Tracking and manipulating cellular RNA via nuclear delivery of CRISPR/CAS9
11667903 · 2023-06-06
Assignee
Inventors
- Eugene Yeo (La Jolla, CA, US)
- David A. Nelles (La Jolla, CA, US)
- Mark Fang (La Jolla, CA, US)
- Ranjan Batra (La Jolla, CA, US)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
A61P25/14
HUMAN NECESSITIES
C12N15/111
CHEMISTRY; METALLURGY
A61P21/00
HUMAN NECESSITIES
C12N9/22
CHEMISTRY; METALLURGY
C07K2319/80
CHEMISTRY; METALLURGY
A61K48/0058
HUMAN NECESSITIES
A61K38/465
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
C12N15/113
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
C12N15/11
CHEMISTRY; METALLURGY
Abstract
Cas9 polypeptides which target RNA and method of using them are provided.
Claims
1. A method of altering target RNA in a cell, the method comprising: administering to the cell a 2-component RNA targeting system comprising: (a) nucleic acid sequence encoding a truncated nuclease-inactive RNA-targeted Cas9 (RCas9) polypeptide, wherein the truncated nuclease-inactive RCas9 polypeptide lacks all or part of its HNH domain compared to the wild-type (WT) Cas9 protein; and (b) a single guide RNA (sgRNA) sequence comprising: (i) on its 5′ end, an RNA sequence that hybridizes to or binds to the target RNA sequence comprising a repeat sequence selected from the group consisting of CUG, CCUG, CAG, and GGGGCC; and (ii) on its 3′ end, an RNA sequence capable of binding to or associating with the truncated nuclease-inactive RCas9 polypeptide, wherein the RNA sequence capable of binding to or associating with the truncated nuclease-inactive RCas9 polypeptide comprises or is derived from the wild type guide RNA of an archaeal or a bacterial organism from which the truncated nuclease-inactive RCas9 is derived, wherein the RNA targeting system exclusively recognizes and alters the target RNA in the cell in the absence of PAMmers.
2. The method of claim 1, wherein the truncated nuclease-inactive RCas9 is missing residues 775-909 from full-length Cas9 protein.
3. The method of claim 1, wherein the sequences of a) and b) are in a single vector.
4. The method of claim 3, wherein the sequences of a) and b) are a size of less than about 4.5 kb, or a size of less than about 4.7 kb.
5. The method of claim 1, wherein the nuclease-inactive RCas9 polypeptide and the RNA sequence capable of binding to or associating with the nuclease-inactive RCas9 polypeptide comprises or is derived from Haloferax mediteranii, Mycobacterium tuberculosis, Francisella tularensis subsp. novicida, Pasteurella multocida, Neisseria meningitidis, Campylobacter jejune, Streptococcus thermophilus, Campylobacterlari, Mycoplasma gallisepticum str. F, Nitratifractor salsuginis str. DSM 16511, Parvibaculum lavamentivorans, Roseburia intestinalis, Neisseria cinerea, Gluconacetobacter diazotrophicus, Azospirillum B510, Sphaerochaeta globus str. Buddy, Flavobacterium columnare, Fluviicola taffensis, Bacteroides coprophilus, Mycoplasma mobile, Lactobacillus farciminis, Streptococcus pasteurianus, Lactobacillus johnsonii, Staphylococcus pseudintermedius, Filifactor alocis, Treponema denticola, Legionella pneumophila str. Paris, Sutterella wadsworthensis, Corynebacter diphtheriae, Streptococcus aureus, and Natronobacterium gregoryi.
6. The method of claim 1, wherein the 5′ end of the sgRNA is between about 15 to 25 nucleotides in length, and wherein the RNA sequence of the RCas9 polypeptide scaffold is between about 85 and 100 nucleotides in length.
7. The method of claim 1, wherein the truncated nuclease-inactive RCas9 polypeptide is linked to an effector polypeptide, a targeting agent, an enzyme, a detectable moiety, or a combination thereof.
8. The method of claim 7, wherein the effector polypeptide comprises an RNA modifying polypeptide.
9. The method of claim 7, wherein the targeting agent comprises: (a) a cytoplasmic polyadenylation element binding protein (CPEB), a zinc finger binding protein (ZBP), TIA-1, PSF, the DNA-binding domain (DBD) of PSF, fragile X mental retardation protein (FMRP), IMP1, IMP2, 1MP3, a cytoskeleton binding protein, a transmembrane protein, or (b) an engineered protein comprising a combination of domains of the proteins of (a).
10. The method of claim 8, wherein the RNA modifying polypeptide comprises a splicing factor or an RNA splicing domain, a RBFOX2 domain-containing protein, a protein known to influence RNA splicing, an RNA cleaving domain or a PIN domain-containing protein.
11. The method of claim 10, wherein the RNA cleaving domain comprises an endonuclease.
12. The method of claim 11, wherein the truncated nuclease-inactive RCas9 lacks all of its HNH domain.
13. The method of claim 1, wherein the sequence of a) comprises a promoter.
14. The method of claim 1, wherein the sequence of b) comprises the U6 polymerase III promoter.
15. The method of claim 1, wherein the sequence of b) comprises one or more point mutations that remove the transcription termination sequence.
16. A method of altering target RNA in a cell, the method comprising administering to the cell an engineered nucleoprotein complex comprising: (a) a nuclease-inactive RNA-targeted Cas9 (RCas9) polypeptide, wherein the nuclease-inactive RCas9 polypeptide: (i) lacks all or part of an HNH domain, all or part of RuvC nuclease domain, all or part of a Cas9 polypeptide DNase active site, all or part of a ββα-metal fold comprising the Cas9 polypeptide active site, or a combination thereof as compared to the corresponding wild type (WT) Cas9 polypeptide; (ii) lacks DNase, DNA cleaving activity, or nickase activity; and (iii) has a reduced polypeptide size as compared to the corresponding wild type (WT) Cas9 polypeptide that permits packaging of the RCas9-coding nucleotide in a delivery vector; and (b) a recombinant or synthetic single guide RNA (sgRNA) comprising: (i) on its 5′ end, an RNA sequence that hybridizes to or binds to the target RNA sequence, wherein the target RNA sequence comprises a repeat sequence, wherein the RNA sequence that hybridizes to or binds to the target RNA sequence is capable of hybridizing or binding to the repeat sequence, and wherein the repeat sequence is CUG, CCUG, CAG, GGGGCC, or any combination thereof; and (ii) on its 3′ end: (1) an RNA sequence capable of binding to or associating with the nuclease-inactive RCas9 polypeptide, or (2) a linker that covalently links or non-covalently links the 5′ RNA sequence of the sgRNA with the nuclease-inactive RCas9 polypeptide, wherein the engineered nucleoprotein complex recognizes and alters target RNA in the cell in the absence of a PAMmer.
17. The method of claim 16, wherein the nuclease-inactive RCas9 polypeptide is covalently linked to an effector polypeptide, a detectable moiety, or an RNA modifying polypeptide.
18. The method of claim 16, wherein said RNA modifying polypeptide comprises a splicing factor or an RNA splicing domain, a RBFOX2 domain-containing protein, an RNA cleaving domain or a PIN domain-containing protein.
19. The method of claim 16, wherein said sgRNA comprises one or more point mutations that remove the transcription termination sequence or a portion thereof.
20. The method of claim 16, wherein said sgRNA comprises one or more of methylphosphonate, thiophosponoaceteate, and phosphorothioate linkages that reduce nuclease activity on the target RNA.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18) FIG. 7A1. Alternative embodiments (“Permutation 1, Permutation 2”) and uses for exemplary RNA-targeting Cas9 (RCas9). Permutations 1 and 2 describe which in some embodiments may be the minimal components for measuring and manipulating RNA with an exemplary RNA-targeting Cas9. The RCas9 system is composed of the Streptococcus pyogenes Cas9 protein, a single guide RNA, and a short oligonucleotide known as the PAMmer (permutation 1) OR Streptococcus pyogenes Cas9 protein and a single guide RNA only. Each use case (1-3) describes a distinct technological or biomedical exemplary application of the RCas9 system in the context of living cells.
(19) FIG. 7A2. Use Case 1 describes tracking the presence, localization, and movement of a target RNA, such as repeat-containing RNAs, with applications in diagnostics and research (data supporting this use case is described in
(20) FIG. 7A3. Use case 2 describes an exemplary therapeutic application of RCas9 in living cells that utilizes a fused endonuclease (effector) protein to Cas9 that destroys targeted RNAs. This general principle can be used to cleave a variety of disease causing RNAs that cause various conditions ranging from neurodegeneration to cancer. Data supporting this application in the context of targeting the repeat-containing RNA that causes myotonic dystrophy is described in FIG. 7D2.
(21) FIG. 7A4. RNA splicing use case 3 describes alteration of RNA splicing with RCas9. Dysfunctional RNA splicing is linked to many diseases including cancer and spinal muscular atrophy (SMA). This use case involves an effector comprising a splicing factor or other protein that alters RNA splicing that is targeted to pre-mRNAs to alter splicing. Data supporting this use case is described in
(22)
(23)
(24) FIG. 7D1. Data demonstrating cleavage of RNA using an exemplary RCas9 system (use case 2). Here, the RNA that causes myotonic dystrophy (composed of repeating CUG RNA bases) was targeted in living human cells using both permutation 1 and 2 of the RCas9 system.
(25) FIG. 7D2. Application of the permutation 2 of the RNA-cleaving RCas9 system (use case 2) resulted in a large reduction of the amount of CUG repeat-containing RNA (˜35% RNA levels compared to no RCas9 system present, bar on far left). The bar graph represents a quantification of the Northern dot blot (below).
(26)
(27)
(28)
(29)
(30)
(31)
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
(32) All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference in their entireties for all purposes to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. For example, PCT/US14/53301 is herein incorporated by reference in its entirety for all purposes.
(33) Definitions
(34) Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art in the field to which this disclosure belongs. As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. Any reference to “or” herein is intended to encompass “and/or” unless otherwise stated.
(35) As used herein the term “associated” or “associated with” can mean that two or more moieties, such as chemical groups, nucleotides, oligonucleotides, proteins or peptides are linked to each other, either covalently or non-covalently. For example, a protein may be associated with a nucleotide, a fluorescent agent, or another protein. An association can mean that two or more proteins or peptides form a fusion protein. An association can be a physical association. In some instances two or more proteins or peptides are “tethered”, “attached”, or “linked” to one another. An association may be a covalent bond between two proteins or peptides.
(36) As used herein, a “polypeptide” includes proteins, fragments of proteins, and peptides, whether isolated from natural sources, produced by recombinant techniques, or chemically synthesized. A polypeptide may have one or more modifications, such as a post-translational modification (such as glycosylation, etc.) or any other modification (such as pegylation, etc.). The polypeptide may contain one or more non-naturally-occurring amino acids (such as an amino acid with a side chain modification). Polypeptides described herein typically comprise at least about 10 amino acids.
(37) As used herein, the term “sample” can refer to a composition comprising targets. Suitable samples for analysis by the disclosed methods, devices, and systems include cells, tissues, organs, or organisms or compositions obtained from cells, tissues or organisms.
(38) As used herein, the term “specifically binds” refers to the binding specificity of a specific binding pair. Hybridization by a target-specific nucleic acid sequence of a particular target polynucleotide sequence in the presence of other potential targets is one characteristic of such binding. Specific binding involves two different nucleic acid molecules wherein one of the nucleic acid molecules specifically hybridizes with the second nucleic acid molecule through chemical or physical means. The two nucleic acid molecules are related in the sense that their binding with each other is such that they are capable of distinguishing their binding partner from other assay constituents having similar characteristics. The members of the binding component pair are referred to as ligand and receptor (anti-ligand), specific binding pair (SBP) member and SBP partner, and the like.
(39) “Polynucleotide,” or “nucleotide,” as used interchangeably herein, refer to polymers of nucleotides of any length, and include DNA and RNA. A polynucleotide or nucleotide sequence could be either double-stranded or single-stranded. When a polynucleotide or nucleotide sequence is single stranded, it could refer to either of the two complementary strands. The nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and their analogs. If present, modification to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. Other types of modifications include, for example, “caps”, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (such as methyl phosphonates, phosphotriesters, phosphoamidates, cabamates, etc.) and with charged linkages (such as phosphorothioates, phosphorodithioates, etc.), those containing pendant moieties, such as, for example, proteins (such as nucleases, toxins, antibodies, signal peptides, ply-L-lysine, etc.), those with intercalators (such as acridine, psoralen, etc.), those containing chelators (such as metals, radioactive metals, boron, oxidative metals, etc.), those containing alkylators, those with modified linkages (such as alpha anomeric nucleic acids, etc.), as well as unmodified forms of the polynucleotide(s). Further, any of the hydroxyl groups ordinarily present in the sugars may be replaced, for example, by phosphonate groups, phosphate groups, protected by standard protecting groups, or activated to prepare additional linkages to additional nucleotides, or may be conjugated to solid supports. The 5′ and 3′ terminal OH can be phosphorylated or substituted with amines or organic capping groups moieties of from 1 to 20 carbon atoms. Other hydroxyls may also be derivatized to standard protecting groups. Polynucleotides can also contain analogous forms of ribose or deoxyribose sugars that are generally known in the art, including, for example, 2′-O-methyl-2′-O-allyl, 2′-fluoro- or 2′-azido-ribose, carbocyclic sugar analogs, α-anomeric sugars, epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, sedoheptuloses, acyclic analogs and abasic nucleoside analogs such as methyl riboside. One or more phosphodiester linkages may be replaced by alternative linking groups. These alternative linking groups include, but are not limited to, embodiments wherein phosphate is replaced by P(O)S (“thioate”), P(S)S (“dithioate”), “(O)NR 2 (“amidate”), P(O)R, P(O)OR′, CO or CH 2 (“formacetal”), in which each R or R′ is independently H or substituted or unsubstituted alkyl (1-20 C) optionally containing an ether (—O—) linkage, aryl, alkenyl, cycloalkyl, cycloalkenyl or araldyl. Not all linkages in a polynucleotide need be identical. The preceding description applies to all polynucleotides referred to herein, including RNA and DNA.
(40) “Oligonucleotide,” as used herein, generally refers to short, generally single stranded, generally synthetic polynucleotides that are generally, but not necessarily, less than about 200 nucleotides in length. The terms “oligonucleotide” and “polynucleotide” are not mutually exclusive. The description above for polynucleotides is equally and fully applicable to oligonucleotides.
(41) The terms “homologous”, “substantially homologous”, and “substantial homology” as used herein denote a sequence of amino acids having at least 50%, 60%, 70%, 80% or 90% identity wherein one sequence is compared to a reference sequence of amino acids. The percentage of sequence identity or homology is calculated by comparing one to another when aligned to corresponding portions of the reference sequence.
(42) As used herein, “complementary or matched” means that two nucleic acid sequences have at least 50% sequence identity. Preferably, the two nucleic acid sequences have at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of sequence identity. “Complementary or matched” also means that two nucleic acid sequences can hybridize under low, middle and/or high stringency condition(s).
(43) As used herein, “substantially complementary or substantially matched” means that two nucleic acid sequences have at least 90% sequence identity. Preferably, the two nucleic acid sequences have at least 95%, 96%, 97%, 98%, 99% or 100% of sequence identity. Alternatively, “substantially complementary or substantially matched” means that two nucleic acid sequences can hybridize under high stringency condition(s).
(44) As used herein, “improve” means a change of at least about 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 35%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 225%, 250%, 275%, 300%, 350%, 400%, 450%, 500%, 600%, 700%, 800%, 900%, 1000% or more or any value between any of the listed values. Alternatively, “improve” could mean a change of at least about 1-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 500-fold, 1000-fold, 2000-fold or more or any value between any of the listed values.
(45) As used herein, “complexed” means non-covalently linked to or associated with.
(46) As used herein, “nuclease null” may refer to a polypeptide with reduced nuclease activity, reduced endo- or exo-DNAse activity RNAse activity, reduced nickase activity, or reduced ability to cleave DNA and/or RNA.
(47) As used herein, “reduced nuclease activity” means decline in nuclease, nickase, DNAse, or RNAse activity of at least about 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 35%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more or any value between any of the listed values. Alternatively, “reduced nuclease activity” may refer to a decline of at least about 1-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 500-fold, 1000-fold, 2000-fold or more or any value between any of the listed values.
(48) As used herein, a “trafficking agent or agents” may refer to any polypeptide that directs the nucleoprotein complex to a desired location in a cell, such as a cytoplasmic polyadenylation element binding protein (CPEB), a zinc finger binding protein (ZBP), TIA-1 (a 3′UTR mRNA binding protein), a PSF (a protein component of spliceosomes) or a DNA-binding domain (DBD) of PSF, fragile X mental retardation protein (FMRP), IGF-II mRNA-binding protein (IMP)-1 (IMP1), IMP2, IMP3, a cytoskeleton binding protein, a transmembrane protein, or an engineered protein comprising a combination of domains of these aforementioned proteins to generate a combinatorial trafficking phenomena.
(49) In general, the stability of a hybrid is a function of the ion concentration and temperature. Typically, a hybridization reaction is performed under conditions of lower stringency, followed by washes of varying, but higher, stringency. Moderately stringent hybridization refers to conditions that permit a nucleic acid molecule such as a probe to bind a complementary nucleic acid molecule. The hybridized nucleic acid molecules generally have at least 60% identity, including for example at least any of 70%, 75%, 80%, 85%, 90%, or 95% identity. Moderately stringent conditions are conditions equivalent to hybridization in 50% formamide, 5× Denhardt's solution, 5× SSPE, 0.2% SDS at 42° C., followed by washing in 0.2× SSPE, 0.2% SDS, at 42° C. High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5× Denhardt's solution, 5× SSPE, 0.2% SDS at 42° C., followed by washing in 0.1× SSPE, and 0.1% SDS at 65° C.
(50) Low stringency hybridization refers to conditions equivalent to hybridization in 10% formamide, 5× Denhardt's solution, 6× SSPE, 0.2% SDS at 22° C. followed by washing in 1× SSPE, 0.2% SDS, at 37° C. Denhardt's solution contains 1% Ficoll, 1% polyvinylpyrolidone, and 1% bovine serum albumin (BSA), 20× SSPE (sodium chloride, sodium phosphate, ethylene diamide tetraacetic acid (EDTA)) contains 3M sodium chloride, 0.2M sodium phosphate, and 0.025 M (EDTA). Other suitable moderate stringency and high stringency hybridization buffers and conditions are well known to those of skill in the art.
(51) RNA-Targeting Cas9 Polypeptides (RCas9)
(52) Some embodiments disclosed herein provide Cas9 polypeptide which has been engineered to recognize a target RNA, wherein the Cas9 polypeptide is associated with an effector. In some embodiments, the Cas9 polypeptide is a Streptococcus pyogenes Cas9 polypeptide. In some embodiments, the Cas9 polypeptide comprises a mutation, such as D10A, H840A, or both (SEQ ID NO: 31), in the Streptococcus pyogenes Cas9 polypeptide.
(53) Some embodiments relate to a version of the Cas9 polypeptide-comprising nucleoprotein complex as provided herein is involved in the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9, or CRISP/Cas9, system that has been repurposed or engineered to target RNA instead of DNA in living cells. This repurposed or engineered Cas9 polypeptide-comprising nucleoprotein complex binds to RNA is referred to herein as RCas9. CRISPR has revolutionized genome engineering by allowing simply-programmed recognition of DNA in human cells and supported related technologies in imaging and gene expression modulation. We have developed an analogous means to target RNA using an RCas9, or with CRISPR/Cas9. In some embodiment, nucleoprotein complexes as provided herein comprise a Cas9 protein, a single guide RNA (sgRNA), and optionally an (chemically-modified or synthetic) antisense PAMmer oligonucleotide. The PAMmer is an antisense oligonucleotide that serves to simulate a DNA substrate for recognition by Cas9 via hybridization to the target RNA. Together, the Cas9 protein and sgRNA components allow recognition of hypothetically any RNA sequence
(54) Thus, in alternative embodiments, compositions and methods provided herein provide solutions to persistent problems in many fields of basic biology and therapy. As a tool for basic biology and drug development, this technology has already supported nondestructive measurement of RNA localization and gene expression in living cell (see discussion below). From a therapeutic perspective, compositions and methods provided herein allow targeted alteration of RNA compositions via alteration of RNA splicing or RNA editing to reverse RNA features that are implicated in diseases such as cancer and neurodegeneration. The nucleoprotein complexes as provided herein stand apart from the state of the art as the first simply reprogrammable, nucleic acid-guided RNA binding protein.
(55) In some embodiments, exemplary nucleoprotein complexes as provided herein are associated with, or comprise, a detectable agent, such as a fluorescent agent, a fluorescent protein, an enzyme, or the like. In some embodiments, the fluorescent protein is a green fluorescent protein (GFP), an enhanced GFP (EGFP (SEQ ID NO: 30)), a blue fluorescent protein or its derivatives (EBFP, EBFP2, Azurite, mKalama1), a cyan fluorescent protein or its derivatives (ECFP, Cerulean, CyPet, mTurquoise2), a yellow fluorescent protein and its derivatives (YFP, Citrine, Venus, YPet), UnaG, dsRed, eqFP611, Dronpa, TagRFPs, KFP, EosFP, Dendra, IrisFP, etc., or fragments thereof. In some embodiments, a fluorescent protein may be split into two halves, each fused with a Cas9 polypeptide, so that when the two Cas9 polypeptides bind to adjacent RNA targets, the two halves of the fluorescent protein come into close proximity of each other and generate a fluorescent signal. For example, the fluorescent protein Venus can be split into two halves: an N-terminal portion and a C-terminal portion. In some embodiments, the N-terminal portion comprises residues 1-155 or 1-173 (SEQ ID NO: 25). In some embodiments, the N-terminal portion comprises an I152L mutation (SEQ ID NO: 24; I152L reduced background complementation mutant, from Kodama et al Biotechniques, 2010 November, 49(5):793-805). In some embodiments, the C-terminal portion comprises residues 155-238 (SEQ ID NO: 26). In some embodiments, the enzyme is luciferase (Gaussia, Renilla, Firefly variants), tobacco etch virus. (TEV) protease, ubiquitin, horse radish peroxidase, or a toxin such as diphtheria toxin, etc. In some embodiments, the enzyme may be split into two halves, each fused with a Cas9 polypeptide, so that when the two Cas9 polypeptides bind to adjacent RNA targets, the two halves of the enzyme come into close proximity of each other and create the enzymatic activity. In some embodiments, the enzyme is involved in the modification of synthesis of a compound. In some embodiments, the compound is a polypeptide or a nucleic acid. In some embodiments, the association of the Cas9 polypeptide on a target RNA creates a local accumulation of intermediate products in a biosynthetic pathway to amplify the production of a medically- or technologically-useful compound compared to free-floating biosynthetic enzymes.
(56) In some embodiments, the nucleoprotein complexes as provided herein are associated with an effector polypeptide such as a nuclease that cleaves RNA, such as, a PIN domain protein, such as human SMG6 (SEQ ID NO: 27), or fragments thereof. In some embodiments, nucleoprotein complexes as provided herein are associated with an RNA binding protein, such as, human RBFOX1 (SEQ ID NO: 28), Human RBFOX2 (SEQ ID NO: 29), or the like, or fragments thereof. In some embodiments, the Cas9 polypeptide is associated with a splicing factor, or fragments thereof. In some embodiments, the nuclease, RNA binding protein, or splicing factor may be split into two halves, each fused with a Cas9 polypeptide, so that when the two Cas9 polypeptides bind to adjacent RNA targets, the two halves of the nuclease, RNA binding protein, or splicing factor come into close proximity of each other and create the enzymatic activity.
(57) In some embodiments, nucleoprotein complexes as provided herein are further associated with or comprise one or more nuclear localization signals, one or more stable, inert linker peptides such as XTEN peptides, or combinations thereof. XTEN peptides have been used to extend the serum half-life of translationally fused biologic drugs by increasing their hydrodynamic radius, acting as a protein-based functional analog to chemical PEGylation. As XTEN peptides are chemically stable, non-cationic, non-hydrophobic, and predicted to adopt an extended, unstructured conformation. XTEN-based linker peptides can function as stable, inert linker sequences to join Cas9 polypeptides to an effector polypeptide, such as an RNA modifying polypeptide, or to a detectable moiety.
(58) Truncated Cas9 Polypeptides
(59) Truncated versions of Streptococcus pyogenes Cas9 that are capable of binding RNA are advantageous in terms of their ability to specifically alter target RNA but not DNA sequences while reducing the size of Cas9 protein to fit in adeno-associated viral vectors (AAV). In some embodiments, the nucleoprotein complexes comprise truncated versions of Cas9 that lack part or all of the DNA-cleaving HNH, RuvC domains, or combinations thereof, which facilitate both of these important features by eliminating the DNA-cleaving ability of Cas9 (producing a nuclease-null Cas9) and reducing its size. In some embodiments, AAV vectors capable of delivering ˜4.5 kb are used for packaging of transgenes. In some embodiments, AAVs capable of packaging large transgenes such as about 4.6 kb, 4.7 kb, 4.8 kb, 4.9 kb, 5.0 kb, 5.1 kb, 5.2 kb, 5.3 kb, 5.4 kb, 5.5 kb, 5.6 kb, 5.7 kb, 5.8 kb, 5.9 kb, 6.0 kb, 6.1 kb, 6.2 kb, 6.3 kb, 6.4 kb, 6.5 kb, 6.6 kb, 6.7 kb, 6.8 kb, 6.9 kb, 7.0 kb, 7.5 kb, 8.0 kb, 9.0 kb, 10.0 kb, 11.0 kb, 12.0 kb, 13.0 kb, 14.0 kb, 15.0 kb, or larger are used.
(60) In other embodiments, the nucleoprotein complexes comprise truncations lacking all or portions of other domains that contact specific DNA residues (such as the PAMmer-interaction-domain, or PAM-ID domain), all or portions of the Rec domain, or combinations thereof, providing further reductions in size that maintain the ability of Cas9 to bind RNA. By fusing nuclease-null Cas9 to effectors such as the PIN domain or other effectors that act on RNA but not DNA, these embodiments provide means to alter RNA while not targeting the encoding DNA.
(61) In some embodiments, the Cas9 active sites (10 and 840) are mutated to Alanine (D10A and H840A) to eliminate the cleavage activity of Streptococcus pyogenes Cas9, producing nuclease-deficient or dCas9. The RuvC domain is distributed among 3 non-contiguous portions of the dCas9 primary structure (residues 1-60, 719-775, and 910-1099). The Rec lobe is composed of residues 61-718. The HNH domain is composed of residues 776-909. The PAM-ID domain is composed of residues 1100-1368.
(62) The REC lobe be considered the structural scaffold for recognition of the sgRNA and target DNA/RNA. The NUC lobe contains the two nuclease domains (HNH and RuvC), plus the PAM-interaction domain (PAM-ID), which recognizes the PAM sequence. In some embodiments, the 98-nucleotide sgRNA can similarly be broken into two major structural components: the first contains the target-specific guide or “spacer” segment (nucleotides 1-20) plus the repeat-tetraloop-anti-repeat and stem-loop 1 (SL1) regions; the second contains stem-loops 2 and 3 (SL2, SL3). In some embodiments, the guide-through-SL1 RNA segment is bound mainly by the Cas9 REC lobe. In some embodiments, the SL2-SL3 segment is bound mainly by the NUC lobe.
(63) A recent study demonstrated that 1368-amino acid Streptococcus pyogenes Cas9 can be split into two polypeptides comprising the REC lobe (amino acids 56-714) and the NUC lobe (amino acids 1-57 fused to 729-1368), which can be combined in trans to form a functional nuclease (Wright A V, Sternberg S H, Taylor D W, Staahl B T, Bardales J A, Kornfeld J E, Doudna J A. Rational design of a split-Cas9 enzyme complex. Proc Natl Acad Sci USA. 2015;112(10):2984-9). The study results demonstrate that Cas9 construct missing the entire NUC lobe can assemble with sgRNA with high affinity: albeit significantly lower affinity than full-length Cas9. Currently, it is unknown how affinity changes in this range affect either DNA-editing efficiency of CRISPR/Cas9 or its ability to target RNA in cells.
(64) In some embodiments, a minimal construct of SpCas9 is engineered that will recognize a target RNA sequence with high affinity and guide its fused PIN RNA endonuclase domain to a model RNA for destruction. In some embodiments, the smallest construct will be a REC-only construct. In some embodiments, the constructs will comprise less minimized constructs lacking the HNH, PAM-ID, parts of each domain, lacking both of each domains, or combinations thereof. In some embodiments, the HNH domain will be excised by inserting a five-residue flexible linker between residues 77 and 909 (ΔHNH). In some embodiments, all or part of the PAM-ID are removed. In some embodiments, truncating Cas9 at residue 1098 (ΔPAM-ID #1), fusing residues 1138 and 1345 with an 8-residue linker (ΔPAM-ID #2), or fusing residues 1138 with 1200 and 1218 with 1339 (with 5-residue and 2-residue linkers, respectively: ΔPAM-ID #3) are used to remove all or part of the PAM-ID. The ΔPAM-ID #2 and 3 constructs will retain elements of the PAM-ID that contribute to binding of the sgRNA repeat-anti-repeat (residues 1099-1138) and SL2-SL3 (residues 1200-1218 and 1339-1368) segments. In some embodiments, the HNH deletion will be combined with the three PAM-ID deletions.
(65) In some embodiments, the nucleoprotein complex may comprise a Cas9 polypeptide that lacks all or part of (1) an HNH domain, (2) at least one RuvC nuclease domain, (3) a Cas9 polypeptide DNase active site, (4) a ββα-metal fold comprising a Cas9 polypeptide active site, or (5) a Cas9 polypeptide that lacks all or part of one or more of the HNH domain, at least one RuvC nuclease domain, a Cas9 polypeptide DNase active site, and/or a ββα-metal fold comprising a Cas9 polypeptide active site as compared to a corresponding wild type (WT) Cas9 polypeptide and wherein, the complex may or may not comprise a PAMmer oligonucleotide.
(66) Single Guide RNA (sgRNA)
(67) In some embodiments, nucleoprotein complexes as provided herein are complexed with a single guide RNA (sgRNA). In some embodiments, the single guide RNA carries extensions of secondary structures in the single guide RNA scaffold sequence. In some embodiments, the single guide RNA comprises one or more point mutations that improve expression levels of the single guide RNAs via removal of partial or full transcription termination sequences or sequences that destabilize single guide RNAs after transcription via action of trans-acting nucleases. In some embodiments, the single guide RNA comprises an alteration at the 5′ end which stabilizes said single guide RNA against degradation. In some embodiments, the single guide RNA comprises an alteration at the 5′ end which improves RNA targeting. In some embodiments, the alteration at the 5′ end of said single guide RNA is selected from the group consisting of 2′O-methyl, phosphorothioates, and thiophosphonoacetate linkages and bases. In some embodiments, the single guide RNA comprises 2′-fluorine, 2′O-methyl, and/or 2′-methoxyethyl base modifications in the spacer or scaffold region of the sgRNA to improve target recognition or reduce nuclease activity on the single guide RNA. In some embodiments, the single guide RNA comprises one or more methylphosphonate, thiophosponoaceteate, or phosphorothioate linkages that reduce nuclease activity on the target RNA.
(68) In some embodiments, the single guide RNA can recognize the target RNA, for example, by hybridizing to the target RNA. In some embodiments, the single guide RNA comprises a sequence that is complementary to the target RNA. In some embodiments, the single guide RNA has a length that is, is about, is less than, or is more than, 10 nt, 20 nt, 30 nt, 40 nt, 50 nt, 60 nt, 70 nt, 80 nt, 90 nt, 100 nt, 110 nt, 120 nt, 130 nt, 140 nt, 150 nt, 160 nt, 170 nt, 180 nt, 190 nt, 200 nt, 300 nt, 400 nt, 500 nt, 1,000 nt, 2,000 nt, or a range between any two of the above values. In some embodiments, the single guide RNA can comprise one or more modified nucleotides.
(69) In alternative embodiments, a variety of RNA targets can be recognized by the single guide RNA. For example, a target RNA can be messenger RNA (mRNA), ribosomal RNA (rRNA), signal recognition particle RNA (SRP RNA), transfer RNA (tRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), antisense RNA (aRNA), long noncoding RNA (lncRNA), microRNA (miRNA), piwi-interacting RNA (piRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), retrotransposon RNA, viral genome RNA, viral noncoding RNA, or the like. In some embodiments, a target RNA can be an RNA involved in pathogenesis or a therapeutic target for conditions such as cancers, neurodegeneration, cutaneous conditions, endocrine conditions, intestinal diseases, infectious conditions, neurological disorders, liver diseases, heart disorders, autoimmune diseases, or the like.
(70) In some embodiments, a target RNA can comprise a repeat sequence. For example, the repeat sequence can be CTG, CCTG, CAG, GGGGCC, or any combination thereof. In some embodiments, the repeat sequence is associated with a disease, for example, myotonic dystrophy, Huntington's disease, familial ALS, cancer, spinal muscular atrophy, Fragile X syndrome, etc.
(71) PAMmer Oligonucleotide
(72) In some embodiments, nucleoprotein complexes as provided herein are further complexed with an antisense oligonucleotide which is complementary to a sequence in the target RNA. In some embodiments, the antisense oligonucleotide comprises a PAMmer oligonucleotide. In some embodiments, the antisense oligonucleotide comprises at least one modified nucleotide. In some embodiments, the at least one modified nucleotide is selected from the group consisting of 2′OMe RNA and 2′OMe DNA nucleotides. In some embodiments, the PAMmer oligonucleotide comprises one or more modified bases or linkages. In some embodiments, the one or more modified bases or linkages are selected from the group consisting of locked nucleic acids and nuclease stabilized linkages. In some embodiments, the antisense oligonucleotide is complementary to a sequence that is in close proximity to the target RNA. For example, the antisense oligonucleotide can be complementary to a sequence that is about 10 nt, 20 nt, 30 nt, 40 nt, 50 nt, 60 nt, 70 nt, 80 nt, 90 nt, 100 nt, from the target RNA. In some embodiments, the antisense oligonucleotide has a length that is, is about, is less than, or is more than, 10 nt, 20 nt, 30 nt, 40 nt, 50 nt, 60 nt, 70 nt, 80 nt, 90 nt, 100 nt, 110 nt, 120 nt, 130 nt, 140 nt, 150 nt, 160 nt, 170 nt, 180 nt, 190 nt, 200 nt, 300 nt, 400 nt, 500 nt, 1,000 nt, 2,000 nt, or a range between any two of the above values. In some embodiments, the antisense oligonucleotide comprises RNA, DNA, or both.
(73) Nucleic Acids Encoding Cas9 Polypeptides
(74) Some embodiments disclosed herein provide nucleic acids that encode the Cas9 polypeptides, sgRNAs, or fusion proteins of the nucleoprotein complexes as provided herein, optionally associated with an effector or detectable moiety, such as a detectable reagent or an RNA modifying polypeptide, e.g., an RNA endonuclease.
(75) The nucleic acids may be naturally occurring nucleic acids DNA, RNA, or nucleic acids including peptide nucleic acid (PNA), Morpholino and locked nucleic acid (LNA), as well as glycol nucleic acid (GNA) and threose nucleic acid (TNA). Both single-stranded and double-stranded nucleic acids may be used for the present disclosure. In some embodiments, the nucleic acid is a recombinant DNA molecule.
(76) In some embodiments, the Cas9 polypeptides as encoded herein comprise archaeal or bacterial Cas9 polypeptides. In some embodiments the Cas9 polypeptide is, comprises or is derived from: Haloferax mediteranii, Mycobacterium tuberculosis, Francisella tidarensis subsp. novicida, Pasteurella multocida, Neisseria meningitidis, Campylobacter jejune, Streptococcus thermophilius LMD-9 CRISPR 3, Campylobacter lari CF89-12, Mycoplasma gallisepticum str. F, Nitratifractor salsuginis str. DSM 16511, Parvibaculum lavamentivorans, Roseburia intestinalis, Neisseria cinerea, Gluconacetobacter diazotrophicus, Azospirillum B510, Sphaerochaeta globus str. Buddy, Flavobacterium columnare, Fluviicola taffensis, Bacteroides coprophilus, Mycoplasma mobile, Lactobacillus farciminis, Streptococcus pasteurianus, Laciobacillus johnsonii, Staphylococcus pseudintermedius, Filifactor alocis, Treponema denticola, Legionella pneumophila str. Paris, Sutterella wadsworthensis, Corynebacter diphtheriae, or Streptococcus aureus; a Francisella novicida (optionally a Francisella novicida Cpf1) or a Natronobacterium gregoryi Argonaute modified or repurposed to target RNA, wherein optionally the sgRNA 3′ end or “scaffold sequence” comprises all or part of, or is derived from, the wild type (WT) cognate guide nucleic acid of each of these respective bacteria or archaeal organisms.
(77) As used herein, “operatively linked” or “linked operatively” refer to the situation in which part of a linear DNA sequence can influence the other parts of the same DNA molecule. For example, when a promoter controls the transcription of the coding sequence, it is operatively linked to the coding sequence.
(78) Some embodiments disclosed herein provide genetically engineered recombinant vectors comprising nucleic acid molecules encoding exemplary Cas9 polypeptides, sgRNAs, or fusion proteins of an exemplary Cas9 polypeptide optionally associated with an effector or detectable moiety, such as a detectable reagent or an RNA modifying polypeptide, e.g., an RNA endonuclease. Vectors used can include those that are suitable for expression in a selected host, whether prokaryotic or eukaryotic, for example, phage, plasmid, and viral vectors. Viral vectors may be either replication competent or replication defective retroviral vectors. Viral propagation generally will occur only in complementing host cells comprising replication defective vectors, for example, when using replication defective retroviral vectors in methods provided herein viral replication will not occur. Vectors may comprise Kozak sequences (Lodish et al., Molecular Cell Biology, 4th ed., 1999) and may also contain the ATG start codon. Promoters that function in a eukaryotic host include SV40, LTR, CMV, EF-1α, white cloud mountain minnow β-actin promoter, etc.
(79) Copy number and positional effects are considered in designing transiently and stably expressed vectors. Copy number can be increased by, for example, dihydrofolate reductase amplification. Positional effects can be optimized by, for example, Chinese hamster elongation factor-1 vector pDEF38 (CHEF1), ubiquitous chromatin opening elements (UCOE), scaffold/matrix-attached region of human (S/MAR), and artificial chromosome expression (ACE) vectors, as well as by using site-specific integration methods known in the art. The expression constructs containing the vector and gene of interest will further contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation. The coding portion of the transcripts expressed by the constructs can include a translation initiating codon at the beginning and a termination codon (UAA, UGA, or UAG) appropriately positioned at the end of the polypeptide to be translated.
(80) Considering the above-mentioned factors, exemplary vectors suitable for expressing exemplary Cas9 polypeptides, sgRNAs, and/or fusion proteins of a Cas9 polypeptide, optionally associated with an effector or detectable moiety, such as a detectable reagent or an RNA modifying polypeptide in bacteria include pTT vectors, are available e.g., from Biotechnology Research Institute (Montreal, Canada), pQE70, pQE60, and pQE-9, available from Qiagen (Mississauga, Ontario, Canada); vectors derived from pcDNA3, available from Invitrogen (Carlsbad, Calif.); pBS vectors, Phagescript vectors. Bluescript vectors, pNH8A, pNH6a, pNH18A, pNH46A, available from Stratagene (La Jolla, Calif.); and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia (Peapack, N.J.). Among suitable eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1, and pSG available from Stratagene (La Jolla, Calif.); and pSVK3, pBPV, pMSG and pSVL, available from Pharmacia (Peapack, N.J.).
(81) Vectors for expressing exemplary Cas9 polypeptides, sgRNAs, or fusion proteins of a Cas9 polypeptide, optionally associated with an effector or detectable moiety, such as a detectable reagent or an RNA modifying polypeptide include those comprising a pTT vector backbone (Durocher et al., Nucl. Acids Res. 30:E9 (2002)). Briefly, the backbone of a pTT vector may be prepared by obtaining pIRESpuro/EGFP (pEGFP) and pSEAP basic vector(s), for example from Clontech (Palo Alto, Calif.), and pcDNA3.1, pCDNA3.1/Myc-(His)6 and pCEP4 vectors can be obtained from, for example, Invitrogen (Carlsbad, Calif.). As used herein, the pTT5 backbone vector can generate a pTT5-Gateway vector and be used to transiently express proteins in mammalian cells. The pTT5 vector can be derivatized to pTT5-A, pTT5-B, pTT5-D, pTT5-E, pTT5-H, and pTT5-I, for example. As used herein, the pTT2 vector can generate constructs for stable expression in mammalian cell lines.
(82) A pTT vector can be prepared by deleting the hygromycin (BsmI and SalI excision followed by fill-in and ligation) and EBNA1 (ClaI and NsiI excision followed by fill-in and ligation) expression cassettes. The ColEI origin (FspI-SalI fragment, including the 3′ end of the β-lactamase open reading frame (ORF) can be replaced with a FspI-SalI fragment from pcDNA3.1 containing the pMBI origin (and the same 3′ end of β-lactamase ORF). A Myc-(His)6 C-terminal fusion tag can be added to SEAP (HindIII-HpaI fragment from pSEAP-basic) following in-frame ligation in pcDNA3.1/Myc-His digested with HindIII and EcoRV. Plasmids can subsequently be amplified in E. coli (DH5α) grown in LB medium and purified using MAXI prep columns (Qiagen, Mississauga, Ontario, Canada). To quantify, plasmids can be subsequently diluted in, for example, 50 mM Tris-HCl pH 7.4 and absorbencies can be measured at 260 nm and 280 nm. Plasmid preparations with A260/A280 ratios between about 1.75 and about 2.00 are suitable for producing the Fc-fusion constructs.
(83) The expression vector pTT5 allows for extrachromosomal replication of the cDNA driven by a cytomegalovirus (CMV) promoter. The plasmid vector pCDNA-pDEST40 is a Gateway-adapted vector which can utilize a CMV promoter for high-level expression. SuperGlo GFP variant (sgGFP) can be obtained from Q-Biogene (Carlsbad, Calif.). Preparing as pCEP5 vector can be accomplished by removing the CMV promoter and polyadenylation signal of pCEP4 by sequential digestion and self-ligation using SalI and XbaI enzymes resulting in plasmid pCEP4Δ. A GblII fragment from pAdCMV5 (Massie et al., J. Virol. 72:2289-2296 (1998)), encoding the CMV5-poly(A) expression cassette ligated in BglII-linearized pCEP4Δ, resulting in the pCEP5 vector.
(84) Vectors for expressing exemplary Cas9 polypeptides, sgRNAs or fusion proteins of a Cas9 polypeptide, optionally associated with an effector or detectable moiety, such as a detectable reagent or an RNA modifying polypeptide can include those comprising vectors optimized for use in CHO-S or CHO-S-derived cells, such as pDEF38 (CHEF1) and similar vectors (Running Deer et al., Biotechnol, Prog. 20:880-889 (2004)). The CHEF vectors contain DNA elements that lead to high and sustained expression in CHO cells and derivatives thereof. They may include, but are not limited to, elements that prevent the transcriptional silencing of transgenes.
(85) Vectors may include a selectable marker for propagation in a host. In alternative embodiments, a selectable marker is used that allows the selection of transformed cells based on their ability to thrive in the presence or absence of a chemical or other agent that inhibits an essential cell function. The selectable markers confer a phenotype on a cell expressing the marker, so that the cell can be identified under appropriate conditions. Suitable markers, therefore, include genes coding for proteins which confer drug resistance or sensitivity thereto, impart color to, or change the antigenic characteristics of those cells transfected with a molecule encoding the selectable marker, when the cells are grown in an appropriate selective medium.
(86) Suitable selectable markers include dihydrofolate reductase or G418 for neomycin resistance in eukaryotic cell culture; and tetracycline, kanamycin, or ampicillin resistance genes for culturing in E. coli and other bacteria. Suitable selectable markers also include cytotoxic markers and drug resistance markers, whereby cells are selected by their ability to grow on media containing one or more of the cytotoxins or drugs; auxotrophic markers, by which cells are selected for their ability to grow on defined media with or without particular nutrients or supplements, such as thymidine and hypoxanthine; metabolic markers for which cells are selected, for example, for ability to grow on defined media containing a defined substance, for example, an appropriate sugar as the sole carbon source; and markers which confer the ability of cells to form colored colonies on chromogenic substrates or cause cells to fluoresce.
(87) As mentioned above, vectors for the expression of exemplary Cas9 polypeptides, sgRNA, or fusion proteins of an exemplary Cas9 polypeptide optionally associated with an effector or detectable moiety, such as a detectable reagent or an RNA modifying polypeptide can also be constructed in retroviral vectors. One such vector, the ROSA geo retroviral vector, which maps to mouse chromosome six, was constructed with the reporter gene in reverse orientation with respect to retroviral transcription, downstream of a splice acceptor sequence (U.S. Pat. No. 6,461,864; Zambrowiez et al., Proc. Natl. Acad. Sci. 94:3789-3794 (1997)). Infecting embryonic stem (ES) ceps with ROSA geo retroviral vector resulted in the ROSA geo26 (ROSA26) mouse strain by random retroviral gene trapping in the ES cells.
(88) A DNA insert comprising nucleic acids (optionally contained in a vector or vectors) encoding exemplary Cas9 polypeptides, sgRNAs, or fusion proteins of a Cas9 polypeptide, optionally associated with an effector or detectable moiety, such as a detectable reagent or an RNA modifying polypeptide can be operatively linked to an appropriate promoter, such as the phage lambda PL promoter; the E. coli lac. trp. phoA, and tac promoters; the SV40 early and late promoters; and promoters of retroviral LTRs. Suitable vectors and promoters also include the pCMV vector with an enhancer, pcDNA3.1; the pCMV vector with an enhancer and an intron, pCIneo; the pCMV vector with an enhancer, an intron, and a tripartate leader, pTT2, and CHEF1. Other suitable vectors and promoters will be known to the skilled artisan. The promoter sequences include at least the minimum number of bases or elements necessary to initiate transcription of a gene of interest at levels detectable above background. Within the promoter sequence may be a transcription initiation site, as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. In alternative embodiments, eukaryotic promoters will often, but not always, contain “TATA” boxes and “CAT” boxes.
(89) Some embodiments disclosed herein provide vectors for the in vivo expression of exemplary Cas9 polypeptides, sgRNAs, or fusion proteins of an exemplary Cas9 polypeptide, optionally associated with an effector or detectable moiety, such as a detectable reagent or an RNA modifying polypeptide in animals, including humans, under the control of a promoter that functions in a tissue-specific manner. For example, promoters that drive the expression of the Cas9 polypeptides sgRNAs, or fusion proteins of a Cas9 polypeptide associated, optionally associated with an effector or detectable moiety, such as a detectable reagent or an RNA modifying polypeptide may be liver-specific, as described in PCT/US06/00668.
(90) A region of additional amino acids, particularly charged amino acids, may be added to the N-terminus of the polypeptide to improve stability and persistence in the host cell purification throughout and subsequent handling and storage. Also, amino acid moieties may be added to the polypeptide to facilitate purification. Such amino acids may or may not be removed prior to the final preparation of the polypeptide. The Cas9 polypeptides or fusion proteins of a Cas9 polypeptide, optionally associated with an effector or detectable moiety, such as a detectable reagent or an RNA modifying polypeptide can be fused to marker sequences, such as a peptide, that facilitates purification of the fused polypeptide. The marker amino acid sequence may be is hexa-histidine peptide such as the tag provided in a pQE vector (Qiagen, Mississauga, Ontario, Canada), among others, many of which are commercially available. As described in Gentz et al., Proc. Natl. Acad. Sci. 86:821-824 (1989), for instance, hexa-histidine provides for convenient purification of the fusion protein. Another peptide tag useful for purification, the hemagglutinin HA tag, corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al., Cell 37:767-778 (1984)). Any of the above markers can be engineered using the polynucleotides or the polypeptides as provided herein.
(91) The expression constructs can further contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation. The coding portion of the transcripts expressed by the constructs can include a translation initiating codon at the beginning and a termination codon (UAA, UGA, or UAG) appropriately positioned at the end of the polypeptide to be translated.
(92) Cells Expressing Cas9 Polypeptides
(93) Some embodiments disclosed herein provide a cell line comprising the nucleic acid or nucleic acids (e.g., vector or vectors) that encode exemplary Cas9 polypeptides, sgRNAs, or fusion proteins of an exemplary Cas9 polypeptide associated with an effector or detectable moiety, such as a detectable reagent or an RNA modifying polypeptide. In some embodiments, the cell line transfected may be a prokaryotic cell line, a eukaryotic cell line, a yeast cell line, an insect cell line, an animal cell line, a mammalian cell line, a human cell line, etc. The proteins expressed in mammalian cells have been glycosylated properly. The mammalian cells can produce the Cas9 polypeptides, sgRNAs, or fusion proteins of a Cas9 polypeptide, optionally associated with an effector or detectable moiety, such as a detectable reagent or an RNA modifying polypeptide in this disclosure. Examples of useful mammalian host cell lines are HEK293, CHO, sp2/0, NSO, COS, BHK, PerC6. Many other cells can also be used as the expression and production host, and hence, are encompassed by this disclosure.
(94) For recombinant production of the fusion proteins, molecular cloning method is used based on the molecular cloning protocols, for example those described in, Sambrook & Russel, Molecular Cloning (3rd ed., CSHL Press, 2001). The DNA sequences coding the fusion protein can be acquired by ordinary techniques, e.g. by whole gene synthesizing or spliced DNA fragments. Many vectors can be used. The vector components generally include, but are not limited to, one or more of the following: a signal sequence for the secretion of expressed proteins, one or more marker genes including the selection marker gene for the stable cell line screening in eukaryote cells, an origin of replication, an enhancer element, a promoter, and a transcription termination sequence, and poly A, etc.
(95) Transfection of animal cells typically involves opening transient pores or “holes” in the cell membrane, to allow the uptake of material. Genetic material (such as supercoiled plasmid DNA or siRNA constructs), or even proteins such as antibodies, may be transfected. There are various methods of introducing foreign DNA into a eukaryotic cell. Transfection can be carried out using calcium phosphate, by electroporation, or by mixing a cationic lipid with the material to produce liposomes, which fuse with the cell membrane and deposit their cargo inside. Many materials have been used as carriers for transfection, which can be divided into three kinds: (cationic) polymers, liposomes and nanoparticles.
(96) Exemplary Cas9 polypeptides or fusion proteins of an exemplary Cas9 polypeptide associated with an effector or detectable moiety, such as a detectable reagent or an RNA modifying polypeptide may be recovered from the cells by precipitation, ultracentrifugation, or chromatographic methods, including ion exchange chromatography, size exclusion chromatography, affinity chromatography, immunoaffinity chromatography, HPLC, etc. RP-HPLC may be used to further purify the recovered fusion protein. When the Cas9 polypeptides or fusion proteins of a Cas9 polypeptide associated with an effector or detectable moiety, such as a detectable reagent or an RNA modifying polypeptide are secreted, commercially available ultrafiltration membranes from Millipore, Amicon, Pellicon, etc. may be used to concentrate the supernatant.
(97) In some embodiments, protein A affinity chromatography may be used to recover the Cas9 polypeptides or fusion proteins of a Cas9 polypeptide associated with an effector or detectable moiety, such as a detectable reagent or an RNA modifying polypeptide. Protein A is a cell wall component produced by several strains of Staphylococcus aureus and can be made in a recombinant fashion. It consists of a single polypeptide chain weighing approximately 42,000 daltons and contains little or no carbohydrate. Protein A binds specifically to the Fc region of most immunoglobulin molecules, including IgG (Sjoquist et al., Eur. J. Biochem. 29:572-578 (1972); Hjelm et al., Eur. J. Biochem. 57:395-403 (1975)).
(98) Protein G affinity chromatography may also be used to purify the Cas9 polypeptides or fusion proteins of a Cas9 polypeptide associated with an effector or detectable moiety, such as a detectable reagent or an RNA modifying polypeptide. Protein G is a bacterial cell wall protein produced by group G streptococci and can also be made in a recombinant fashion. Like Protein A, Protein G binds to most mammalian immunoglobulins, primarily through their Fc regions (Bjorck et al., J. Immunol. 133:969-974 (1984); Guss et al., EMBO J. 5:1567-1575 (1986); Åkerström et al., J. Biol. Chem. 261;10,240-10,247 (1986)). Affinity chromatography using Cas9 binding molecules may further be used to purify Cas9 polypeptides of the disclosure. For example, Protein A/G is a genetically engineered protein that combines the IgG binding profiles of both Protein A and Protein G. Protein A/G is a gene fusion product, which can be secreted from, inter alia, nonpathogenic Bacillus. Protein A/G typically weighs approximately 50,000 daltons and was designed to contain four Fc binding domains from Proteins A and two from Protein G (Sikkema, Amer. Biotech. Lab. 7:42 (1989); Eliasson et al., J. Biol. Chem. 263:4323-4327 (1988)).
(99) Methods of Tracking or Measuring the Amount of Target RNA
(100) Some embodiments disclosed herein provide compositions for and methods of tracking a target RNA or measuring the amount of a target RNA in a sample, such as a cell, comprising allowing an exemplary Cas9 polypeptide disclosed herein to bind to said target RNA in said cell and determining the location of said target RNA in said cell or determining the amount of said target RNA in said cell. In some embodiments, the Cas9 polypeptide associated with a detectable agent as disclosed herein is introduced to the sample. In some embodiments, a single guide RNA that recognizes the target RNA, and/or an antisense oligonucleotide, such as a PAMmer oligonucleotide, is further introduced to the sample.
(101) In some embodiments, exemplary Cas9 polypeptides bind to said target RNA in a nucleus of said cell and is subsequently co-exported from said nucleus with said target RNA. In some embodiments, the location of said target RNA in said cell or the amount of said target RNA in said cell is determined using fluorescence microscopy.
(102) In some embodiments, the methods provided herein comprise measuring the content of a target RNA in said sample. In some embodiments, the methods comprise diagnosing a disease condition of said sample based on the content of said target RNA in said sample. In some embodiments, the disease is selected from the group consisting of myotonic dystrophy, Huntington's disease, familial ALS, cancer, spinal muscular atrophy and Fragile X syndrome, etc.
(103) Methods of Modifying a Target RNA
(104) Some embodiments disclosed herein provide methods of modifying a target in a sample comprising introducing exemplary Cas9 polypeptides disclosed herein into the sample and modifying said target RNA in said sample using an RNA modifying polypeptide, which in alternative embodiments can be linked or fused to an exemplary Cas9 polypeptide. In some embodiments, the exemplary Cas9 polypeptide associated with an RNA modifying polypeptide as disclosed herein is introduced to the sample. In some embodiments, a single guide RNA (sgRNA) that recognizes the target RNA, and/or an antisense oligonucleotide, such as a PAMmer oligonucleotide, is further introduced to the sample, and in some embodiments, the sgRNA is associated with, or is co-expressed with, the Cas9 polypeptide.
(105) In some embodiments, the RNA modifying polypeptide can fragment the target RNA. In some embodiments, the RNA modifying polypeptide can change the splicing of the target RNA.
(106) In some embodiments, the methods comprise treating a disease condition of said sample by modifying said target RNA in said sample. In some embodiments, the disease is selected from the group consisting of myotonic dystrophy, Huntington's disease, familial ALS, cancer, spinal muscular atrophy and Fragile X syndrome, etc.
(107) Current methods to target RNA in living cells rely on nucleic acid basepairing with antisense oligonucleotides (ASOs) or engineered RNA binding proteins. ASOs can unambiguously recognize target RNA, but are limited in their function to destruction of the target RNA or as a means to block association of other nucleic acids or protein to the RNA. Engineered RNA binding proteins are difficult and expensive to design, must be completely redesigned for every RNA target, target structured RNAs poorly, and their affinities for RNA can vary unpredictably. In contrast to ASOs, engineered RNA binding proteins can carry a variety of protein factors to alter the target RNA for therapy for RNA tracking. Certain Cas9 polypeptides and methods of using them are discussed in PCT/US2014/069730, entitled Methods and Compositions for Modifying a Single-Stranded Target Nucleic Acid, filed Dec. 11, 2014 and published as WO2015/089277, the disclosure of which is incorporated herein by reference in its entirety.
(108) In alternative embodiments, exemplary RCas9 polypeptides and RCas9 complexes as provided herein combines the strengths of both of these approaches by allowing simply-programmed and strong RNA binding based on nucleic acid basepairing while carrying any protein factor to achieve the effect of choice on the target RNA. In alternative embodiments, exemplary RCas9 polypeptides and RCas9 complexes as provided herein also incorporate CRISPR-related technologies that include modified single guide RNAs that can recruit trans-acting protein factors, photo- and drug-activatable Cas proteins, and optogenetics-compatible Cas proteins.
(109) There currently exist no widely-used methods of RNA localization tracking that are compatible with living cells. FISH protocols require destruction of the cells/tissues of interest, but there is great interest in non-destructive RNA tracking in living cells. In alternative embodiments, exemplary RNA-targeted Cas9 polypeptides and RCas9 complexes as provided herein can fill this important gap.
(110) With respect to altering RNA splicing modulation, PUF protein splicing factors or 2′-O-methyl and 2′-O-2-methoxyethyl RNA oligonucleotides have drawbacks (Wang Y, Cheong C G, Hall T M, Wang Z, 2009. Engineering splicing factors with designed specificities. Nat Methods 6: 825-830). As mentioned above, there are no widely-used factors for splicing modulation due to the weaknesses of PUF proteins and oligonucleotides. In alternative embodiments, the need for improved splicing modulation for basic research and therapies can be addressed using exemplary RCas9 technology described herein.
(111) Some embodiments described herein relate to the design and application of RCas9 for RNA tracking in living cells. In some embodiments, RCas9 comprises a mutant form of Cas9 protein fused to a fluorescent protein, a single guide RNA with expression in mammalian cells driven by a U6 polymerase III promoter, and an antisense oligonucleotide composed of 2′OMe RNA and DNA bases. These components may be delivered to the cellular nucleus with transfection reagents and bind mRNA forming the RCas9 complex. The RCas9 complex is subsequently exported from the nucleus while bound to the target RNA, allowing tracking of the target mRNA localization via fluorescence microscopy. Other embodiments allow measurement of RNA abundance in the cell, or fusion of Cas9 to splicing factors or other RNA-modifying enzymes to alter RNA features for therapy or research. In some embodiments, RCas9 is delivered to the cellular nucleus and subsequently co-exported with a targeted mRNA to be localized, detected or measured.
(112) RCas9 RNA tracking has been compared herein to established methods of RNA tracking. Established methods such as fluorescence in situ hybridization require killing of the cells-of-interest, while RCas9 provided high quality RNA tracking measurements in living cells. Further, RCas9 supported tracking of RNAs as the translocated in the cytoplasm of living cells. We also demonstrate co-export of RCas9 from cellular nuclei in response to mRNA detection. By attaching a split or inactivated protein to RCas9 and localizing the other half or activating peptide to the cellular cytoplasm, we have successfully reconstituted split protein activity in response to RNA abundance.
(113) In some embodiments, RCas9 provided herein is used for tracking RNA in living cells. Current methods of RNA tracking require killing cells of interest. Many diseases feature altered RNA localization patterns and drug development will require methods to track endogenous RNAs in diseased cells and in response to drug treatment.
(114) In some embodiments, RCas9 provided herein is used for nondestructive isolation of cells based on gene expression. The RCas9 system can be used to create fluorescence readout of RNA abundance in living cells. This could allow isolation of circulating cancer cells in patient blood or from patient biopsies. These rare cells could be isolated based on their gene expression using RCas9 and be expanded and studied, allowing cancer detection long before development of tumors sufficiently large to identify with MRI or PET imaging.
(115) In some embodiments, RCas9 provided herein is used for altering RNA composition in living cells. The ability for force binding of Cas9 fused to RNA-modifying enzymes will provide a fundamental tool to the rapidly growing field of RNA metabolism and processing. The Human Genome Project has shifted its focus to studying the importance of RNA and there is a profound lack of engineering tools for studying and utilizing the consequences of RNA processing.
(116) The Streptococcus pyogenes CRISPR-Cas system has gained widespread application as a genome editing and gene regulation tool as simultaneous cellular delivery of the Cas9 protein and guide RNAs enables recognition of specific DNA sequences. As provided herein, the discovery and engineering of a Cas9 that can bind and cleave RNA in an RNA-programmable manner demonstrates the utility of exemplary systems and method as provided herein as a universal nucleic acid-recognition technology. In alternative embodiments, exemplary RNA-targeted Cas9 (RCas9) as provided herein allows identification and manipulation of RNA substrates in live cells, empowering the study of cellular gene expression, and could ultimately spawn patient- and disease-specific diagnostic and therapeutic tools. Here we describe the development of RCas9 and compare it to previous methods for RNA targeting, including engineered RNA binding proteins and other types of CRISPR-Cas systems. Provided are exemplary alternative uses ranging from live imaging of transcriptional dynamics to patient-specific therapies and applications in synthetic biology.
(117) Introduction
(118) The human genome project was completed more than a decade ago and sets the foundation for understanding the genetic basis of cell behavior in health and disease. Since then, efforts have shifted towards understanding the importance of functional genetic elements and how they affect gene expression (The ENCODE Project Consortium, 2012. An integrated encyclopedia of DNA elements in the human genome, Nature 489: 57-74). Since all cells of an individual contain largely the same DNA, the functional distinctions between cell types (a cardiomyocyte and a neuron, for instance) are closely linked to the portions of the genome that are transcriptionally active. As a result, measurement of transcribed RNA within individual cells reveals cellular identity and distinguishes healthy and disease states. For example, expression levels of a focused panel of RNA transcripts identified disease-associated aberrations in neuronal development in models of autism spectrum disorder (Pasca S P, Portmann T, Voineagu I, Yazawa M, et al. 2011. Using iPSC-derived neurons to uncover cellular phenotypes associated with Timothy syndrome, Nat Med 17; 1657-62). As another example, the expression of certain small non-coding RNAs known as microRNAs (miRs) is increasingly recognized as a characteristic signature of oncogenic transformation. Tumor microRNA signatures can serve as biomarkers informing the type of malignancy and associated clinical outcomes (Lu J, Getz G, Miska E A, Alvarez-Saavedra E. et al. 2005. MicroRNA expression profiles classify human cancers, Nature 435: 834-8; MacKenzie T A, Schwartz G N, Calderone H M, Graveel C R, et al. 2014. Stromal Expression of miR-21 Identifies High-Risk Group in Triple-Negative Breast Cancer, Am J Pathol 184: 3217-25). These studies and others make clear that tracking informative RNAs in vivo will be key to disease modeling, diagnostics and potentially therapeutics.
(119) Due to the obvious impact of expressing specific RNAs on cell state and behavior, unraveling the mechanisms that affect the processing of these RNA has become very important. Following transcription, protein-encoding RNAs undergo a series of maturation steps that include alternative splicing, nuclear export and subcellular targeting, turnover and spatiotemporally restricted translation. These steps are mediated by RNA binding proteins (RBPs) and dysfunction of these factors and their RNA targets causes disease in humans (Gerstberger S, Hafner M, Ascano M, Tuschl T. 2014. Evolutionary conservation and expression of human RNA-binding proteins and their role in human genetic disease, Adv Exp Med Biol 825: 1-55). Altered subcellular distribution of RBPs caused by gain-of-function expanded RNA elements is also becoming a common theme in human disease. For example, expansion of an intronic hexanucleotide repeat within the C9ORF72 gene was recently recognized at the most frequently mutated genetic locus among two common neurodegenerative disorders, frontotemporal lobar degeneration and amyotrophic lateral sclerosis (DeJesus-Hernandez M, Mackenzie I R, Boeve B F, Boxer A L, et. al. 2011. Expanded GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes chromosome 9p-linked FTD and ALS, Neuron 72: 245-56; Renton A E, Majounie E, Waite A, Simon-Sanchez J, et al. 2011. A hexanucleotide repeat expansion in C9ORF72 is the cause of chromosome 9p21-linked ALS-FTD, Neuron 72: 257-68). In vivo approaches to targeting the processing of endogenous RNA would open up basic biological understanding of development and disease as well as new avenues for therapies.
(120) A recent publication has raised awareness of the potential of RNA-guided RNA recognition (O'Connell M R, Oakes B L, Sternberg S H, East-Seletsky A, et al. 2014. Programmable RNA recognition and cleavage by CRISPR/Cas9, Nature 516: 263-6). Here, we focus on the potential of repurposing and engineering Cas9, the effector nuclease of the Streptcococcus pyogenes CRISPR-Cas system that has been used to recognize DNA in mammalian cells, as an RNA-programmed RNA recognition technology.
(121) Current RNA Recognition Modalities and Their Limitations
(122) The development of designer RNA recognition factors will support a variety of advances in biology and medicine. Aside from targeted modulation of RNA processing and abundance, a designer RBP could generate completely novel activities in response to RNA recognition, such as generating a signal for noninvasive detection of cell state, promoting association of signaling proteins and their substrates only in particular cell types, or even ablating cells that display particular expression profiles. This broad potential has motivated the development of designer RNA recognition factors to varying degrees of success.
(123) An ideal RNA recognition system would be capable of strong and specific binding to endogenous RNAs and display sufficient modularity for simple and predictable targeting. Inroads towards programmable RNA recognition have emerged based upon engineered natural nucleic acid binding proteins that are powerful for some applications but suffer from limited programmability, recognize too short a recognition sequence to be specific, and/or require large libraries of protein repeat sequences to target all possible RNA sequences. In contrast to direct recognition of nucleic acids by proteins, CRISPR-Cas (clustered regularly-interspaced short palindromic repeats) systems form bacterial adaptive immune systems and recognize invading nucleic acids with RNA-guided proteins.
(124) An obvious strategy is the alteration or concatenation of natural RNA-binding protein domains. The identification of canonical RNA recognition protein domains such as KH and RRM led to attempts at identifying and modulating their natural RNA targets (Beuth B, Pennell S, Arnvig K B, Martin S R, et al. 2005. Structure of a Mycobacterium tuberculosis NusA-RNA complex, EMBO J 24: 3576-87; Braddock D T, Louis J M, Baber J L, Levens D, et al. 2002. Structure and dynamics of KH domains from FBP bound to single-stranded DNA, Nature 415: 1051-6; Laird-Offringa I A, Belasco J G. 1995. Analysis of RNA-binding proteins by in vitro genetic selection: identification of an amino acid residue important for locking U1A onto its RNA target, Proc Natl Acad Sci USA 92: 11859-63). These domains bind RNA in groups of 4-5 contiguous nucleotides. As a result, libraries of more than 1000 protein domains are required to recognize all 5-base RNA sequences. In contrast, PUF proteins contain repeat domains that recognize a single RNA nucleotide each so only four repeats are in principle required to recognize all possible RNA sequences. The crystal structures of natural PUF proteins were first described in 2001 (Wang X, Zamore P D, Hall T M. 2001. Crystal structure of a Pumilio homology domain, Mol Cell 7: 855-65) and revealed recognition of specific RNA bases that is largely determined by the amino acid side chains rather than the backbone. Since their initial discovery, the RNA specificity of PUF proteins has been decoded (Filipovska A, Razif M F, Nygard K K, Rackham O. 2011. A universal code for RNA recognition by PUF proteins. Nat Chem Biol 7: 425-7) and PUFs have been designed against a variety of RNA targets (Wang Y, Cheong C G, Hall T M, Wang Z. 2009. Engineering splicing factors with designed specificities. Nat Methods 6: 825-30). Furthermore, PUFs have been successfully fused to nucleolytic domains to target and destroy disease-associated RNA (Zhang W, Wang Y, Dong S, Choudhury R, et al. 2014. Treatment of type I myotonic dystrophy by engineering site-specific RNA endonucleases that target (CUG)(n) repeats. Molecular therapy: J Am Soc Gene Ther 22: 312-20). However, PUF proteins can only recognize 8 contiguous bases and local secondary structures can have a strong influence on RNA affinity, thus limiting their utility (Zhang W, Wang Y, Dong S, Choudhury R, et al. 2014. Treatment of type 1 myotonic dystrophy by engineering site-specific RNA endonucleases that target (CUG)(n) repeats. Molecular therapy: J Am Soc Gene Ther 22: 312-20).
(125) Cas9 for RNA-Guided Nucleic Acid Recognition
(126) While PUF, KH, and RRM proteins rely upon protein-RNA interactions to recognize RNA, nucleic acid base-pairing represents a simpler means of RNA recognition. The CRISPR-Cas bacterial immune system utilizes RNA-mediated base-pairing to recognize DNA, and has been successfully repurposed to target DNA in mammalian cells (Mali P, Yang L H, Esvelt K M, Aach J, et al. 2013. RNA-Guided Hutnan Genome Engineering via Cas9. Science 339: 823-6; Cho S W, Kim S, Kim J M, Kim J S. 2013. Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol 31: 230-2; Hwang W Y, Fu Y F, Reyon D, Maeder M L. et al. 2013. Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol 31: 227-9; Jinek M, East A, Cheng A, Lin S. et al. 2013. RNA-programmed genome editing in human cells. eLife 2: e00471). In bacteria and archaea, CRISPR-Cas forms the functional core of adaptive immune systems that are typically composed of a nuclease associated with a pair of RNAs called the trans-activating CRISPR RNA (tracrRNA) and CRIPSR RNA (crRNA). The tracrRNA and crRNA guide the CRISPR nuclease to invading plasmid or bacteriophage DNA by base-pairing for cleavage by the nuclease (
(127) RNA-targeted Cas9 (RCas9) is the subject of recent work from the Doudna lab that demonstrates strong and specific binding and subsequent cleavage of ssRNA by Cas9 in vitro. In
(128) O'Connell and Oakes et al. also demonstrated that a 5′ extension of the PAMmer beyond the PAM motif is required to generate specific RNA recognition programmed by the sgRNA. Shorter PAMmers lacking this extension promote Cas9:sgRNA binding that is independent of sgRNA sequence, but the sequence specificity of sgRNA-programmed RNA recognition is reconstituted by an extension of the PAMmer. This effect may be due to the energetic cost of Cas9-mediated unwinding of the PAMmer-RNA target duplex which is recovered only when the sgRNA hybridizes its target. Since the sgRNA is encodable and small (˜100 bases), there is potential to generate large libraries of sgRNAs to target particular gene networks or screen the transcriptome. In contrast, the size of engineered RNA recognition proteins does not easily support large-scale screens. Although the cost associated with producing and distributing large libraries of modified oligonucleotide PAMmers will be an obstacle to work at this scale, future developments may allow the use of minimally modified oligonucleotides and leverage low-cost, high-throughput oligonucleotide synthesis technologies.
(129) The aforementioned study was conducted exclusively in vitro and the strength and specificity of RNA-targeting Cas9 (RCas9) inside living cells or organisms is not yet known. Analogous to recent measurement of CRISPR-Cas off-target activities on genomic DNA (Cencic R, Miura H, Malina A, Robert F, et al. 2014. Protospacer adjacent motif (PAM)-distal sequences engage CRISPR Cas9 DNA target cleavage. PLoS One 9: e109213; Kuscu C, Arslan S, Singh R, Thorpe J, et al. 2014. Genome-wide analysis reveals characteristics of off-target sites bound by the Cas9 endonuclease. Nat Biotechnol 32: 677-83), extensive validation of the RCas9 binding specificity will be required in order to evaluate its potential as an intracellular, RNA-programmable RNA-binding protein. Along with its well-known ability to target DNA, the comprehensive ability of the S. pyogenes CRISPR-Cas system to target nucleic acids is now being established. The Information Box highlights major challenges that must be overcome for RCas9 to be applicable in vivo.
(130) Information Box: In Vivo Applications of RCas9
(131) An evaluation of the potential of RCas9 for RNA targeting in living organisms naturally begins by examining reported in vivo applications of Cas9 for genome editing. Delivery of Cas9 and the cognate sgRNA have been achieved by various means, including the use of viruses that encode Cas9 and the sgRNA (Swiech L, Heidenreich M, Banerjee A, Habib N, et al. 2015. In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9. Nature Biotechnol 33: 102-6; Maddalo D, Manchado E, Concepcion C P, Bonetti C, et al. 2014. In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system. Nature 516: 423-7), transgenic animals that allow drug-inducible expression of Cas9 (Dow L E, Fisher J, O'Rourke K P, Muley A. et al. 2015. Inducible in vivo genome editing with CRISPR-Cas9. Nature Biotechnol doi:10.1038/nbt.3155), and delivery of Cas9 protein and sgRNA via anionic fusion proteins and cationic lipids (Zuris J A, Thompson D B, Shu Y, Guilinger J P, et al. 2015. Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo. Nature Biotechnol 33: 73-80). Modulation of RNA splicing by RCas9 via targeting of a splicing factor fused to Cas9 to a pre-mRNA of interest, for instance, could be conducted in the central nervous system with an appropriately serotyped adenovirus. Splicing modulation in other tissues could be achieved with drug-inducible and tissue-specific expression of Cas9 and its sgRNA. But in all cases, an efficient means to deliver the RCas9 PAMmer to the appropriate tissues must be identified. By limiting the expression or delivery of either Cas9 or the sgRNA to the tissue of interest and conducting systemic administration of the PAMmer, it may be possible to achieve tissue-specific RCas9 activity. Highly stable modified oligonucleotides such as 2′-O-(2-methoxyethyl)-RNA have supported effective delivery and targeting of antisense RNAs in vivo (Meng L, Ward A J, Chun S, Bennett C F, et al. 2015. Towards a therapy for Angelman syndrome by targeting a long non-coding RNA. Nature 518: 409-12; Hua Y, Sahashi K, Hung G, Rigo F, et al. 2010. Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes Dev 24: 1634-44; Passini M A, Bu J, Richards A M, Kinnecom C, et al. 2011. Antisense oligonucleotides delivered to the mouse CNS ameliorate symptoms of severe spinal muscular atrophy. Science Transl Med 3: 72ra18) and may prove useful in the RCas9 system as well. Thus, while these and similar approaches have been used to deliver one or two components of the RCas9 system in vivo, it remains to be seen which combination allows effective reconstitution of all three components. Further modifications in the PAMmer will be required to prevent destruction of the target RNA due to recognition by RNAse H, the cellular enzyme that degrades RNA in RNA-DNA hybrids. Careful adjustment of the PAMmer length and modifications will be important to maintain targeting specificity while avoiding recruitment of the RNAi machinery. Although RCas9 does not appear to cleave DNA in vitro, it remains to be seen if inadvertent DNA targeting may occur in vivo. Ultimately, the success of RCas9 in vivo will ultimately rely on its specificity and whether RCas9 destabilizes the target RNA or interferes with its translation.
(132) Modulating Post-Transcriptional Gene Expression
(133) Exemplary RCas9 polypeptides as provided herein utilize the inherent endonucleolytic activity of Cas9 to attenuate gene expression via cleavage of particular transcripts (
(134) TABLE-US-00001 TABLE 1 Summary of exemplary RCas9 applications RCas9-based Main area of Application State of the art Limitations approach innovation Targeted RNA siRNA, antisense Efficiency limited Natural nucleolytic Strong binding of Cas9 knockdown oligonucleotides. by access to RNA activity of Cas9. to target RNA may (FIG. 2A) silencing allow better machinery and knockdown efficiency; dependence on may allow knockdown RNA structure. in compartments lacking RNAi machinery. RNA Coding region of Requires targeted dCas9 fused to RNA Potential first means to stabilization GOI placed within genetic stabilizing factor. stabilize any unlabeled (FIG. 2B) stabilizing UTR manipulation or RNA. contexts; exogenous expression of GOI. RNA localization Cis-acting sequence Requires targeted dCas9 fused to RNA. The high affinity of alteration tags incorporated genetic trafficking protein. RCas9 for RNA could (FIG. 2C) into transcript; these manipulation or enable control of recruit tagged exogenous endogenous RNA exogenous or expression of GOI. localization. endogenous localization factors. RNA splicing PUF proteins fused PDFs limited to 8 dCas9 fused to Potentially more alteration to splicing factors or base recognition splicing factor specific alteration of (FIG. 2D) splicing factor sequences, targeted adjacent to splicing allowing either access blocked with oligonucleotides or inside exons. gain- or loss-of-function. antisense limited to splicing oligonucleotides. factor loss-of-function. Imaging of RNA MS2 or Spinach Requires dCas9 fused to May be effective localization labeling of RNA in modification of fluorescent protein means of revealing (FIG. 2E) conjunction with target RNA. or split fluorescent localization of any MS2-GFP protein or protein. unlabeled RNA. Spinach fluorophore. Time-resolved Incorporation of Requires genetic dCas9 fused to split May be first means for RNA fluorescent or modification. fluorescent or time-resolved gene measurements luminescent reporter luminescent protein. expression (FIG. 2E) at genomic locus measurement without near GOI. genetic modification. Isolation of rare Identification of Requires known dCas9 fused to split There are currently no cells based on surface markers and surface marker for fluorescent protein. high-sensitivity means gene expression antibodies for FACS. cell type of interest. to measure RNA (FIG. 2F) content in live cells. Death induction Incorporation of Requires genetic dCas9 fused to split Potentially first means based in toxic protein at modification, toxic protein. to programmably target response to genomic locus near limited therapeutic RNA profiles for death gene expression GOI. potential. induction. (FIG. 2G) Substrate Fusion of enzymes Results in dCas9 fused to First means to control shuttling or incorporation of constitutive members of substrate shuttling protein/protein substrate shuttling. synthetic pathway based upon RNA interaction partners targeting adjacent abundance. to create enzyme sites on an RNA. concatemers.
(135) TABLE-US-00002 TABLE 2 Comparison of RNAi and exemplary RCas9 for gene knockdown RNA RCas9 Specificity Specificity determined by at most ~21RNA Target recognized by both 20 nucleotids within nucleotides the sgRNA and the 20+ nucleotide PAMmer. Components Engages endogenous RNA-induced Requires delivery of Cas9 protein, sgRNA, and silencing complex (RISC); requires delivery PAMmer oligonucleotide. of siRNA only. Localization RISC mainly cytoplasmic; targeting nuclear RCas9 potentially active in both nucleus and RNAs difficult. cytoplasm. Influence of Efficiency dependent on RNA accessibility Cas9's helicase activity may allow recognition of RNA structure and structure. structured RNA sequences.
(136) Effective ways to enhance rather than decrease gene expression have been elusive. In alternative embodiments, by fusing Cas9 to a factor that stabilizes mature messenger RNAs, compositions and methods provided herein enhance protein production from particular transcripts (
(137) Another means by which cells control gene product activity is through the localization of RNA. In neurons, cell somata can be separated from synapses by centimeters or more, which presents a challenge to accumulating synaptic proteins at sufficient concentrations. After export from the nucleus, mRNAs involved in synaptic structure and activity such as postsynaptic density protein 95 (PSD-95) (Muddashetty R S, Nalavadi V C, Gross C, Yao X, et al. 2011. Reversible inhibition of PSD-95 mRNA translation by miR-125a, FMRP phosphorylation, and mGluR signaling. Mol Cell 42: 673-88) are transported through dendrites where they are translated near their site of action (
(138) In alternative embodiments, exemplary RCas9 is used to alter the composition of RNAs. Pre-mRNA splicing is a vital step in mRNA biogenesis and tethering of splicing factors to the pre-mRNA has been shown to alter the inclusion or exclusion of sequences (Graveley B R, Maniatis T. 1998. Arginine/serine-rich domains of SR proteins can function as activators of pre-mRNA splicing. Mol Cell 1: 765-71). For instance, the splicing factor RBFOX2 has been shown to influence inclusion of exons depending on whether it binds up or downstream of alternative exons (Lovei M T, Ghanem D, Marr H, Arnold J, et al. 2013. Rbfox proteins regulate alternative mRNA splicing through evolutionarily conserved RNA bridges. Nat Struct Mol Biol 20: 1434-42; Weyn-Varthentenryck S M, Mele A, Yan Q, Sun S, et al. 2014. HITS-CLIP and integrative modeling define the Rbfox splicing-regulatory network linked to brain development and autism. Cell Rep 6: 1139-52; Yeo G W, Coufal N G, Liang T Y, Peng G E, et al. 2009. An RNA code for the FOX2 splicing regulator revealed by mapping RNA-protein interactions in stem cells. Nat Struct Mol Biol 16; 130-7). In alternative embodiments, by carefully choosing splicing factors and fusing them to exemplary Cas9, it may be possible to create designer splicing factors whose influence on splice site choice can be determined by RCas9 sequence binding. For instance, spinal muscular atrophy is caused by deletion of the gene SMN1 resulting in neuron death, but there is evidence that forced alteration of SMN2 splicing in SMN1-deficient cells can produce a SMN2 isoform that reconstitutes the activity of SMN1 (Hua Y, Vickers T A, Okunola H L, Bennett C F, et al. 2008. Antisense masking of an hnRNP A1/A2 intronic splicing silencer corrects SMN2 splicing in transgenic mice. Am J Hum Genet 82: 834-48). In alternative embodiments, this type of targeted splicing alteration is used in compositions and methods as provided herein to reverse a variety of diseases caused by aberrant splicing (Nissim-Rafinia M, Kerem B. 2002. Splicing regulation as a potential genetic modifier. Trends Genet 18: 123-7).
(139) These are just a few examples of exemplary RCas9's as provided herein to modulate cellular RNA composition and cell behavior. In alternative embodiments, as universal nucleic acid-recognitions proteins, Cas proteins as provided herein allow targeting of particular RNAs genomic loci. For instance, long non-coding RNAs (lncRNAs) can recognize particular genomic loci and guide associated chromatin-modifying factors to dramatic effect on genome organization (Geisler S, Coller J. 2013. RNA in unexpected places: long non-coding RNA functions in diverse cellular contexts. Nat Rev Mol Cell Biol 14: 699-712). In alternative embodiments, exemplary RCas9 is fused to another Cas protein that utilizes an orthogonal sgRNA could be used to alter genome organization in a similar manner. By bringing targeted RNA in close proximity to a genomic locus of choice, this DNA- and RNA-binding Cas fusion can support studies of the function of lncRNAs in any genomic context. In alternative embodiments, the use of multiple Cas proteins with orthogonal sgRNAs also allows simultaneous and distinct alteration of multiple RNAs for instance by utilizing both nuclease-null and active Cas proteins. In alternative embodiments, However, it is currently unclear whether other Cas proteins are capable of RNA recognition, so it remains to be seen if RCas9 can target multiple RNAs simultaneously (Esvelt K M, Mali P, Braff J L, Moosburner M, et al. 2013. Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods 10: 1116-21).
(140) Imaging Applications
(141) Several RNA recognition tools developed recently have enabled imaging of specific RNA species in live cells but suffer from several shortcomings (see (Rath A K, Rentmeister A. 2014. Genetically encoded tools for RNA imaging in living cells. Curr Opin Biotechnol 31C; 42-9) for an excellent review). In a manner analogous to visualizing proteins through fusion with fluorescent proteins, a set of RNA-based systems that rely on sequence tags incorporated in the RNA of interest can allow RNA visualization. These tags are specifically recognized by a protein moiety that binds strongly and specifically to the RNA tag. One popular approach utilizes bacteriophage MS2 coat protein (MCP) fused to a fluorescent protein (Bertrand E, Chartrand P, Schaefer M, Shenoy S M, et al. 1998. Localization of ASH1 mRNA particles in living yeast. Mol Cell 2: 437-45) recognizing a short RNA structural motif (a so-called ‘hairpin’). The low signal-to-noise ratio due to background fluorescence from unbound probe can be improved by incorporating long arrays of tandemly repeated recognition elements, an approach that has allowed effective imaging of highly abundant RNAs in live cells (Park H Y, Lim H, Yoon Y J, Follenzi A, et al. 2014. Visualization of dynamics of single endogenous mRNA labeled in live mouse. Science 343: 422-4), but there is concern that such large tags can significantly perturb typical RNA behavior. An alternative approach is the incorporation of artificial RNA sequence tags that are bound by an exogenous small molecule fluorophore (Paige J S, Wu K Y, Jaffrey S R. 2011. RNA mimics of green fluorescent protein. Science 333: 642-6; Strack R L, Disney M D, Jaffrey S R. 2013. A superfolding Spinach2 reveals the dynamic nature of trinucleotide repeat-containing RNA. Nat Methods 10: 1219-24). By immobilizing the fluorophore in this aptamer tag, fluorescence signal can be generated by increasing quantum yield, separating a fluorophore-quencher pair, or by FRET (Paige J S, Wu K Y, Jaffrey S R. 2011. RNA mimics of green fluorescent protein. Science 333: 642-6; Shrack R L, Disney M D, Jaffrey S R. 2013. A superfolding Spinach2 reveals the dynamic nature of trinucleotide repeat-containing RNA. Nat Methods 10: 1219-24; Sunbul M, Jaschke A. 2013. Contact-mediated quenching for RNA imaging in bacteria with a fluorophore-binding aptamer. Angew Chem Int Ed Engl 52: 13401-4; Shin I, Ray J, Gupta V, Ilgu M, et al. 2014. Live-cell imaging of Pol II promoter activity to monitor gene expression with RNA IMAGEtag reporters. Nucleic Acids Res 42; e90). A third approach to suppress background fluorescence is the expression of two polypeptides that reconstitute a functional fluorescent protein when recruited to an RNA target by taking advantage of natural or artificial RNA binding domains (Rackham O, Brown C M. 2004. Visualization of RNA-protein interactions in living cells: FMRP and IMP1 interact on mRNAs. EMBO J 23: 3346-55). While all three methods have been tremendously useful and are widely used to study dynamics of RNA transport and localization, they require a tagged version of the RNA of interest either through genetic modification of the endogenous locus or by forced expression of an exogenous tagged version of the RNA. To illustrate, cells derived from a knock-in mouse harboring 24 MS2 hairpins in the 3′-untranslated region (UTR) of the beta-actin gene allowed the real time visualization of transcription from the modified allele, including the observation of transcriptional bursting upon serum stimulation (Lionnet T, Czaplinski K, Darzacq X, Shav-Tal Y, et al. 2011. A transgenic mouse for in vivo detection of endogenous labeled mRNA. Nature Methods 8: 165-70). However, the MCP-GFP fusion proteins need to be delivered to cells exogenously and this system is limited to only highly expressed RNAs. Furthermore, incomplete occupation of the MS2 hairpins reduces local signal and generates significant background noise due to unbound probe (Fusco D, Accornero N, Lavoie B, Shenoy S M, et al. 2003. Single mRNA molecules demonstrate probabilistic movement in living mammalian cells. Curr Biol: 13: 161-7). Another technology, molecular beacons, allows imaging of unmodified transcripts but suffer from high noise and cumbersome delivery (Tyagi S, Kramer F R. 1996. Molecular beacons: Probes that fluoresce upon hybridization. Nat Biotechnol 14: 303-8). RCas9 may circumvent these issues by allowing direct recognition of untagged RNAs with high specificity and low noise.
(142) Exemplary alternative RCas9 applications as provided herein allow visualization of the abundance and/or localization of one or more endogenous RNAs simultaneously. By fusing an exemplary nuclease-null Cas9 to a fluorescent protein, it could be possible to visualize the localization of particular RNAs or RNA splice variants. In alternative embodiments, a pair of exemplary Cas9 proteins is fused to halves of split fluorescent protein such as Venus (Ozawa T, Natori Y, Sato M, Umezawa Y. 2007. Imaging dynamics of endogenous mitochondrial RNA in single living cells. Nat Methods 4: 413-9) and targeted to adjacent sites on an RNA (
(143) In alternative embodiments, provided are applications of compositions and methods for endogenous RNA localization and abundance measurements in live cells. For example, characterization of somatic stem cells remains difficult because few surface markers exist for cell sorting-based identification and purification of these rare cells. Gene expression profiling remains the most effective way to identify rare cell types and in alternative embodiments, exemplary RCas9 as provided herein enables this type of nondestructive measurement so that rare cells can be preserved, expanded, and studied in isolation.
(144) In alternative embodiments, provided are compositors and methods for RNA localization, which is important in cellular response to injury, stress, and some behaviors that promote cell polarity such as extension of neuronal processes. Stress granules are a type of RNA and protein cluster that sequester mRNA and protein and typically form in response to oxidative stress, heat, viral infection, or hypoxia (Kedersha N, Anderson P. 2007. Mammalian stress granules and processing bodies. Methods Enzymol 431: 61-81). Aberrant formation of RNA granules is implicated in many diseases, but the RNA components of these structures are only beginning to be described. In alternative embodiments, compositions and methods provided herein can image endogenous RNA trafficking to stress granules and support investigation of stress granule roles in health and disease. In order to understand the importance of RNA granules in disease, exemplary RCas9 can be used for time-resolved measurements of granule formation in response to stress, disease, or in drug screens where RNA localization may play a role in disease progression or regeneration of damaged tissues.
(145) Synthetic Biology Applications
(146) Provided herein are methods and compositions having industrial, clinical, and other technological utility. Like all engineering-oriented disciplines, provided herein are modularized, flexible platforms that can be tuned for diverse applications. The highly modular and programmable nature of exemplary RCas9 systems as provided herein can be used as a platform technology in synthetic biology. For example, in alternative embodiments, split enzymes are fused to Cas9 proteins whose activity is reconstituted upon binding to a target RNA such as complementation of split death-inducing proteins after detection of a cancer-linked RNA (
(147) Conclusions, General Concerns and Alternative Approaches
(148) Progress in RNA targeting methods from their beginnings, when RBP domains were adapted to serve as sequence specificity determinants, to RCas9, with its target recognition by simple nucleic acid hybridization, is poised to closely parallel the development of DNA targeting technology. Here, zinc finger and TAL effector nucleases have recently given way to DNA recognition by the Cas9-bound sgRNA. While for DNA targeting applications, Cas9 and its sgRNA are sufficiently stable and nontoxic in mammalian cells, it remains to be seen whether all three components of the RCas9 system (Cas9, sgRNA, and PAMmer) can be delivered efficiently and, if so, successfully cooperate to bind target RNA. Alternative approaches to RNA-programmed RNA recognition are on the horizon. Type III-B CRISPR-Cas systems are known to target and cleave RNA as part of their normal activities in bacterial immunity. The effector complexes of these CRISPR systems from Thermus thermophilus (Staals R H, Zhu Y, Taylor D W, Kornfeld J E, et al. 2014. RNA Targeting by the Type III-A CRISPR-Cas Csm Complex of Thermus thermophilus. Mol Cell 56: 518-30) and Pyrococcus furiosus (Yeo G W, Coufal N G, Liang T Y, Peng G E, et al. 2009. An RNA code for the FOX2 splicing regulator revealed by mapping RNA-protein interactions in stem cells. Nat Struct Mol Biol 16: 130-7) have been characterized in detail and their nucleolytic activities reconstituted in vitro. While the natural ability of these complexes to recognize RNA is appealing, each complex is composed of 1-4 copies of six different proteins, which could pose challenges for its reconstitution in vivo. Cas9 from Francisella novicida targets a particular endogenous RNA in this organism in a RNA-guided manner, although the flexibility of this system to target chosen RNAs remains unclear (Sampson T R, Saroj S D, Llewellyn A C, Tzeng Y L, et al. 2013. A CRISPR/Cas system mediates bacterial innate immune evasion and virulence. Nature 497: 254-7).
(149) In alternative embodiments, exemplary RCas9 polypeptides recognize untagged, endogenous RNA via simple base-pairing, and this represents a major advance in RNA targeting and is particularly critical in diagnostic or therapeutic applications. In alternative embodiments, exemplary RCas9 polypeptides and systems as provided herein are delivered efficiently to cells, cooperate to recognize RNA, with minimal unwanted destabilization or alteration of target RNA while also avoiding targeting of genomic DNA and off-target transcripts, and thereby provide new applications of RCas9 in basic and applied biology and in medicine.
(150) Data provided herein demonstrates that exemplary RCas9 polypeptides and systems as provided herein are effective for nucleic acid-programmed recognition and tracking of untagged mRNA localization in living cells by CRISPR/Cas9.
(151) Summary
(152) In alternative embodiments, provided herein are RCas9 polypeptides and systems for RNA-programmed genome editing using CRISPR/Cas9 from Streptococcus pyogenes has enabled rapid and accessible alteration of genomic loci in a variety of organisms. In alternative embodiments, provided herein are flexible means to target RNA to allow alteration and imaging of endogenous RNA transcripts analogous to CRISPR/Cas-based genomic tools, but most RNA tracking methods rely on incorporation of exogenous tags. Here we demonstrate that exemplary nuclease-inactive S. pyogenes CRISPR/Cas9 can bind RNA in a nucleic acid-programmed manner and allow endogenous RNA tracking in living cells. We show that nuclear-localized RNA-targeting Cas9 (RCas9) is exported to the cytoplasm only in the presence of sgRNAs targeting mRNAs with distributions that correlate well with fluorescence in situ hybridization imaging. We also demonstrate time-resolved measurements of β-actin mRNA trafficking to stress granules. Our results establish the exemplary RCas9 as provided herein can be used to bind and track RNA in living cells in a programmable manner without the requirement of genetically encoded tags.
(153) Introduction
(154) Clustered Regularly-Interspaced Palindromic Repeats (CRISPRs) form the basis of adaptive immune systems in bacteria and archaea by encoding CRISPR RNAs that guide CRISPR-associated (Cas) nucleases to invading genetic material (Wiedenheft B., Sternberg, S. H., and Doudna, J. A. (2012). RNA-guided genetic silencing systems in bacteria and archaea. Nature 482, 331-338). Cas9 from the type II CRISPR system of S. pyogenes has been repurposed for genome engineering in eukaryotic organisms (Hwang, W. Y., Fu, Y., Reyon, D., Maeder, M. L., Tsai, S. Q., Sander, J. D., Peterson, R. T., Yeh, J. R., and Joung, J. K. (2013). Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol 31, 227-229; Li, D., Qiu, Z., Shao, Y., Chen, Y., Guan, Y., Liu, M., Li, Y., Gao, N., Wang, L., Lu, X., et al. (2013a). Heritable gene targeting in the mouse and rat using a CRISPR-Cas system. Nat Biotechnol 31, 681-683; Nakayama, T., Fish, M. B., Fisher, M., Oomen-Hajagos, J., Thomsen, G. H., and Grainger, R. M. (2013). Simple and efficient CRISPR/Cas9-mediated targeted mutagenesis in Xenopus tropicalis. Genesis 51, 835-843; Sander, J. D., and Joung, J. K. (2014). CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. 32, 347-355; Yang, D., Xu, J., Zhu, T., Fan, J., Lai, L., Zhang, J., and Chen, Y. E. (2014). Effective gene targeting in rabbits using RNA-guided Cas9 nucleases. J Mol Cell Biol 6, 97-99) and is rapidly proving to be an efficient means of DNA targeting for other applications such as gene expression modulation (Qi, L. S., Larson, M. H., Gilbert, L. A., Doudna, J. A., Weissman, J. S., Arkin, A. P., and Lim, W. A. (2013). Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell. I52, 1173-1183) and imaging (Chen, B., Gilbert, L. A., Cimini, B. A., Schnitzbauer, J., Zhang, W., Li, G. W., Park, J., Blackburn, E. H., Weissman, J. S., Qi, L. S., et al. (2013). Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 155, 1479-1491). Cas9 and its associated single guide RNA (sgRNA) require two critical features to target DNA: a short DNA sequence of the form 5′-NGG-3′ (where ‘N’=any nucleotide) known as the protospacer adjacent motif (PAM) and an adjacent sequence on the opposite DNA strand that is antisense to the sgRNA. By supporting DNA recognition with specificity determined entirely by a short spacer sequence within the sgRNA, CRISPR/Cas9 provides uniquely flexible and accessible manipulation of the genome. Manipulating cellular RNA content, in contrast, remains problematic. While there exist robust means of attenuating gene expression via RNA interference and antisense oligonucleotides, other critical aspects of post-transcriptional gene expression regulation such as alternative splicing, subcellular trafficking, and spatiotemporally-restricted translation are largely intractable.
(155) Analogous to the assembly of zinc finger nucleases (Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., and Gregory, P. D. (2010). Genome editing with engineered zinc finger nucleases. Nat Rev Genet 11, 636-646) and transcription activator-like effector nucleases (TALEN) to recognize specific DNA sequences, efforts to recognize specific RNA sequences have focused on engineering RNA binding domains. For instance, the Pumilio and FBF homology (PUF) proteins carry well-defined modules capable of recognizing a single base each. However each module must be redesigned and validated for each RNA target and at most can only recognize 8 contiguous bases, which limits their utility for recognizing RNA substrates uniquely in the transcriptome. An alternative approach to recruiting proteins to specific RNA substrates is to introduce RNA aptamers into target RNAs, enabling specific and strong association of cognate aptamer binding proteins such as the MS2 coat protein (Fouts, D. E., True, H. L., and Celander, D. W. (1997). Functional recognition of fragmented operator sites by R17/MS2 coat protein, a translational repressor. Nucleic Acids Res 25, 4464-4473). This approach has enabled tracking RNA localization in living cells over time with high sensitivity (Buxbaum, A. R., Wu, B., and Singer, R. H. (2014). Single beta-actin mRNA detection in neurons reveals a mechanism for regulating its translatability. Science 343, 419-422) but relies upon laborious genetic manipulation of the target RNA in cells and is not suitable for recognition of arbitrary RNA sequences. Analogous to CRISPR/Cas9-based recognition of DNA, programmable RNA recognition based on nucleic acid specificity alone without the need for genetic manipulation or libraries of RNA binding proteins would greatly expand researchers' ability to modify the mammalian transcriptome and enable transcriptome engineering.
(156) Although the CRISPR/Cas9 system has evolved to recognize double-stranded DNA, recent in vitro work has demonstrated that programmable targeting of RNAs with Cas9 is possible by providing the PAM as part of an exogenously added oligonucleotide (PAMmer) that hybridizes to the target RNA (O'Connell, M. R., Oakes, B. L., Sternberg, S. H., East-Seletsky, A., Kaplan, M., and Doudna, J. A. (2014). Programmable RNA recognition and cleavage by CRISPR/Cas9. Nature 516, 263-266). By taking advantage of the Cas9 target search mechanism that relies on PAM sequences (Sternberg, S. H., Redding, S., Jinek, M., Greene, E. C., and Doudna, J. A. (2014). DNA interrogation by the CRISPR RNA-guided endonuclease Cas9, Nature 507, 62-67), a mismatched PAM sequence in the PAMmer/RNA hybrid allows exclusive targeting of RNA and not the encoding DNA. The high affinity and specificity of RNA recognition by Cas9 in cell-free extracts and the success of genome targeting with Cas9 indicate the potential of CRISPR/Cas9 to support programmable RNA targeting in living cells.
(157) To assess the potential of CRISPR/Cas9 to act as a programmable RNA binding protein in living cells, we measured the degree of nuclear expert of a nuclear localization signal-tagged nuclease-deficient Cas9-GFP fusion. We demonstrate that the sgRNA alone is sufficient to promote nuclear export of the Cas9 fusion without influencing the abundance of the targeted mRNA or abundance of protein encoded by the targeted mRNA. In order to evaluate whether RNA-targeted Cas9 (RCas9) signal patterns correspond with an established untagged RNA labeling method, we compared distributions of RCas9 and fluorescence in situ hybridization (FISH) targeting β-actin mRNA. We observed high correlation among FISH and RCas9 colocalization that was dependent on the presence of a PAMmer, indicating the importance of the PAM for efficient RNA targeting. In contrast to established untagged RNA localization measurements such as FISH, RCas9 supports temporally-resolved measurements of RNA localization. We demonstrate this capability by tracking β-actin localization to oxidative stress-induced RNA/protein accumulations called stress granules. This work establishes the ability of RCas9 to bind RNA in living cells and sets the foundation for manipulation of the transcriptome in addition to the genome by CRISPR/Cas9.
EXAMPLES
Example 1: RNA-Targeted Cas9 Export from Nucleus in Presence of sgRNA Targeting GAPDH mRNA
(158) As an initial assessment of the ability of RCas9 to recognize specific mRNA substrates in human cells, we tested if enhanced GFP (EGFP)-tagged Cas9 containing a nuclear localization signal can be co-exported from the nucleus with an mRNA in the presence of a cognate sgRNA and PAMmer designed to recognize that mRNA (
(159) TABLE-US-00003 TABLE 3 RNA target sequences PAMmer target underlined, sgRNA Target target bold GAPDH mRNA CACAAGAGGAAGAGAGAGACCCTCACTGCTGGGG 3′UTR AGTCC (SEQ ID NO: 5) β-actin mRNA GAAGGTGACAGCAGTCGGTTGGAGCGAGCATCCC 3′UTR CCAAA (SEQ ID NO: 6) λ2 GCTCAATTTTGACAGCGGTCATGGCATTCCACTT bacteriophage ATCAC (SEQ ID NO: 7)
(160) TABLE-US-00004 TABLE 4 PAMmer (PAM in bold) and sgRNA (spacer in bold) sequences PAMmer, β-actin 3′UTR mUCmGCmUCmCAmUGGmGAmCTmGCmUGmUCmACmCTmUC (SEQ ID NO: 8) sgRNA, β-actin 3′UTR GTTTGGGGGATGCTCGCTCCAGTTTAAGAGCTATGCTGGAAACAGCATA GCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCG AGTCGGTGCTTTTTTT (SEQ ID NO: 9) PAMmer, GAPDH 3′UTR mAGmUGmAGmGGmCGGmCTmCTmCTmUCmCTmCTmUGmUG (SEQ ID NO: 10) sgRNA, GAPDH 3′UTR GGACTCCCCAGCAGTGAGGGGTTTAAGAGCTATGCTGGAAACAGCATAG CAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGA GTCGGTGCTTTTTTT (SEQ ID NO: 11) PAMmer, mATmGCmCAmUGmUGGmGCmUGmUCmAAmAAmUTmGAmGc λ2 bacteriophage (SEQ ID NO: 12) sgRNA, GTGATAAGTGGAATGCCATGGTTTAAGAGCTATGCTGGAAACAGCATAG λ2 bacteriophage CAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGA GTCGGTGCTTTTTTT (SEQ ID NO: 13)
Example 2: Recognition of an mRNA with RNA-Targeted Cas9 does not Alter RNA Translation or Stability
(161) To further characterize the interaction between RCas9 and a target mRNA, we directed RCas9 to the 3′ untranslated region (UTR) of Renilla luciferase carrying a commonly-used RNA tag for RNA tracking from the MS2 bacteriophage (Fouts, D. E., True, H. L., and Celander, D. W. (1997). Functional recognition of fragmented operator sites by R17/MS2 coat protein, a translational repressor, Nucleic Acids Res 25, 4464-4473) and a sequence targeted by a previously validated sgRNA:PAMmer pair (O'Connell, M. R., Oakes, B. L., Sternberg, S. H., East-Seletsky, A., Kaplan, M., and Dondna, J. A. (2014). Programmable RNA recognition and cleavage by CRISPR/Cas9. Nature 516, 263-266) (
Example 3: RNA-Targeted Cas9 Signal Distributions Correlate with an Established Untagged RNA Localization Determination Method
(162) To assess whether RCas9 signal distributions correlate with an orthogonal method to measure RNA localization, we targeted the 3′UTR of β-actin (“+” sgRNA and “+” PAMmer) and compared dCas9-2xNLS-mCherry signal to RNA fluorescence in situ hybridization (FISH) for β-actin mRNA (
Example. 4: Tracking RNA Trafficking to Stress Granules Over Time
(163) In addition to promoting local translation, trafficking of mRNA can also influence temporal programming of protein production (Buchan, J. R., and Parker, R. (2009). Eukaryotic stress granules: the ins and outs of translation. Mol Cell 36, 932-941). We therefore determined whether RCas9 supports tracking of mRNA to protein-RNA aggregates known as stress granules. Stress granules are translationally-silent protein and RNA accumulations that can form aberrantly and may influence disease progression in the nervous system (Li, Y. R., King, O. D., Shorter, J., and Gitler, A. D. (2013b). Stress granules as crucibles of ALS pathogenesis. J Cell Biol 201, 361-372) but there are limited means that can track the movement of endogenous RNA to these structures in live cells (Bertrand, E., Chartrand, P., Schaefer, M., Shenoy, S. M., Singer, R. H., and Long, R. M. (1998). Localization of ASH1 mRNA particles in living yeast. Mol Cell 2, 437-445). As β-actin mRNA is known to localize to stress granules (Unsworth, H., Raguz, S., Edwards, H. J., Higgins, C. F., and Yague, E. (2010). mRNA escape from stress granule sequestration is dictated by localization to the endoplasmic reticulum. FASEB J 24, 3370-3380) during oxidative stress, we simultaneously tracked β-actin mRNA using RCas9 and mCherry-fused to the Ras GTPase-activating protein-binding protein 1 (G3BP1) protein, a well-described marker for stress granules (Tourriere, H., Chebli, K., Zekri, L., Courselaud, B., Blanchard, J. M., Bertrand, E., and Tazi, J. (2003). The RasGAP-associated endoribonuclease G3BP assembles stress granules. J Cell Biol 160, 823-831). After application of sodium arsenite to induce cellular stress, wee observed accumulation of RCas9 signal to G3BP1-positive foci only in the presence of the RCas9 system targeting β-actin mRNA and not in the presence of non-targeting sgRNA and PAMmer (
(164) Discussion
(165) This work demonstrates, to our knowledge, the first proof-of-principle that RCas9 can be utilized in living cells to bind target RNAs such as mRNAs with specificity determined entirely by simply-programmed sgRNA and PAMmers. In alternative embodiments, provided are RCas9 polypeptides and systems (complexes) that support the recognition of RNA sequences that are long enough for unique discrimination in the transcriptome which contrasts with engineered RNA-binding proteins such as PUF proteins (Cheong, C. G., and Hall, T. M. (2006). Engineering RNA sequence specificity of Pumilio repeats. Proc Natl Acad Sci USA 103, 13635-13639; Wang, X., McLachlan, J., Zamore, P. D., and Hall, T. M. (2002). Modular recognition of RNA by a human pumilio-homology domain. Cell 110, 501-512) that suffer from short RNA recognition sequences and require protein design, assembly and validation for each RNA target. Other CRISPR/Cas systems have demonstrated RNA binding in bacteria (Hale, C. R., Zhao, P., Olson, S., Duff, M. O., Graveley, B. R., Wells, L., Terns, R. M., and Terns, M. P. (2009). RNA-guided RNA cleavage by a CRISPR RNA-Cas protein complex. Cell 139, 945-956; Sampson, T. R., Saroj, S. D., Llewellyn, A. C., Tzeng, Y. L., and Weiss, D. S. (2013). A CRISPR/Cas system mediates bacterial innate immune evasion and virulence. Nature 497, 254-257) or eukaryotes (Price, A. A., Sampson, T. R., Rainer, H. K., Grakoui, A., and Weiss, D. S. (2015). Cas9-mediated targeting of viral RNA in eukaryotic cells. Proc Natl Acad Sci USA 112, 6164-6169), although these systems cannot discriminate RNA from DNA targets, feature RNA targeting rules that remain unclear, or rely on large protein complexes that may be difficult to reconstitute in mammalian cells. Further work varying the sgRNA spacer length (Fu, Y., Sander, J. D., Reyon, D., Caseio, V. M., and Joung, J. K. (2014). Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nat Biotechnol 32, 279-284) and PAMmer length and chemical modifications will be required to determine the optimal RCas9 parameters.
(166) In some embodiments, the nucleoprotein complexes provided herein does not include a PAMmer oligonucleotide. The RCas9 system described in “Methods and compositions for modifying a single stranded target nucleic acid” (WO 2015089277 A1) as utilize a PAMmer oligonucleotide. Using a unique nucleoprotein complex comprising an RCas9 polypeptide and a single guide RNA, but not to including a PAMmer oligonucleotide, to target RNA, we have demonstrated that this system recognizes and alters target RNA in the absence of a PAMmer. Despite the absence of a PAMmer, our results for this system indicate (1) highly efficient alteration of targeted RNAs, and (2) RNA recognition in living eukaryotic cells. The fully encodable nature of this 2-component system enables the deployment of our system in a therapeutic context using viral vectors, nanoparticles, or other excipients that support delivery of DNA. Because PAMmer cannot be encoded in DNA due to chemical modifications that are required to stabilize and protect it from cellular enzymatic activities, earlier systems requiring a PAMmer were not fully encodable.
(167) Alternative applications of exemplary RCas9 as provided herein measure or alter RNA splicing via targeting of split fluorescent proteins or splicing factors adjacent to alternatively spliced exons. In alternative embodiments, the nucleic acid-programmable nature of exemplary RCas9 as provided herein allows for multiplexed targeting (Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X., Jiang, W., Marraffini, L. A., et al. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819-823) of RNA and the use of Cas9 proteins that bind orthogonal sgRNAs (Esvolt, K. M., Mali, P., Braff, J. L., Moosburner, M., Yaung, S. J., and Church, G. M. (2013). Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods 10, 1116-1121), which can support distinct activities on multiple target RNAs simultaneously. In alternative embodiments, RNA targeting afforded by exemplary RCas9 as provided herein supports the development of sensors that recognize specific healthy or disease-related gene expression patterns and reprogram cell behavior via alteration of gene expression or concatenation of enzymes on a target RNA (Delebecque, C. J., Lindner, A. B., Silver, P. A., and Aldaye, F. A. (2011). Organization of intracellular reactions with rationally designed RNA assemblies. Science 333, 470-474; Sachdeva, G., Garg, A., Godding, D., Way, J. C., and Silver, P. A. (2014). In vivo co-localization of enzymes on RNA scaffolds increases metabolic production in a geometrically dependent manner. Nucleic Acids Res 42, 9493-9503). Efforts towards In alternative embodiments, Cas9 is delivered in vivo are underway (Dow, L. E., Fisher, J., O'Rourke, K. P., Muley, A., Kastenhuber, E. R., Livshits, G., Tschaharganch, D F., Socci, N. D., and Lowe, S. W. (2015). Inducible in vivo genome editing with CRISPR-Cas9, Nat Biotechnol 33, 390-394; Swiech, L., Heidenreich, M., Banerjee, A., Habib, N., Li, Y., Trombetta, J., Sur, M., and Zhang, F. (2015). In alternative embodiments, exemplary RCas9 as provided herein can be used for in vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9. Nat Biotechnol 33, 102-106; Zuris, J. A., Thompson, D. B., Shu, Y., Guilinger, J. P., Bessen, J. L., Hu, J. H., Maeder, M. L., Joung, J. K., Chen, Z. Y., and Liu, D. R. (2015). In alternative embodiments, provided are cationic lipid-mediated delivery of exemplary RCas9 as provided herein to enable efficient protein-based genome editing in vitro and in vivo. Nat Biotechnol 33, 73-80), and these efforts combined with existing oligonucleotide chemistries (Bennett, C. F., and Swayze, E. E. (2010). RNA targeting therapeutics: molecular mechanisms of antisense oligonucleotides as a therapeutic platform. Annu Rev Pharmacol Toxicol 50, 259-293) could support in vivo delivery of the RCas9 systems as provided herein for targeted modulation of many features of RNA processing in living organisms.
(168) Experimental Procedures
(169) Plasmid Construction, PAMmer Synthesis, and Target Site Choice
(170) The dCas9-2xNLS sequence was amplified from pHR-SFFV-dCas9-BFP-KRAB (a gift from Stanley Qi & Jonathan Weissman, Addgene plasmid #46911), tagged with a SV40 nuclear localization signal (NLS) on the N-terminus, and fused to EGFP or mCherry in pcDNA 3.1 (Invitrogen, Carlsbad Calif.) using Gibson assembly. A version lacking NLS on the N-terminus was also constructed. To construct the sgRNA scaffold construct, the human U6 polymerase III promoter with the modified sgRNA scaffold (Chen et al., 2013) was purchased as a gBlock from IDT with a BbsI restriction site at the 5′ end of the sgRNA scaffold (see sequence in
(171) RCas9 target sites were chosen with a combination of the IDT antisense oligonucleotide design tool and the microarray probe design tools Picky (Chou et al., 2004) and OligoWiz (Wernersson and Nielsen, 2005). We designed PAMmers against high-confidence sites with 8 bases on the 5′ end beyond the PAM sequence. PAMmers were composed of mixed 2′OMe RNA and DNA bases and purified by HPLC (Integrated DNA Technologies, Coralville Iowa).
(172) Cell Lines
(173) U2OS and HEK293T cells were grown in Dulbecco's modified eagle medium (DMEM) supplemented with 10% fetal bovine serum, glutamax, and non-essential amino acids (Invitrogen). Cells were passaged every 3-4 days with TrypLE EXPRESS (Invitrogen) using standard methods and maintained in a humidified incubator at 37° C. with 5% CO.sub.2.
(174) GAPDH and β-Actin mRNA Targeting with RCas9
(175) U2OS cells cultured as described above were passaged at ˜80% confluency. Glass-bottom 96-well plates or chamber slides were coated with 20 μg/mL fibronectin in PBS for 2 h at 37° C., then the fibronectin solution was aspirated and 20,000 cells were plated in each well. 16 hours later, cells were transfected with the sgRNA and dCas9-2xNLS-EGFP plasmids using Lipofectamine 3000 (Invitrogen) according to the manufacturer's instructions. pCMV-Renilla luciferase was co-transfected in these experiments so that total transfected protein load was the same among various dosages of sgRNA and dCas9. The weight ratio of sgRNA and dCas9-EGFP (carrying a N-terminal NLS) plasmids ranged from 5:1 to 2.5:1, respectively, where the amount of dCas9-EGFP was fixed at 10% of total transfected material. Immediately after plasmid transfection, PAMmers were transfected using Lipofectamine RNAiMax (Invitrogen) according to manufacturer's instructions. 24 hours after transfection, cells were washed with PBS and fixed with 3.7% paraformaldehyde in PBS, permeabilized with 70% ethanol at 4° C. for one hour, and mounted using Prolong Gold Antifade mounting medium with DAPI (Invitrogen). Confocal microscopy was conducted using an Olympus FV1000 confocal microscope.
(176) Nuclear export of RCas9 in the presence of sgRNA and PAMmer targeting the 3′UTR of GAPDH was analyzed by measuring the average signal in the nuclei and cytoplasm of individual cells. Cells with average cytoplasmic signal greater than 10% of the average nuclear signal were considered to have a cytoplasmic signal.
(177) RNA Immunoprecipitation
(178) HEK293T cells cultured as described above were passaged at 80% confluency and 600,000 cells were seeded in each well of 6-well tissue culture plates coated with poly-L-lysine. 16 hours later, cells were co-transfected with the RCas9 system as described above (dCas9-GFP with 2× internal NLS tags), or plasmids encoding MS2-EGFP or EGFP along with a plasmid encoding the model Renilla luciferase mRNA driven by a CMV promoter. 30 hours later, the growth media was aspirated and the cells were washed with PBS. 1% paraformaldehyde in PBS was applied to the cells, incubated for 10 minutes at room temperature, then the solution was aspirated and the cells washed twice with cold PBS. Next, the cells were scraped from the wells in cold PBS and the cell suspension was centrifuged as 800×g for 4 minutes to pellet the cells. The cells were washed once more, then resuspended in RIPA buffer with protease inhibitor (Roche) and sonicated for 5 minutes in a BIORUPTOR™ sonicator (50% duty cycle, 1 minute period). Insoluble material was pelleted after a high-speed centrifugation and the supernatant was applied to protein G DYNABEADS™ (Invitrogen) coated with mouse anti-GFP antibody (Roche). After overnight incubation at 4° C., the bead supernatant was retained and beads washed 3 times with RIPA buffer containing 0.02% Tween-20 and once with DNase buffer (350 mM Tris-HCl, pH 6.5; 50 mM MgCl.sub.2; 5 mM DTT). The beads were resuspended in DNase buffer and TURBO™ DNase (Invitrogen) was added to 0.08 units/μL. The beads were incubated at 37° C. for 30 minutes, then proteinase K (NEB) was added to 0.1 U/μL and incubated with shaking at 37° C. for 30 minutes. Next, urea was added to 2.5 M and the beads were incubated with shaking at 37° C. for 30 minutes. The bead supernatant was collected and subjected to a two sequential phenol:chloroform:isoamyl alcohol (25:24:1) extractions followed by three chloroform extractions. The RNA was precipitated and reverse transcribed using SuperScript III™ (Invitrogen) using random hexamer primers, and relative abundance of Renilla luciferase RNA on the beads was compared to the supernatant using qPCR (see Table 5 for primer sequences).
(179) TABLE-US-00005 TABLE 5 qPCR primer sequences GAPDH forward primer AAGGTGAAGGTCGGAGTCAAC (SEQ ID NO: 14) GAPDH reverse primer GGGGTCATTGATGGCAACAATA (SEQ ID NO: 15) Renilla luciferase GTAACGCTGCCTCCAGCTAC forward primer (SEQ ID NO: 16) Renilla luciferase GTGGCCCACAAAGATGATTT reverse primer (SEQ ID NO: 17)
Measurements of Influence of RCas9 on RNA Stability and Translation
(180) HEK293T cells were cultured as described above, passaged and plated in 96- or 12-well tissue culture plates, and were co-transfected 24 h later with the RCas9 system (dCas9-GFP with 2× internal NLS tags) and the Renilla luciferase construct carrying MS2 and RCas9 binding sites in the 3′UTR. In the protein abundance measurements, a small amount of CMV-driven firefly luciferase vector (5% of total transfected plasmid) was co-transfected as a transfection control. For RNA stability measurements, RNA was isolated 24 h after transfection, DNase treated, reverse transcribed with Superscript III (Invitrogen) using dT(20) primers according the manufacturer's instructions. The amount of Renilla luciferase cDNA relative to GAPDH was then measured using qPCR. For the translation studies, Renilla and firefly luciferase protein were measured with the Dual Luciferase Kit (Promega) according to the manufacturer's instructions.
(181) Fluorescence In Situ Hybridization for β-Actin mRNA
(182) Stellaris FISH Probes recognizing human β-actin mRNA and labeled with Quasar 670™ (VSMF-2003-5. Biosearch Technologies, Inc., Petaluma, Calif.) were hybridized to cells 24 hours after transfection with the RCas9 system targeting β-actin mRNA. Hybridization was conducted according to the manufacturer's instructions. Confocal microscopy was conducted using an Olympus FV1000™ confocal microscope.
(183) Overlap Analysis for Fluorescence In Situ Hybridization and RCas9
(184) Colocalization analysis among FISH and RCas9 (dCas9-GFP with 2× internal NLS tags) targeting β-actin mRNA was conducted using the Coloc 2 plugin from the image analysis software FIJI™ (Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., et al. (2012). Fiji: an open-source platform for biological-image analysis. Nat Methods 9, 676-682). The cytoplasm of individual cells with similar dCas9-EGFP transfection levels was selected and the Coloc 2 analysis was conducted using default parameters. The Mander's overlap coefficient describing degree of overlap of the FISH signal with RCas9 for more than 60 cells in each condition was compiled and p-values were calculated with the two-tailed Mann-Whitney U test.
(185) Tracking β-Actin mRNA Trafficking to Stress Granules
(186) A HEK293T cell line was genetically modified with a fusion of mCherry to the C-terminus of Ras GTPase-activating protein-binding protein 1 (G3BP1) using CRISPR/Cas9. Briefly, a donor plasmid was constructed consisting of the mCherry ORF, a puromycin selection cassette, and flanking 1.5 kb homology arms directed at the G3BP1 locus. An sgRNA sequence targeting the C-terminus of G3BP1 was cloned into pSpCas9(BB)-2A-GFP (pX458) (gift from Feng Zhang, Addgene plasmid #48138) and co-transfected with the donor plasmid using Fugene HD (Roche) following the manufacturer's instructions. 48 hours after transfection, cells were selected with 1 μg/mL puromycin in growth medium for 14 days and mCherry-positive clones were selected and screened by PCR.
(187) A clone with at least one modified allele was plated on glass chamber slides coated with fibronectin and transfected with the RCas9 system targeting the 3′UTR of β-actin mRNA as described above. 24 hours after transfection, cells were imaged with a Zeiss LSM 810™ confocal microscope with a stage incubator and sodium arsenite was applied to cells at concentrations ranging from 50 to 200 μM. Cells were maintained at 37° C. in a humidified atmosphere and 5% CO.sub.2 and imaged at regular intervals.
(188) Analysis of β-Actin mRNA Trafficking to Stress Granules
(189) The average signal intensity in the RCas9 channel in areas with overlapping G3BP1-mCherry foci was recorded for each time point. Average signal intensity in the RCas9 channel surrounding G3BP1-mCherry foci was recorded as background and subtracted from the previous value to produce the background-adjusted RCas9 signal in stress granules.
Example 5: Tracking and Manipulating RNA Repeats Using RCas9 Plasmid Construction, PAMmer Synthesis, and Transfections
(190) The dCas9-2xNLS sequence was amplified from pHR-SFFV-dCas9-BFP-KRAB (a gift from Stanley Qi & Jonathan Weissman. Addgene plasmid #46911), tagged with two SV40 nuclear localization signals (NLS) on the C-terminus, and fused to EGFP or mCherry pCDNA 3.1 (Invitrogen, Carlsbad Calif.) using Gibson assembly. To construct the sgRNA scaffold construct, the human U6 polymerase III promoter with the modified sgRNA scaffold (Chen et al., 2013) was purchased as a gBlock from IDT with two BbsI restriction sites at the 5′ end of the sgRNA scaffold (see table 1) and cloned into the multiple cloning site of pBlueScript II SK (+)™ (Agilent, Santa Clara, Calif.) using Gibson assembly. Phosphorylated oligonucleotides encoding the sgRNA sequences (with overhangs 5′CACC on the RNA antisense strand and 5′AAAC on the sense strand) were ligated into BbsI-digested sgRNA scaffold construct to produce sgRNAs targeting specific transcripts (see table 1). The SMA minigene construct was a gift from the Adrian Krainer lab. DM1 related 120 CTG repeats were present downstream of the CMV promoter in pCDNA 3.1 plasmid backbone for expression in mammalian cell lines. pCDNA3.1 PIN-XTEN-dCas9-2XNLS was constructed via amplification of the PIN domain from human cDNA from the SMG6 gene. The XTEN linker is a flexible linker used to isolate adjacent proteins domains. pCDNA 3.1 FOX2-dCas9-2xNLS was constructed via amplification of FOX2 from the Open Biosystem Human ORFeome™ and assembled with dCas9-2XNLS using Gibson assembly.
(191) In all experiments, Lipofectamine 3000 (Life Technologies, Carlsbad, Calif.) was used according to the manufacturer's direction. For 100 ng total transfected plasmid in a 96w format, 5 ng of Cas9 plasmid and 25 ng sgRNA plasmid were transfected. In the imaging experiments, the GFP-tagged version of Cas9 was used with 20 ng of CAG or GGGGCC (SEO ID NO: 19) repeat plasmid. In the cleavage experiments, the PIN-tagged version of Cas9 with used with the same amount of repeat plasmid. In the RNA splicing experiments, varied amounts of pCDNA 3.1 FOX2-dCas9-2xNLS were transfected ranging from 0 to 25 ng per well in 96w format.
(192) For the MBNL1 redistribution experiment (
(193) PAMmers were composed of mixed 2′OMe RNA and DNA bases and purified by HPLC (Integrated DNA Technologies, Coralville Iowa).
(194) Cell Lines
(195) HEK293T and COS-7 cells were grown in Dulbecco's modified eagle medium (DMEM) supplemented with 10% fetal bovine serum, glutamax, penicillin/streptomycin and non-essential amino acids (Invitrogen). Cells were passaged every 3-4 days with TrypLE EXPRESS (Invitrogen) using standard methods and maintained in a humidified incubator at 37° C. with 5% CO.sub.2.
(196) RT-PCR
(197) For the SMN2 minigene splicing experiments, RNA was extracted using Qiagen RNAeasy™ columns, subjected to DNAse treatment, reverse transcription (Superscript III™, Life Technologies), and PCR (Phusion polymerase, Life Technologies) according to manufacturer's directions. The PCR products were run on agarose gels and imaged using Sybr Safe gel stain (Life Technologies) with a UV imager.
(198) RNA FISH
(199) Media was removed from the cell culture slides and cells were washed gently with PBS (pH7.4). Cells were fixed with 4% PFA at room temperature for 10 minutes and subsequently washed at RT with PBS 5 times 3 min each. Slides were incubated in pre-chilled 70% ethanol overnight at 4° C. Ethanol was decanted and slides were rehydrated slides in 40% formamide in 2× SSC for 10 minutes at RT (20 ml deionized formamide, 5 ml 20× SSC, 25 ml ultrapure/DEPC water). While incubation is going lyophilized DNA probe (CAG10-cy3 (SEQ ID NO: 23) or GGGGCC-cy3 (SEQ ID NO: 19)) was reconstituted in water to the concentration of 500 ng/ul. Required volume of probe was pipetted into a PCR tube, heated at 99 C for 10 minutes and immediately cooled on ice for 10 minutes. Incubate cells for prehyb with the required volume of prehyb buffer (see recipe) at 37° C. for 15 mins in a humidified chamber or an incubator. The probe was added to the hybridization buffer (see recipe below). Cells were hybridized with DNA probe made in prehyb buffer (Hyb buffer=prehyb buffer+probe) at 37° C. for 2 hours in a humidified chamber or an incubator. Cells were washed 3× with 40% formamide/2× SSC at 37-37° C. for 30 min each. Wash sections with PBS at RT for 5 mins and then mounted them with mounting medium VECTASHIELD™ with DAPI (vector labs H-1200).
(200) Northern Dot Blot
(201) MATERIALS: Bio-Rad Bio-Dot™ Apparatus 1706545), HYBOND+ nylon membrane (GE HealthCare), Whatman paper.
(202) SOLUTIONS 10 mM EDTA, 20× SSC (Lonza 51205), 10× SSC (diluted with RNase Free water from 20× SSC), 37% Formaldehyde, dH2O
(203) RNA was extracted using Tri reagent (Sigma Aldrich) as per manufacturer's protocol. 5 ug of RNA was used per lane. RNA can be stored at −80 C for 6 months until needed.
(204) For sample preparation, 5 ug (for each sample) of RNA resuspended in RNase Free water was diluted to 50 ul with RNase Free water. 30 ul 20× SSC, and 20 ul of 37% formaldehyde were added to each sample. The samples were incubated at 60 C for 30 minutes and then kept on ice until needed.
(205) The Bio-Rad Bio-Dot™ Apparatus (1706545) was assembled as per manufacturer's protocol, washed with ethanol by passing ethanol through the wells and dried. The apparatus was then disassembled. The Hybond+™ nylon membrane and 3 pieces of whatman paper were cut to the size of the Bio-Dot. The Hybond+ membrane was soaked in RNase Free water for 5 minutes and then transferred to 10× SSC buffer for 5 minutes. The Bio-Dot apparatus was then reassembled as following: From the top down >Hybond+ nylon membrane, 3× Whatman™ papers, Gasket, Gasket support plate, vaccum manifold were assembled and the apparatus was screwed tight and connected to a lab vacuum assembly. The vacuum was turned and a quiet seal was taken as the sign of a good seal. The wells to be used were hydrated and tested by passing 200 ul of 10× SSC twice while the vacuum is on. The sample was then applied for 5 minutes with vacuum off, and then the vaccum was turned on. After the samples were passed through the membrane by the vacuum, the wells were washed with 200 ul of 10× SCC twice. The vacuum was turned off, the Bio-Dot assembly was disassembled and the membrane was crosslinked in the UV STRATALINKER™ using the “Auto-Crosslink” setting which is equivalent to 1200 mJ with sample side up. At this point, the membrane can be dried and stored at RT for up to a month.
(206) For probing, the membrane was hydrated with 10× SSC, and the washed with 1× SSC (diluted from 20× SSC with RNase Free water). The membrane was pre-hybridized with 10 ml Express-Hyb™ hybridization solution (Clonetech 636831) containing 500 ul of 1 mg/ml yeast tRNA (Thermo Fisher Scientific 15401-029) in a borosilicate hybridization tube (Thermo Scientific ELED-110113) in a hybridization oven (Thermo Scientific 6240TS) for 2 hours at 50 C.
(207) During Pre-hybridization step, the CAG 10 (CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG) (SEQ ID NO: 23) DNA probe was end-labeled with gamma-P32 ATP (Perkin Elmer BLU502Z) using T4 PNK in the following reaction: 20 ul 500 ng/ul CAG10 probe 10 ul 10× PNK buffer (NEB) 5 ul T4-PNK (NEB) 5 ul gamma-P32 ATP (Perkin Elemer) 60 ul Water
(208) The reaction was incubated at 37 C for 30 minutes. The probe was cleaned using the GE Lifesciences G-50 columns (28-9034-08) as per manufacturer's protocol. The probe was boiled at 100 C for 5 minutes and then kept on ice until use. The probe was directly added to the Pre-hybridization buffer (after 2 hours of pre-hybridization) and the hybridization was carried out at 45 C overnight (12-16 hours). After hybridization, the express-hyb buffer was decanted and the membrane was taken out into a small glass square baking dish/reservoir and washed with 1× SSC containing 0.1% SDS for 10 minutes at room temperature. 3 more washes were done with 0.5× SSC containing 0.1% SDS for 10 minutes each at room temperature. The membrane was then blotted with KimWipes™ (KimTech) and wrapped in a Saran wrap. The membrane was exposed to autoradiography film (Thermo Fisher Scientific) to an autoradiography cassette (GE Healthcare) with an intensifying screen (GE Healthcare) at −80 C for 4 hours.
(209) TABLE-US-00006 TABLE 6 PAMmer (PAM sequence in bold) and sgRNA sequences PAMmer, CAG repeat mTGmCTmGCmTGmTGGmCTmGCmTGmCTmGCmTGmCTmGC (SEQ ID NO: 20) sgRNA, CAG repeat GTGCTGCTGCTGCTGCTGCTGGUUUAAGAGCAUUGCUGGAAACAGCAUAGCAA GUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG CUUUUUUU (SEQ ID NO: 21) U6 promoter-2x-Bbsi- TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTAC sgRNA scaffold CAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATA TACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACA AAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTT TGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTT GAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC GGGTCTTCGAGAAGACCTGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTT TAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTT TTTTT (SEQ ID NO: 22)
Buffers Recipes:
20× Standard Sodium Citrate (SSC) Buffer:
(210) TABLE-US-00007 Component Recipe 3M sodium chloride 175.3 g (FW 58.44) 300 mM sodium citrate 88.2 g (FW 294.1) d2H2O up to 1 L
(pH to 7.0 with HCl and bring to final volume with d2H2O)
Formamide/SSC Buffer:
(211) TABLE-US-00008 Component Recipe 40% formamide 20 mL (OmniPur deionized formamide, EMD Cat.# 4650) 2X SSC 5 mL of 20X SSC d2H2O 25 mL
Prehybridization Buffer:
(212) TABLE-US-00009 Component Recipe 40% formamide 400 μL (OmniPur deionized formamide. EMD Cat.# 4650) 2X SSC buffer 100 μL of 20X SSC 200 μg/mL BSA 20 μL of 10 mg/mL BSA 10% dextran sulfate 100 mg (Sigma, Cat.# D8906-10G) 2 mM vanadyl sulfate 10 μL of 200 mM vanadyl (Aldrich 20,486-2) sulfate 1 mg/mL yeast iRNA 100 μL of 10 mg/mL yeast (Invitrogen Cat. # 15401-029) tRNA d2H2O Up to 1 mL (usually 320 μL)
(213) Vortex vigorously until dextran sulfate has dissolved. Solution will be viscous. Alternatively, 200 nM vanadyl adenosine complex can be used instead of vanadyl sulfate. Vanadyl complex is an RNase inhibitor that can either be made or purchased from NEB (Cat. #S1402S). Alternatively, RNAsin can be used.
(214) Hybridization Buffer:
(215) TABLE-US-00010 Component Recipe 40% formanide 400 μL (OmniPur deionized formamide, EMD Cat.# 4650) 2X SSC Buffer 100 μL of 20X SSC 200 μg/mL BSA 20 μL of 10 mg/mL BSA 10% dextran sulfate 100 mg (Sigma, Cat.# D8906-10G) 2 mM vanadyl sulfate 10 μL of 200 mM vanadyl (Aldrich 20,486-2) sulfate 1 mg/mL yeast tRNA 100 μL of 10 mg/mL yeast (Invitrogen Cat. # 15401-029) tRNA 500 pg/μL probe 1 μL of 500 ng/uL probe d2H2O Up to 1 mL (usually 319 μL)
(216) Prepare initially without probe. Vortex vigorously until dextran sulfate has dissolved. Solution will be viscous. Add denatured probe to pre-chilled buffer.
Example 6: Using an RNA-Targeting Cas9 Systems for Targeted Destruction of Disease-Causing RNAs in Humans and/or Animal Models
(217) An RNA-targeting Cas9 system is used to treat a human patient suffering from a disease caused by an RNA microsatellite repeat expansion (such as microsatellite repeat expansion RNAs that cause myotonic dystrophy, C9orf72-linked ALS, and Huntington's disease). In alternative embodiments, the RNA-targeting Cas9 system, or nucleoprotein complex as provided herein, comprises two components: 1) a nuclease-inactive Cas9-polypeptide, optionally fused to an effector polypeptide and/or detectable moiety, and 2) a single guide RNA (sgRNA) targeting the repeat-containing sequence.
(218) The effector polypeptide can be, but is not limited to, one of the following proteins: an RNA cleaving domain (endonuclease) such as a PIN domain-containing protein; a fluorescent protein; or an RNA splicing domain (splicing factor) such as RBFOX2 domain-containing protein or a protein known to influence RNA splicing.
(219) The single guide RNA can be, but is not limited to, one of the following: an sgRNA targeting the CTG repeat-containing RNA that causes myotonic dystrophy; an sgRNA targeting the GGGGCC repeat-containing RNA that causes C9orf72-linked ALS; an sgRNA targeting the CAG repeat-containing RNA that causes Huntington's disease; or an sgRNA targeting the other diseases caused by repeat-containing RNA (microsatellite repeat expansion diseases such as Fragile X syndrome, spinocerebellar ataxias, Fragile X-associated tremor/ataxia syndrome, Spinal-bulbar muscular dystrophy, Oculopharyngeal muscular dystrophy, and others).
(220) In alternative embodiments, the RNA-targeting Cas9 system is encoded in DNA carried by a vector, e.g., an adenovirus or an adeno-associated virus (AAV), and can be delivered to appropriate tissues via one of the following methods: use of specific AAV serotypes that display specific tissue tropism (such as AAV-9 targeting neurons muscle); injection of naked DNA encoding the RCas9 system into tissue such as muscle or liver; use of nanoparticles composed of lipids, polymers, or other synthetic or natural materials that carry DNA or RNA encoding the therapeutic RCas9 system; or any of the above where the RCas9 system is split between two separate viruses or DNA molecules so that: one virus encodes the Cas9 protein and the other virus encodes the sgRNA; or one virus encodes a portion of the Cas9 protein while the other virus encodes the another portion of the Cas9 protein and the sgRNA. In embodiments in which the portions of Cas9 are encoded on separate vectors, the encoded portions of Cas9 can interact with one another so as to form a functional Cas9 protein. For example, in some embodiments, the portions of Cas9 are engineered to complement via protein splicing or complementation to generate a functional Cas9 protein (see Wright et al., Rational design of a split-Cas9 enzyme complex. PNAS 112:2984-2989 (2015), the content of which is hereby incorporated by reference in its entirety).
(221) In alternative embodiments, to use exemplary RNA-targeting Cas9 systems as provided herein in treatment of a human subject or animal, the vector, e.g., the AVV, encoding the RNA-targeting Cas9 system can, for example, be injected by the following methods:
(222) 1. Skeletal muscle tissue (intramuscular) at multiple sites simultaneously (relevant indication: myotonic dystrophy)—injection of 10.sup.11-10.sup.14 GC (genome copies) per injection into major muscle group such as the abdominal muscles, biceps, deltoids, erector spinae, gastrocnemius, soleus, gluteus, hamstrings, latissimus dorsi, rhomboids, obliques, pectoralis, quadriceps, trapezius and/or triceps;
(223) 2. Intravenous delivery of a muscle-targeted AAV serotype such as AAV-9 or AAV-6 or a novel muscle-targeted serotype (relevant indication: myotonic dystrophy)—injection of 10.sup.11-10.sup.14 GC per injection for a total of 10.sup.12-10.sup.17 GC delivered;
(224) 3. Subpial spinal injection of AAV-6, AAV-9 or another serotype displaying neuronal tropism (relevant indication: ALS)—injection of 10.sup.11-10.sup.17 GC in a single or multiple doses;
(225) 4. Intracranial injection of AAV-6, AAV-9 or another serotype displaying neuronal tropism (relevant indication: Huntington's disease, spinocerebellar ataxias, Fragile X syndrome)—injection of 10.sup.11-10.sup.17 GC in a single or multiple doses.
Example 7: Treating Myotonic Dystrophy in Human Subjects
(226) In some embodiments for treating myotonic dystrophy in a human subject, the modified RCas9 endonuclease system, the nucleic acid, the genetic construct, or the viral vector (such as a lentiviral or AAV vector) may be formulated by methods known in the art. In addition, any route of administration may be envisioned. In alternative embodiments, the RCas9 endonuclease system, the nucleic acid, the genetic construct and the viral vector (such as a lentiviral or AAV vector) is administered by any conventional route of administration including, but not limited to oral, pulmonary, intraperitoneal (ip), intravenous (iv), intramuscular (im), subcutaneous (sc), transdermal, buccal, nasal, sublingual, ocular, rectal and vaginal. In addition, administration directly to the nervous system may include, and are not limited to, intracerebral, intraventricular, intracerebroventricular, intrathecal, intracisternal, intraspinal or peri-spinal routes of administration by delivery via intracranial or intravertebral needles or catheters with or without pump devices. Any dose or frequency of administration that provides the therapeutic effect described herein is suitable for use in the present treatment. In a particular embodiment, the subject is administered a viral vector encoding the RCas9 endonuclease system according to the disclosure by the intramuscular route. In a specific variant of this embodiment, the vector is an AAV vector as defined above, in particular an AAV9 vector. In some embodiments, the human subject may receive a single injection of the vector. Additionally, standard pharmaceutical methods can be employed to control the duration of action. These are well known in the art and include control release preparations and can include appropriate macromolecules, for example polymers, polyesters, polyamino acids, polyvinyl, pyrolidone, ethylenevinylacetate, methyl cellulose, carboxymethyl cellulose or protamine sulfate. In addition, the pharmaceutical composition may comprise nanoparticles that contain the RCas9 endonuclease system of the present disclosure.
Example 8: Treating Myotonic Dystrophy in Mouse Models and Measuring the Effects of such Treatments
(227) Mouse models which can be used include: HSALR transgenic mice that express 250 CUG repeats in the human skeletal actin 3′UTR; GGGGCC (G4C2) transgenic mice; and various human HTT transgenic mouse models.
(228) The gastronemius or tibialis anterior muscles of adult mice are injected respectively with 30 to 100 μi of physiological solution containing or not AAV vectors (AAV-6, AAV-2, or AAV-9). For each mouse, one muscle is injected with AAV GFP-ACT3 and the contralateral muscle is injected with control AAV containing any transgene (MCS) or GFP or vehicle alone (PBS). Six weeks after injections, the isometric contractile properties of the muscles are measured as previously described. Then, the mice are killed, muscles are collected and snap-frozen in liquid nitrogen-cooled isopentane and stored at −80° C.
(229) At the physiological level, it has been established that myotonia observed in the DM1 mouse model results from abnormal splicing of muscle-specific chloride channel Clc-1 exon 7a. Myotonia that is characterized by muscle hyperexcitability that leads to persistent electrical discharges and delayed force relaxation. One means to assess the efficacy of a myontic dystrophy therapeutic is to measure splicing of Clc-1 exon 7a via RNA sequencing or RT-PCR. Further, the effect of the therapeutic on muscle force relaxation can be determined after induced-contraction compared to control contralateral muscles. Reversal of myotonic dystrophy-related electrical activity in muscles will be assessed using electromyography in mice under general anesthesia using 30 gauge concentric needle electrotrode in hindlimb muscles (tibialis anterior, gastrocnemius, and vastus muscles) and forelimb muscles (flexor compartment of distal forelimb, triceps). At least ten needle insertions are performed for each muscle and myotonic discharges will be graded on a 4-point scale where 0 relates to no myotonia, 1, occasional myotonic discharge in <50% of insertions, 2, myotonic discharge in >50% of insertions, or 3, myotonic discharge in nearly all insertions.
(230) In at least some of the previously described embodiments, one or more elements used in an embodiment can interchangeably be used in another embodiment unless such a replacement is not technically feasible. It will be appreciated by those skilled in the art that various other omissions, additions and modifications may be made to the methods and structures described above without departing from the scope of the claimed subject matter. All such modifications and changes are intended to fall within the scope of the subject matter, as defined by the appended claims.
(231) With respect to the use of substantially any plural and/or singular terms herein, those having skill in the art can translate from the plural to the singular and/or from the singular to the plural as is appropriate to the context and/or application. The various singular/plural permutations may be expressly set forth herein for sake of clarity.
(232) It will be understood by those within the art that, in general, terms used herein, and especially in the appended claims (for example bodies of the appended claims) are generally intended as “open” terms (for example, the term “including” should be interpreted as “including but not limited to,” the term “having” should be interpreted as “having at least,” the term “includes” should be interpreted as “includes but is not limited to,” etc.). It will be further understood by those within the art that if a specific number of an introduced claim recitation is intended, such an intent will be explicitly recited in the claim, and in the absence of such recitation no such intent is present. For example, as an aid to understanding, the following appended claims may contain usage of the introductory phrases “at least one” and “one or more” to introduce claim recitations. However, the use of such phrases should not be construed to imply that the introduction of a claim recitation by the indefinite articles “a” or “an” limits any particular claim containing such introduced claim recitation to embodiments containing only one such recitation, even when the same claim includes the introductory phrases “one or more” or “at least one” and indefinite articles such as “a” or “an” (for example, “a” and/or “an” should be interpreted to mean “at least one” or “one or more”); the same holds true for the use of definite articles used to introduce claim recitations. In addition, even if a specific number of an introduced claim recitation is explicitly recited, those skilled in the art will recognize that such recitation should be interpreted to mean at least the recited number (for example, the bare recitation of “two recitations,” without other modifiers, means at least two recitations, or two or more recitations). Furthermore, in those instances where a convention analogous to “at least one of A, B, and C, etc.” is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (for example, “a system having at least one of A, B, and C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and/or A, B, and C together, etc.). In those instances where a convention analogous to “at least one of A, B, C, etc.” is used, in general such a construction is intended in the sense one having skill in the art would understand the convention (for example, “a system having at least one of A, B, or C” would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and/or A, B, and C together. etc.). It will be further understood by those within the art that virtually any disjunctive word and/or phrase presenting two or more alternative terms, whether in the description, claims, or drawings, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase “A or B” will be understood to include the possibilities of “A” or “B” or “A and B.”
(233) In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.
(234) As will be understood by one of skill in the art, for any and all purposes, such as in terms of providing a written description, all ranges disclosed herein also encompass any and all possible sub-ranges and combinations of sub-ranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as “up to,” “at least,” “greater than,” “less than,” and the like include the number recited and refer to ranges which can be subsequently broken down into sub-ranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 articles refers to groups having 1, 2, or 3 articles. Similarly, a group having 1-5 articles refers to groups having 1, 2, 3, 4, or 5 articles, and so forth.
(235) All references listed herein are expressly incorporated herein by reference in their entireties, including the following references:
REFERENCES
(236) Bashor C J, Helman N C, Yan S, Lim W A. 2008, Using engineered scaffold interactions to reshape MAP kinase pathway signaling dynamics. Science 319: 1539-43.
(237) Batra et al, 2014, Loss of MBNL Leads to Disruption of Developmentally Regulated Alternative Polyadenylation in RNA-Mediated Disease; Mol Cell. 56(2): 311-322.
(238) Bennett C. F., and Swayze, E. E. (2010), RNA targeting therapeutics: molecular mechanisms of antisense oligonucleotides as a therapeutic platform. Annu Rev Pharmacol Toxicol 50, 259-293.
(239) Bertrand, E., Chartrand, P., Schaefer, M., Shenoy, S. M., Singer, R. H., and Long, R. M. (1998). Localization of ASH1 mRNA particles in living yeast. Mol Cell 2, 437-445.
(240) Beuth B, Pennell S, Arnvig K B, Martin S R, et al. 2005. Structure of a Mycobacterium tuberculosis NusA-RNA complex. EMBO J 24: 3576-87.
(241) Braddock D T, Louis J M, Baber J L, Levens D. et al. 2002. Structure and dynamics of KH domains from FBP bound to single-stranded DNA. Nature 415: 1051-6.
(242) Buchan, J. R., and Parker, R. (2009). Eukaryotic stress granules: the ins and outs of translation. Mol Cell 36, 932-941.
(243) Buxbaum, A. R., Wu, B., and Singer, R. H. (2014). Single beta-actin mRNA detection in neurons reveals a mechanism for regulating its translatability. Science 343, 419-422.
(244) Cencie R, Miura H, Malina A, Robert F, et al. 2014. Protospacer adjacent motif (PAM)-distal sequences engage CRISPR Cas9 DNA target cleavage. PLoS One 9: e109213.
(245) Chen, B., Gilbert, L. A., Cimini, B. A., Schnitzbauer, J., Zhang, W., Li, G. W., Park, J., Blackburn, E. H., Weissman, J. S., Qi, L. S., Huang, B. (2013). Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 155, 1479-1491.
(246) Cheong, C. G., and Hall, T. M. (2006). Engineering RNA sequence specificity of Pumilio repeats. Proc Natl Acad Sci USA 103, 13635-13639.
(247) Cho S W, Kim S, Kim J M, Kim J S. 2013. Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol 31: 230-2.
(248) Chou, H. H., Hsia, A. P., Mooney, D. L., and Schnable, P. S. (2004). Picky: oligo microarray design for large genomes. Bioinformatics 20, 2893-2902.
(249) Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X., Jiang, W., Marraffini, L. A., et al. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819-823.
(250) DeJesus-Hernandez M, Mackenzie I R, Boeve B F, Boxer A L, et al. 2011. Expanded GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes chromosome 9p-linked FTD and ALS. Neuron 72: 245-56.
(251) Delebecque, C. J., Lindner, A. B., Silver, P. A., and Aldaye, F. A. (2011). Organization of intracellular reactions with rationally designed RNA assemblies. Science 333, 470-474.
(252) Donnelly C J, Willis D E, Xu M, Tep C, et al. 2011. Limited availability of ZBP1 restricts axonal mRNA localization and nerve regeneration capacity. EMBO J 30: 4665-77.
(253) Doudna lab patent: https://patentscope.wipo.int/search/en/detail.jsf?docId=WO2015089277&recNum=2&maxRec=2924&office=&prevFilter=&sortOption=&queryString=EN_ALL %3Anmr+AND+PA %3A %22THE+REGENTS+OF+THE+UNIVERSITY+OF+CALIFORNIA %22&tab=PCT+Biblio
(254) Dow, L. E., Fisher, J., O'Rourke, K. P., Muley, A., Kastenhuber, E. R., Livshits, G., Tschaharganeh, D. F., Socci, N. D., and Lowe, S. W. (2015). Inducible in vivo genome editing with CRISPR-Cas9. Nat Biotechnol 33, 390-394.
(255) Dow L E, Fisher J, O'Rourke K P, Muley A, et al. 2015. Inducible in vivo genome editing with CRISPR-Cas9. Nature Biotechnol doi:10.1038/nbt.3155.
(256) Dueber J E, Wu G C, Malmirchegini G R, Moon T S, et al. 2009. Synthetic protein scaffolds provide modular control over metabolic flux. Nat Biotechnol 27: 753-9.
(257) Esvelt, K. M., Mali, P., Braff, J. L., Moosburner, M., Yaung, S. J., and Church, G. M. (2013). Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods 10, 1116-1121.
(258) Filipovska A, Razif M F, Nygard K K, Rackham O. 2011. A universal code for RNA recognition by PUF proteins. Nat Chem Biol 7: 425-7.
(259) Fouts, D. E., Truc, H. L., and Celander, D. W. (1997). Functional recognition of fragmented operator sites by R17/MS2 coat protein, a translational repressor. Nucleic Acids Res 25, 4464-4473.
(260) Fu, Y., Sander, J. D., Reyon, D., Cascio, V. M., and Joung, J. K. (2014). Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nat Biotechnol 32, 279-284.
(261) Fusco D, Accornero N., Lavoie B, Shenoy S M, et al. 2003. Single mRNA molecules demonstrate probabilistic movement in living mammalian cells. Curr Biol: 13: 161-7.
(262) Garcia, J. F., and Parker, R. (2015). MS2 coat proteins bound to yeast mRNAs block 5′ to 3′ degradation and trap mRNA decay products: implications for the localization of mRNAs by MS2-MCP system. RNA 21, 1393-1395.
(263) Geisler S, Coller J. 2013. RNA in unexpected places: long non-coding RNA functions in diverse cellular contexts. Nat Rev Mol Cell Biol 14: 699-712.
(264) Gerstberger S, Hafner M, Ascano M, Tuschl T. 2014. Evolutionary conservation and expression of human RNA-binding proteins and their role in human genetic disease. Adv Exp Med Biol 825: 1-55.
(265) Gilbert L A, Larson M H, Morsut L., Liu Z., et al. 2013. CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell 154: 442-51.
(266) Graveley B R, Maniatis T. 1998. Arginine/serine-rich domains of SR proteins can function as activators of pre-mRNA splicing. Mol Cell 1: 765-71.
(267) Hale, C. R., Zhao, P., Olson, S., Duff, M. O., Graveley, B. R., Wells, L., Terns, R. M., and Terns, M. P. (2009). RNA-guided RNA cleavage by a CRISPR RNA-Cas protein complex. Cell 139, 945-956.
(268) Halo et al “NanoFlares for the detection, isolation, and culture of live tumor cells from human blood” PNAS doi: 10.1073/pnas.1418637111.
(269) Hendel, A., Bak, R. O., Clark, J. T., Kennedy, A. B., Ryan, D. E., Roy, S., Steinfeld, I., Lunstad, B. D., Kaiser, R. J., Wilkens, A. B., Bacchetta, R., Tsalenko, A., Dellinger, D., Bruhn, L., Porteus, M. H. (2015). Chemically modified guide RNAs enhance CRISP-Cas genome editing in human primary cells. Nature Biotechnology 33, 985-989.
(270) Ho et al. 2005. Colocalization of muscleblind with RNA foci is separable from mis-regulation of alternative splicing in myotonic dystrophy. J Cell Sci. 118(13): 2923-2933.
(271) Hua Y, Vickers T A, Okunola H L, Bennett C F, et al. 2008. Antisense masking of an hnRNP A1/A2 intronic splicing silencer corrects SMN2 splicing in transgenic mice. Am J Hum Genet 82: 834-48.
(272) Hua Y, Sahashi K, Hung G, Rigo F, et al. 2010. Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes Dev 24: 1634-44.
(273) Hua et al “Peripheral SMN restoration is essential for long-term rescue of a severe spinal muscular atrophy mouse model.” Nature. 2011 Oct. 5;478(7367):123-6. doi: 10.1038/nature10485.
(274) Hwang, W. Y., Fu, Y., Reyon, D., Maeder, M. L., Tsai, S. Q., Sander, J. D., Peterson, R. T., Yeh, J. R., and Joung, J. K. (2013). Efficient genome editing in zebrafish using as CRISPR-Cas system. Nat Biotechnol 31, 227-229.
(275) Jiang F, Taylor D W, Chen J S, Kornfeld J E, Zhou K, Thompson A J, Nogales E, Doudna J A. Structures of a CRISPR-Cas9 R-loop complex primed for DNA cleavage. Science. 2016;351(6275):867-71.
(276) Jinek M, East A, Cheng A, Lin S, et al. 2013. RNA-programmed genome editing in human cells. eLife 2: e00471.
(277) Kanadia R N, Johnstone K A, Mankodi A, Lungu C, Thornton C A, Esson D, Timmers A M, Hauswirth W W, Swanson M S. A muscleblind knockout model for myotonic dystrophy. Science. 2003;302(5652):1978-80.
(278) Kedersha N, Anderson P. 2007. Mammalian stress granules and processing bodies. Methods Enzymol 431: 61-81.
(279) Kuscu C, Arslan S, Singh R, Thorpe J, et al. 2014. Genome-wide analysis reveals characteristics of off-target sites bound by the Cas9 endonuclease. Nat Biotechnol 32: 677-83.
(280) Laird-Offringa I A, Belasco J G. 1995. Analysis of RNA-binding proteins by in vitro genetic selection: identification of an amino acid residue important for locking U1A onto its RNA target. Proc Natl Acad Sci USA 92: 11859-63.
(281) Li, D., Qiu, Z., Shao, Y., Chen, Y., Guan, Y., Liu, M., Li, Y., Gao, N., Wang, L., Lu, X., et al. (2013a). Heritable gene targeting in the mouse and rat using a CRISPR-Cas system. Nat Biotechnol 31, 681-683.
(282) Li, Y. R., King, O. D., Shorter, J., and Gitler, A. D. (2013b). Stress granules as crucibles of ALS pathogenesis. J Cell Biol 201, 361-372.
(283) Lionnet T, Czaplinski K, Darzacq X, Shav-Tal Y, et al. 2011. A transgenic mouse for in vivo detection of endogenous labeled mRNA. Nature Methods 8: 165-70.
(284) Long C, Amoasii L, Mireault A A, McAnally J R, Li H, Sanchez-Ortiz E, Bhattacharyya S, Shelton J M, Basel-Duby R, Olson E N. Postnatal genome editing partially restores dystrophin expression in a mouse model of muscular dystrophy. Science. 2016;351(6271):400-3.
(285) Lovei M T, Ghanem D, Marr H, Arnold J, et al. 2013. Rbfox proteins regulate alternative mRNA splicing through evolutionarily conserved RNA bridges. Nat Struct Mol Biol 20: 1434-42.
(286) Lu J, Getz G, Miska E A, Alvarez-Saavedra E, et. al. 2005. MicroRNA expression profiles classify human cancers. Nature 435: 834-8.
(287) MacKenzie T A, Schwartz G N, Calderone H M, Graveel C R, et al. 2014. Stromal Expression of miR-21 Identifies High-Risk Group in Triple-Negative Breast Cancer. Am J Pathol 184: 3217-25.
(288) Maddalo D, Manchado E, Concepcion C P, Bonetti C, et al. 2014. In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system. Nature 516: 423-7.
(289) Mali P, Yang L H, Esvelt K M, Aach J, et al. 2013. RNA-Guided Human Genome Engineering via Cas9. Science 339: 823-6.
(290) Manders, E. M., Stap, J., Brakenhoff, G. J., van Driel, R., and Aten, J. A. (1992). Dynamics of three-dimensional replication patterns during the S-phase, analysed by double labelling of DNA and confocal microscopy. J Cell Sci 103 (Pt 3), 857-862.
(291) Meng L, Ward A J, Chun S, Bennett C F, et al. 2015. Towards a therapy for Angelman syndrome by targeting a long non-coding RNA. Nature 518: 409-12.
(292) Miyanohara A, Kamizato K, Juhas S, Juhasova J, Navarro M, Marsala S, Lukacova N, Hruska-Plochan M, Curtis E, Gabel B, Ciacci J, Ahrens E T, Kaspar B K, Cleveland D, Marsala M. Potent spinal parenchymal AAV9-mediated gene delivery by subpial injection in adult rats and pigs. Mol Ther Methods Clin Dev. 2016;3:16046.
(293) Mouisel E, Blondet B, Escourrou P, Chatonnet A, Molgo J, Ferry A. Outcome of acetylcholinesterase deficiency for neuromuscular functioning. Neurosci Res. 2006;55(4):389-96.
(294) Muddashetty R S, Nalavadi V C, Gross C, Yao X, et al. 2011. Reversible inhibition of PSD-95 mRNA translation by miR-125a, FMRP phosphorylation, and mGluR signaling. Mol Cell 42: 673-88.
(295) Nakayama, T., Fish, M. B., Fisher, M., Oomen-Hajagos, J., Thomsen, G. H., and Grainger, R. M. (2013). Simple and efficient CRISPR/Cas9-mediated targeted mutagenesis in Xenopus tropicalis. Genesis 51, 835-843.
(296) Nissim-Rafinia M, Kerem B. 2002. Splicing regulation as a potential genetic modifier. Trends Genet 18: 123-7.
(297) O'Connell, M. R., Oakes, B. L., Sternberg, S. H., East-Seletsky, A., Kaplan, M., and Doudna, J. A. (2014). Programmable RNA recognition and cleavage by CRISPR/Cas9. Nature 516, 263-266.
(298) Orengo J P, Chambon P, Metzger D, Mosier D R, Snipes G J, Cooper T A. Expanded CTG repeats within the DMPK 3′ UTR causes severe skeletal muscle wasting in an inducible mouse model for myotonic dystrophy. Proc Natl Acad Sci USA. 2008;105(7):2646-51.
(299) Ozawa T, Natori Y, Sato M, Umezawa Y. 2007. Imaging dynamics of endogenous mitochondrial RNA in single living cells. Nat Methods 4: 413-9.
(300) Paige J S, Wu K Y, Jaffrey S R. 2011. RNA mimics of green fluorescent protein. Science 333: 642-6.
(301) Park H Y, Lim H, Yoon Y J, Follenzi A, et al. 2014. Visualization of dynamics of single endogenous mRNA labeled in live mouse. Science 343: 422-4.
(302) Pasca S P, Portmann T, Voineagu I, Yazawa M, et al. 2011. Using iPSC-derived neurons to uncover cellular phenotypes associated with Timothy syndrome. Nat Med 17: 1657-62.
(303) Passini M A, Bu J, Richards A M, Kinnecom C, et al. 2011. Antisense oligonucleotides delivered to the mouse CNS ameliorate symptoms of severe spinal muscular atrophy. Science Transl Med 3: 72ra18.
(304) Price, A. A., Sampson, T. R., Ratner, H. K., Grakoui, A., and Weiss, D. S. (2015). Cas9-mediated targeting of viral RNA in eukaryotic cells. Proc Natl Acad Sci USA 112, 6164-6169.
(305) Qi, L. S., Larson, M. H., Gilbert, L. A., Doudna, J. A., Weissman, J. S., Arkin, A. P., and Lim, W. A. (2013). Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173-1183.
(306) Rackham O, Brown C M. 2004. Visualization of RNA-protein interactions in living cells: FMRP and IMP1 interact on mRNAs. EMBO J 123: 3346-55.
(307) Rath A K, Rentmeister A. 2014. Genetically encoded tools for RNA imaging in living cells. Curr Opin Biotechnol 31C: 42-9.
(308) Renton A E, Majounie E, Waite A, Simon-Sanchez J, et al. 2011. A hexanucleotide repeat expansion in C9ORF72 is the cause of chromosome 9p21-linked ALS-FTD. Neuron 72: 257-68.
(309) Sachdeva, G., Garg, A., Godding, D., Way, J. C., and Silver, P. A. (2014). In vivo co-localization of enzymes on RNA scaffolds increases metabolic production in a geometrically dependent manner. Nucleic Acids Res 42, 9493-9503.
(310) Sampson, T. R., Saroj, S. D., Llewellyn, A. C., Tzeng, Y. L., and Weiss, D. S. (2013). A CRISPR/Cas system mediates bacterial innate immune evasion and virulence. Nature 497, 254-257.
(311) Sander, J. D., and Joung, J. K. (2014). CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol 32, 347-355.
(312) Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., et al. (2012). Fiji: an open-source platform for biological-image analysis. Nat. Methods 9, 676-682.
(313) Shestakova E A, Singer R H, Condeelis J. 2001. The physiological significance of beta-actin mRNA localization in determining cell polarity and directional motility. Proc Natl Acad Sci USA 98: 7045-50.
(314) Shin I, Ray J, Gupta V, Ilgu M, et al. 2014. Live-cell imaging of Pol II promoter activity to monitor gene expression with RNA IMAGEtag reporters. Nucleic Acids Res 42: e90.
(315) Staals R H, Zhu Y, Taylor D W, Kornfeld J E, et al. 2014. RNA Targeting by the Type III-A CRISPR-Cas Csm Complex of Thermus thermophilus. Mol Cell 56: 518-30.
(316) Stepto A, Gallo J M, Shaw C E, Hirth F. Modelling C9ORF72 hexanucleotide repeat expansion in amyotrophic lateral sclerosis and frontotemporal dementia. Acta Neuropathol. 2014;127(3):377-89.
(317) Sternberg, S. H., Redding, S., Jinek, M., Greene, E. C., and Doudna, J. A. (2014). DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature 507, 62-67.
(318) Strack R L, Disney M D, Jaffrey S R. 2013. A superfolding Spinach2 reveals the dynamic nature of trinucleotide repeat-containing RNA. Nat Methods 10: 1219-24.
(319) Sunbul M, Jaschke A. 2013. Contact-mediated quenching for RNA imaging in bacteria with fluorophore-binding aptamer. Angew Chem Int Ed Engl 52: 13401-4.
(320) Swiech, L., Heidenreich, M., Banerjee, A., Habib, N., Li, Y., Trombetta, J., Sur, M., and Zhang, F. (2015). In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9. Nat Biotechnol 33, 102-106.
(321) The ENCODE Project Consortium. 2012. An integrated encyclopedia of DNA elements in the human genome. Nature 489: 57-74.
(322) Tourriere, H., Chebli, K., Zekri, L., Courselaud, B., Blanchard, J. M., Bertrand, E., and Tazi, J. (2003). The RasGAP-associated endoribonuclease G3BP assembles stress granules. J Cell Biol 160, 823-831.
(323) Tyagi S, Kramer F R. 1996. Molecular beacons: Probes that fluoresce upon hybridization. Nat Biotechnol 14: 303-8.
(324) Unsworth, H., Raguz, S., Edwards, H. J., Higgins, C. F., and Yague, E. (2010). mRNA escape from stress granule sequestration is dictated by localization to the endoplasmic reticulum. FASEB J 24, 3370-3380.
(325) Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., and Gregory, P. D. (2010). Genome editing with engineered zinc finger nucleases. Nat Rev Genet 11, 636-646.
(326) Wang X, Zamore P D, Hall T M. 2001. Crystal structure of a Pumilio homology domain. Mol Cell 7: 855-65.
(327) Wang, X., McLachlan, J., Zamore, P. D., and Hall, T. M. (2002). Modular recognition of RNA by a human pumilio-homology domain. Cell 110, 501-512.
(328) Wang Y, Cheong C G, Hall T M, Wang Z. 2009. Engineering splicing factors with designed specificities. Nat Methods 6: 825-830.
(329) Wernersson, R., and Nielsen, H. B. (2005). OligoWiz 2.0—integrating sequence feature annotation into the design of microarray probes. Nucleic Acids Res 33, W611-615.
(330) Weyn-Vanhentenryck S M, Mele A, Yan Q, Sun S, et al. 2014. HITS-CLIP and integrative modeling define the Rbfox splicing-regulatory network linked to brain development and autism. Cell Rep 6: 1139-52.
(331) Wheeler T M, Lueck J D, Swanson, M S, Dirksen R T, Thornton C A. Correction of ClC-1 splicing eliminates chloride channelopathy and myotonia in mouse models of myotonic dystrophy. J Clin Invest. 2007:117(12):3952-7.
(332) Wiedenheft, B., Sternberg, S. H., and Doudna, J. A. (2012). RNA-guided genetic silencing systems in bacteria and archaea. Nature 482, 331-338.
(333) Wright A V, Sternberg S H, Taylor D W, Staahl B T, Bardales J A, Kornfeld J E, Doudna J A. Rational design of a split-Cas9 enzyme complex. Proc Natl Acad Sci USA. 2015;112(10):2984-9.
(334) Wu X, Kriz A J, Sharp P A. Target specificity of the CRISPR-Cas9 system. Quant Biol. 2014;2(2):59-70.
(335) Yang, D., Xu, J., Zhu, T., Fan, J., Lai, L., Zhang, J., and Chen, Y. E. (2014). Effective gene targeting in rabbits using RNA-guided Cas9 nucleases. J Mol Cell Biol 6, 97-99.
(336) Yang Y, Wang L, Bell P, McMenamin D, He Z, White J, Yu H, Xu C, Morizono H, Musunuru K, Batshaw M L, Wilson J M. A dual AAV system enables the Cas9-mediated correction of a metabolic liver disease in newborn mice. Nat. Biotechnol. 2016;34(3):334-8.
(337) Yeo G W, Confal N G, Liang T Y, Peng G E, et al. 2009. An RNA code for the FOX2 splicing regulator revealed by mapping RNA-protein interactions in stem cells. Nat Struct Mol. Biol 16: 130-7.
(338) Zhang W, Wang Y, Doug S, Choudhury R, et al. 2014. Treatment of type 1 myotonic dystrophy by engineering site-specific RNA endonucleases that target (CUG)(n) repeats. Molecular therapy: J Am Soc Gene Ther 22: 312-20.
(339) Zuris, J. A., Thompson, D. B., Shu, Y., Guilinger, J. P., Bessen, J. L., Hu, J. H., Maeder, M. L., Joung, J. K., Chen, Z. Y., and Liu, D. R. (2015). Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo. Nat Biotechnol 33, 73-80.