Aptamers and use of the aptamers in the diagnosis and treatment of cancer

Abstract

The present invention relates to an aptamer comprising a nucleotide sequence SEQ ID NO: 1, a composition comprising an aptamer, and the use of the aptamer in the diagnosis and treatment of cancer, particularly solid tumors.

Claims

1. An aptamer, wherein the aptamer comprises a nucleotide sequence (SEQ ID NO: 1) according to general formula (1) as given as follows or a pharmaceutically acceptable salt thereof: 5′-GCTGTGTGACTCCTGCAA-N43-GCAGCTGTATCTTGTCTCC-3′ (1) (SEQ ID NO: 1), wherein: N43 is a nucleotide sequence selected from the group comprising: 5′-CCGGACTGCAGAGACCGTCTGTCGGTGAACACTATTAGACGCG-3′ (SEQ ID NO: 2), 5′-CGTTGTTTGTTCGCTCCGGGCTGTAGAGCCTCGAAGATGAGTT-3′ (SEQ ID NO: 3), 5′-CAGGCCGGAGGGACTGGGGAGGTGCGACGTTTACGTGTTCTCC-3′ (SEQ ID NO: 4), 5′-CCAGACCGTAGGGGCTGTCTGTAGAGGACGCTGACGCGCACGA-3′ (SEQ ID NO: 5), 5′-CCTGTTCGGGCGCTAGCCTGATAGAAGTGTGCGTTCAATGGTG-3′ (SEQ ID NO: 6), 5′-CAGGTTGGGCTGATGGTGGGCAGACCGTAGGGTCCGTAATCCG-3′ (SEQ ID NO: 7), 5′-GGCGGTACGCGTGTGGACAGAAGTGACCGCCAAATAGCGCCTG-3′ (SEQ ID NO: 8), 5′-GGGGTACACGCGCATGCTCATCTGGACCGGAGGGTTCCGGGGA-3′ (SEQ ID NO: 9), 5′-CAAAGGGTCGGCGGACTGTTGAGACCACCGGCAGCGGGGCATT-3′ (SEQ ID NO: 10), 5′-GGGTACGGCATTGATTTGCTGCCTTATTGGTGTTGGTGGGGGG-3′ (SEQ ID NO: 11), 5′-CATGCTTTATGTAACAGGCGGAGGCCGTCCGTGGTACAGGTTC-3′ (SEQ ID NO: 12) and 5′-GGAGGGGATCACACCGTATAGACTGCAGAGTTCTGTCGGTGTG-3′ (SEQ ID NO: 13), or wherein the aptamer comprises a nucleotide sequence selected from the group comprising SEQ ID NOs: 2 to 13 or a pharmaceutically acceptable salt thereof.

2. The aptamer according to claim 1, wherein the nucleotide sequence is selected from the group comprising: TABLE-US-00003 (SEQ ID NO: 14) 5′-GCTGTGTGACTCCTGCAACAGGCCGGAGGGACTGGGGAGGT GCGACGTTTACGTGTTCTCCGCAGCTGTATCTTGTCTCC-3′, (SEQ ID NO: 15) 5′-GCTGTGTGACTCCTGCAACGTTGTTTGTTCGCTCCGGGCTG TAGAGCCTCGAAGATGAGTTGCAGCTGTATCTTGTCTCC-3′, (SEQ ID NO: 16) 5′-GCTGTGTGACTCCTGCAACCGGACTGCAGAGACCGTCTGTC GGTGAACACTATTAGACGCGGCAGCTGTATCTTGTCTCC-3′, and (SEQ ID NO: 17) 5′-GCTGTGTGACTCCTGCAAGGCGGTACGCGTGTGGACAGAAG TGACCGCCAAATAGCGCCTGGCAGCTGTATCTTGTCTCC-3′.

3. The aptamer according to claim 1, wherein the aptamer comprises the nucleotide sequence SEQ ID NO: 16.

4. The aptamer according to claim 1, for use as a medicament or a diagnostic reagent.

5. The aptamer according to claim 1, for use in the diagnosis and treatment of cancer, particularly solid tumours.

6. The aptamer according to claim 5, wherein the solid tumours are selected from the group comprising mammary gland adenocarcinoma, breast cancer, lung cancer, cervix cancer and pancreas carcinoma.

7. The aptamer according to claim 4, wherein the aptamer comprises the nucleotide sequence SEQ ID NO: 16.

8. A composition comprising an aptamer according to claim 1.

9. A pharmaceutical composition comprising as an active ingredient an aptamer according to claim 1.

10. The composition according to claim 8 for use in the detection or diagnosis, or the treatment of cancer, particularly solid tumours.

11. A solid tumour-specific drug delivery composition comprising an aptamer according to claim 1, and an anti-cancer agent such as a toxin, an anti-cancer growth inhibitor gene, an antagomir, siRNA, or combinations thereof.

12. An in vitro method of detecting or diagnosing a predisposition of solid tumours, the method comprising the steps of bringing an aptamer according to claim 1 into contact with a cell, tissue or sample obtained from a subject, and detecting the binding of an aptamer to the cell, tissue, or sample.

13. A method of treating solid tumours the method comprising the step of administering to a subject a therapeutically effective amount of an aptamer according to claim 1 coupled with an anti-cancer agent such as a toxin, an anti-cancer growth inhibitor gene, an antagomir, siRNA, or combinations thereof.

Description

(1) The Examples, which follow serve to illustrate the invention in more detail but do not constitute a limitation thereof.

(2) The figures show:

(3) FIG. 1 The screening of selected aptamers candidates against MCF-7 in FIG. 1a) and H460 in FIG. 1b) using radioactively labelled aptamers. The cells were washed and incubated with the aptamers. The amount of ssDNA bound to the cells was measured using radioactive analysis.

(4) FIG. 2 A selectivity study to assess the recognition of aptamers A33, A26, A28 and A32 of different cell lines. The developed aptamers and the starting pool (library) were 5′-.sup.32P-labeled and incubated with different cell lines. The amount of ssDNA bound to the cells was measured using radioactive analysis.

(5) FIG. 3 The effect of A26-Streptavidin-siRNA complexes on MCF-7 and Raji cells gene expression. Cells were treated with complexes and UBR5 mRNA expression and Paip1 mRNA expression were detected by quantitative RT-PCR analysis in both control and target cells. Shown is the mRNA expression of Paip complex in FIG. 3a), control Paip complex in FIG. 3b), UBR complex in FIG. 3c) and control UBR complex in FIG. 3d).

(6) FIG. 4 The effect of naked siRNAs and A26-Streptavidin-siRNA complexes on control and target cells viability. The cells were treated with naked siRNAs and complexes and viability of cells was assessed by MTT assay as shown in FIG. 4a). The effect of naked siRNAs and A26-Streptavidin-siRNA complexes on apoptosis of MCF-7 cells and Raji cells is shown in FIG. 4b). The cells were treated with naked siRNAs and complexes and apoptotic cells were detected by FACS.

(7) FIG. 5 The effect of A26-Streptavidin-siRNA complexes on H460, SK-BR-3, and HeLa cell gene expression. The cells were treated with the complexes and UBR5 mRNA expression and Paip1 mRNA expression were detected by quantitative RT-PCR analysis.

EXAMPLES

Cell Lines and Cell Culture

(8) Cell lines MCF-7 (ATCC.HTB-22, human mammary gland adenocarcinoma), H460 (ATCC.HTB-177, human non-small lung carcinoma), A549 (ATCC. CCL-185, human non-small lung carcinoma), SK-BR-3 (ATCC.HTB-30, human mammary gland adenocarcinoma), Raji (ATCC.CCL-86, Human Burkitt's lymphoma), Jurkat (ATCC-TIB-152, human acute T cell leukemia), PC3 (ATCC. CRL-1435, human prostate adenocarcinoma), HPBMC (ECACC. 07073110, Human Peripheral blood Mononuclear Cells), HUVEC (ECACC. 06090720, Human Umbilical Vein Endothelial Cells) were grown in Roswell Park Memorial Institute 1640 medium (RPMI-1640, PAA). MEC-1 (DSMZ. ACC-497, Human chronic B cell leukemia) was grown in Iscove's Modified Dulbecco's Medium (IMDM, Invitrogen). HEK-293 (ATCC. CRL-1573, Human epithelial embryonic kidney) and NIH 3T3 (ECACC. 93061524, Mouse embryonic fibroblast) were grown in Dulbecco's modified Eagle medium (DMEM, PAA). Hela (ATCC.CCL-2.2, Human cervix adenocarcinoma) was grown in minimum essential medium (MEM, Invitrogen). All cell lines were supplemented with 10% heat inactivated fetal bovine serum (FBS, GIBCO) and 100 U/mL penicillin-streptomycin (Cellgro).

(9) Statistics

(10) Statistical tests were performed using the student's t-test. Data are means±SD, n=3 independent treatments. P values less than 0.05 were considered as significant; whereas P>0.05 means data are not significantly different.

Example 1

Selection of Aptamers

(11) A human mammary gland adenocarcinoma cell line (MCF-7) was used as complex target during whole cell-SELEX selection. To deprive common cell-recognizing nucleic acid motifs a human lung carcinoma cell line, namely H460, was chosen. In this way the nucleic acids that recognize common cell structures may be eliminate, though limited to the extent possible. After incubating the DNA library with H460 cells, the supernatant was removed and added to MCF-7 cells. Subsequently, after washing the bound sequences were recovered and amplified.

(12) The library contained a central randomized sequence of 43 nucleotides flanked by two 18 and 19 nucleotides PCR primer hybridization sites (5′-GCTGTGTGACTCCTGCAA-43N-GCAGCTGTATCTTGTCTCC-3′ (SEQ ID NO: 1), 5′-phosphorylated reverse primer (5′-Phos-GGAGACAAGATACAGCTGC-3′(SEQ ID NO: 26), and forward primer 5′-GCTGTGTGACTCCTGCAA-3′ (SEQ ID NO: 27)) (Ella Biotech GmbH, Germany). All ATTO-labelled aptamer sequences were purchased from Microsynth (Switzerland). These ATTO-coupled sequences were used for determination of aptamers binding affinity, internalization assay and confocal imaging.

(13) MCF-7 was used as the target cell line and H460 as the control cell line. The single-stranded DNA (ssDNA) library (1 nmol) dissolved in 100 μl washing buffer (1 L DPBS (Dulbecco's Phosphate-Buffered Saline, Gibco) with 5 mM MgCl.sub.2), denatured by heating at 95° C. for 5 min, and cooled on ice for 10 min. The volume was filled up to 1000 μl with binding buffer (1 L DPBS, 1 g FBS, 5 mM MgCl.sub.2 and 500 mg salmon sperm DNA). Then the library was incubated with H460 cells on a 100 mm diameter cell culture dish for 45 min at 37° C. Subsequently the library was incubated with MCF-7 cells on a 60 mm diameter cell for 45 min at 37° C. After incubation, the cells were washed twice with 1.5 ml of washing buffer (1 L DPBS, 5 mM MgCl.sub.2) for 30 s. 500 μl of water was added and the cells were harvested using a cell scraper. The bound DNA sequences were eluted by heating at 95° C. for 4 min and the mixture was centrifuged at 12000 g to pellet the cell debris. The supernatant containing the ssDNA was recovered by phenol/chloroform extraction and ethanol precipitation and amplified by PCR (denaturing at 95° C. for 1 min, annealing at 64° C. for 1 min and extension at 72° C. for 90 s).

(14) For each round of SELEX, the number of PCR cycles was optimized between 10 and 20. The PCR products were purified using nucleospin extract II kit (Macherey-Nagel) following the manufacturer's protocol. The single stranded DNA was generated by λ-exonuclease digest of the phosphorylated antisense strand and used for the next selection cycle. ssDNA was recovered by mixing of purified dsDNAs with a specific volume of λ-exonuclease enzyme (Fermentas, e.g., 2 μg of dsDNA with 1 μl of λ-exonuclease), and the mixture was adjusted to yield 1× λ-exonuclease reaction buffer conditions using 10× concentrated buffer stock. This mixture was immediately incubated at 37° C. for 35 min, followed by additional 10 min incubation at 80° C. to stop the enzymatic reaction. After digestion, ssDNA was purified using nucleospin extract II kit following the manufacturer's protocol. All product of the first round was used for the second round using the same procedure as described for first selection. For the third round, after heating pool at 95° C. and snap cooled, the library was used to perform negative selection using H460 cells.

(15) The progress of the selection was monitored by radioactive assays, in which radioactively labelled ssDNA from different selection cycles was incubated with MCF-7 cells or H460 cells, respectively, and Cherenkov counting was applied to measure the amount of ssDNA retained on the cells after washing. In the counter selection, H460 cells were cultured in a 100 mm diameter cell culture. Similarly, cells were washed and incubated with pool. After incubation, the non-binding sequences in the incubation buffer were recovered and used for incubation with target cells using the same procedure as described for first selection. The entire selection process was repeated until significant enrichment was obtained for the MCF-7 cells (12 rounds) when analyzed by radioactive test. To acquire more specific and high affinity aptamers, the incubation time with target cells was decreased from 45 to 35 min as the number of selection rounds increased, the washing strength was increased by gradually increasing washing time (from 30 to 90 s), washing volume (from 1.5 to 3 ml) and washing cycles (from 2 to 3 times).

(16) After 12 rounds of selection, the selected ssDNA pool was PCR-amplified with unlabeled primers, then cloned into Escherichia coli using the TOPO TA cloning kit (Invitrogen). Individual colonies were picked to extract the plasmids for sequencing using NucleoSpin® Plasmid kit (Macherey-Nagel). Cloned sequences were determined by GATC Biotech Company (Germany). Sequence alignment was performed with the sequence alignment program ClustalX2.0.10. Sequences were grouped into families and representative sequences from different families were selected as candidate aptamers for monoclonal testing.

(17) As a result, sequence analysis provided the 12 candidate molecules having a nucleotide sequence as follows:

(18) TABLE-US-00002 A28: (SEQ ID NO: 14) 5′-GCTGTGTGACTCCTGCAACAGGCCGGAGGGACTGGGGAGGT GCGACGTTTACGTGTTCTCCGCAGCTGTATCTTGTCTCC-3′, A32: (SEQ ID NO: 15) 5′-GCTGTGTGACTCCTGCAACGTTGTTTGTTCGCTCCGGGCTG TAGAGCCTCGAAGATGAGTTGCAGCTGTATCTTGTCTCC-3′, A26: (SEQ ID NO: 16) 5′-GCTGTGTGACTCCTGCAACCGGACTGCAGAGACCGTCTGTC GGTGAACACTATTAGACGCGGCAGCTGTATCTTGTCTCC-3′, A33: (SEQ ID NO: 17) 5′-GCTGTGTGACTCCTGCAAGGCGGTACGCGTGTGGACAGAAG TGACCGCCAAATAGCGCCTGGCAGCTGTATCTTGTCTCC-3′, A42: (SEQ ID NO: 18) 5′-GCTGTGTGACTCCTGCAACCAGACCGTAGGGGCTGTCTGTA GAGGACGCTGACGCGCACGAGCAGCTGTATCTTGTCTCC-3′, A10: (SEQ ID NO: 19) 5′-GCTGTGTGACTCCTGCAACCTGTTCGGGCGCTAGCCTGATA GAAGTGTGCGTTCAATGGTGGCAGCTGTATCTTGTCTCC-3′, A13: (SEQ ID NO: 20) 5′-GCTGTGTGACTCCTGCAACAGGTTGGGCTGATGGTGGGCAG ACCGTAGGGTCCGTAATCCGGCAGCTGTATCTTGTCTCC-3′, A34: (SEQ ID NO: 21) 5′-GCTGTGTGACTCCTGCAAGGGGTACACGCGCATGCTCATCT GGACCGGAGGGTTCCGGGGAGCAGCTGTATCTTGTCTCC-3′, A41: (SEQ ID NO: 22) 5′-GCTGTGTGACTCCTGCAACAAAGGGTCGGCGGACTGTTGAG ACCACCGGCAGCGGGGCATTGCAGCTGTATCTTGTCTCC-3′, A1: (SEQ ID NO: 23) 5′-GCTGTGTGACTCCTGCAAGGGTACGGCATTGATTTGCTGCC TTATTGGTGTTGGTGGGGGGGCAGCTGTATCTTGTCTCC-3′, A5: (SEQ ID NO: 24) 5′-GCTGTGTGACTCCTGCAACATGCTTTATGTAACAGGCGGAG GCCGTCCGTGGTACAGGTTCGCAGCTGTATCTTGTCTCC-3′, A2: (SEQ ID NO: 25) 5′-GCTGTGTGACTCCTGCAAGGAGGGGATCACACCGTATAGAC TGCAGAGTTCTGTCGGTGTGGCAGCTGTATCTTGTCTCC-3′.

(19) The sequence A28 (SEQ ID NO: 14) was the most dominant sequence.

Example 2

Determination of Cell Binding Against MCF-7 and H460 Cells

(20) The binding of the aptamers obtained in Example 1 to the cell lines MCF-7, a human mammary gland adenocarcinoma cell line, and H460, a human non-small lung carcinoma cell line, was determined by radioactive interaction analysis.

(21) To monitor the monoclonal aptamers for cell binding 5′-.sup.32P-labeled ssDNA was prepared and incubated with the respective cells in 6-well plates for 40 min at 37° C. After removal of the supernatant, cells were washed three times with 1.5 ml washing buffer. Bound DNA was recovered by harvesting the cells and re-suspension in 1.5 ml washing buffer. In case of suspension cells supernatant and wash fractions were collected by centrifugation at 200 g for 4 min. The amount of radioactive labelled DNA in every fraction was determined by Cherenkov scintillation counting.

(22) The FIG. 1 illustrates the results of the screening of the selection rounds 1 (“1”) and 12 (“12”) and the aptamers obtained in Example 1 against MCF-7 in FIG. 1a) and H460 in FIG. 1b). As can be taken from the figures, the aptamers A28, A32, A26, A42, A42, A13, A33 and A34 show good binding to MCF-7 cells (FIG. 1a) and H460 cells (FIG. 1b), while the sequences A1, A2, and A5 show lower binding. A comparison of the FIGS. 1a) and 1b) shows that no sequence was found to exclusively recognize MCF-7 cells.

Example 3

Determination of Binding to Further Cancer Types

(23) The recognition of the selected aptamers was tested on the following cell lines human lung cancer cell line (A549), human cervical cancer cell line (Hela), human breast cancer cell line (SK-BR-3), transformed but non-tumour human embryonic Kidney cell line (HEK) and transformed but non-tumour mouse embryonic fibroblast cell line (3T3), as described in Example 2. As a control the starting pool (library) was used.

(24) The aptamers A26, A28 and A32 showed stronger signals on cervix carcinoma cell line (Hela), lung cancer cell line (A549), and breast cancer cell line (SK-BR-3) compared to the transformed but non-tumour human embryonic Kidney cell line (HEK) and embryonic fibroblast cell line (3T3). Also, the aptamers A41, A42 and A13 showed strongest signals on Hela cells, and better binding was obtained with lung cancer cell line (A549), and breast cancer cell line (SK-BR-3) compared to the transformed but non-tumour cells, while the control showed only very low binding, demonstrating that contrary to the library the aptamers recognize a broad spectrum of tumour cells.

Example 4

Determination of Binding to Cancer Cells and Healthy Cells

(25) For the aptamers A26, A28, A32 and A33, the determination of selectivity was further extended to other cell lines, including human burkitt's lymphoma cell line (Raji), human T cell lymphoblast cell line (Jurkat), human chronic B cell leukemia cell line (MEC1), human umbilical vein endothelial cell (HUVEC), and peripheral blood mononuclear cell line (PBMC) from healthy individuals. As described in Example 2, the aptamers and the starting pool (library) were 5′-.sup.32P-labeled and incubated with different cell lines. The amount of ssDNA bound to the cells was measured using radioactive analysis.

(26) FIG. 2 illustrates the results of the selectivity study to assess the recognition of the aptamers to different cell lines for the aptamers A33 (SEQ ID NO: 17), A26 (SEQ ID NO: 16), A28 (SEQ ID NO: 14) and A32 (SEQ ID NO: 15). As can be taken from the FIG. 3, the sequences A26, A28 and A32 showed stronger signals with cancer cells compared to those observed with non-cancer cells. The aptamers A26, A28 and A32 showed no significant interaction with these primary cells or cell lines (FIG. 4). This implies that the aptamers A26, A28 and A32 own a good specificity towards solid-tumour derived cancer cells.

Example 5

Determination of Apparent Affinities

(27) Flow cytometry was used to determine the apparent affinities (k.sub.app) of the aptamers for MCF-7 cells. Therefore, 5′-ATTO647N labelled variants of the aptamers were synthesized and their cell-binding behaviour was investigated by flow cytometry. Employing increasing concentrations of individual aptamers while keeping the amount of cells constant apparent affinities can be determined, thus providing means to rank the aptamers in respect of their concentration-dependent cell-recognition properties.

(28) The binding affinity of aptamers was determined by incubating increasing concentrations of ATTO647N-labelled aptamers (0 to 900 nM) with MCF-7 cells in 12 well plates at 37° C. for 40 min. The cells were washed twice with 700 μl of washing buffer. The cells were scraped and suspended in 400 μl of washing buffer. The fluorescence intensity was determined by using a FACScan cytometer (FACS Canto II, BD) by counting 10000 events. The mean fluorescence intensity of cells labelled by aptamers was used to calculate the specific binding by subtracting the mean fluorescence intensity obtained for the non-specific binding control sequence (5′-GCTGTGTGACTCCTGCAAGAC-GGACCAGAGGGCGGAGAGCTTTGGCAGCTCTCGGCATCAAGCAGCTGTATCTTGTCTCC-3′ (SEQ ID NO: 29)). The equilibrium apparent binding constants (K.sub.app) of the aptamer-cell interaction were obtained by fitting the dependence of fluorescence intensity of specific binding on the concentration of the aptamers to the equation Y=B max X/(K.sub.d+X), using PrismGraphPad.

(29) All aptamers revealed apparent affinities in the nanomolar range.

Example 6

Determination of Binding and Localisation of the Aptamers

(30) The binding of the aptamers A26 (SEQ ID NO: 16) and A33 (SEQ ID NO: 17) to MCF-7 cells and the localisation of the aptamers was assessed by confocal microscopy. MCF-7 cells were seeded on glass coverslips in 6 well plates, and cultured overnight. The cells were carefully washed and then incubated with ATTO647N-labeled aptamers A26 and A33 and control sequence (A33sc) 5′-GCTGTGTGACTCCTGCAAGACGGACCAGAGGGCGGAGAGCTTTGGCAGCTCTCGGCATCA AGCAGCTGTATCTTGTCTCC-3′ (SEQ ID NO: 29) at a final concentration of 100 nM for 2 h. After incubation, cells were carefully washed, fixed and stained with DAPI and Wheat germ agglutinin (WGA-488). DAPI staining was employed to visualize the nucleus. WGA-488 was used to stain the plasma membrane. The signal was detected by confocal microscopy (FV500-IX81 confocal microscope, Olympus America Inc., Melville, N.Y.), with 406oil immersion objective (NA=1.40, Olympus, Melville, N.Y.). Excitation wavelength and emission filters were as follows: PE, 488 nm laser line excitation, emission BP520; and Alexa Fluor 633 nm laser line excitation, emission LP650 filter.

(31) The microscopy images reveal that the aptamers A26 and A33 were localized inside the tumour cells after 2 h incubation. These data qualify the aptamers A33 and A26 as molecular vehicle for cargo delivery into tumour cells.

Example 7

Determination of Cargo Delivery into MCF-7 Tumour Cells

(32) For the targeted delivery into and treatment of MCF-7 cells, a ternary complex of A26-streptavidin and siRNA molecules was assembled. siRNA molecules either targeting Paip1 or UBR 5 mRNA were chosen. Paip1 regulates the activity of Poly (A) binding protein (PABP). PABP has an important role on both mRNA stability and translation in eukaryotic cells. Paip1 acts as a translational activator whereas Paip2 is a translational inhibitor in cultured mammalian cells. Paip2 competes with Paip1 for binding to PABP, inhibits binding of PABP to the mRNA poly (A) tail and, thus, prohibits translation in vitro and in vivo. Ubiquitin protein ligase E3 component n-recognin 5 (UBR5), also known as EDD1, plays an important role in ubiquitin conjugation. UBR5 targets Paip2, which is not bound to PABP, to the proteasome for degradation. Another role of UBR5 is the regulation of DNA damage responses. It has been demonstrated that UBR5 is highly expressed in several solid tumours, such as ovarian and breast cancer.

(33) As a negative control against MCF-7, a human mammary gland adenocarcinoma cell line, the human burkitt's lymphoma cell line (Raji) was used.

(34) A26-streptavidin-siRNA (siRNA against UBR5 or siRNA against Paip1) complexes, referred in the following to as UBR5 complex and Paip complex, respectively, were assembled and the influence of these complexes on tumour cell viability, induced apoptosis and level of the corresponding mRNA molecules of UBR5 and Paip1 was determined as follows.

(35) 7.1 siRNA Preparation

(36) siRNA sequences were designed according to software by Thermo Scientific (http://dharmacon.com/predesignedsiRna/search.aspx) and Invitrogen (https://rnaidesigner.invitrogen.com/rnaiexpress/). For Paip1 siRNA, the biotinylated (B) sense sequence with a disulfide linker (-s-s-) was 5′-B-s-s-GAAGAUGCUUGGAAGGAAAUU-3′ (SEQ ID NO: 30) and the antisense sequence was 3′-UUCUUCUACGAACCUUCCUUU-5′ (SEQ ID NO: 31). For UBR5 siRNA the biotinylated sense sequence with a disulfide linker was 5′-B-s-s-GCAAAUAGCAUAAGAGCAAUU-3′ (SEQ ID NO: 32) and the antisense sequence was 3′-UUCGUUUAUCGUAUUCUCGUU-5′ (SEQ ID NO: 33). The negative control siRNA biotinylated sense sequence with a disulfide linker was 5′-B-s-s-UUCUCCGAACGUGUCACGU-3′ (SEQ ID NO: 34) and the antisense sequence was 3′-ACGUGACACGUUCGGAGAA-5′ (SEQ ID NO: 35). The sequences were purchased from Microsynth (Switzerland). The selected sequences were submitted to Blast (http://www.ncbi.nil.nih.gov/blast/) to make sure that the selected genes are targeted specifically.

(37) 7.2 Annealing of siRNA

(38) To anneal the siRNA, 50 nM of each sense and antisense strands of siRNA were combined with annealing buffer (100 mM KOAc, 30 mM HEPES-KOH (pH 7.4) and 2 mM MgOAc). The solution was incubated for 2 min in a water bath at 95° C. and allowed to cool to room temperature within 50 min and was stored on ice until use.

(39) 7.3 Preparation of Nanocomplex System

(40) siRNA-A26 complexes were prepared by mixing 200 pmol double-stranded siRNA and 200 pmol biotin-A26 (Microsynth, Switzerland) conjugate with 100 pmol of streptavidin (Sigma) for 1 h. The complex was stored on ice until use.

(41) 7.4 Evaluation of Nanocomplex Formation

(42) The formation of A26-Streptavidin-siRNA complex was assessed by 2% agarose gel electrophoresis. UBR5 siRNA, A26 aptamer and A26-Streptavidin-siRNA complex treated with dithiothreitol (DTT; Invitrogen) were loaded onto the gel. Gel electrophoresis was run at 100 V for 30 min using Tris-borate-EDTA buffer (TBE). The gel was stained using ethidium bromide and observed under a UV illuminator.

(43) 7.5 Aptamer-Mediated siRNA Transfection

(44) MCF-7 cells and Raji cells were plated in 12-well plates. The following day the medium was exchanged and the cells were divided into four groups: 1) blank group, 2) control complex group wherein the concentration of siRNA was 10 nM, 30 nM, 60 nM or 200 nM, respectively, 3) UBR complex group wherein the concentration of siRNA was 10 nM, 30 nM, 60 nM or 200 nM, respectively, and 4) Paip complex group wherein the concentration of siRNA was 10 nM, 30 nM, 60 nM or 200 nM, respectively. The cells were incubated for 4 h with A26-Streptavidin-siRNA complexes, then the culture medium was removed and complete culture medium (Medium+10% FBS) was added. Cells were harvested 72 h after complex addition and gene expression inhibition was monitored by real-time PCR.

(45) As a control complex (control compl.) A33sc-Streptavidin-siRNA having the sequence 5′-GCTGTGTGACTCCTGCAAGACGGACCAGAGGGCGGAGAGCTTTGGCAGCTCTCGGCATCA AGCAGCTGTATCTTGTCTCC-3′ (SEQ ID NO: 29) was used, wherein the nucleotides of the N.sub.43 part correspond to the nucleotides of SEQ ID NO: 8, but are arranged in a scrambled order.

(46) FIG. 3 illustrates the effect of A26-Streptavidin-siRNA complexes on MCF-7 and Raji cells gene expression, wherein the mRNA expression of Paip complex is shown in FIG. 3a), control Paip complex in FIG. 3b), UBR complex in FIG. 3c) and control UBR complex in FIG. 3d). As can be taken from the FIGS. 3a) and 3c), the level of the corresponding mRNA molecules of Paip (FIG. 3a) and UBR5 (FIG. 3c) was concentration dependently down regulated upon incubation of MCF-7 cells with the respective complexes. Further, the escalating concentrations of 10 nM, 30 nM, 60 nM and 200 nM, respectively, of UBR complex and Paip complex showed that for both complexes cytotoxicity reaches a plateau by adding 60 nM and higher concentration of the complexes to MCF-7 cells. As can be taken from the FIGS. 3b) and 3d), replacing the aptamer A26 with a control non-binding ssDNA molecule (A33sc) had no effect on the mRNA levels. Likewise the levels of UBR5 and Paip mRNA were unaffected in Raji cells, which are not recognised by A26, as can be seen in the FIGS. 3a) to 3d).

(47) 7.6 MTT Assay

(48) To monitor cell viability of MCF-7 and Raji cells upon treatment with the complexes or control complexes MTT assays were performed.

(49) MCF-7 cells and Raji cells for control (1.5×10.sup.4) were seeded in 96-well plates. The following day old culture medium was replaced with fresh serum-free culture medium and cells were divided into five groups: 1) blank groups, 2) control complex group wherein the concentration of siRNA was 60 nM, 3) UBR complex group wherein the concentration of siRNA was 60 nM, 4) Paip complex group wherein the concentration of siRNA was 60 nM, 5) UBR complex and Paip complex group wherein the concentration of siRNA was 30 nM for each complex. 4 h after A26-Streptavidin-siRNA complex incubation with cells, culture medium was removed and complete culture medium was added to each well. Cells were incubated for 72 h. Then 20 μl MTT solution was added to each well and mixed. After 4 h of incubation, 200 μl DMSO was added to each well and absorbance was measured with a microplate reader (Biotrek, USA) at 545 nm. Each experimental condition was done in triplicate.

(50) The FIG. 4a) illustrates the effect of naked siRNAs and A26-Streptavidin-siRNA complexes on control and target cells viability as assessed by MTT assay. As shown in FIG. 4a), the viability of MCF-7 and Raji cells upon treatment with UBR5 siRNA, Paip1 siRNA, or control complexes remains unchanged. In contrast, viability of cells incubated with UBR5 complex, Paip complex, or both complexes were significantly reduced. The viability of the control cell line (Raji) remained unchanged independently of the treatment procedure. Hence, treatment with UBR5 complex, Paip complex, or both complexes induced a significant reduction in cell proliferation in solid tumour cells, but not in control cells.

(51) 7.7 Determination of Cell Apoptosis

(52) To determine whether the reduction in cell viability of MCF-7 cells caused by the UBR5 complex and the Paip complex was due to an increase in apoptosis, the number of apoptotic MCF-7 and Raji cells after treatment was evaluated by flow cytometry.

(53) Annexin V-FITC apoptosis detection kit (Abcam) was used to study apoptosis. MCF-7 cells and Raji cells were plated in 12-well plates and were divided into the same five groups as in the MTT assay. The A26-Streptavidin-siRNA complexes treatments were as before. After 48 h, cells were collected and washed with PBS. Cells (˜5×10.sup.5) were resuspended in 500 μl of binding buffer. 5 μl of annexin V-FITC and 5 μl of propidium iodide were added to each sample and incubated at room temperature for 5 min in dark. Apoptosis was determined by flow cytometry. Each group was assayed three times.

(54) The effect of naked siRNAs and A26-Streptavidin-siRNA complexes on apoptosis of MCF-7 cells and Raji cells is shown in FIG. 4b). As shown in FIG. 4b), the amount of apoptotic MCF-7 cells (including early apoptotic cells and the late apoptotic cells) 48 h after treatment with UBR5 siRNA, Paip1 siRNA, or control complex was almost unchanged. However, incubation of cells with the UBR5 complex, Paip complex and both complexes clearly resulted in an induction of apoptosis. Again the amount of apoptotic Raji cells remained unaffected.

(55) In summary, the results of the cargo delivery study demonstrate that the aptamer A26 is a suitable molecular vehicle for the targeted delivery of siRNA molecules into specific target cells.

Example 8

Determination of Cargo Delivery into Solid Tumour Cells

(56) The targeted delivery of siRNA into tumour cells by a ternary complex of A26-streptavidin and siRNA molecules was repeated for other solid tumour cells, namely human non-small lung carcinoma cells (H460), a breast cancer cell line (SK-BR-3), and Hela (Human cervix adenocarcinoma) cells. The cells were treated with the complexes of A26-Streptavidin-siRNA complexes of UBR5 and Paip1, and UBR5 mRNA and Paip1 mRNA expression were detected by quantitative RT-PCR analysis, as described in Example 7.1 to 7.5. The H460, SK-BR-3, and Hela cells were treated with the complexes for 4 h, wherein 60 nM siRNA was used, respectively. After 4 h incubation of A26-Streptavidin-siRNA complexes with cells, the culture medium was removed and completed culture medium was added to each well. Cells were harvested 72 h after adding of the complexes and monitored for gene expression inhibition by real-time PCR.

(57) FIG. 5 illustrates the effect of A26-Streptavidin-siRNA complexes on H460, SK-BR-3, and HeLa cell gene expression. As can be taken from the FIG. 5, the level of the corresponding mRNA molecules of Paip1 and UBR5 was down-regulated upon incubation of cells with the respective complexes.

(58) The results demonstrate the aptamer A26 to be a suitable broad-spectrum aptamer vehicle for targeted delivery of siRNA molecules into solid tumour cells of different origin.