCA GATTGTACTG AGAG GAG CTT GGT GAG CGC TAG GAG TCA and the reverse primer 5′-CGG TAT TTT CTC CTT ACG CAT GGA AAG CGC GCC TCG TTC AGA ATG-3′ (SEQ ID NO 62) with the underlined homologous overhangs to the linearized RHO0025 vector. The two fragments were recombined using the Infusion Cloning Kit. The resulting vector pESC-HIS3-TDH3-PAL2-TEF1-C4H:CYB5:ATR2 (RHO0028).
EXAMPLE 14
Generation of Vector RHO009 from RHO0011 (Marker Exchange)
(102) The HIS3 marker in vector RHO0011 was exchanged for the URA3 marker using the Infusion Technology. The RHO0011 vector backbone except for the HIS3 marker cassette was linearized with PCR using the Herculase II polymerasae with the forward primer 5′-TCG ACG GAT CTA TGC GGT GTG AAA TAC C-3′ (SEQ ID NO 63) and the reverse primer 5′-ACT CTC AGT ACA ATC TGC TCT GAT GCC G-3′ (SEQ ID NO 64). The URA3 marker cassette was reamplified from pESC-URA (Stratagene) using the forward primer 5′-AGA GCAGATTGTA CTGAGAGT CAT CAG AGC AGA TTG TAC TGA GAG TGC-3′ (SEQ ID NO 65) and the reverse primer 5′-CAC ACC GCA TAG ATC CGT CGA GGA TTT TGC CGA TTT CGG CCT ATT GG-3′ (SEQ ID NO 66) with the underlined homologous overhangs to the linearized RHO0011 vector. The two fragments were recombined using the Infusion Cloning Kit. The resulting vector pESC-URA3-TEF2-4CL2-TDH3-VST1 was called RHO009.
EXAMPLE 15
Construction of a Yeast Vector for Constitutive Expression PAL2, C4H:ATR2, 4CL2 and VST1 Containing the ura3 Marker RHO0029
(103) RHO0019 was used as template for PCR amplification (Herculase II) using forward primer 5-CAG AGC AGA TTG TAC TGA GAG TG-3 (SEQ ID NO 70) and reverse primer 5-ATG CCG CAT AGT TAA GCC A-3 (SEQ ID NO 67). RHO0011 was used as template for PCR amplification (Herculase II) using forward primer 5-TGG CTT AAC TAT GCG GCA TGA GCG ACC TCA TGC TAT ACC T-3 (SEQ ID NO 68) and reverse primer 5-TCT CAG TAC AAT CTGC TCT GCT GTG GAT AAC CGT ATT ACC G-3 (SEQ ID NO 69). The two fragments obtained by PCR was fused using InFusion Cloning technology resulting in the plasmid pESC-URA-TDH3-PAL2-TEF1-C4H:ATR2-TDH3-4CL2-TEF-VST1 (RHO0029).
EXAMPLE 16
Construction of a Yeast Vector for Constitutive Expression PAL2, C4H:ATR2, 4CL2 and VST1 Containing the His3 Marker RHO0030
(104) RHO0011 was used as template for PCR amplification (Herculase II) using forward primer 5-CAG AGC AGA TTG TAC TGA GAG TG-3 (SEQ ID NO 70) and reverse primer 5-ATG CCG CAT AGT TAA GCC A-3 (SEQ ID NO 67). RHO0019 was used as template for PCR amplification (Herculase II) using forward primer 5-TGG CTT AAC TAT GCG GCA TGA GCG ACC TCA TGC TAT ACC T-3 (SEQ ID NO 68) and reverse primer 5-TCT CAG TAC AAT CTGC TCT GCT GTG GAT AAC CGT ATT ACC G-3 (SEQ ID NO 69).
(105) The two fragments obtained by PCR was fused using InFusion Cloning technology resulting in the plasmid pESC-HIS-TDH3-PAL2-TEF1-C4H:ATR2-TDH3-4CL2-TEF-VST1 (RHO0030).
EXAMPLE 17
Construction of a Yeast Vector for Constitutive Expression PAL2, C4H:CYB5:ATR2, 4CL2 and VST1 Containing the His3 Marker RHO0032b
(106) RHO0025 was used as template for PCR amplification (Herculase II) using forward primer 5-CAG AGC AGA TTG TAC TGA GAG TG-3 (SEQ ID NO 70) and reverse primer 5-ATG CCG CAT AGT TAA GCC A-3 (SEQ ID NO 67). RHO0011 was used as template for PCR amplification (Herculase II) using forward primer 5-TGG CTT AAC TAT GCG GCA TGA GCG ACC TCA TGC TAT ACC T-3 (SEQ ID NO 68) and reverse primer 5-TCT CAG TAC AAT CTGC TCT GCT GTG GAT AAC CGT ATT ACC G-3 (SEQ ID NO 69).
(107) The two fragments obtained by PCR was fused using InFusion Cloning technology resulting in the plasmid pESC-HIS-TDH3-PAL2-TEF1-C4H:CYB5:ATR2-TDH3-4CL2-TEF-VST1 (RHO0032b).
EXAMPLE 18
Construction of a Yeast Vector for Constitutive Expression PAL2, C4H:CYB5:ATR2, 4CL2 and VST1 Containing the Leu2 Marker RHO0044
(108) Vector RHO0044 (The full resveratrol pathway on one 2 micron based self-replicative multicopy vector with leu2-marker) was constructed as follows. First the HIS3 marker was exchanged in plasmid pesc-HIS3-TDH3-4CL2-TEF-VST1 (RhO0011) using InFusion Cloning by fusing fragment i) linearized RHO0011 constructed by PCR with Herculase II and the forward primer 5′-TCG ACG GAT CTA TGC GGT GTG AAA TAC C (SEQ ID NO 63) and the reverse primer 5′-ACT CTC AGT ACA ATC TGC TCT GAT GCC G (SEQ ID NO 64) and fragment ii) constructed by amplifying the LEU2 expression cassette from pESC-LEU2 (Stratagene) with forward primer 5′-AGA GCAGATTGTA CTGAGAGT AAG ATG CAA GAG TTC GAA TCT CTT AGC AA (SEQ ID NO 71) and reverse primer 5′-CAC ACC GCA TAG ATC CGT CGA TCG ACT ACG TCG TAA GGC CGT TTC T-3′ (SEQ ID NO 72). This resulted in vector pESC-LEU2-TDH3-4CL2-TEF-VST1 (RhO0072). The expression cassette containing TDH3-PAL2-TEF-C4H::CYb5::ATR2 was then inserted into RHO0072 by using Infusion Technology between fragment i) linearized RHO0072 constructed by PCR with Herculase II polymerase with forward primer 5′-AAGATGCAAGAGTTCGAATCTCTTAGCAACC (SEQ ID NO 73) and reverse primer 5′-CTC TCA GTA CAA TCT GCT CTG ATG CC (SEQ ID NO 60) and fragment ii) constructed by PCR of plasmid RhO0025 with forward primer 5′-CAGAGCAGATTGTACTG AGAGGAGCGACCTCATGCTAT ACCT (SEQ ID NO 74) and the reverse primer 5′-AGATTCGAACTCTTGCATCTT CTGTGGATAACCGTATTACCG-3′(SEQ ID NO 75). This resulted in vector pESC-LEU-TDH3-PAL2-TEF1-C4H:CYB5:ATR2-TDH3-4CL2-TEF-VST1 (RhO0044).
EXAMPLE 19
Construction of a Yeast Vector for Constitutive Expression PAL2, C4H:CYB5:ATR2, 4CL2 and VST1 Containing the Ura3-tag2 Marker RHO0053
(109) RHO0025 was used as template for PCR amplification (Herculase II) removing the ura3 coding sequence using forward primer 5-CTC ATT TTG TTA TTC ATT TGT AAA AAA CTG TAT TAT AAG TAA ATG CAT GT-3 (SEQ ID NO 76) containing a ubiquitination tag and reverse primer 5-TCC TTA TAT GTA GCT TTC GAC AT-3 (SEQ ID NO 77).
(110) RHO0020 was used as template for PCR amplification of the ura3 coding sequence using forward primer 5-ATG TCG AAA GCT ACA TAT AAG GAA CGT G-3 (SEQ ID NO 78) and reverse primer 5-CAA ATG AAT AAC AAA ATG AGA CAA AGA AGA AAA CCA ATT TTT ACA AGC GTT TTG CTG GCC-3 (SEQ ID NO 79) containing a ubiquitination tag. The two fragments obtained by PCR was fused using InFusion Cloning technology resulting in the plasmid pESC-URA3:TAG-TDH3-PAL2-TEF1-C4H:CYB5:ATR2. The plasmid was called RHO0058.
(111) RHO0058 was linearized by PCR amplification (Herculase II) using forward primer 5-CAG AGC AGA TTG TAC TGA GAG TG-3 (SEQ ID NO 70) and reverse primer 5-ATG CCG CAT AGT TAA GCC A-3 (SEQ ID NO 67). RHO0011 was used as template for PCR amplification of the 4CL2 and VST1 expression cassettes (Herculase II) using forward primer 5-TGG CTT AAC TAT GCG GCA TGA GCG ACC TCA TGC TAT ACC T-3 (SEQ ID NO 68) and reverse primer 5-CT CAG TAC AAT CTGC TCT GCT GTG GAT AAC CGT ATT ACC G-3 (SEQ ID NO 69). The two fragments obtained by PCR was fused using InFusion Cloning technology resulting the plasmid pESC-URA3:TAG-TDH3-PAL2-TEF1-C4H:CYB5:ATR2-TDH3-4CL2-TEF-VST1. The tag sequence added to the C-terminal of the URA3 gene product was ACKNWFSSLSHFVIHL (SEQ ID NO 1). The plasmid was called RHO0053. A diagram of this expression system containing phenylalanine ammonia lyase and cinnamate-4-hydroxylase fusion gene, 4-coumarate-CoA ligase and resveratrol synthase appears in
EXAMPLE 20
Transformation of Euroscarf Deletion Mutants Deleted for Putative Resveratrol to Screen for Putative Resveratrol Transporters
(112) We screened the deletion mutant strain collection from the European S. cerevisiae archive for functional analysis (Euroscarf). This collection consists of different mutants in which each mutant has a known gene deleted (Giaever, et al 2002). From this library we selected mutants with the deleted transporters, identified in Table 2, which were chosen as described above.
(113) TABLE-US-00009 TABLE 2 Selected ABC transporters candidates for screening Euroscarf Strain Deleted ORF Gene name for deleted ORF YOOOO*1) Control srain, No deletion ΔYGR281w YOR1 ΔYDR406w PDR15 ΔYDR011w SNQ2 ΔYOR328w PDR10 ΔYOR153w PDR5 ΔYPL058c PDR12 ΔYNR070w PDR18 ΔYIL013c PDR11 *1)The strain background (genotype) for the control yeast YOOOO is [BY4741 MATA his3Δ1; leu2Δ0; met15Δ0; ura3Δ0] and for strains with gene deletions it is [BY4741 MATA his3Δ1; leu2Δ0; met15Δ0; ura3Δ0 Gene:delta:KanMx] where Genne:delta:KanMX means that each gene has been deleted by the homologous incorporation of the kanamycin cassette (KANMM), resistance towards geneticin G418.
(114) The Euroscarf deletion mutants and control in Table 2 were transformed with two vectors RHO009 and RHO0028, which together harboured the full heterologous resveratrol pathway divided on the two different multi copy 2 micron. Vector RHO009 contained the genes encoding the enzymes that convert phenylalanine to coumaric acid, that is phenylalanine ammonia lyase (PAL2) from Arabidopsis thaliana and Cinnamate-4-hydroxylase (C4H) from Arabidopsis thaliana fused in frame to its cytochromep-450-reductase (AR2) from Arabidopsis thaliana. RHO0028 contains the genes that convert coumaric acid into resveratrol, that is 4-coumarate:CoA-ligase (4CL2) from A. thaliana and resveratrol synthase (VST1) from Vitis vinifera. In detail Euroscarf yeast cells were taken out from the delivered agar slant from Euroscarf and inoculated in 5 ml YPD in sterile screening tubes over night at 30° C. Cells were transformed according to the standard lithium acetate method (Gitez and Schiestl, 1989) with vector RHO009 and RHO028.
(115) Transformants as single colonies were selected on SC-URA-HIS agar plates.
EXAMPLE 21
Test Tube Screening of Resveratrol Producing Euroscarf Transporter Deletion Mutants
(116) Transformants from the SC-ura-his plates were picked with sterile plastic inoculation loops and 5 colonies from each transformation plate were inoculated into 5 ml defined mineral medium containing 40 g/l glucose supplemented with 750 mg/l leucine and 300 mg/l methionine. Cells were grown for 72 hours until the glucose was depleted. We calculated the amount of produced resveratrol per produced biomass (OD600) at 72 hours when the glucose was depleted. The values are presented in
EXAMPLE 22
Shake Flask Screening of Resveratrol Producing Euroscarf Transporter Deletion Mutants
(117) The work in the screening tubes was repeated in shake flasks containing defined mineral medium with 40 g/l glucose, 750 mg/l leucine, and 300 mg/l methionine. The shake flasks were inoculated to an OD of 0.1 from the 72 hour cultured screening tubes (Example 21) and cultivated for 72 hours until glucose was depleted. We calculated the amount of produced resveratrol per produced biomass (OD600) at 72 hours when the glucose was depleted. The values are presented in
EXAMPLE 23
Isolation of Resveratrol Transporter Genes
(118) The ABC-transporter SNQ2 (encoded by gene YDR011w) (SEQ ID NO 80) was isolated via PCR using genomic DNA from S. cerevisiae CEN.PK113-5D K1, which had been prepared using the QIAamp DNA mini kit (Qiagen). The forward primer was 5′-TCGACGGATTCTAGAGGATCC ATG AGC AAT ATC AAA AGC ACG CAA GAT A (SEQ ID NO 81) and the reverse primer was 5′-ATC TTA GCT AGC CGC GGT ACC TTACTGCTTC TTTTTCCTTATGT TTTTAATTT TATTGA-3′ (SEQ ID NO 82).
(119) The ABC-transporter BcatrB from Botrytis cinerea (Schoonbeek et al, 2001) was synthesized by GenScript Corporation (Piscataway, N.J.) based on protein sequence for BcatrB gene (protein accession nr Q9UW03). The gene (SEQ ID NO 83) was codon optimized for expression in S. cerevisiae. The protein sequence in the data base for BcatrBp (protein Q9UW03) had an undefined amino acid sequence in position 99 called X. To reveal what amino acid X could be we blasted the BcatrB-Q9UW03-protein sequence towards other ABC-transporters at the Uniprot database (www.uniprot.org/) with the following results:
(120) TABLE-US-00010 BcatrB/Q9UW03 MPEL.sup.1---QAMQQQSDKD.sup.2-------------------QAKRRDLGVTWKNLTVKGIGADAX.sup.3 99 A6RVE0 MPEL---QAMQQQSDKD-------------------QAKRRDLGVTWKNLTVKGIGADAA.sup.4 99 Q8TFM7 MPEI.sup.5---QAMREQGEKD.sup.6-------------------QVKRRDLGVTWRNLTVKGIGADAA.sup.7 106 A7F7S9 MPEI---QAIRNQEEKD.sup.8-------------------QVKRRDLGVTWKNLTVKGIGADAA.sup.9 99 Q96W59 TEEL.sup.10---KQTQQQNEND.sup.11-------------------GAKDKKLGITWTDLDIKGIGADAA.sup.12 93 .sup.1SEQ ID NO 186 .sup.2SEQ ID NO 189 .sup.3SEQ ID NO 84 .sup.4SEQ ID NO 85 .sup.5SEQ ID NO 187 .sup.6SEQ ID NO 190 .sup.7SEQ ID NO 86 .sup.8SEQ ID NO 191 .sup.9SEQ ID NO 87 .sup.10SEQ ID NO 188 .sup.11SEQ ID NO 192 .sup.12SEQ ID NO 88
Blast Search of BcatrB-protein and alignment using Clustal W, only partial sequences that are conserved are shown, neither the number nor the identity of intervening amino acids are indicated. The X at position 99 in BcatrB-protein aligns nicely with alanine in other ABC-transporter with high homology to BcatrBp.
(121) Other sequences with a high level of identity to BcatrB-protein revealed that the X is most likely an alanine (A), which we included in the final order of the synthetic gene.
(122) The gene was delivered in a standard E. coli puc-vector (Puc-57-BcatrB). The BcatrB gene was isolated by re-amplifying the gene by PCR from the puc-BcatrB vector with primers For: TCGACGGATTCTAGAGGATCC ATG GCA GCA ATA GAG CCA GAA GGT TT (SEQ ID NO 89) and Rev: ATC TTA GCT AGC CGC GGT ACC TCA TTC AGC ACC TTT TGT TTT CTT TGT TCT C (SEQ ID NO 90).
EXAMPLE 24
Generation of Integration Vectors with Expression of Resveratrol Transporters
(123) The integrative vector with constitutive TEF/TDH promoters and TRP1 marker, called pSF057, was constructed as follows. Vector RHO011 was digested with EcoRI and BamHI to get the fragment with the glucose promoters TDH3/TEF. Then vector pESC-TRP (Stratagene) was digested with the same restriction enzymes, EcoRI and BamHI, to remove the galactose promoters fragment (GAl1/GAl10) from this vector and the vector backbone was kept. The TEF/TDH3 glucose promoter fragment from RHO0011 was then ligated into the remaining backbone of pesc-TRP using T4-DNA ligase. The resulting vector was called pSF055. Plasmid pSF055 was digested with restriction enzyme AfeI and re-ligated with T4 DNA ligase. The AfeI digest removes most of the 2 micron origin and converts a multi copy self-replicative vector into an integrative vector. The resulting integrative vector was called pSF057.
(124) The ABC-transporter BcatrB and SNQ2 genes, isolated with the primers described in Example 23, were cloned into vector pSF057 under the control of TDH3 promoter by infusion cloning between the PCR products of the transporters and linearized pSF057. The pSF057 was linearized with Herculase II polymerase and forward primer 5′-GGT ACC GCG GCT AGC TAA GAT CCG-3′ (SEQ ID NO 91) and reverse primer 5′-GGA TCC TCT AGA ATC CGT CGA AAC TAA GTT-3′ (SEQ ID NO 92). The resulting vectors pSF57-TRP1-TDH3-SNQ2 and PSF057-TRP1-TDH3-BCATRB were called RHO0051 and RHO0067, respectively.
EXAMPLE 25
Generation of a S. Cerevisiae Strain with Two Markers ura3-52 and his3.
(125) A double marker yeast mutant strain FS01528 [MatA ura3-52, his3] and FS01529 [Matalpha ura3-52, his3] was constructed by cross breading FS01210 [Matalpha his3] and FS01202 [MatA ura3-52] dissecting spores and scoring the double deletion mutant on SC-Ura (synthetic complete medium lacking uracil) and SC-His (synthetic complete medium lacking histidine) and SC-Ura-His (synthetic complete medium lacking both uracil and histidine) agar plates.
EXAMPLE 26
Construction of a Strain Over Expressing Native S. cerevisiae ACC1 Gene Under the TPI-Promoter
(126) The yeast gene ACC1 (YNR016c), encoding acetyl-CoA carboxylase, was overexpressed with the strong constitutive yeast TPI1 promoter as described previously (WO2005/118814). This was done by replacing the native ACC1 promoter with the TPI1 promoter, using a slightly modified promoter-replacement method based on the bipartite gene-targeting method. One part of the bipartite substrate consisted of two thirds (towards the 3′ end) of K. lactis URA3, fused to the TPI1 promoter sequence and a target sequence corresponding to the beginning of ACC1. The second part of the bipartite substrate consisted of a target sequence upstream of ACC1, fused to the TPI1 promoter sequence and two thirds (towards the 5′ end) of K. lactis URA3. Following transformation with the bipartite substrate and selection on medium lacking uracil, transformants were obtained in which the native promoter had been knocked out and replaced with two copies of the TPI1 promoter sequence as a direct repeat on either side of the K. lactis URA3 marker gene. A second recombination event, resulting in looping out of the selection marker, was selected for by re-plating transformants on medium containing 5′-fluoroorotic acid (5-FOA), which is toxic to cells expressing the URA3 gene. This resulted in a strain, in which the native ACC1 promoter had been replaced with the TPI1 promoter.
(127) In order to construct part 1 of the bipartite substrate, two thirds (towards the 3′ end) of K. lactis ura3 was amplified from the plasmid pWJ716 using the primers 5′ CTTGACGTTCGTTCGACTGATGAGC 3′ (SEQ ID NO 93) and 5′ CTGGAATTCGATGATGTAGTTTCTGG 3′ (SEQ ID NO 94). Moreover, the TPI1 promoter sequence was amplified from genomic S. cerevisiae DNA using the primers 5′ CTACATCATCGAATTCCAGCTACGTATGGTCATTTCTTCTTC 3′ (SEQ ID NO 95) and 5′ TTTTTGATTAAAATTAAAAAAACTTTTTAGTTTATGTATGTGTTTTTTG 3′ (SEQ ID NO 96) and a downstream targeting sequence, consisting of the beginning of the ACC1 gene (i.e., the first 553 bp of the gene) was amplified from genomic S. cerevisiae DNA using the primers 5′ AGTTTTTTTAATTTTAATCAAAAAATGAGCGAAGAAAGCTTATTCGAGTC 3′ (SEQ ID NO 97) and 5′ CACCTAAAGACCTCATGGCGTTACC 3′ (SEQ ID NO 98). These three fragments were fused to each other in two rounds of PCR. First, the TPI1 promoter sequence was fused to the downstream targeting sequence, using the primers 5′ CTACATCATCGAATTCCAGCTACGTATGGTCATTTCTTCTTC 3′ (SEQ ID NO 95) and 5′ CACCTAAAGACCTCATGGCGTTACC 3′ (SEQ ID NO 98). The resulting product was then fused to the fragment containing two thirds (towards the 3′ end) of K. lactis URA3. The resulting fragment, 3′ 2/3 K. lactis URA3-pTPI1-DOWN(ACC1) was part 1 of the bipartite gene targeting substrate.
(128) In order to construct part 2 of the bipartite substrate, two thirds (towards the 5″end) of K. lactis URA3 was amplified from the plasmid pWJ716 using the primers 5′ CGGTCTGCATTGGATGGTGGTAAC 3′ (SEQ ID NO 99) and 5′ GAGCAATGAACCCAATAACGAAATC 3′ (SEQ ID NO 100). The TPI1 promoter sequence was amplified from genomic S. cerevisiae DNA using the primers 5′ CTACATCATCGAATTCCAGCTACGTATGGTCATTTCTTCTTC 3′ (SEQ ID NO 95) and 5′ CACCATCCAATGCAGACCGTTTTAGTTTATGTATGTGTTTTTTG 3′ (SEQ ID NO 101), and a target sequence upstream of ACC1 was amplified from genomic S. cerevisiae using primers 5′ TGTTCTGCTCTCTTCAATTTTCCTTTC 3′ (SEQ ID NO 102) and 5′ CTGGAATTCGATGATGTAGTTTCTAATTTTCTGCGCTGTTTCG 3′ (SEQ ID NO 103). These three fragments were fused in two rounds of PCR. First, the upstream targeting sequence was fused to the TPI1 promoter sequence, using the primers 5′ TGTTCTGCTCTCTTCAATTTTCCTTTC 3′ (SEQ ID NO 102) and 5′ CACCATCCAATGCAGACCGTTTTAGTTTATGTATGTGTTTTTTG 3′ (SEQ ID NO 101). The resulting fragment was then fused to the fragment containing two thirds (towards the 5′ end) of K. lactis URA3, resulting in the fragment UP(ACC1)-pTPI1-5′ 2/3 K. lactis URA3, which constituted part 2 of the bipartite gene targeting substrate.
(129) Yeast strain FS01529 [MATalpha ura3-52, his3] was transformed with the linear substrates UP(ACC1)-pTPI1-5′ 2/3 K. lactis URA3 and 3′ 2/3 K. lactis URA3-pTPI1-DOWN(ACC1). Transformants were selected and streak-purified on medium lacking uracil and were then transferred to plates containing 5-FOA. Pop-out recombinants were streak-purified on 5-FOA-containing medium. The resulting strain was named FS09216 and had the genotype [MATalpha ura3-52, his3, TPI-ACC1]. The correct integration of the TPI1 promoter was checked by colony PCR.
EXAMPLE 27
Construction of a Strain Deleted for the Gene ARO10 Encoded by YDR380w
(130) The yeast gene ARO10, encoding phenylpyruvate decarboxylase (YDR380w), was deleted using the Cre/loxP method. One part of the bipartite substrate consisted of two thirds (towards the 3′ end) of K. lactis URA3, a loxP site located between the marker gene and the target sequence corresponding to the sequence upstream of the coding sequence of ARO10. The second part of the bipartite substrate consisted of two thirds (towards the 5′ end) of K. lactis URA3, a loxP site located between the marker gene and the target sequence corresponding to the sequence downstream of the coding sequence of ARO10. Furthermore a plasmid containing the HIS3 gene, a Cre-recombinase gene controlled by the GAL1 promoter was included in the transformation.
(131) Following transformation with the bipartite substrate and selection on medium lacking uracil, and histidine transformants were obtained in which the coding sequence of ARO10 had been knocked out and replaced with two copies of the loxP sequence as a direct repeat on either side of the K. lactis URA3 marker gene. A second recombination event, resulting in looping out of the selection marker, was selected for by growing selected transformation in YP-galactose medium over night and re-plating transformants on YPD medium. This resulted in a strain, in which the native ARO10 coding sequence been replaced with one loxP site.
(132) In order to construct part 1 of the bipartite substrate, two thirds (towards the 3′ end) of K. lactis ura3 and a loxP site was amplified from the plasmid pUG72 using the primers 5′ CCA ACA ATG ATG ATA TCT GAT C 3′ (SEQ ID NO 104) and 5′ CCG CTG CTA GGC GCG CCG TGG GCG CAA TTA TAA AAC ACT G 3′ (SEQ ID NO 106). Moreover, the downstream homolog targeting sequence was amplified from genomic yeast DNA using the primers 5-CCG CTG CTA GGC GCG CCG TGG GCG CAA TTA TAA AAC ACT G-3 (SEQ ID NO 106) and 5-GTT TCA AAT AGA ACG AGG GAG-3 (SEQ ID NO 105). The two fragments were fused to each other by PCR using the PCR fragments as template and the primers 5-CCA ACA ATG ATG ATA TCT GAT C-3 (SEQ ID NO 104) and 5-GTT TCA AAT AGA ACG AGG GAG-3 (SEQ ID NO 105). The resulting fragment, 3′ 2/3 K. lactis URA3-loxP-DOWN(ARO10) was part 1 of the bipartite gene targeting substrate.
(133) In order to construct part 2 of the bipartite substrate, two thirds (towards the 5′ end) of K. lactis URA3 and a loxP site was amplified from the plasmid pUG72 using the primers 5′ GTC AGC GGC CGC ATC CCT GCT ACG CTG CAG GTC GAC AA 3′ (SEQ ID NO 107) and 5′ ATA CAT TTG CCT TTT GAA AAC 3′ (SEQ ID NO 108). The target sequence upstream of ARO10 was amplified from genomic S. cerevisiae DNA using primers 5′ GCC GTC ATA TAT TAC TTT GAG C 3′ (SEQ ID NO 109) and 5′ GCA GGG ATG CGG CCG CTG ACA CAG AAG TCG CGT CAA CTT G 3′ (SEQ ID NO 110). The two fragments were fused by PCR using the generated PCR fragments as templates, using the primers 5′ GCC GTC ATA TAT TAC TTT GAG C 3′ (SEQ ID NO 109) and 5′ ATA CAT TTG CCT TTT GAA AAC 3′ (SEQ ID NO 108) resulting in the fragment UP(ARO10)-loxP-5′ 2/3 K. lactis URA3, which constituted part 2 of the bipartite gene targeting substrate.
(134) Yeast strain FS09216 [MATalpha ura3-52, his3, TPI-ACC1] was transformed with the linear substrates UP(ARO10)-loxP-5′ 2/3 K. lactis URA3 and 3′ 2/3 K. lactis URA3-loxP-DOWN(ARO10). Transformants were selected and streak-purified on medium lacking uracil and histidine. Selected strains were inoculated in liquid YP-galactose over night and plated onto YPD plates. Single colonies were streak purified on YPD plates and replica plated onto YPG, SC-URA and SC-HIS to confirm loss of marker and pettiness. The resulting strain was named FS09235 and had the genotype [matalpha ura3-52 his3-11 pTPI-Acc1 deltaaro10]. The correct integration of the TPI1 promoter was checked by colony PCR.
(135) The LEU2 gene (encoded by YCL018W) was partially deleted to enable the use of LEU2 based vectors in the mutant yeast strains. The parental strain used for the deletion of LEU2 was FS09216 [Matalpha ura3-52 his3 pTPI-Acc1]. The LEU2 deletion was done using the bipartite gene-targeting method for gene deletions and Klyuveromyces lactis URA3 as selection marker followed by a URA3-marker rescue on 5-FOA (5-fluoro-orotic acid) plates (Erdeniz et al., 1997). One part of the bipartite substrate consisted of the target sequence corresponding to the beginning of LEU2 gene fused to two thirds (towards the 5′ end) of K. lactis URA3. The second part of the bipartite substrate consisted of two thirds (towards the 3′ end) of K. lactis URA3 fused to the target sequence downstream of LEU2 gene.
(136) In detail, the LEU2-up target sequence fragment was constructed via PCR with genomic DNA from S. cerevisiae CEN.PK and forward primer (LEU2-up-F) 5′-CAGAGGTCGCCTGACGCATATACCT (SEQ ID NO 111) and reverse primer 5′-GCAGGGATGCGGCCGCTGACGCAAAGTTACATGGTCTTAAGTTGG. The LEU2-Down target sequence was constructed via PCR from genomic DNA of S. cerevisiae CEN.PK and forward primer 5′-CCGCTGCTAGGCGCGCCGT GCTCCAGATTTGCCAAAGAATAAGGTCAAC-3′ (SEQ ID NO 112) and reverse primer (LEU2-Down-R) 5′-TGTTACACCTAACTTTTTGTGTGGTGCC.
(137) The K. lactis up fragment (KLURA5-R of 865 bp) was generated by PCR with vector pWJ1042 as template (Sequence xx) and the forward primer 5′-GTCAGCGGCCGCATCCCTGC TTCGGCTTCATGGCAATTCCCG (SEQ ID NO 113) (dKL5′) and the reverse primer 5′ GAGCAATGAACCCAATAACGAAATC (SEQ ID NO 100) (Int3′). Vector pWJ1042 is an E. coli shuttle vector and contains the full K. lactis ura3 expression cassette flanked by two 144 bp homologous DNA repeat sequences on each side of the marker cassette for easy recombination and marker rescue on 5-FOA.
(138) The K. lactis down fragment (KLURA3-R of 1246 bp) was generated by PCR with vector pWJ1042 as template and the forward primer (Int5′) 5′-CTTGACGTTCGTTCGACTGATGAGC (SEQ ID NO 93) and the reverse primer 5′-CACGGCGCG CCTAGCAGCGG TAACGCCAGGG TTTTCCCAGTCAC (SEQ ID NO 114) (cKL3′).
(139) The leu2-up target sequence fragment was fused to the Klura5-R via PCR by using primers Leu2-up-F and Int 3′. The LEU2-Down target sequence fragment was fused to KLURA3-R using primers Int 5′ and Leu2-Down-R.
(140) These fused fragments were used to transform the yeast FS09216 using the standard lithium acetate transformation method. Transformants were grown in SC-URA plates for two days at 30° C. and subsequently streaked in 5-FOA plates to allow the pop-out and marker rescue of the gene segment to be deleted. After confirmation the LEU2 deletion and marker rescue was confirmed by replica plating onto SC-URA and SC-LEU. The new strain with LEU2 deletion was called FS09236 [MATalpha ura3-52 his3 leu2 pTPI1-Acc1].
EXAMPLE 29
Generation of Strain FS09240 Matalpha ura3-52, his 3, leu2, pTPI-ACC1, deltaAro10
(141) The yeast gene ARO10, encoding phenylpyruvate decarboxylase, was deleted using the Cre/loxP method as described in Example 27.
(142) Yeast strain FS09236 [MATalpha ura3-52 his3-11 leu2 pTPI1-Acc1] was transformed with the linear substrates UP(ARO10)-loxP-5′ 2/3 K. lactis URA3 and 3′ 2/3 K. lactis URA3-loxP-DOWN(ARO10). Transformants were selected and streak-purified on medium lacking uracil and histidine. Selected strains were inoculated in liquid YP-galactose over night and plated onto YPD plates. Single colonies were streak purified on YPD plates and replica plated onto YPG, SC-URA and SC-HIS to confirm loss of marker and pettiness. The resulting strain was named FS09240 and had the genotype [MATalpha ura3-52 his3-11 leu2 pTPI1-Acc1 deltaaro10]. The correct integration of the TPI1 promoter was checked by colony PCR.
EXAMPLE 30
Generation of Strain FS09258 Matalpha ura3-52, his3, Leu2, trp1, pTPI-ACC1 deltaAro10
(143) The TRP1 gene (encoded by YDR007W) was partially deleted to create a non-revertant TRP1 marker in the yeast mutant and to enable the integration of the resveratrol transporters into the partially deleted TRP1 gene using the TRP1 based integrative vectors RHO0067 and RHO0051. The parental strain used for the deletion of TRP1 was FS09240 [Matalpha ura3-52 his3 delta-Leu2 pTPI-Acc1, delta-ARO10]. The deletion was done according to the bipartite CRE-lox method using the Klyuveromyces lactis Leu2 cassette flanked by LOXP targets (pUG73 vector Eursocarf) as reusable marker for the bi-partite fragments.
(144) Kluyveromyces lactis LoxP-Leu2-up-fragment (1323 bp) was generated by PCR from vector pUG73 using forward primer (X1F) 5′-GTCAGC GGCCGCATCCC TGCTACGCTGCAGGTCGACAA (SEQ ID NO 115) and reverse primer (KLEU-R) 5′-CAC ACT ACA CAG ATT ATA CCA TG (SEQ ID NO 116).
(145) Klyuveromyces lactis Leu2-LoxP-down-fragment (1500 bp) was generated by PCR from vector pUG73 using forward primer (KLEU-F) 5′-TTCTCTAACG ACGACGAAATCG (SEQ ID NO 117) and reverse primer 5′CACGGCGCGCCTAGCAGCGG AGGCCACTAGTGGATCTGATAT (SEQ ID NO 118) (X2R).
(146) The TRP1-up fragment was generated by PCR using S. cerevisiae genomic DNA as template and forward primer (TRP-up-F) 5′GAA GAG GAG TAG GGA ATA TTA CTG GCT (SEQ ID NO 119) and reverse primer 5′ GCAGGGATGCG GCCGCTGAC ACT CCA AGC TGC CTT TGT GTG CTT AAT (SEQ ID NO 120).
(147) The TRP1-down fragment was generated by PCR using S. cerevisiae genomic DNA as template and forward primer 5′CCGCTGCTAGGCGCGCCGTG CAA GAG TTC CTC GGT TTG CCA GTT ATT A (SEQ ID NO 121) and reverse primer (TRP-Down-R) 5′CCT GCG ATG TAT ATT TTC CTG TAC AAT CAA TC (SEQ ID NO 122).
(148) TRP1-up fragment was fused to Klyuveromyces lactis LoxP-Leu2-up-fragment by fusion PCR using TRP-up-F and Kleu-R as primers. The Klyuveromyces lactis Leu2-LoxP-down-fragment was fused to The TRP1-down fragment by fusion PCR using KLEU-F and TRP-DOWN-R as primers.
(149) FS09240 was transformed with 10 microliters each of the two fused PCR products (bi-partite substrate) and selected on SC-leu plates. Five to ten of the resulting transformants were pooled and used to transform with 3 microliter PSH47 (Cre-recombinase under GAL1 promoter on a URA3 vector) selected on SC-Leu plates). The resulting transformants were grown over night in YP-galactose (20 g/l galactose 10 g/l yeast extract and 20 g/l peptone) for induction of Cre-recombinase and marker rescue. One microliter of the over night culture was dissolved in 1 ml sterile water and 200 microliter was plated on YPD-agar plates. 40 colonies were scored for lack of growth on SC-TRP, SC-leu and SC-ura agar plates by replica plating, which indicated that the deletion of TRP1 and marker rescue had worked. The resulting strain with partial TRP1-deletion was confirmed by colony PCR using primer 5′-CTG GGA GCA GAT GAC GAG TTG GT (SEQ ID NO 123) and TRP-DOWN-R. The resulting delta-TRP1 strain has a partial deletion of TRP1 (where a region from the middle of the TRP1-ORF to the middle of the terminator has been deleted), and was called FS09258 [Matalpha ura3-52 his3 delta-leu2 delta-trp1 pTPI-Acc1, delta-ARO10].
EXAMPLE 31
Generation of Strain with Constitutive Expression of the Pathway to Resveratrol in the Yeast S. Cerevisiae FS01529-9-28
(150) S. cerevisiae strain FS01529 (CEN.PK MATa ura3 His3) was co-transformed with RHO0028 (pESC-HIS3-TEF-PAL2-TDH3-C4H::CYB5:ATR2) and RHO009 (pESC-URA3-TEF2-4CL2-TDH3-VST1 and the transformed strain was named FS01529-9-28. Transformants were selected on medium lacking uracil and histidine and streak purified on the same medium.
EXAMPLE 32
Generation of Strain with Constitutive Expression of the Pathway to Resveratrol in the Yeast S. Cerevisiae FS09258-53-32-44-51
(151) Strain FS09258 [Matalpha ura3-52 his3 delta-leu2 delta-trp1 pTPI-Acc1, delta-ARO10] was first transformed with plasmid RHO0051, linearized by HINDIII digestion, and selected on SC-trp solid agar plates. After re-streaking the transformants on new SC-trp solid agar plates the cells from this plate were inoculated into YPD and transformed with plasmids RHO0053 and RHO0032 and selected on SC-ura-his solid agar plates. The strains were then pre-grown in selective medium (liquid SC-ura-his medium) and transformed with plasmid RHO0044 and selected on SC-ura-his-leu solid agar plates. This resulted in strain FS09258-53-32-44-51.
(152) A second strain was generated in the same way but instead of RHO0051 the RHO0067, linearized by HINDIII digestion, was used resulting in strain FS09258-53-32-44-67.
EXAMPLE 33
Shake Flask/Deep Well Cultivation and Media
(153) The yeast strains were grown in 500 ml shake flasks with 50-100 ml working volume or in 10 ml deep well cultivation plates with 5 ml working volume (“Riplate BV” 850601 from HJ-Bioanalytik Gmbh, Germany) covered with Airpore Tape sheets (catalogue nr 19571) (Qiagen, Maryland, USA). Deep Well cultivation plates and shake flasks were inoculated at 250 rpm and 30 degrees.
(154) Unless stated elsewhere the medium used for growth and stilbenoid production in the shake flask or deep well cultivations was a defined mineral medium (referred to as Delft medium) consisting of i) glucose or galactose as carbon source in general 40 g/l unless stated elsewhere ii) ammonium sulphate, (NH4).sub.2SO.sub.4,30 g/l as nitrogen source iii) phosphate buffer consisting of 12 g/l KH.sub.2PO.sub.4 and 5 g/l K.sub.2HPO.sub.4 with the medium adjusted to pH 5.5 iV) 2 g/l MgSO.sub.4.7H.sub.2O and V) 1 ml of a 1000× stock solution of vitamins and 1 ml of a 1000× stock solution of trace elements. The vitamin solution and trace element solution was prepared as described previously (Verduyn et al, 1992; Boer et al, 2003).
EXAMPLE 34
Creation of a Chimeric Protein Increasing the Hydroxylation of Cinnamic Acid Leading to Increased Resveratrol Production
(155) Cinnamate-4-hydroxylase (C4H) belongs to the cytochrome P450 monooxygenases (P450s) protein family. The enzyme is a heme-dependent membrane bound oxidase facilitating the addition of an oxygen atom by cleaving molecular di-oxygen (Werck-Reichhart and Feyereisen, 2000). C4H is supported by P450 reductase (CPR), an electron donor, and uses the electron to split atmospheric oxygen to reactive oxygen radicals. The enzyme complex is thought to co-operation with cytochrome b.sub.5 which in theory facilitates the electron transfer. It has been shown that heterologous P450s in some cases do not possess the ability to accept electron donation from endogenous sources (Guengerich et al., 1993). Therefore to optimally exploit metabolic pathways containing monooxygenases in heterologous expression organisms, a chimeric enzyme is assembled containing hydroxylase, cytochrome B.sub.5 and reductase activity.
(156) Two strains were constructed containing pESC plasmids containing the resveratrol pathway with or without a chimeric protein (Table 3).
(157) TABLE-US-00011 TABLE 3 Strain Parent name strain Genotype FS01529-1-2 FS01529 MATalpha ura3-52 his3 [pESC-ura- pGAL1-C4H-pGAL10-PAL2], [pESC-his- GAL1-4CL1-pGAL10-VST1] FS01529-1-4 FS01529 MATalpha ura3-52 his3 [pESC-ura- pGAL1-C4H:CYB5:ATR2-pGAL10-PAL2], [pESC-his-GAL1-4CL1-pGAL10-VST1]
(158) The strains were grown in delft medium with 0.2% glucose and 1.8% galactose. The strains were cultivated for 71 hours reaching the stationary phase and samples were taken for extraction and subsequent HPLC analysis (Table 4).
(159) TABLE-US-00012 TABLE 4 mg/l mg/l Strain OD600 resveratrol pinosylvin FS01529- 11.0 11.0 153.7 1-2 FS01529- 10.0 45.1 92.9 1-4
Expression of the chimeric protein increased the resveratrol titer by 310%.
EXAMPLE 35
Resveratrol Pathway on Different Vectors
(160) We investigated whether there would be a difference between a strain having the full resveratrol pathway separated on two vectors, that is transformed with RHO009 and RHO0028 versus a strain having the full resveratrol pathway on one vector such as RHO0029 or RHO0030 and whether a strain harbouring two vectors, each with the full resveratrol pathway, would lead to higher titres than a strain having only one vector with the full resveratrol pathway from only one vector.
(161) We therefore constructed the following strains: i) FS0916-9-28 (having one copy of the resveratrol pathway divided on two different vectors. ii) FS09216-29-22 having one URA3-based multicopy vector with the full resveratrol pathway and one empty HIS3 vector to remove the auxotrophy. iii) FS09216-30-20 having one HIS3-based multicopy vector with the full resveratrol pathway and one empty URA3 vector to remove the auxotrophy. iv) FS09216-29-30 having one URA3-based multicopy vector with the full resveratrol pathway and one HIS3-based multicopy vector with the full resveratrol pathway, that is in principle two copies of the full resveratrol pathway.
(162) The strains were grown in shake flaks containing 100 ml of mineral medium with 40 g/l glucose as carbon source. After 72 hours the resveratrol per optical density (OD 600) was calculated.
(163) The amount of resveratrol produced per biomass was highest when two copies of the resveratrol pathway were present, that is in FS0916-29-30. Having one copy of the full resveratrol pathway on a HIS3 based vector (FS09216-30-20) or URA3 based vector (FS09216-29-21) gave similar results but lower than the strain with two copies. Having only one copy of the pathway separated on two different plasmids gave the lowest resveratrol yields (FS09216-9-28).
EXAMPLE 36
Strain Stability
(164) A strain with one copy of the resveratrol pathway divided on two vectors was constructed—FS01529-9-28. A second strain with two vectors each with the full resveratrol pathway was also constructed in the same background FS01529-29-30. The two strains were grown in 100 ml defined mineral medium with 40 g/l glucose in a series of three 500 ml shake flasks. Sampling and measurement of resveratrol was made at 72 hours. A serial transfer study was made where 50 microliters from shake flask 1 was inoculated to a new shake flask (shake flask 2) with the same medium as culture 1. After 72 hours the resveratrol and optical density were measured and a third shake flask was conducted in the same way with sampling at 72 hours.
(165) Black bars=resveratrol (mg/l), Grey bars=Optical density (OD600 nm) at 72 hours in each shake flask.
(166) From
EXAMPLE 37
Comparison Resveratrol Transporters SNQ2, BcatrB and Control in Deep Well Cultivations
(167) Strain 9258-29-30-44-51 expressing the SNQ2 transporter, strain 9258-29-30-44-67 expressing the BcatrB transporter and the control strain 9240-29-30-44 were grown for 48 hours in deep well cultivation plates. The control strain produced 48 mg/l resveratrol at OD 5.6 after and the strain expressing SNQ2 produced 61 mg/l resveratrol at an OD of 5.7. The strains expressing the BcatrB (Botrytis cinerea resveratrol transporter) produced 56 mg/l resveratrol at an OD 8 after 48 hours.
(168) Genotypes:
(169) 9240=Matalpha ura3-52 his3 Leu2 pTPI-Acc1, DARo10 9258=Matalpha ura3-52 his3 Leu2 pTPI-Acc1, DARo10, deltaTRP1
Inserted Vectors: RHO0029 RHO0030 RHO0044 RHO0051 RHO0067
(170) In fermentation the same strains as in Example 34 gave at 72 hours: 9240-29-30-44 gave 437 mg/l resveratrol. 9258-29-30-44-51 (including SNQ2 overexpression) gave 573 mg/l resveratrol. Strain 9258-29-30-44-67 (including BcatrB overexpression) gave 951 mg/l resveratrol.
(171) The conditions for fermentation and analysis are described below before Example 41.
(172) Conclusion: The effect of overexpression of a transporter is most likely more apparent in a fed-batch fermentation where the total concentration of resveratrol exceeds 200 mg/l whereas in shake flask or deep well cultivations the resveratrol levels reached are lower, which may not be as inhibitory and thus the resveratrol transporter effect is obscured by this fact.
EXAMPLE 38
Development of a Stable High Copy Number Expression Vector System Using an Ubiquitination Tag
(173) Two strains were constructed one containing a p4-ura plasmid (Example 15) and the other containing a p4-ura-tag 2 plasmid (Example 19) (Table 5).
(174) TABLE-US-00013 TABLE 5 Inserted Genes in Strain Parent expression expression name strain system system Tag FS01202-29 FS01202 Rho0029 pTDH3-PAL2, pTEF1- None C4H::CYB4::ATR2, pTDH3-4CL2, pTEF1- VST1 FS01202-53 FS01202 Rho0053 pTDH3-PAL2, pTEF1- Ubiquit- C4H::CYB4::ATR2, ination pTDH3-4CL2, pTEF1- tag VST1
(175) The strains were grown in delft medium with 2% glucose. The strains were cultivated for 72 hours reaching the stationary phase and samples were taken for extraction and subsequent HPLC analysis (Table 6).
(176) TABLE-US-00014 TABLE 6 Mg/l Yield on Yield on Strain resveratrol OD.sub.600 biomass glucose FS01227- 28.0 9.8 2.9 0.70 29 FS01227- 54.8 8.3 6.6 1.37 53
From the results present in Table 6 the yield on biomass was increase by 127%, yield on glucose by 95% and titer by 96%.
EXAMPLE 39
Overexpression of Acetyl-CoA Carboxylase (ACC1) for Increased Resveratrol Production
(177) The two key yeast precursors for resveratrol production using the heterologous resveratrol pathway that starts with the phenylalanine ammonia lyase are phenylalanine and malonyl-CoA. To increase the production of malonyl-CoA the acetyl-CoA carboxylase (ACC1) converting acetyl-CoA to malonyl-CoA was overexpressed, leading to redirected acetyl-CoA flux from biomass accumulation and TCA cycle assimilation towards malonyl-CoA production, thereby increasing the availability of MAlonyl-CoA to increase the resveratrol titer.
(178) Two strains were constructed containing pESC plasmids containing the resveratrol pathway. Furthermore one of the strains had the endogenous ACC1 promoter exchanged with the glycolytic triose phosphate isomerase promoter (TPI1). (Table 7).
(179) TABLE-US-00015 TABLE 7 Strain Parent name strain Genotype FS01529-1-4 FS01529 MATalpha ura3-52 his3 [pESC-ura-pGAL1- C4H:CYB5:AR2-pGAL10-PAL2], [pESC-his- GAL1-4CL1-pGAL10-VST1] FS09216-1-4 FS01529 MATalpha ura3-52 his3 pTPI-ACC1 [pESC- ura-pGAL1-C4H:CYB5:AR2-pGAL10-PAL2], [pESC-his-GAL1-4CL1-pGAL10-VST1]
(180) The strains were grown in delft medium with 0.2% glucose and 1.8% galactose. The strains were cultivated for 72 hours reaching the stationary phase and samples were taken for extraction and subsequent HPLC analysis (Table 8).
(181) TABLE-US-00016 TABLE 8 Mg/l Strain resveratrol FS01529- 119 1-5 FS09216- 165 1-5
(182) From the results present in Table 8 the genomic overexpression of acc1 increased the titer of resveratrol by 39%.
EXAMPLE 40
Deletion of Aro10 Phenylpyruvate Decarboxylase for Increased Phenylalanine Availability Resveratrol Production
(183) Two strains were constructed containing p4 containing the resveratrol pathway. Furthermore one of the strains had the endogenous ARO10 deleted (Table 9).
(184) TABLE-US-00017 TABLE 9 Strain Parent name strain Genotype FS09216-29- FS09216 MATalpha ura3-52 his3 pTPI-ACC1 [p4-ura- 30 pTDH3-PAL2, pTEF1-C4H::CYB4::ATR2, pTDH3-4CL2, pTEF1-VST1], [p4-his-pTDH3- PAL2, pTEF1-C4H::CYB4::ATR2, pTDH3- 4CL2, pTEF1-VST1] FS09235-29- FS09216 MATalpha ura3-52 his3 pTPI-ACC1 ΔARO10 30 [p4-ura-pTDH3-PAL2, pTEF1- C4H::CYB4::ATR2, pTDH3-4CL2, pTEF1- VST1], [p4-his-pTDH3-PAL2, pTEF1- C4H::CYB4::ATR2, pTDH3-4CL2, pTEF1- VST1]
(185) The strains were grown in delft medium with 2% glucose. The strains were cultivated for 72 hours reaching the stationary phase and samples were taken for extraction and subsequent HPLC analysis (Table 10).
(186) TABLE-US-00018 TABLE 10 mg/l coumaric mg/l mg/OD600 mg/OD600 Strain acid resveratrol coumaric acid resveratrol FS09216-29-30 14 109 1.0 7.9 FS09235-29-30 43 113 3.2 8.5
(187) From the results presented in Table 10, the deletion of ARO10 lead to an increased yield on biomass of approximately 10% and 220% for resveratrol and coumaric acid respectively.
(188) Fermentation Media and Conditions
(189) The next group of examples describe fermentations performed in the following general manner.
Growth Medium for Fed-Batch Fermentation
(190) The composition of the medium used in the initial batch phase of the fed-batch cultivations is shown in Table 11. The composition of the feeding medium is presented in Table 12, 13, 14. The nitrogen source used in the initial batch phase of the fed-batch cultivation was urea, whereas, in the feeding phase, ammonium hydroxide (NH.sub.4OH, 25%) was used both as the nitrogen source and the base. In the major part of the cultivations, NH.sub.4OH (25%) was used as the base in both the batch and feeding phases. In some of the cultivations, the base used in the initial batch phase was KOH (2 N). For both the initial batch and feeding phases, HCl (2 N) was used as the acid.
(191) TABLE-US-00019 TABLE 11 Composition of the minimal medium used in the initial batch of the fed-batch fermentation Concentration Glucose•H.sub.2O [g/l] 110 Urea [g/l] 11.36 KH.sub.2PO.sub.4 [g/l] 15.00 MgSO.sub.4•7H.sub.2O [g/l] 2.5 Vitamin solution [ml/l] Table 13 5.00 Trace element solution[ml/l] Table 14 5.00 Antifoam 204 (Sigma A-8311) [μ/l] 50.00
(192) TABLE-US-00020 TABLE 12 Composition of the minimal medium used in the feed of the fed-batch cultivations Concentration Glucose•H.sub.2O [g/l] 550 KH.sub.2PO.sub.4 [g/l] 9.00 MgSO.sub.4•7H.sub.2O [g/l] 5.10 K.sub.2SO.sub.4 [g/l] 3.5 Na.sub.2SO.sub.4 [g/l] 0.28 Vitamin solution [ml/l] Table 13 12.00 Trace element solution [ml/l] Table 14 10.00 Antifoam 204 (Sigma A-8311) [μ/l] 50.00* *During fermentation additional Antifoam has to be added after demand when foaming occurs
(193) TABLE-US-00021 TABLE 13 Composition of the vitamin solution used in fed- batch fermentation Concentration [g/L] Biotin 0.05 Calcium pantothenate 1.0 Nicotinic acid 1.0 Myo-inositol 25.0 Thiamine HCL 1.0 Pyridoxal HCL 0.2 Para-aminobenzoic acid 0.2
(194) TABLE-US-00022 TABLE 14 Composition of trace element solution used in fed- batch fermentation Concentration [g/L] EDTA (disodium) 15 ZnSO.sub.4•7H.sub.2O 4.5 MnCl.sub.2•2H.sub.2O 1.0 CoCl.sub.2•6H.sub.2O 0.3 CuSO.sub.4•5H.sub.2O 0.3 Na.sub.2MoO.sub.4•2H.sub.2O 0.4 CaCl.sub.2•2H.sub.2O 4.5 FeSO.sub.4•7H.sub.2O 3.0 H.sub.3BO.sub.3 1.0 KI 0.1
Operating Conditions of Fed-Batch Fermentation
(195) The operating conditions used in the initial batch phase and feeding phase of the fed-batch fermentations are shown in Table 15.
(196) TABLE-US-00023 TABLE 15 Operating conditions for the initial batch phase in fed-batch fermentation Parameter Set-point Volume of liquid (l) 0.5 Temperature (° C.) 30.0 pH 5.5 Agitation speed (rpm).sup.1 1200-1800 Gas flow rate (vvm).sup.2, 3 1.5 Gas flow rate (l/min) 0.75 .sup.1automatically adjusted such that the dissolved oxygen is above 60% (100% set for 0.75 l/min and 1200 rpm, no cells) .sup.2vvm = l gas/(l liquid × min) .sup.31 vvm for fermentation using strain FS09263-29-44-51
Preparation of Glycerol Stocks
(197) Glycerol stocks were prepared using overnight 250 ml side baffled shake flask cultivations (conducted at 30° C. and stirred at 250 rpm). Such cultivations were inoculated with loop full of cells from an agar plate. Cells were harvested during late log-phase (OD.sub.600˜7-9) while there is residual glucose. Broth is transferred into sterile Falcon 50 ml centrifuge tubes and cells are spun down for 5 min. at approximately 4000 rpm at 4° C. Cells are re-suspended in ˜15 ml of 15% (w/v) sterile glycerol solution. An aliquot of 1 ml of suspended cells is transferred into cryo-vials and stored at −80° C.
(198) Seed Cultures and Inoculum
(199) The seed cultures were prepared by conducting sequential shake-flask cultivations, such that the cells underwent a certain number of generations before being inoculated into the bioreactor. Shake flask culture were conducted in 500 ml shake flask using a working volume of 100 ml. The medium used in the cultivations is described above. The initial shake-flask was inoculated with a glycerol stock culture to a final OD600 of 0.01 or 0.001. The cells were incubated at 30° C. and 150 rpm and harvested when the OD600 reached approximately 1 (which corresponds to approximately 10 generations) and transferred into the following shake-flask. The process was repeated, such that a total of 4 shake-flask cultivations (or approximately 40 generations) were conducted before inoculation. The culture in the fourth flask was used to inoculate the reactor. The starting OD of all fermentation was approximately 0.001. When strain FS09258-53-32B-44-51 or FS09258-29-30-44-67 was used the start OD in the fermentation was approximately 0.05
(200) Fed-Batch Cultivations in Bioreactors
(201) The fed-batch cultivations were performed in bioreactors Biostat B plus (Sartorius BBI systems), with a working volume of 2 l. The initial volume of liquid used in all cultivations was 500 ml. The total volume of feed prepared was 1 l, such that the volume of liquid in the fermentor vessel did not exceed 1.5 l. The bioreactor was equipped with two Rushton four-blade disc turbines and baffles. Air was used for sparging the bioreactors. The concentrations of oxygen, carbon dioxide, and ethanol in the exhaust gas were monitored by a gas analyzer Innova 1313 with multiplexing. Temperature, pH, agitation, and aeration rate were controlled throughout the cultivations. The temperature was maintained at 30° C. The pH was kept at 5.5 by automatic addition of KOH (2N) or NH4OH (25%), in the course of the initial batch, and NH4OH (25%) and HCl (2 N), during the feeding phase. The stirrer speed was initially set to 1200 rpm and the aeration rate to 1.5 vvm (i.e., 0.75 l/h, for a volume of liquid of 500 ml). The aeration rate was set to 2.25 l/h, during the feeding process. When the levels of dissolved oxygen decreased below 60%, the stirrer speed was automatically increased to values up to 1800 rpm. The formation of foam was controlled using a foam sensor and through the automatic and/or manual addition of an anti-foam agent (Anti-foam 204) (diluted or pure). Samples were withdrawn at selected time points and analyzed for cell mass, extracellular metabolites, and stilbenoids.
(202) After inoculation, the fed-batch fermentations went through a batch phase that lasted until no residual glucose was measured during the fermentation. Afterwards, an exponential feeding profile was used in order to secure a reduced constant specific growth rate.
Feeding Profiles
(203) An exponential feeding profile leads to a constant specific growth rate and residual substrate concentration (Equation 1).
(204)
where V.sub.0 [l] denotes the volume of liquid at the start of the fed-batch process; X.sub.0 [g DW/l] and S.sub.0 [g/l], the biomass and substrate concentrations at the start of the fed-batch process, respectively; S.sub.feed [g/l], the substrate concentration in the feed; Y.sub.XS [g/g DW], the inverse of biomass yield on substrate; and μ.sub.0 [1/h], the specific growth rate.
(205) In all cultivations, pre-defined exponential feeding profiles were used (Table 16) after the batch phase, without any type of automatic control of the feed rate. The feed rate was manually adjusted in the course of the cultivations (to constant profiles), in order to avoid respiro-fermentative metabolism. The phase of exponential feeding was followed either one or two phases with reduced and constant feeding. In Table 17, parameters are listed upon which the fermentations were switched from batch phase to exponential feeding, to constant feeding phase 1, and to constant feeding phase 2.
(206) TABLE-US-00024 TABLE 16 Parameters used for the calculation of pre-defined, exponential feeding profiles in the fed-batch phase. S.sub.feed V.sub.0 X.sub.0 Y.sub.XS μ.sub.0 [g/l] [l] [g DW/l] [g/g DW] [1/h] FS09258- 500 0.5 17.7 0.35 0.08 51-53- 32B-44 FS09240- 500 0.5 16.9 0.35 0.1 29-30-44 FS09258- 500 0.5 15.5 0.35 0.1 29-30- 44-51 FS09258- 500 0.5 12.6 0.35 0.1 29-30- 44-67 FS09263- 500 0.5 13.4 0.35 0.1 29-44-51 FS09263- 500 0.5 15.1 0.35 0.1 29-44- pSF057
(207) TABLE-US-00025 TABLE 17 Approximate parameters at start of exponential feeding phase, constant feeding phase 1, constant feeding phase 2 μ (1/h) or flow Time rate Eth Strain Start of (h) (ml/h) OD.sub.600 (g/L) FS09258-51- exponential 25 0.08 1/h 30 40 53-32B-44 feeding phase constant 50 20 ml/h 110 0.15 feeding phase 1 constant 73 7.7 ml/h 190 0 feeding phase 2 FS09240-29- exponential 43 0.1 1/h 15 12 30-44 feeding phase constant 61 18 ml/h 40 0 feeding phase 1 constant 74 8.8 ml/h 110 0 feeding phase 2 FS09258-29- exponential 43 0.1 1/h 22 4 30-44-51 feeding phase constant 63 20 ml/h 186 0 feeding phase 1 constant None None None None feeding phase 2 FS09263-29- exponential 42 0.1 1/h 20 20 44-51 feeding phase constant 64 21 ml/h 160 0 feeding phase 1 constant 73 10.4 ml/h 184 0 feeding phase 2 FS09263-29- exponential 24 0.1 l/h 18 22.7 44-67 feeding phase constant 75 20 ml/h 108 0 feeding phase 1 constant None None None None feeding phase 2 FS09263-29- exponential 42 0.1 1/h 21.5 18 44-pSF057 feeding phase constant 63 21.3 ml/h 174 0 feeding phase 1 constant None None None None feeding phase 2
Analysis of Stilbenoids
(208) For quantitative analysis of coumaric acid, cinnamic acid, phloretic acid, trans-resveratrol, cis-resveratrol, dihydroresveratrol and pinosylvin, samples are subjected to separation by high-performance liquid chromatography (HPLC), using a HPLC-system from Dionex, prior to UVdiode-array detection at l=306 nm. A Phenomenex (Torrance, Calif., USA) Luna 2.5 micrometer C18 (100×2.00 mm) column is used at 60° C. The method comprises, as the mobile phase, a non-linear S-shaped gradient of acetonitrile and milliQ water (both containing 50 ppm trifluoroacetic acid), at a flow of 0.8 ml/min. The gradient profile varies from 10% to 100% acetonitrile over 5 minutes. The elution time is approximately 3.2 min for coumaric acid, 4.6 min for trans-resveratrol, 6.0 min for cinnamic acid, and 7.1 min for trans-pinosylvin. The following sample preparation procedure is used for analysis of stilbenoids: Addition of ethanol (99.9%) to a final concentration of 50% (v/v); Vortex (30 s); Centrifugation (5 min, speed 13000); Analysis of supernatant by HPLC.
The samples are appropriately diluted in distilled water prior to HPLC analysis, whenever required, such that the concentrations of stilbenoids fall within the linear ranges defined by the standards.
EXAMPLE 41
Fed-Batch Fermentation of FS09258-51-53-32B-44, FS09258-29-30-44-51, FS09240-29-30-44
(209) The effect of overexpression of SNQ2 on resveratrol production was investigated in controlled fed-batch fermentation. FS09240-29-30-44 was used as reference strain and compared to a strain that additionally harbours an overexpression of SNQ2, that is FS09240-29-30-44-51. In a subsequent experiment the effect of using an ubiquitination tag on one of the plasmids (Rho 053) was further tested, and FS09258-51-53-32B-44 was compared to FS09240-29-30-44-51. The results of the conducted three fed-batch fermentations of strains FS09240-29-30-44, FS09258-29-30-51 and FS09258-51-53-32B-44 can be seen in
(210) It was found that the overexpression allowed an increase in final fermentation titres to approximately 1400 mg/L from 400 mg/L. The use of a ubiquitination tag on one of the plasmids allowed a further increase and titres beyond 1800 mg/L.
EXAMPLE 42
PUFA Example Tag System
(211) The Delta 12 desaturase (MrD12D gene) from Mucor Rouxii (Passorn et al., unpublished) (SEQ ID NO 124), delta 6 desaturase (OtD6D gene) from Ostreococcus tauri (Domergue et al., 2005) (SEQ ID NO 125), delta 6 elongase (MaD6E gene) from Mortiella alpine (Tavares et al., 2008) (SEQ ID NO 126), and delta 5 desaturase (PtD5D gene) from Paramecium tetraurelia (Aury et al., 2006) (SEQ ID NO 127) codon optimized for expression in S. cerevisiae was synthesized by GenScript Corporation (Piscataway, N.J.). The synthetic codon optimized genes were delivered inserted in E. coli pUC57 vector. The synthetic genes were reamplified with via PCR using the pUC57 vectors as templates. After DPN1 digestion the PCR products were purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen).
(212) Delta 12 desaturase (MrD12D gene) from Mucor Rouxii was reamplified via PCR from genscript vector pUC57-MrD12D using forward primer 5-TAG AAC TAA AGG GCG GCC GCA TGG CAA CCA AGA GAA AC-3 (SEQ ID NO 128) and reverse primer 5-TTA ATT AAG AGC TCA GAT CTT TAG TTC TTA AAG AAG ACA ACA-3 (SEQ ID NO 129).
(213) Delta 6 desaturase (OtD6D gene) from Ostreococcus tauri was reamplified via PCR from genscript vector pUC57-OtD6D using forward primer 5-TAT AGG GCC CGG GCG TCG ACA TGT GTG TTG AAA CAG AAA AT-3 (SEQ ID NO 130) and reverse primer 5-CGG TAC CAA GCT TAC TCG AGT TAT GCT GTT TTA CCA GAA TG-3 (SEQ ID NO 131).
(214) Delta 6 elongase (MaD6E gene) from Mortiella alpine was reamplified via PCR from genscript vector pUC57-MaD6E using forward primer 5-TAG AAC TAA AGG GCG GCC GCA TGG AAT CTA TTG CTC AAT TC-3 (SEQ ID NO 132) and reverse primer 5-TTA ATT AAG AGC TCA GAT CTT TAT TGT AAC TTT CTA GCC TTT-3 (SEQ ID NO 133).
(215) Delta 5 desaturase (PtDSD gene) from Paramecium tetraurelia was reamplified via PCR from genscript vector pUG57-PtD5D using forward primer 5-TAT AGG GCC CGG GCG TCG ACA TGG AAG GTA TCA TCA CTC A-3 (SEQ ID NO 134) and reverse primer 5-CGG TAC CAA GCT TAC TCG AGT TAT TCC ATT TTA GCA AAA CCA-3 (SEQ ID NO 135)
(216) Plasmid Constructions
EXAMPLE 43
Construction of a Yeast Vector for Constitutive Expression of MrD12D and OtD6D Gene
(217) The amplified MrD12D PCR-product (Example 42) was ligated into NotI/BglII digested Rho0020 vector (Example 12) using InFusion technology, resulting in vector Rho20-MrD12D. The amplified OtD6D PCR product (Example 42) was ligated into SalI/XhoI digested Rho20-MrD12D vector using InFusion technology, resulting in vector Rho20-MrD12D-OtD6D. Two different clones of Rho20-MrD12D-OtD6D were sequenced to verify the sequence of the cloned gene.
EXAMPLE 44
Construction of a Yeast Vector for Constitutive Expression of MaD6E and PtD5D Gene
(218) The amplified MaD6E PCR-product (Example 42) was ligated into NotI/BglII digested Rho20 vector (Example 12) using InFusion technology, resulting in vector Rho20-MaD6E. The amplified PtD5D PCR-product (Example 42) was ligated into SalI/XhoI digested Rho20-MaD6E vector using InFusion technology, resulting in vector Rho20-MaD6E-PtD5D. Two different clones of Rho20-MaD6E-PtD5D were sequenced to verify the sequence of the cloned gene.
EXAMPLE 45
Construction of a Yeast Vector for Constitutive Expression of MrD12D, OtD6D, MaD6E and PtD5D Gene
(219) The vector Rho20-MrD12D-OtD6D (Example 43) was linearized by PCR amplification using forward primer 5-CAG AGC AGA TTG TAC TGA GAG TG-3 and reverse primer 5-ATG CCG CAT AGT TAA GCC A-3. The PCR fragment was cut with DpnI and purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen).
(220) The vector Rho20-MaD6E-PtD5D (Example 44) was used as template for PCR amplification of the MaD6E-PtD5D expression cassettes using forward primer 5-TGG CTT AAC TAT GCG GCA TGA GCG ACC TCA TGC TAT ACC T-3 (SEQ ID NO 68) and reverse primer 5-TCT CAG TAC AAT CTG CTC TGC TGT GGA TAA CCG TAT TAC CG-3. The amplified PCR fragment containing the MaD6E-PtD5D expression cassette was purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen).
(221) The PCR linearized Rho20-MrD12D-OtD6D vector and the MaD6E-PtD5D expression cassette was ligated using InFusion technology resulting in Rho20-MrD12D-OtD6D-MaD6E-PtD5D called p13. Two different clones of p16 were sequenced to verify the sequence of the cloned gene.
EXAMPLE 46
Construction of a Yeast Vector for Constitutive Expression of MrD12D, OtD6D, MaD6E and PtD5D Gene with the Marker Gene ura3 Fused to a Ubiquitination Tag
(222) Rho20-MrD12D-OtD6D (Example 43) was used as template for PCR amplification (Herculase II) removing the ura3 coding sequence using forward primer 5-CTC ATT TTG TTA TTC ATT TGT AAA AAA CTG TAT TAT AAG TAA ATG CAT GT-3 (SEQ ID NO 76) containing the ubiquitination tag and reverse primer 5-TCC TTA TAT GTA GCT TTC GAC AT-3 (SEQ ID NO 77).
(223) Rho0020 (Example 12) was used as template for PCR amplification of ura3 using forward primer 5-ATG TCG AAA GCT ACA TAT AAG GAA CGT G-3 (SEQ ID NO 78) and reverse primer 5-CAA ATG AAT AAC AAA ATG AGA CAA AGA AGA AAA CCA ATT TTT ACA AGC GTT TTG CTG GCC-3 (SEQ ID NO 79) containing the ubiquitination tag.
(224) The two fragments obtained by PCR was fused using InFusion Cloning technology resulting in the plasmid Rho20-ura3-tag2-MrD12D-OtD6D.
(225) Rho20-ura3-tag2-MrD12D-OtD6D was linearized by PCR amplification (Herculase II) using forward primer 5-CAG AGC AGA TTG TAC TGA GAG TG-3 (SEQ ID NO 70) and reverse primer 5-ATG CCG CAT AGT TAA GCC A-3 (SEQ ID NO 67). The PCR fragment was cut with DpnI and purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen).
(226) Rho20-MaD6E-PtD5D (Example 44) was used as template for PCR amplification (Herculase II) of the expression cassettes containing MaD6E and PtD5D using forward primer 5-TGG CTT AAC TAT GCG GCA TGA GCG ACC TCA TGC TAT ACC T-3 (SEQ ID NO 68) and reverse primer 5-TCT CAG TAC AAT CTG CTC TGC TGT GGA TAA CCG TAT TAC CG-3 (SEQ ID NO 137). The two fragments obtained by PCR was ligated using InFusion technology resulting in the plasmid Rho20-ura3-tag2-MrD12D-OtD6D-MaD6E-PtD5D called p16. Two different clones of p16 were sequenced to verify the sequence of the cloned gene.
(227) Results
(228) Strain FS01529 was used as expression host for either plasmid p13 or p16 (See Table 18).
(229) TABLE-US-00026 TABLE 18 Inserted Genes in Strain Parent expression expression name strain system system Tag FS01529- FS01529 P13 pTDH3-OtD6D, None p13 pTEF1-MrD12D, pTDH3-PtD5D, pTEF1-MaD6E FS01529- FS01529 P16 pTDH3-OtD6D, Ubiquitination p16 pTEF1-MrD12D, tag pTDH3-PtD5D, pTEF1-MaD6E
(230) The strains were grown in a 24 well deep well plate containing delft medium with 2% glucose. The strains were cultivated for 72 hours reaching the stationary phase and samples were taken for lipid extraction and subsequent GC-FID analysis (see Table 19).
(231) TABLE-US-00027 TABLE 19 Arachidonic acid as % of total Strain fatty acid composition FS01529-p13 0.3 FS01529-p16 1.2
(232) From the results present in Table 19 the percentage of the total fatty acid in the cell was 4 fold higher using tag plasmid (p16) compared to a non tag plasmid (p13).
EXAMPLE 47
Isolation of the Metabolic Engineering Target Genes Encoding Aro4 and Aro7
(233) 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (Aro4 gene) (Luttik et al., 2008) (SEQ ID NO 138) and Chorismate mutase (Aro7 gene) (Luttik et al., 2008) (SEQ ID NO 139) from Saccharomyces cerevisiae codon optimized for expression in S. cerevisiae was synthesized by GenScript Corporation (Piscataway, N.J.). ARO4 catalyzes the conversion of phosphoenolpyruvate, D-erythrose 4-phosphate and water to 3-deoxy-D-arabino-kept-2-ulosonate 7-phosphate and phosphate; ARO7 catalyzes the conversion of chorismate to prephanate. The synthetic codon optimized genes were delivered inserted in E. coli pUC57 vector. The synthetic genes were reamplified with PCR using the pUC57 vectors as templates. After DPN1 digestion the PCR products were purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen).
EXAMPLE 48
Isolation of STS a Resveratrol Synthase Originating from Vitis Pseudoreticulata
(234) Resveratrol synthase (STS gene) (www.ncbi.nlm.nih.gov/protein/ABF06883.1) (SEQ ID NO 140) from Vitis pseudoreticulata codon optimized for expression in S. cerevisiae was synthesized by GenScript Corporation (Piscataway, N.J.). The synthetic codon optimized genes were delivered inserted in E. coli pUC57 vector. The synthetic genes were reamplified with PCR using the pUC57 vectors as templates. After DPN1 digestion the PCR products were purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen).
EXAMPLE 49
Construction of the Yeast Vector Rho0098 for Constitutive Expression of VST1 and STS Containing the His3 Marker
(235) pUC57-STS was used as template for PCR amplification (Herculase II) using forward primer 5-GGC CCG GGC GTC GAC ATG GCT TCT GTT GAA GAA ATT A-3 (SEQ ID NO 141) and reverse primer 5-CCA AGC TTA CTC GAG TCA TTA ATT AGA ATC AGT ACC A-3 (SEQ ID NO 142). Rho0011 was used as template for PCR amplification (Herculase II) using forward primer 5-CTA AAG GGC GGC CGC ATG GCA TCC GTA GAG GAG-3 (SEQ ID NO 143) and reverse primer 5-TCC ATC GAT ACT AGT TCA TTA GTT AGT GAC AGT TG-3 (SEQ ID NO 144). Rho0022 was digested with spel, SalI, and XhoI.
(236) The three fragments obtained by PCR were fused using InFusion Cloning System (Clonetech). The resulting plasmid was cut with PvuII for verification. The plasmid was used as template for PCR amplification (Herculase II) using forward primer 5-ATG GCA TCC GTA GAG GAG TTC-3 (SEQ ID NO 44) and reverse primer 5-ATG GCT TCT GTT GAA GAA ATT A-3 (SEQ ID NO 141). Rho0011 was used as template for PCR amplification (Herculase II) using forward primer 5-CTC TAC GGA TGC CAT GAA TTC TCT AGA ATC CGT CGA AAC TAA GTT CTG-3 (SEQ ID NO 145) and reverse primer 5-TTC AAC AGA AGC CAT GGA TCC TCT AGA AAA CTT AGA TTA GAT TGC TAT G-3 (SEQ ID NO 146). The two fragments obtained by PCR was fused using InFusion Cloning System (Clonetech) resulting in the plasmid Rho0098 (SEQ ID NO 178).
(237) Two different clones of Rho0098 were sequenced and the sequence of the cloned gene was verified.
EXAMPLE 50
Construction of the Yeast Vector p0161 for Constitutive Expression of VST1 and STS Containing the His3 Marker
(238) Rho0098 was used as template for PCR amplification (Herculase II) using forward primer 5-GCA ATG GAT CAG TTA CGT TAT ATC TTC GAG CGT CCC AAA A-3 (SEQ ID NO 147) and reverse primer 5-ATA ACG TAA CTG ATC CAT TGC TTC CTC GCT CAC TGA CTC-3 (SEQ ID NO 148).
(239) The fragment obtained by PCR was fused using InFusion Cloning System (Clonetech) resulting in the plasmid p0161 (SEQ ID NO 180). Two different clones of p0161 were sequenced and the sequence of the cloned gene was verified.
EXAMPLE 51
Construction of a Yeast Vector for Constitutive Expression PAL2 and C4H:CYB5:ATR2 Containing the Ura3-Tag2 Marker p0160
(240) Rho0058 was used as template for PCR amplification (Herculase II) using forward primer 5-GCA ATG GAT CAG TTA CGT TAT ATC TTC GAG CGT CCC AAA A-3 (SEQ ID NO 147) and reverse primer 5-ATA ACG TAA CTG ATC CAT TGC TTC CTC GCT CAC TGA CTC-3 (SEQ ID NO 148).
(241) The fragment obtained by PCR was fused using InFusion Cloning System (Clonetech) resulting in the plasmid p0160 (SEQ ID NO 179). Two different clones of p0160 were sequenced and the sequence of the cloned gene was verified.
EXAMPLE 52
Construction of a Yeast Replicative Vector, p0202, Bearing pTEF1-C4H::CYB5::ATR2 and pCUP1-PAL2, URA3-tag2 as Selective Marker
(242) p0160 was used as template for a PCR amplification using primer 5-ACG TAT TCT TTG AAA TGG CG-3 and 5-ATG GAC CAA ATT GAA GCA ATG CTA-3. The promoter of CUP1 gene, pCUP1, was PCR amplified from S. cerevisiae CEN.PK genomic DNA using primers 5-TTT CAA AGA ATA CGT TTA CCG ACA TTT GGG CGC-3 (SEQ ID NO 149) and 5-TTC AAT TTG GTC CAT ACA GTT TGT TTT TCT TAA TAT C-3 (SEQ ID NO 150). The two above-mentioned fragments were fused using InFusion Cloning technology resulting in the plasmid p0202.
EXAMPLE 53
Construction of the Yeast Vector Rho0021 with Constitutive Expression Cassettes and the Leu2 Marker (SEQ ID NO 176)
(243) pESC-leu (Stratagene) was used as template for PCR amplification (Herculase II) using forward primer 5-CAG AGC AGA TTG TAC TGA GAG TG-3 (SEQ ID NO 70) and reverse primer 5-ATG CCG CAT AGT TAA GCC A-3 (SEQ ID NO 67). RHO0011 was used as template for PCR amplification (Herculase II) using forward primer 5-TGG CTT AAC TAT GCG GCA TGA GCG ACC TCA TGC TAT ACC T-3 (SEQ ID NO 68) and reverse primer 5-TCT CAG TAC AAT CTGC TCT GCT GTG GAT AAC CGT ATT ACC G-3 (SEQ ID NO 69).
(244) The two fragments obtained by PCR were fused using InFusion Cloning System (Clonetech) resulting in the plasmid Rho0021 (SEQ ID NO 176). Two different clones of Rho0021 were sequenced and the sequence of the cloned gene was verified
EXAMPLE 54
Construction of the Yeast Rho0039 Vector for Constitutive Expression of Aro7 and Aro4 Containing the Leu2 Marker
(245) Vector Rho0021 was digested with restriction enzyme NotI and BglII. The gene encoding Aro4 from S. cerevisiae was reamplified via PCR from Genscript vector pUC-57-Aro4 using forward primer 5-ACT AAA GGG CGG CCG ATG TCA GAG TCT CCA ATG T-3 (SEQ ID NO 151) and reverse primer 5-TAA GAG CTC AGA TCT CTA CTT CTT ATT TAC CTC TCT T-3 (SEQ ID NO 152) with homologous overhangs to the linearized RHO0021 vector.
(246) The two fragments were recombined using the Infusion Cloning System (Clonetech). The resulting vector was called Rho0021-Aro4. Two different clones of pESC-URA-Pal2 were sequenced and the sequence of the cloned gene was verified.
(247) Vector Rho0021-Aro4 was digested with restriction enzyme SalI and XhoI. The gene encoding Aro7 from S. cerevisiae was reamplified via PCR from Genscript vector pUC-57-Aro7 using forward primer 5-GGC CCG GGC GTC GAC ATG GAT TTT ACA AAG CCA GAA-3 (SEQ ID NO 153) and reverse primer 5-CCA AGC TTA CTC GAG TCA TTC TTC CAA TCT TCT CAA-3 (SEQ ID NO 154) with homologous overhangs to the linearized Rho0021-Aro4 vector.
(248) The two fragments were recombined using the Infusion Cloning System (Clonetech). The resulting vector was called Rho0039 (SEQ ID NO 177). Two different clones of pESC-URA-Pal2 were sequenced to verify the sequence of the cloned gene.
EXAMPLE 55
Achieving High Expression Levels of Genes of Interest Through Multiple Integrations in S. Cerevisiae Genomic DNA Using TY-Delta Regions
(249) Achieving high production yields of a product of interest often requires molecular biology tools for high level gene expression. The use of replicative, multicopy vectors and strong promoters are often chosen to trigger the expression of genes of interest. Unfortunately strains constructed upon these plasmid borne expression systems are frequently prone to instability through DNA rearrangements, variations in plasmid copy number or even loss of plasmids.
(250) In order to achieve high production levels of resveratrol, whilst providing a stable strain, we designed an expression system based on multiple integration of genes of interest at TY-delta regions. TY-delta regions are “long terminal repeats” (LTR) which are left out after the sequential insertion and excision of a Ty1 or Ty2 retrotransposon. A total of 331 retrotransposon insertions were identified on S. cerevisiae's genome, 85% of which correspond to solo LTRs or to LTR fragments (Kim et al, Transposable Elements and Genome Organization: A Comprehensive Survey of Retrotransposons Revealed by the Complete Saccharomyces cerevisiae Genome Sequence(Genome Research, 2009). S. cerevisiae's retrotransposons are divided into 5 different families designated Ty1-Ty5 (Kim et al, 2009).
(251) In order to specifically integrate a chosen DNA sequence of interest into TY-delta regions by homologous recombination, a TY-delta consensus sequence was identified by aligning a number of TY-delta DNA sequences retrieved from Saccharomyces Genome Database (www.yeastgenome.org). By modifying 2 nucleotides, a BglII restriction site was added to the consensus sequence. The final sequence is presented in
EXAMPLE 56
Construction of a Yeast Vector p0179 for Multiple Integration Using a Ty-Delta Consensus Sequence and Schizosaccharomyces Pombe HIS5 Marker Tagged by Tag2
(252) HIS5 coding DNA sequence was PCR amplified from Schizosaccharomyces pombe genomic DNA (Phusion® High-fidelity DNA polymerase, Finnzymes) using forward primer 5-CAA GAT AAA CGA AGG CAA AGA TGG GTA GGA GGG CTT TT-3 (SEQ ID NO 155) and reverse primer 5-ATG AGA CAA AGA AGA AAA CCA ATT TTT ACA AGC CAA CAC TCC CTT CGT GCT T-3. pSF127 was used as template for PCR amplification (Herculase II) using forward primer 5-TCT TCT TTG TCT CAT TTT GTT ATT CAT TTG TAG TGA CAC CGA TTA TTT AAA GCT G-3 (SEQ ID NO 157) and reverse primer 5-CTT TGC CTT CGT TTA TCT TG-3 (SEQ ID NO 158). The two fragments obtained by PCR was fused using InFusion Cloning System (Clontech) resulting in the plasmid p0179. p0179 was verified by sequencing.
EXAMPLE 57
Construction of the Yeast Vector p0246 for Multiple Integration Using a Ty-Delta Consensus Sequence and the His3 Marker p0246
(253) p0179 was used as template in a PCR reaction using primer 5-GCA ATG GCG GCC GCT TAC GTT ATC TTC CTC GCT CAC TGA CT-3 (SEQ ID NO 159) and 5-ATA ACG TAA GCG GCC GCC ATT GCA TTG GAG ACT TGA CCA AAC CT-3 (SEQ ID NO 160) removing the ADH1 terminator. The fragment obtained by PCR was fused to itself using InFusion Cloning technology resulting in the plasmid p0246 (SEQ ID NO 181). Two different clones of p0246 were sequenced and the sequence of the cloned gene was verified.
EXAMPLE 58
Construction of the Yeast Vector p0249 for Multiple Integration Using a Ty-Delta Consensus Sequence and the KanMX Marker p0249
(254) p0246 was used as template in a PCR reaction using primer 5-CTT TGC CTT CGT TTA TCT TG-3 (SEQ ID NO 158) and 5-TGA CAC CGA TTA TTT AAA GCT GC-3 (SEQ ID NO 161) removing the entire His S-tag2 coding sequence. p0191 was used as template in a PCR reaction using primer 5-CAA GAT AAA CGA AGG ATG GGT AAG GAA AAG ACT CAC-3 (SEQ ID NO 162) and 5-GCA GCT TTA AAT AAT CGG TTA GAA AAA CTC ATC GAG CAT CAA ATG-3 (SEQ ID NO 163) removing the entire His S-tag2 coding sequence. The two fragments obtained by PCR were fused using InFusion Cloning System (Clonetech) resulting in the plasmid p0249 (SEQ ID NO 182). Two different clones of p0249 were sequenced and the sequence of the cloned gene was verified.
EXAMPLE 59
Construction of the Yeast Vector p0280 for Constitutive Expression and Integration of Aro7 and Aro4 Containing the KanMX Marker
(255) RHO0039 was used as template for PCR amplification (Herculase II) using forward primer 5-AAT TGG AGC TCC ACC GCG GCT TCG AGC GTC CCA AAA CCT TC-3 (SEQ ID NO 164) and reverse primer 5-GCT TGA TAT CGA ATT CGA GCG ACC TCA TGC TAT ACC TG-3 (SEQ ID NO 165). p0249 was digested using the restriction enzymes SacII and EcorRI. The two fragments obtained by PCR and restriction enzyme digestion were fused using InFusion Cloning technology resulting in the plasmid p0245-pTDH3-Aro7-pTEF1-Aro4 (p0280 (SEQ ID NO 184)). Two different clones of p0280 were sequenced and the sequence of the cloned gene was verified.
EXAMPLE 60
Construction of the Yeast Vector p0262 for Constitutive Expression and Integration of VST1 and STS Containing the KanMX Marker
(256) p0161 was used as template for PCR amplification (Herculase II) using forward primer 5-AAT TGG AGC TCC ACC GCG GCT TCG AGC GTC CCA AAA CCT TC-3 (SEQ ID NO 164) and reverse primer 5-GCT TGA TAT CGA ATT CGA GCG ACC TCA TGC TAT ACC TG-3 (SEQ ID NO 165). p0245 was digested using the restriction enzymes SacII and EcorRI. The two fragments obtained by PCR and restriction enzyme digestion were fused using InFusion Cloning technology resulting in the plasmid p0245-pTDH3-Aro7-pTEF1-Aro4 (p0280). Two different clones of p0262 (SEQ ID NO 183) were sequenced and the sequence of the cloned gene was verified.
EXAMPLE 61
Construction of Integrative Plasmids pSF126 and pSF127, for Multiple Integrations at TY-Delta Regions
(257) pSF126 is a URA3 based vector, pSF127 is based on HIS3. These two plasmids were synthetically assembled by Genscript.
(258) These vectors are non-replicative in S. cerevisiae and can be specifically targeted for insertion at TY-delta regions by digestion using either BglII or Xho1 (both restriction sites are present in the previously identified LTR consensus sequence).
EXAMPLE 62
Construction of a Yeast Vector p0140 for Multiple Integration Using a Ty-Delta Consensus Sequence, Bearing Saccharomyces Cerevisiae HIS3 Marker, pTDH3-4CL2 and pTEF1-VST1
(259) Rho0011 (Example 11) was used as template for PCR amplification (Phusion® High-fidelity DNA polymerase, Finnzymes) using forward primer 5-CTA GTG GAT CCC CCG GGT TGG AGC GAC CTC ATG CTA TAC C-3 (SEQ ID NO 166) and reverse primer 5-GAA TTC CTG CAG CCC GGG CGA GCG TCC CAA AAC CTT CTC AAG-3 (SEQ ID NO 167). pSF127 was linearized by digestion using SmaI endonuclease. The two obtained fragments were fused using InFusion Cloning System (Clontech) resulting in a yeast vector suitable for multiple integration at TY-delta regions (Example 55), bearing Saccharomyces cerevisiae HIS3 marker, pTDH3-4CL2 and pTEF1-VST1. In order to allow the linearization of the vector by BglII, thus allowing multiple integrations at TY-delta elements, the plasmid abovementioned was on the one hand PCR amplified (Phusion® High-fidelity DNA polymerase, Finnzymes) using forward primer 5-GGC GAA GAA TTG TTA ATT AAG AGC TCT GAT CTT ATC G-3 (SEQ ID NO 168) and reverse primer 5-GGC GCA GCA AGT CGA CGG CGA G-3 (SEQ ID NO 169); on the other hand the same plasmid was digested by Pad and SalI endonucleases. The two fragments, after agarose gel purification, were fused using InFusion Cloning technology resulting in the plasmid p0140. p0140 was verified by sequencing.
EXAMPLE 63
Construction of a Yeast Vector p0180 for Multiple Integration Using a Ty-Delta Consensus Sequence, Bearing Schizosaccharomyces Pombe HIS5 Marker Tagged by Tag2, pTDH3-4CL2 and pTEF1-VST1
(260) p0140 was used as template for PCR amplification (Herculase II) using forward primer 5-CTA GTG GAT CCC CCG GGT TGG AGC GAC CTC ATG CTA TAC C-3 (SEQ ID NO 166) and reverse primer 5-GAA TTC CTG CAG CCC GGG CGA GCG TCC CAA AAC CTT CTC AAG-3 (SEQ ID NO 167). p0179 was linearized by digestion using SmaI endonuclease. The two fragments obtained were fused using InFusion Cloning technology resulting in the plasmid p0180. p0180 was verified by sequencing.
EXAMPLE 64
Construction of a Yeast Vector, p0204, for Multiple Integration Using a Ty-Delta Consensus Sequence, Bearing Saccharomyces cerevisiae URA3 Auxotrophic Marker, pTEF1-C4H::CYB5::ATR2 and pCUP1-PAL2
(261) pSF126 was digested by KpnI and SacII endonucleases. p0202 was used as template to PCR amplify (Herculase II) the expression cassette pTEF1-C4H::CYB5::ATR2/pCUP1-PAL2 using forward primer 5-GGG AAC AAA AGC TGG GTA CCC TGT GGA TAA CCG TAT TAC C-3 (SEQ ID NO 170) and reverse primer 5-AAT TGG AGC TCC ACC GCG GGA GCG ACC TCA TGC TAT ACC-3 (SEQ ID NO 171). The two fragments, after agarose gel purification, were fused using InFusion Cloning technology resulting in the plasmid p0204.
EXAMPLE 65
Generation of Strain FS09308 Matalpha Ura3-52 his3 leu2 pTPI-ACC1, Delta-aro10, Delta-trp1, p0204 (pTEF1-C4H::CYB5::ATR2 and pCUP1-PAL2, TY-delta Consensus Element, URA3), p0180 (pTDH3-4CL2 and pTEF1-VST1, TY-Delta Consensus Element, S. pombe HIS5-Tag2)
(262) S. cerevisiae strain FS09258 (Example 30) was transformed concomitantly with on the one hand plasmid p0204 digested by XhoI and on the other hand plasmid p0180 digested by BglII. Transformants were selected on SC-ura-his. 43 clones were inoculated in 48 deep-well plates containing Delft minimal medium, 20gL.sup.−1 glucose, supplemented with leucine and tryptophan. Additionally, the latter medium was supplemented by CuSO4 (0.15 mM) or not. The best performing transformant, referred to as “C3” in
(263) The production of biomass (OD600), coumaric acid, cinnamic acid, pinosylvin, phloretic acid and resveratrol from 7 different clones arising from the transformation of S. cerevisiae FS09258 with linearized plasmids p0204 and p0180 is presented in
EXAMPLE 66
Generation of Strain FS09322 Matalpha ura3-52 his3 leu2, trp1 pTPI-Acc1, ΔaRo10, p204 (pTEF-C4H::CYB5::ATR2 pCUP1-PAL2, TY Element, URA3), p180 (pTDH3-4CL2 pTEF1-VST1, TY Element, S. pombe HIS5-Tag2), Rho51 (TEF1-Snq2, TRP1), p0262 (pTDH3-VST1 pTEF1-STS, TY Element, LEU2)
(264) Yeast strain FS09313 [Matalpha ura3-52 his3 leu2 trp1 pTPI-Acc1, ΔaRo10, p204 (pTEF-C4H::CYB5::ATR2 pCUP1-PAL2, TY element, URA3), p180 (pTDH3-4CL2 pTEF1-VST1, TY element, S. pombe HIS5-Tag2), Rho51 (TEF1-Snq2, TRP11)] was transformed with the linear substrates originating from two PCR reactions using p0262 as template and primer 5-GAG GAG AAC TTC TAG TAT ATT CTG TAT ACC-3 (SEQ ID NO 172) and primer 5-GAG GAT ATA GGA ATC CAC AAA AGG G-3 (SEQ ID NO 173) for the first PCR reaction and primer 5-ATC TAT GAA TAA CAT ATA AAA CGA AAA GAG GAA TAA TC-3 (SEQ ID NO 174) and primer 5-CTT ATT ACA TTA TCA ATC CTT GCA TTT CAG C-3 (SEQ ID NO 175) for the second PCR reaction. Transformants were selected inoculated into delft medium containing 20 g/l glucose. 24 colonies were screened for increased resveratrol production and the highest producer was isolated.
(265) The resulting strain was named FS09322 and had the genotype [Matalpha ura3-52 his3 leu2 trp1 pTPI-Acc1, ΔARo10, p204 (pTEF-C4H::CYB5::ATR2 pCUP1-PAL2, TY element, URA3), p180 (pTDH3-4CL2 pTEF1-VST1, TY element, S. pombe HISS-Tag2), Rho51 (TEF1-Snq2, TRP1), p0262 (pTDH3-VST1 pTEF1-STS, TY element, LEU2)]. The integration of VST1 and STS was checked by PCR and verified.
(266) A comparison between strain FS09332 and strain FS09258-53-32-44-51 is shown below:
(267) TABLE-US-00028 FS09258-53-32-44-51 (previous strain) FS09322 (new strain) Deletion of URA3 Deletion of URA3 Deletion of HIS3 Deletion of HIS3 Deletion of LEU2 Deletion of LEU2 Deletion of TRP1 Deletion of TRP1 Deletion ARO 10 Deletion ARO 10 Overexpression of ACC1 Overexpression of ACC1 — — Plasmid pESC-URA3(tag2)- Integrative plasmid TDH3-PAL2-TEF1- p0204 pSF126 (URA3) (pCUP1- C4H::CYB5::ATR2-TDH3-4CL2- PAL2, pTEF1-C4H::CYB5::ATR2, TEF1-VST1 (Rho53) URA3-without a tag sequence) Plasmid pESC-HIS3-TDH3- Integrative plasmid PAL2-TEF1-C4H::CYB5::ATR2- p0180 (pTEF1-VST, pTDH3-4CL2; TDH3-4CL2-TEF1-VST1 (Rho32) Marker: HIS5 from S. pombe attached to ubiquitin degradation Tag 2) Plasmid pESC-LEU2-TDH3- Integrative plasmid PAL2-TEF1-C4H::CYB5::AR2- p0262 (pTEF1-STS, pTDH3-VST1) TDH3-4CL2-TEF1-VST1 (Rho44) Plasmid Snq2 Transporter Plasmid rho0051 Snq2 Transporter Antibiotic marker Antibiotic marker (Ampicillin) (Ampicillin)
(268) FS09322 contains four integrative plasmids that contain the plant heterologous resveratrol pathway genes and resveratrol transporter genes and carries a deletion in the genes Aro10, Ura3, His3, Leu2, Trp1 and an overexpression of the genes ACC1 and SNQ2.
EXAMPLE 67
Generation of Strain FS09324 Matalpha ura3-52 his3 Leu2 trp1 pTPI-Acc1, ΔARo10, p204 (pTEF-C4H::CYB5::ATR2 pCUP1-PAL2, TY element, URA3), p180 (pTDH3-4CL2 pTEF1-VST1, TY Element, S. pombe HIS5-Tag2), Rho51 (TEF1-Snq2, TRP1), p0262 (pTDH3-VST1 pTEF1-STS, TY Element, Leu2), p0280 (pTDH3-Aro7, pTEF1-Aro4, TY Element, KanMX)
(269) Yeast strain FS09322 was transformed with the linear substrates originating from two PCR reactions using p0280 as template and primer 5-GAG GAG AAC TTC TAG TAT ATT CTG TAT ACC-3 (SEQ ID NO 172) and primer 5-GAG GAT ATA GGA ATC CAC AAA AGG G-3 (SEQ ID NO 173) for the first PCR reaction and primer 5-ATC TAT GAA TAA CAT ATA AAA CGA AAA GAG GAA TAA TC-3 (SEQ ID NO 174) and primer 5-CTT ATT ACA TTA TCA ATC CTT GCA TTT CAG C-3 (SEQ ID NO 175) for the second PCR reaction. Transformants were selected inoculated into delft medium containing 20 g/l glucose. 24 colonies were screened for increased resveratrol production and the highest producer was isolated.
(270) The resulting strain was named FS09324 and had the genotype [Matalpha ura3-52 his3 Leu2 pTPI-Acc1, DARo10, deltaTRP1, p204 (pTEF-C4H::CYB5::ATR2 pCUP1-PAL2, TY element, URA3), p180 (pTDH3-4CL2 pTEF1-VST1, TY element, S. pombe HIS5-Tag2), Rho51 (TEF1-Snq2, TRP1), p0262 (pTDH3-VST1 pTEF1-STS, TY element, Leu2), p0280 (pTDH3-Aro7, pTEF1-Aro4, TY element, KanMX)]. The integration of Aro7 and pTEF1-Aro4 was checked by PCR and verified.
EXAMPLE 68
Generation of Strain FS09313 Matalpha ura3-52 his3 leu2 pTPI-ACC1, Delta-aro10, Delta-trp1, p0204 (pTEF1-C4H::CYB5::ATR2 and pCUP1-PAL2, TY-delta Consensus Element, URA3), p0180 (pTDH3-4CL2 and pTEF1-VST1, TY-Delta Consensus Element, S. pombe HIS5-Tag2), Rho0051 (pTEF1-SNQ2, TRP1)
(271) S. cerevisiae strain FS09308 was transformed with plasmid Rho0051 digested by HindIII for integration by single cross-over into trp1 coding DNA sequence. The resulting strain was named FS09313 [Matalpha ura3-52 his3 leu2 pTPI-ACC1, Delta-aro10, Delta-trp1, p0204 (pTEF1-C4H::CYB5::ATR2 and pCUP1-PAL2, TY-delta consensus element, URA3), p0180 (pTDH3-4CL2 and pTEF1-VST1, TY-delta consensus element, S. pombe HIS5-Tag2), Rho0051 (pTEF1-SNQ2, TRP1)].
EXAMPLE 69
Generation of Strain FS09326 Matalpha ura3-52 his3 leu2 pTPI-ACC1, Delta-aro10, Delta-trp1, p0204 (pTEF1-C4H::CYB5::ATR2 and pCUP1-PAL2, TY-Delta Consensus Element, URA3), p0180 (pTDH3-4CL2 and pTEF1-VST1, TY-Delta Consensus Element, S. pombe HIS5-Tag2), Rho0051 (pTEF1-SNQ2, TRP1), Rho0039 (pTDH3-ARO7, pTEF1-ARO4, LEU2)
(272) S. cerevisiae strain FS09313 was transformed with plasmid Rho0039 (pTDH3-ARO7, pTEF1-ARO4, LEU2). The resulting strain was named FS09326 [Matalpha ura3-52 his3 leu2 pTPI-ACC1, Delta-aro10, Delta-trp1, p0204 (pTEF1-C4H::CYB5::ATR2 and pCUP1-PAL2, TY-delta consensus element, URA3), p0180 (pTDH3-4CL2 and pTEF1-VST1, TY-delta consensus element, S. pombe HIS5-Tag2), Rho0051 (pTEF1-SNQ2, TRP1), Rho0039 (pTDH3-ARO7, pTEF1-ARO4, LEU2)].
EXAMPLE 70
Production of Resveratrol with Strain FS09324 Compared to FS09322 in Deep Well Plate Cultivation
(273) The two strains FS09322 and FS09324 were constructed (Example 66 and 67) where FS09324 in comparison to FS09322 had also Aro7 and Aro4 overexpressed. The strains were grown in a 24 deep well plate with delft medium containing 2% glucose and 0.15 mM CuSO.sub.4*H.sub.2O. The strains were cultivated for 72 hours reaching the stationary phase and samples were taken for extraction and subsequent HPLC analysis (Table 20).
(274) TABLE-US-00029 TABLE 20 Mg/l Yield on Yield on Strain resveratrol OD.sub.600 biomass glucose FS09322 182 10.0 18.2 9.1 FS09324 291 9.0 32.2 14.6
(275) From the results present in Table 20 the resveratrol yield on biomass was increased by 77%, the resveratrol yield on glucose by 60% and the resveratrol titre by 60%.
EXAMPLE 71
Fermentation Media and Conditions for the Characterization of Strain FS09322 and FS09326 in Fed-Batch Fermentation
(276) Fed-batch fermentation of FS09322 and FS09326 have been conducted as described in under “Fermentation media and conditions” above with the changes described below.
(277) In the cultivation of FS09322 and FS09326, pre-defined exponential feeding profiles were used (Table 21) after the batch phase, the feed rate were adjusted in the course of the cultivations in order to avoid respiro-fermentative metabolism. In case of ethanol production, the phases of exponential feeding can be followed by phase with reduced and constant feeding. In Table 22, parameters are listed upon which the fermentations were switched from batch phase to exponential feeding, using various feeding media as described in Table 22.
(278) During the course of fermentation of FS09322 0.9 ml of 150 mM CuSO4 were added after 8 h, 37 h and 48.5 h, respectively. During the course of fermentation of FS09326 1.67 150 mM CuSO.sub.4 were added after 43.25 h into the fermentation.
(279) Fermentation using strain FS09326 was conducted using a 5 liter vessel with 1 L starting working volume.
(280) TABLE-US-00030 TABLE 21 Parameters used for the calculation of pre-defined, exponential feeding profiles in the fed-batch phase using FS09322 and FS09326. Three different feeding media were used. F40 F160 F620 FS09322 Sf (g/L) 41.15 172.22 594.17 V0 (L) 0.30 0.57 0.71 Vmax (L) 5.00 5.00 5.00 X0 (g DW/L) 1.50 7.67 17.88 S0 (g/L) 0.00 0.00 0.00 Ysx (g DW/g) 0.35 0.35 0.35 Yxs (g/g DW) 2.86 2.86 2.86 μ0 (1/h) 0.10 0.10 0.10 FS09326 Sf (g/L) 40.00 153.91 620.00 V0 (L) 1.00 1.00 1.16 Vmax (L) 5.00 5.00 5.00 X0 (g DW/L) 2.00 1.50 9.30 S0 (g/L) 0.00 0.00 0.00 Ysx (g DW/g) 0.35 0.35 0.35 Yxs (g/g DW) 2.86 2.86 2.86 μ0 (1/h) 0.10 0.10 0.10
(281) TABLE-US-00031 TABLE 22 Approximate parameters at start of exponential feeding phase, constant feeding phase 1, constant feeding phase 2 Time Strain Start of (h) FS09322 exponential 8 feeding phase using F40 exponential 29.5 feeding phase using F160 exponential 42.5 feeding phase using F620, μ = 0.095 1/h exponential 55 feeding phase using F620, μ = 0.025 1/h FS09326 exponential Not feeding phase used using F40 exponential 9.5 feeding phase using F160 exponential 27 feeding phase using F620, μ = 0.095 1/h exponential 49 feeding phase using F620, μ = 0.025 1/h
EXAMPLE 72
Fed-Batch Fermentation of FS09258-51-53-32B-44, FS09326 and FS09322
(282) The effect of integration of resveratrol pathway and transporter genes was investigated in controlled fed-batch fermentation. FS09258-51-53-32B-44 was used as reference strain and compared to FS09326 which has part of the resveratrol pathway integrated into the genome, and to FS09322 which has all resveratrol pathway genes and transporters integrated into the pathway. The results of the conducted fed-batch fermentations of FS09258-51-53-32B-44, FS09326 and FS09322 can be seen in
(283) Plasmid maps for plasmids referred to above are as follows:
(284) TABLE-US-00032 Plasmid Rho0021. Features Rho0021 Name Type Region ADH1 Terminator complement (2999 . . . 3163) CYC1 Terminator 4809 . . . 4998 pUC Replication origin 5185 . . . 5852 2 mu Replication origin 6994 . . . 8149 TEF1 Promoter complement (3371 . . . 3771) TDH3 Promoter 4061 . . . 4715 LEU2 ORF complement(663 . . . 1757) F1 origin ORF complement (2597 . . . 2903) bla ORF complement (6003 . . . 6860) Flag tag ORF complement (3315 . . . 3338) c-myc tag ORF 4747 . . . 4782
(285) TABLE-US-00033 Plasmid Rho0039. Features Rho0039 Name Type Region CYC1 Terminator 6853 . . . 6973 ADH1 Terminator complement (2999 . . . 3163) 2 um Replication origin 8812 . . . 9967 pUC Replication origin 7003 . . . 7670 F1 Replication origin complement (2597 . . . 2903) TDH3 Promoter 5138 . . . 5792 TEF Promoter complement (4448 . . . 4848) ARO7 ORF 5824 . . . 6594 ARO4 ORF complement (3314 . . . 4426) Leu2 ORF complement (668 . . . 1757) Bla ORF complement (7818 . . . 8678)
(286) TABLE-US-00034 Plasmid Rho0098. Features Rho0098 Name Type Region CYC1 Terminator 6076 . . . 6265 ADH1 Terminator complement (1961 . . . 2125) pUC Replication origin 6452 . . . 7119 2 mu Replication origin 8261 . . . 9416 STS Replication origin 4862 . . . 6040 F1 origin Replication origin 1555 . . . 1861 TEF1 Promoter 4449 . . . 4849 TDH3 Promoter complement (3505 . . . 4159) HIS3 ORF 504 . . . 1163 Bla ORF complement (7267 . . . 8127) VST1 ORF complement (2311 . . . 3492)
(287) TABLE-US-00035 Plasmid p0160. Name Type Region ADH1 Terminator complement (1933 . . . 2097) CYC1 Terminator 9581 . . . 9770 pUCori Replication origin 9913 . . . 10580 2 mu Replication origin 11722 . . . 12877 TDH3 Promoter complement (4413 . . . 5067) TEF1 Promoter 5357 . . . 5758 F1 ORF complement (1531 . . . 1837) URA3-tag2 ORF 417 . . . 1268 BLA ORF complement (10728 . . . 11600) PAL2 ORF complement (2247 . . . 4400) C4H ORF 5770 . . . 7320 ATR2 ORF 7636 . . . 9561 CYB5 ORF 7336 . . . 7626
(288) TABLE-US-00036 Plasmid p0161. Name Type Region CYC1 Terminator 5761 . . . 5950 ADH1 Terminator complement(1661 . . . 1813) pUCori Replication origin 6092 . . . 6759 2 mu Replication origin 7901 . . . 9056 TEF1 Promoter 4137 . . . 4537 TDH3 Promoter complement (3193 . . . 3847) HIS3 ORF 504 . . . 1163 Bla ORF complement (6907 . . . 7767) VST1 ORF complement (1999 . . . 3180) STS ORF 4550 . . . 5725
(289) TABLE-US-00037 Plasmid p0246. Features p0246 Name Type Region HIS3 Terminator 19 . . . 225 pUC Replication origin 1235 . . . 1902 f1ori Replication origin 457 . . . 763 HIS3 Promoter join (3677 . . . >3678, <3679 . . . 3993) bla Promoter complement (2911 . . . 3041) Tag2 ORF 4645 . . . 4677 bla ORF complement (2050 . . . 2910) pombe HIS5 ORF 3994 . . . 4644 loxP Misc. structure 226 . . . 274 MCS Misc. structure 971 . . . 1048 loxP Misc. structure 3628 . . . 3676 Ty Misc. structure 3295 . . . 3627
(290) TABLE-US-00038 Plasmid p0249. Features p0249 Name Type Region HIS3 Terminator 1623 . . . 1824 pUCori Replication origin 2834 . . . 3501 f1ori Replication origin 2056 . . . 2362 pbla Promoter complement(4510 . . . 4640) HIS3 Promoter 501 . . . 812 bla ORF complement (3649 . . . 4509) KanMX ORF 813 . . . 1622 loxP Misc. structure 1825 . . . 1873 MCS Misc. structure 2570 . . . 2647 loxP Misc. structure 452 . . . 500 Ty Misc. structure 119 . . . 451
(291) TABLE-US-00039 Plasmid p0262. Name Type Region CYC1 Terminator complement (3544 . . . 3733) LEU2 Terminator 2309 . . . 2784 ADH1 Terminator 7681 . . . 7845 f1 Replication origin 3016 . . . 3322 pUC Replication origin 8056 . . . 8723 TEF1 Promoter complement (4957 . . . 5357) TDH3 Promoter 5647 . . . 6301 LEU2 Promoter 567 . . . 1213 bla Promoter complement (9732 . . . 9862) LEU2 ORF 1214 . . . 2308 PvVST ORF complement (3766 . . . 4944) VvVST ORF 6314 . . . 7492 bla ORF complement (8871 . . . 9731) loxP Misc. structure 2785 . . . 2833 Ty Misc. structure 185 . . . 517 loxP Misc. structure 518 . . . 566
(292) TABLE-US-00040 Plasmid p0280. Features p0280 Name Type Region HIS3 Terminator 1 . . . 202 ADH1 Terminator 4615 . . . 4779 CYC1 Terminator complement (962 . . . 1151) f1 origin Replication origin 434 . . . 740 pUCori Replication origin 4990 . . . 5657 TDH3 Promoter complement (1986 . . . 2640) TEF1 Promoter 2930 . . . 3330 bla Promoter complement (6666 . . . 6796) HIS3 Promoter 7432 . . . 7743 Bla ORF complement (5805 . . . 6665) KanMX ORF 7744 . . . 8553 Aro4 ORF 3352 . . . 4464 Aro7 ORF complement (1184 . . . 1954) loxP Misc. structure 203 . . . 251 MCS Misc. structure 948 . . . 4803 loxP Misc. structure 7383 . . . 7431 Ty Misc. structure 7050 . . . 7382
(293) As seen in
(294) In this specification, unless expressly otherwise indicated, the word ‘or’ is used in the sense of an operator that returns a true value when either or both of the stated conditions is met, as opposed to the operator ‘exclusive or’ which requires that only one of the conditions is met. The word ‘comprising’ is used in the sense of ‘including’ rather than in to mean ‘consisting of’. All prior teachings acknowledged above are hereby incorporated by reference. No acknowledgement of any prior published document herein should be taken to be an admission or representation that the teaching thereof was common general knowledge in Australia or elsewhere at the date hereof.
REFERENCES
(295) Aury J M, Jaillon O, Duret L, Noel B, Jubin C, Porcel B M, Ségurens B, Daubin V,Anthouard V, Aiach N, Arnaiz O, Billaut A, Beisson J, Blanc I, Bouhouche K, Camara F, Duharcourt S, Guigo R, Gogendeau D, Katinka M, Keller A M, Kissmehl R, Klotz C, Koll F, Le Mouël A, Lepère G, Malinsky S, Nowacki M, Nowak J K, Plattner H, Poulain J, Ruiz F, Serrano V, Zagulski M, Dessen P, Bétermier M, Weissenbach J, Scarpelli C, Schächter V, Sperling L, Meyer E, Cohen J, Wincker P. Global trends of whole-genome duplications revealed by the ciliate Paramecium tetraurelia. Nature. 2006 Nov. 9; 444(7116):171-8. Andrade A C, Del Sorbo G, Van Nistelrooy J G, Waard M A. The ABC transporter AtrB from Aspergillus nidulans mediates resistance to all major classes of fungicides and some natural toxic compounds. Microbiology. 2000:146:1987-97. Banerjee D, Lelandais G, Shukla S, Mukhopadhyay G, Jacq C, Devaux F, Prasad R. Responses of pathogenic and nonpathogenic yeast species to steroids reveal the functioning and evolution of multidrug resistance transcriptional networks. Eukaryot Cell. 2008:7:68-77. Boer V M, de Winde J H, Pronk J T, Piper M D. The genome-wide transcriptional responses of Saccharomyces cerevisiae grown on glucose in aerobic chemostat cultures limited for carbon, nitrogen, phosphorus, or sulfur. J Biol. Chem. 2003:278:3265-74. Chloupková M, Pickert A, Lee J Y, Souza S, Trinh Y T, Connelly S M, Dumont M E, Dean M, Urbatsch I L. Expression of 25 human ABC transporters in the yeast Pichia pastoris and characterization of the purified ABCC3 ATPase activity. Biochemistry. 2007:46:7992.sup.−8003. Cochrane F C, Davin L B, Lewis N G. The Arabidopsis phenylalanine ammonia lyase gene family: kinetic characterization of the four PAL isoforms.Phytochemistry. 2004:65:1557-64. Connolly M S, Sakihama Y, Phuntumart V, Jiang Y, Warren F, Mourant L, Morris P F. Heterologous expression of a pleiotropic drug resistance transporter from Phytophthora sojae in yeast transporter mutants. Curr Genet. 2005:48:356-65. Del Sorbo G, Andrade A C, Van Nistelrooy J G, Van Kan J A, Balzi E, De Waard M A. Multidrug resistance in Aspergillus nidulans involves novel ATP-binding cassette transporters. Mol Gen Genet. 1997:254:417-26. Del Sorbo G, Ruocco M, Schoonbeek H J, Scala F, Pane C, Vinale F, De Waard M A. Cloning and functional characterization of BcatrA, a gene encoding an ABC transporter of the plant pathogenic fungus Botryotinia fuckeliana (Botrytis cinerea). Mycol Res. 2008:112:737-46. Domergue F, Abbadi A, Zähringer U, Moreau H, Heinz E. In vivo characterization of the first acyl-CoA Delta6-desaturase from a member of the plant kingdom, the microalga Ostreococcus tauri. Biochem J. 2005 Jul. 15; 389 (Pt 2):483-90. Ehlting J, Büttner D, Wang Q, Douglas C J, Somssich I E, Kombrink E. Three 4-coumarate:coenzyme A ligases in Arabidopsis thaliana represent two evolutionarily divergent classes in angiosperms. Plant J. 1999:19:9-20. Erdeniz N, Mortensen U H, Rothstein R Cloning-Free PCR-Based Allele Replacement Methods Genome Res. 1997 7: 1174-1183 Etschmann M Mw, Bluemke W, Sell D, Schrader J Biotechnological production of 2-phenylethanol Appl Microbiol Biotechnol 2002:59:1-8 Giaever G, Chu A M, Ni L, Connelly C, Riles L, Véronneau S, Dow S, Lucau-Danila A, Anderson K, André B, Arkin A P, Astromoff A, El-Bakkoury M, Bangham R, Benito R, Brachat S, Campanaro S, Curtiss M, Davis K, Deutschbauer A, Entian K D, Flaherty P, Foury F, Garfinkel D J, Gerstein M, Gotte D, Güldener U, Hegemann J H, Hempel S, Herman Z, Jaramillo D F, Kelly D E, Kelly S L, Kotter P, LaBonte D, Lamb D C, Lan N, Liang H, Liao H, Liu L, Luo C, Lussier M, Mao R, Menard P, Ooi S L, Revuelta J L, Roberts C J, Rose M, Ross-Macdonald P, Scherens B, Schimmack G, Shafer B, Shoemaker D D, Sookhai-Mahadeo S, Storms R K, Strathern J N, Valle G, Voet M, Volckaert G, Wang C Y, Ward T R, Wilhelmy J, Winzeler E A, Yang Y, Yen G, Youngman E, Yu K, Bussey H, Boeke J D, Snyder M, Philippsen P, Davis R W, Johnston M. Functional profiling of the Saccharomyces cerevisiae genome. Nature. 2002:418:387-91. Gietz R D, Schiestl R H. Applications of high efficiency lithium acetate transformation of intact yeast cells using single-stranded nucleic acids as carrier. Yeast. 1991:7:253-63. Guengerich F P, Gillam E M, Ohmori S, Sandhu P, Brian W R, Sari M A, Iwasaki M. Expression of human cytochrome P450 enzymes in yeast and bacteria and relevance to studies on catalytic specificity. Toxicology. 1993:82:21-37. Review. Gilon T, Chomsky O, Kulka R G Degradation signals for ubiquitin system proteolysis in Saccharomyces cerevisiae The EMBO Journal 1998:17:2759-2766 Hain R, Reif H J, Krause E, Langebartels R, Kindl H, Vornam B, Wiese W, Schmelzer E, Schreier P H, Stöcker R H, et al. Disease resistance results from foreign phytoalexin expression in a novel plant.Nature. 1993:361:153-6. Hamberger B, Hahlbrock K. The 4-coumarate:CoA ligase gene family in Arabidopsis thaliana comprises one rare, sinapate-activating and three commonly occurring isoenzymes.Proc Natl Acad Sci USA. 2004:101:2209-14. Johansson B and Hahn-Hagerdal B Overproduction of pentose phosphate pathway enzymes using a new CRE-loxP expression vector for repeated genomic integration in Saccharomyces cerevisiae Yeast 2002:19:225-231. Jungwirth H, Kuchler K. Yeast ABC transporters—a tale of sex, stress, drugs and aging. FEBS Lett. 2006:580:1131-8. Kunji E R, Slotboom D J, Poolman B. Lactococcus lactis as host for overproduction of functional membrane proteins. Biochim Biophys Acta. 2003:1610:97-108. Review. Mizutani M, Ohta D, Sato R. Isolation of a cDNA and a genomic clone encoding cinnamate 4-hydroxylase from Arabidopsis and its expression manner in planta. Plant Physiol. 1997:113:755-63. Mizutani M, Ohta D. Two isoforms of NADPH:cytochrome P450 reductase in Arabidopsis thaliana. Gene structure, heterologous expression in insect cells, and differential regulation.Plant Physiol. 1998:116:357-67. Moriya H, Shimizu-Yoshida Y, Kitano H. In vivo robustness analysis of cell division cycle genes in Saccharomyces cerevisiae. PLoS Genet. 2006 July; 2(7):e111. Epub 2006 Jun. 5. Erratum in: PLoS Genet. 2006 December; 2(12):e218. Muhitch M J, McCormick S P, Alexander N J, Hohn T M. Transgenic expression of the TRI101 or PDR5 gene increases resistance of tobacco to the phytotoxic effects of the trichothecene 4,15-diacetoxyscirpenol. Plant Sci. 2000:157:201-207. Mumberg D, Müller R, Funk M. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene. 1995:156:119-22. Nimii M et al, Functional analysis of fungal drug efflux transporters by heterologous expression in S. cerevisiae Jpn. J. Infect Disease 2005:58:1-7 Pan Z, Agarwal A K, Xu T, Feng Q, Baerson S R, Duke S O, Rimando A M. Identification of molecular pathways affected by pterostilbene, a natural dimethylether analog of resveratrol. BMC Med. Genomics. 2008:20:1-7. Passorn, S., Laoteng, K., Rachadawong, S., Tanticharoen, M. and Cheevadhanarak,S. Heterologous expression of Mucor rouxii delta(12)-desaturase gene in Saccharomyces cerevisiae; Biochem. Biophys. Res. Commun. 263 (1), 47-51 (1999) Rogers B, Decottignies A, Kolaczkowski M, Carvajal E, Balzi E, Goffeau A. The pleitropic drug ABC transporters from Saccharomyces cerevisiae. J Mol Microbiol Biotechnol. 2001:3:207-14. Schoonbeek H, Del Sorbo G, De Waard M A. The ABC transporter BcatrB affects the sensitivity of Botrytis cinerea to the phytoalexin resveratrol and the fungicide fenpiclonil. Mol Plant Microbe Interact. 2001:14:562-71. Mol Gen Genet. 1993 January; 236(2-3):214-8. Gene SNQ2 of Saccharomyces cerevisiae, which confers resistance to 4-nitroquinoline-N-oxide and other chemicals, encodes a 169 kDa protein homologous to ATP-dependent permeases. Servos J, Haase E, Brendel M. Sikorski R S, Hieter P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 1989:122:19-27. Song W Y, Sohn E J, Martinoia E, Lee Y J, Yang Y Y, Jasinski M, Forestier C, Hwang I, Lee Y. Engineering tolerance and accumulation of lead and cadmium in transgenic plants. Nat. Biotechnol. 2003:21:914-9. Tavares,S, and Gunnarsson,N, GenBank, www.ncbi.nim.nih.gov/nuccore/291481146?report=genbank, Trott A, West J D, Klaie L, Westerheide S D, Silverman R B, Morimoto R I, Morano K A. Activation of heat shock and antioxidant responses by the natural product celastrol: transcriptional signatures of a thiol-targeted molecule. Mol Biol Cell. 2008:19:1104-12. Verduyn C, Postma E, Scheffers W A, Van Dijken J P. Effect of benzoic acid on metabolic fluxes in yeasts: a continuous-culture study on the regulation of respiration and alcoholic fermentation. Yeast. 1992:8:501-17. Vuralhan Z, Luttik M A H, Tai S L, Boer V M, Morais M A, Schipper D, Almering M J H, Kotter P, Dickinson J R, Daran J, Pronk J T Physiological Characterization of the ARO10-Dependent, Broad-Substrate-Specificity 2-Oxo Acid Decarboxylase Activity of Saccharomyces cerevisiae Applied and Environmental Microbiology 2005:71:3276-3284 Werck-Reichhart D, Feyereisen R. Cytochromes P450: a success story Genome Biology 2000:1:3003.1-3003.9 Yoon Y G, Posfai G, Szybalski W, Kim S C Cre/loxP-mediated in vivo excision of large segments from yeast genome and their amplification based on the 2 mm plasmid-derived system Gene 1998:223:67-76 Zwiers L H, Stergiopoulos I, Van Nistelrooy J G, De Waard M A. ABC transporters and azole susceptibility in laboratory strains of the wheat pathogen Mycosphaerella graminicola. Antimicrob Agents Chemother. 2002 December; 46(12):3900-6.